Journal Pre-proofs

Research paper

Elevated expression of IL-18 but not IL-1β gene is associated with NALP3 and
AIM2 inflammasome in Polycystic Ovary Syndrome

Maryam Rostamtabar, Sedighe Esmaeilzadeh, Ahmad Karkhah, Mania Amiri,

Abolfazl Rahmani, Fatemeh Bakouei, Hamid Reza Nouri

PII: S0378-1119(20)30021-4
DOI: https://doi.org/10.1016/j.gene.2020.144352
Reference: GENE 144352

To appear in: Gene Gene

Received Date: 24 August 2019

Revised Date: 7 January 2020
Accepted Date: 8 January 2020

Please cite this article as: M. Rostamtabar, S. Esmaeilzadeh, A. Karkhah, M. Amiri, A. Rahmani, F. Bakouei, H.
Reza Nouri, Elevated expression of IL-18 but not IL-1β gene is associated with NALP3 and AIM2 inflammasome
in Polycystic Ovary Syndrome, Gene Gene (2020), doi: https://doi.org/10.1016/j.gene.2020.144352

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover
page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will
undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing
this version to give early visibility of the article. Please note that, during the production process, errors may be
discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2020 Published by Elsevier B.V.

Article type: Original Article

Elevated expression of IL-18 but not IL-1β gene is associated with NALP3 and
AIM2 inflammasome in Polycystic Ovary Syndrome

Authors: Maryam Rostamtabar1†, Sedigheh Esmaeilzadeh2†, Ahmad Karkhah3, Mania Amiri2,

Abolfazl Rahmani1,Fatemeh Bakouei2 and Hamid Reza Nouri2, 3,4*

Affiliation
1. Student Research Committee, Babol University of Medical Sciences, Babol, Iran.
2. Infertility and Reproductive Health Research Center, Health Research Institute, Babol University of Medical
Science, Babol, Iran.
3. Cellular and Molecular Biology Research Center, Health Research Institute, Babol University of Medical
Sciences, Babol, Iran.
4. Immunoregulation Research Center, Health Research Institute, Babol University of Medical Sciences, Babol,
Iran.

† Authors contributed equally.

Running title: AIM2 and NALP3 linked to IL-18 in PCOS.

Corresponding author:
Dr. Hamid Reza Nouri, Cellular and Molecular Biology Research Center, Health Research
Institute, Babol University of Medical Sciences, Babol, Iran (Tel: +98 11 32222033, Fax: +98
11 32229936)
E-mail: nourihr851@gmail.com
ORCID ID : 0000-0001-6521-0875

1
Abstract

Inflammasome complex mediated interleukin 1β (IL-1β) and interleukin 18 (IL-18)

production may be involved in immunopathogenesis of polycystic ovary syndrome (PCOS).

Therefore, this study was conducted to investigate involvd inflammasome pathways in PCOS.

Therefore, inflammasome genes expression and serum level of IL-1β were evaluated in 30

patients with confirmed PCOS and 30 women without PCOS. A remarkable increase in

expression of the nucleotide binding and oligomerization domain (NOD)-like receptor (NLR)

family pyrin domain-containing 3 (NALP3), absent in melanoma 2 (AIM2), IL-18 and associated

speck-like protein containing a caspase recruitment domain (CARD); (ASC) genes in PCOS

were observed (p <0.05). In contrast, expression level of NALP1, NALP12, NLR family

apoptosis inhibitory proteins (NAIP), NLR family caspase recruitment domain (CARD) domain

containing 4 (NLRC4) and IL-1β genes was not significant. Although the IL-1β protein level in

serum of COS patients with BMI ≥ 25 was significantly higher than PCOS patient with BMI <

25, but there was no significant difference in non-PCOS individuals with BMI < 25 or ≥ 25.

Furthermore, significant correlation between expression of AIM2 (r= 0.83, p=0.032) and NALP3

(r= 0.59, p=0.0001) was observed with IL-18, while a positive correlation (r= 0.84, p=0.0001)

was revealed between NAIP and IL-1β. Based on the obtained results on inflammasome

components along with increased expression of IL-1β especially in overweight patients, it can be

concluded that IL-18 expression as well as IL-1β is probably due to activation of AIM2, NALP3

or NAIP inflammasome, which may play a critical role in immunopathology of PCOS.

Key words: IL-1β; IL-18; Inflammasome; Polycystic Ovary Syndrome.

2
1. Introduction

Polycystic Ovary Syndrome (PCOS) is a common endocrinology disorder in women of

reproductive age. PCOS is a heterogeneous disorder characterized by ovulation disorders

(anovulation oroligo-ovulation) with unknown etiology. It was first described by stein and

levental in 1935 (Alsadi 2014; Bednarska and Siejka 2017). The prevalence of polycystic ovary

syndrome may be also diverse according to the nation, age, studied society and also based on the

diagnostic criteria (Wolf et al. 2018). The worldwide prevalence of PCOS is 5–10%. It is

estimated that 15.2% of Iranian women at the reproductive age are suffered to PCOS (Norman et

al. 2007).

PCOS is considered by an over activity of male sexual hormones and ovulatory

dysfunction. Some of the reasons for this may be the change in the hypothalamus-pituitary-

ovarian axis, ovarian dysfunction, and insulin signaling pathway disorder. PCOS is associated

with obesity, metabolic syndrome, hyper-androgenaemia, insulin resistance, reproductive

abnormalities and cardiovascular disease (Esmaeilzadeh et al. 2014a; Ghadimi et al. 2014;

Gholinezhad et al. 2018; Kanafchian et al. 2019).

PCOS etiology remains controversially discussed but inflammatory factors seem to play

an important role. As regards inflammatory process by ovary tissue remodeling in normal

follicogenesis, increase or aberrant of inflammation can be altering the normal ovarian follicular

dynamics. In recent years, several studies have demonstrated the significant increasing role of

inflammatory markers and mediators in PCOS (Boots and Jungheim 2015). In 2011, a meta-

analysis study on women with PCOS showed that the level of CRP in the serum of women with

PCOS significantly increased (Escobar-Morreale et al. 2011). Another study demonstrated that

increased levels of CRP could result in anovulation (Lorenz et al. 2015). Increasing evidence

suggest that with weight gain, especially increased abdominal adipose, the chance of developing

3
polycystic ovary syndrome increases (Sam 2007). Recent studies have shown in overweight or

obese women, visceral adipocytes by releasing the adiponectin, TNF-α, and IL-6 play a key role

in the immunopathology of PCOS. In many patients with PCOS, inflammatory cytokines such as

TNF-α results in insulin resistance by alteration the insulin pathway signaling (González 2012).

Based on the evidence, hypertrophy, hypoxia and oxidative stress in adipose tissue by

recruitment of the immune cells and detection of the pathogenes or danger-associated molecular

patterns (PAMPs or DAMPs) by pattern-recognition receptors (PRRs) of immune cells, causing

an increase in the pro-inflammatory gene expression profile and triggers the signal of the

Inflammasome pathway (Villa and Pratley 2011; Esser et al. 2013).

Since women with the polycystic ovarian syndrome appear to increase in oxidative stress

and free fatty acid (FFA), it can be considered as an activator of inflammatory pathways,

especially the NALP3-Inflammasome pathway (Boots and Jungheim 2015). The Inflammasome

is a multi-protein complex in cytoplasm of the cell and assembled in response to diverse stimuli

as a danger signals such as uric acid crystals, reactive oxygen species (ROS), ATP, free fatty

acid (FFA), high mobility group box1 (HMGB1), heat-shock proteins and pathogens. The

activation of Inflammasome results in maturation of inflammatory cytokines such as IL-1β and

IL-18 (Bianchi 2007; Yang et al. 2019). Several inflammasome platforms known such as

nucleotide binding and oligomerization domain-like receptor family pyrin domain-containing 1

(NALP1), NALP3, AIM2, and NLRC4 inflammasome. The inflammasome platforms consist of

sensor molecule NOD-like receptor (NLR) family, the adaptor protein of ASC and pro-caspase1

as an effector protein component. Regarding the significant role of the IL-1β and IL-18 cytokines

in the process of oocyte maturation and its role in the development of the disease, as well as the

role of the inflammasome complex in the process of secreting the active form of IL-1β and IL-

4
18, this study was conducted to determine which inflammasome is involved in the upstream

pathway underlying IL-1β and IL-18 production in PCOS subjects.

2. Materials and methods

2.1. Subjects and sample collection

This case-control study consisted of 60 women aged 20 to 40. A sample size with α

=0.05, β = 0.2, and power =80% was selected based on previous studies (Yang et al. 2011b;

Daan et al. 2016; Long et al. 2017). Thirty women diagnosed with PCOS considered as the case

group, and 30 age-matched women without PCOS served as the control group. The PCOS

diagnosis criteria is mostly based on the Rotterdam consensus in 2003. The Rotterdam criteria

including menstrual cycle anomalies, clinical and/or biochemical hyperandrogenism and

ultrasound appearance of polycystic ovaries. The presence of two of these three criteria is

sufficient for diagnoses. These women were introduced by Fatemeh Zahra Infertility and

Reproductive Health Research Center of Babol University of Medical Sciences, Babol, Iran.

Those who had used drugs especially nonsteroidal anti-inflammatory drugs (NSAIDs), oral

contraceptives, insulin sensitizers at last month were excluded of the study. Also, subjects with

congenital adrenal hyperplasia, androgen-secreting tumors, hyperprolactinemia, thyroid

dysfunction, and diabetes mellitus were excluded. The non-PCOS women in the control group

had regular menstrual cycles and had been defined by history and physical examinations.

Patients were informed that their participation was voluntary, confidential, and anonymous. This

study was approved by the ethical committee of Babol University of Medical Science.

2.2. PBMCs isolation, RNA extraction and cDNA synthesis

The venous blood sample was collected from all participants and peripheral blood

mononuclear cells (PBMCs) were isolated by Lymphosep (Lymphocyte separator) according to

5
the manufacturer's instructions (Biosera, France). Briefly, 5 ml of Lymphosep was covered by

the equal volume of the blood sample and then centrifuged for 30 minutes at 100 × g in 4

°C. Immediately PBMCs was separated and washed two times with 150 mM phosphate buffered

saline (PBS), pH 7.4. Freshly isolated PBMCs were used for RNA extraction with RNA Isolation

mini Kit (Yekta tajhiz Azma, Iran) according to the manufacturer's instructions. The quality and

concentration of total RNA was determined by NanoDrop Spectrophotometer (Thermo Fisher

Scientific, USA). Then total RNA was reverse transcribed using the Easy™ cDNA Reverse

Transcription kit with oligo (dT)16 and random hexamers as amplifcation primers (Yekta

tajhiz Azma, Iran).

2.3. Primer design and quantitative PCR (qPCR) assay

Specific oligonucleotide primers for the detection of genes involved in the inflammasome

pathway, including NLRP1, NLRP3, NLRP12, NLRC4, NAIP, AIM2, ASC, caspase-1, IL-1β

and IL-18 were designed by Beacon Designer (PREMIER Biosoft, Palo Alto, CA, USA). Primer

sequences are listed in Table I. For assessment of relative mRNA expression real-time PCR was

used. The cDNAs were amplified by PCR in duplicate by SYBR Green qPCR Master Mix 2X

(ParsTous Biotechnology, Mashhad, Iran) on an ABI 7300 real-time thermocycler (ABI, USA).

Briefly, real-time PCR was completed using 10 μl of SYBR Master Mix, 0.4 μl of each primer

(10 pmol/μl), 0.4 μl of ROX, 2 μl of cDNA and 6.8 μl of DEPC water. The cycling conditions

were as follows: 95 ˚C for 5 min (Initial denaturation step), 40 cycles at 95 ˚C for 20 sec, 58-64

˚C for 30 sec (annealing temperature) and 72 ˚C for 30 Sec; and then for final extension step 72

˚C for 5 min. At the end of the amplification reactions, melting curves were determined by

heating the samples from 55 to 95 ˚C at a linear rate of 0.2 ˚C /s. Melting curve and negative

controls were included in each assay to ensure that the PCR products were not the result of

6
reaction contamination. The relative expression ratios of the target genes were analyzed via

Pfaffl method. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the reference

gene to normalize samples. Finally, expression levels of genes in the case group were compared

with the control group.

2.4. IL-1β levels in serum

Inteleukin-1β (IL-1β) levels in sera of all participants was measured by ELISA method.

IL-1β level in case and groups was evaluated by human IL-1β ELISA development kit (HRP)

(Mabtech AB, USA) according to the manufacturer’s protocol. Briefly, the wells of the ELISA

microplate (Nunc MaxiSorpTM, FisherScientific, Pittsburg, PA) were covered by 100 μl/well

of mAb MT175 (anti-IL-1β) diluted to 2μg/ml in PBS, pH 7.4 and, incubated overnight at 4 °C.

After blocking with 2% BSA in PBS for 1 h, wells were washed with PBS, pH 7.4 containing

0.05% tween 20. Then, 100 μl of sera or standards diluted in incubation buffer (PBS, 0.05%

tween 20 containing 0.1% BSA) was added and incubated for 2 hours at room temperature.

Wells were washed five times with PBS (0.05% tween 20). After that, 100 μl of anti-IL-1β

biotinylated monoclonal antibody (1 µg/ml) was added to wells and incubated for 1 hour at

room temperature. Subsequently, wells were washed with PBS (0.05% tween 20) fand 100 μl of

of horseradish peroxidase (HRP)-conjugated streptavidin diluted 1:1000 in incubation buffer was

added to each well and incubated for 1 h. Finally, substrate solution (tetramethyl benzidine

(TMB)/H2O2) was added to each well in the darkness and reaction was stopped by 3 M HCl

after 15 min. Then optical density was measured by using an ELISA reader in 450 nm.

2.5. Statistical analysis

Data analyses were performed with GraphPad Prism v 6.07 (GraphPad Software Inc., La

Jolla, CA, USA). Data were tested for normality using the Kolmogorov–Smirnov test. Results

7
were expressed as the mean ± SEM. Comparisons between two groups were performed via t-

student and, the one-way ANOVA was used to determine whether there were any statistically

significant differences between the means of genes or IL-1β levels between different groups. p < 0.05

was considered statistically significant.

3. Results

3.1. Demographic characteristics of subjects

The all results obtained in the clinical and biochemical experiments conducted on the

PCOS and non-PCOS subjects are listed in table 2. The two groups were similar in term of age.

The mean of LH levels were significantly higher in women with PCOS than those in non-PCOS

women, but FSH and TSH concentrations were not different in the two groups. In addition, most

women in PCOS group had ratio LH/FSH > 1.

3.2. Elevated expression of IL-18 but not IL-1β in PCOS patients

The expression level of IL-1β and IL-18 genes were investigated as two major cytokines

produced by activation of inflammasome complex. Analysis of data showed that there was no

significant difference on IL-1β expression in PCOS and Non-PCOS subjects along with subjects

with BMI <25 or ≥ 25 (Fig. 1A). In contrast, IL-18 expression ration in PCOS and BMI ≥ 25

subjects was higher than Non-PCOS and BMI <25 subjects, respectively. Futheremore, IL-18 in

PCOS subjects with BMI <25 or ≥ 25 was higher tha Non-pcos subjects with BMI <25 or ≥ 25

(Fig. 1B).

3.3. Increased expression of AIM2 and NLRP3 inflammasome along with caspase-1 and

ASC in PCOS patients

In this study, the expression level of genes involved in the inflammasome pathway,

including NALP1, NALP3, NALP12, NLRC4, NAIP, AIM2, ASC and caspase-1 were

8
determined using Real- time PCR and showed in Fig. 2. Analysis of ASC and caspase-1 gene

expression as common proteins in all pathways of inflammasome complex showed that these

proteins were statistically increased (p <0.05) in the PCOS group compared to the control group.

Interestingly, the expression of AIM2 inflammasome had a remarkable increase in the PCOS

patients compared to the control group (p <0.05). Moreover, a significant increase was observed

in the expression level of NALP3 gene in the PCOS patients compared with the control group

which was statistically significant (p <0.05). While, the expression level of NALP1, NALP12,

NLRC4, and NAIP was not statistically significant. Fig. 3 as a heatmap scheme is summarized

the expression level of genes involved in inflammasome pathway.

3.4. Increased IL-1β serum level in overweight PCOS patients

Evaluation of serum cytokine IL-1β level in both case and control groups showed that

there was no significant difference (Fig. 4A). As shown in Fig. 4B, the level of this cytokine in

individuals with BMI ≥ 25 and BMI < 25 showed no significant difference (p> 0.05). Moreover,

an intra-group analysis showed that overweight PCOS patient had higher levels (p <0.05) of IL-

1β compared to PCOS patients with normal weight (Fig. 4C). In contrast, there was no

significant difference in IL-1β levels in normal and overweight individuals in the control group.

Interestingly, IL-1β levels in PCOS patients with normal weight was significantly lower than

control group with normal weight.

3.5. High positive correlation between the and AIM2 and NALP3 expression with IL-18

along with NAIP with IL-1β

The correlation between the genes associated with the inflammasome complex with IL-

1β and IL-18 genes, as well as the IL-1β protein level, was performed by using the Pearson

correlation test. The correlation results are listed in table 3. There was a significant positive

9
correlation between the expression of NALP3 and AIM2 with IL-18 expression. (r = 0.59, p

<0.0001) and (r = 0.83, p <0.032). Correlation of inflammasome components with IL-1β

expression level also showed that only NAIP expression level was positively correlated (r = 0.84,

p <0.0001). In addition, the correlation analysis between inflammasome genes with the protein

expression level of IL-1β showed any significant relationship between them.

4. Discussion

According to the recent studies, PCOS is known as a low-grade chronic inflammatory

disease associated with multi-factorial disorder such as heredity, nutritional pattern, type 2

diabetes, obesity, and oxidative stress (Esmaeilzadeh et al. 2014b; Esmaeilzadeh et al. 2017).

The inflammatory factors established in the pathogenesis of PCOS are CRP and TNF-α.

Recently revealed that cytokines such as IL-1β and IL-18 play an important role in regulating

ovarian steroidogenesis, maturation of ovarian follicles, and other fertility processes (Mendoza et

al. 1999; Vujisić et al. 2006). Moreover, several lines of evidence demonstrated that ovulation is

a semi-inflammatory process, and many pro-inflammatory cytokines are involved in this process.

IL-18 cytokine plays a significant role in the different stages of ovulation, especially during

oocyte maturation. During maturation process, the expression of IL-18 and its receptor (IL-18R)

increases. In the physiological conditions in the follicular stage, the cells express IL-18 and IL-

18R, which results in more follicular growth. Expression of IL-1β in physiological conditions

can increase the ovulation process and play a role as a paracrine factor in the process of

ovulation and oocyte maturation (Salmassi et al. 2017).

In recent years, studies showed that the inflammatory cytokines such as IL-6 and TNF-α

in PCOS was not increased (Mohlig et al. 2004). Also, in a study by Magdalena Olszanecka-

Glinianowicz to investigate chronic inflammation in patients with polycystic ovary syndrome,

10
increased level of TNF-α in PCOS patients was not observed (Olszanecka-Glinianowicz et al.

2007). Therefore, studies focused on other inflammatory cytokines such as IL-18 and IL-1β.

A study showed that activity of caspase-1 intrinsically was increased in visceral adipose

tissue (VAT) (Koenen et al. 2011). Recent studies indicated that followed by development of

VAT, plasma level of inflammatory cytokine such as IL-1β, IL-18, and TNF-α increases. Also,

our obtained results showed increased expression of caspase-1 and confirmed the higher levels of

IL-1β in overweight PCOS patients. Most investigations demonstrated the association of chronic

inflammation with PCOS, but there is also little evidence on this mechanism.

Studies have also shown that the gene expression of NALP3, IL-1β, and caspase-1 has increased

in patients with metabolic syndrome, and one of the reasons for this can be the increase in

macrophage adipose tissue (Esser et al. 2013). In our study, we determined that the expression

level of NLRP3, AIM2, ASC and IL-18 genes in PCOS patients compared to control group

remarkably increased, while expression of NLRP1, NAIP, NLRP12 and NLRC4 genes in the

patients was not significantly different in comparison to the control group. In addition, the results

showed, BMI commonly cannot be considered as an effective factor in determining the level of

IL-1β. However, in patients with higher BMI compared to those with lower BMI, it was shown

that they had a higher level of IL-1β in serum. Furthermore, IL-1β gene expression was found to

be more than in PCOS subjects compared to control group, but there was no statistically

significant difference. One of the possible reasons for decreasing the level of IL-1β in patients

may be increased expression of the interleukin-1 receptor antagonist secreted from adipocytes

due to an increase in abdominal adipose tissue (Juge-Aubry et al. 2004). More studies showed

IL-1β is involved in the development of obesity-associated insulin resistance. IL-1β also, in

obesity is involved in macrophage-adipocyte crosstalk. Studies showed that IL-1β via inhibition

of insulin signal transduction damages insulin sensitivity in adipose tissue. In addition, studies

11
showed that blocking the activity of IL-1β or its production improves insulin signaling. IL-1β

suppresses adipose differentiation along with lipoprotein lipase expression. In addition, IL-1β

through inhibiting the expression of fatty acid translocase and fatty acid transport protein

stimulates lipolysis and inhibits lipogenesis. These studies suggest that IL-1β may be

protectively involved in the onset and progression of weight gain. (Cornelius et al. 1988; Memon

et al. 1998; Um et al. 2004; Gao et al. 2014; Bing 2015). Since, most of PCOS paitents

are insulin resistant; this linke between IL-1β and PCOS may be appearing.

Recent studies demonstrated that IL-18 gene expression significantly increased in PCOS

patients. IL-18 may be a causative factor associating inflammation and insulin resistance in

PCOS development (Zhang et al. 2006; Yang et al. 2011a). Similar to the results of our study,

another study by Escobar and et. al demonstared that PCOS and obesity induced IL-18

production, which was associated with adiposity and insulin resistance(Escobar-Morreale et al.

2004) . Additionally, IL-18 appears to be a promising prognostic marker of success in

reproductive (Gunther et al. 2016). In contrast, a study showed that Levels IL18 was statistically

higher in PCOS comparing to normal women, and these high levels were independent of the

obesity or hyperandrogenism (Shafaq H. Hussein Al-Musawy et al. 2018) .

Interestingly, the obtained results showed that the inflammasome complex potentially

activated by the AIM2 and NALP3 pathways, and associated with an increase in the expression

of ASC and IL-18 genes, which has been accompanied by at least increased the levels of IL-1β

cytokine in overweight patients.

However, our study has several limitations that may lead to further discussion in our

obtained results. For example, the low sample size, as well as abnormal dispersion of subjects

with overweight and normal weight in both PCOS and non-PCOS may affect our obtained

results. Furthermore, we were aware that studying on ovarian tissue samples could give us more

12
realistic results, but access to these samples was not possible for us now. Although blood

samples may sometimes not be indicative of tissue functions, but in most cases, this

synchronization can be seen in the tissue and events that occur in the blood. Therefore, these

result gives further insight into the role of AIM2 and NALP3 Inflammasome in PCOS.

Moreover, due to the importance of this issue, more research is needed.

Based on the obtained results and association between NALP3 and AIM2 with IL-18, it

can be concluded that IL-18 expression, as well as increased expression of IL-1β, especially in

overweight patients, is probably due to activation of these inflammasome complexes, which may

play a key role in the immunopathology of PCOS. However, further experiments are required to

elucidate the exact role of the NALP3 and AIM2 inflammasome in PCOS, which may be useful

for the identification of a novel approach for the treatment and management of this disorder.

Acknowledgements

The present study was supported by Babol University of Medical Sciences (Grant no. 9605039 ).

The authors thank all the patients who participated in this study.

Conflict of interest

There are no conflicts of interest.

Data Availability Statement

The datasets generated during the current study are available from the corresponding author on

reasonable request.

Authors' contributions: Design and supervision of the study: HR Nouri. Methodology and

analysis performed by Rostamtabar R, Esmaeilzadeh R, Karkhah A, Amiri M, Rahmani A and

Bakouei F. Writing and correction of the manuscript was accomplished by all authors.

13
References

Alsadi B. 2014. Polycystic Ovarian Syndrome: Pathophysiology and Infertility.

Bednarska S, Siejka A. 2017. The pathogenesis and treatment of polycystic ovary syndrome: What’s new.
Adv Clin Exp Med 26: 359-367.
Bianchi ME. 2007. DAMPs, PAMPs and alarmins :all we need to know about danger. Journal of Leukocyte
Biology 81: 1-5.
Bing C. 2015. Is interleukin-1beta a culprit in macrophage-adipocyte crosstalk in obesity? Adipocyte 4:
149-152.
Boots CE, Jungheim ES. 2015. Inflammation and Human Ovarian Follicular Dynamics. Seminars in
reproductive medicine 33: 270-275.
Cornelius P, Enerback S, Bjursell G, Olivecrona T, Pekala PH. 1988. Regulation of lipoprotein lipase mRNA
content in 3T3-L1 cells by tumour necrosis factor. Biochem J 249: 765-769.
Daan NM, Koster MP, de Wilde MA, Dalmeijer GW, Evelein AM, Fauser BC, de Jager W. 2016. Biomarker
Profiles in Women with PCOS and PCOS Offspring; A Pilot Study. PLoS One 11: e0165033.
Escobar-Morreale HF, Botella-Carretero JI, Villuendas G, Sancho J, San Millan JL. 2004 .Serum
interleukin-18 concentrations are increased in the polycystic ovary syndrome: relationship to
insulin resistance and to obesity. J Clin Endocrinol Metab 89: 806-811.
Escobar-Morreale HF, Luque-Ramírez M, González F. 2011. Circulating inflammatory markers in
polycystic ovary syndrome: a systematic review and metaanalysis. Fertility and sterility 95: 1048-
1058.e1582.
Esmaeilzadeh S, Andarieh MG, Ghadimi R, Delavar MA. 2014a. Body mass index and gonadotropin
hormones (LH & FSH) associate with clinical symptoms among women with polycystic ovary
syndrome. Glob J Health Sci 7: 101-106.
Esmaeilzadeh S, Delavar MA, Amiri M, Khafri S, Pasha NG. 2014b. Polycystic ovary syndrome in Iranian
adolescents. Int J Adolesc Med Health 26: 559-565.
Esmaeilzadeh S, Gholinezhad-Chari M, Ghadimi R. 2017. The Effect of Metformin Treatment on the
Serum Levels of Homocysteine, Folic Acid, and Vitamin B12 in Patients with Polycystic Ovary
Syndrome. J Hum Reprod Sci 10: 95-101.
Esser N, L’homme L, De Roover A, Kohnen L, Scheen AJ, Moutschen M, Piette J, Legrand-Poels S, Paquot
N. 2013. Obesity phenotype is related to NLRP3 inflammasome activity and immunological
profile of visceral adipose tissue. Diabetologia 56: 2487-2497.
Gao D, Madi M, Ding C, Fok M, Steele T, Ford C, Hunter L, Bing C. 2014. Interleukin-1beta mediates
macrophage-induced impairment of insulin signaling in human primary adipocytes. Am J Physiol
Endocrinol Metab 307: E289-304.
Ghadimi R, Esmaeilzadeh S, Firoozpour M, Ahmadi A. 2014. Does vitamin D status correlate with clinical
and biochemical features of polycystic ovarysyndrome in high school girls? Caspian J Intern Med
5: 202-208.
Gholinezhad M, Gholsorkhtabaramiri M, Esmaeilzadeh S, Ghanbarpour A. 2018. Insulin resistance and
adverse metabolic profile in overweight/obese and normal weight of young women with
polycystic ovary syndrome. Caspian J Intern Med 9: 260-267.
González F. 2012. Inflammation in Polycystic Ovary Syndrome: underpinning of insulin resistance and
ovarian dysfunction. Steroids 77: 300-3.05
Gunther V, Alkatout I, Fuhs C, Salmassi A, Mettler L, Hedderich J, Maass N, Elessawy M, Schmutzler AG,
Eckmann-Scholz C. 2016. The Role of Interleukin-18 in Serum and Follicular Fluid during In Vitro
Fertilization and Intracytoplasmic Sperm Injection .Biomed Res Int 2016: 6379850.
Juge-Aubry CE, Somm E, Chicheportiche R, Burger D, Pernin A, Cuenod-Pittet B, Quinodoz P, Giusti V,
Dayer JM, Meier CA. 2004. Regulatory effects of interleukin (IL)-1, interferon-beta, and IL-4 on

14
 the production of IL-1 receptor antagonist by human adipose tissue. The Journal of clinical
endocrinology and metabolism 89: 2652-2658.
Kanafchian M, Esmaeilzadeh S, Mahjoub S, Rahsepar M, Ghasemi M. 2019. Status of Serum Copper,
Magnesium, and Total Antioxidant Capacity in Patients with Polycystic Ovary Syndrome. Biol
Trace Elem Res.
Koenen TB, Stienstra R, van Tits LJ, Joosten LAB, van Velzen JF, Hijmans A, Pol JA, van der Vliet JA, Netea
MG, Tack CJ et al. 2011. The Inflammasome and Caspase-1 Activation: A New Mechanism
Underlying Increased Inflammatory Activity in Human Visceral Adipose Tissue. Endocrinology
152: 3769-3778.
Long X, Li R, Yang Y, Qiao J. 2017. Overexpression of IL-18 in the Proliferative Phase Endometrium of
Patients With Polycystic Ovary Syndrome. Reprod Sci 24.257-252 :
Lorenz TK, Worthman CM, Vitzthum VJ. 2015. Links among inflammation, sexual activity and ovulation:
Evolutionary trade-offs and clinical implications. Evolution, medicine, and public health 2015:
304-324.
Memon RA, Feingold KR, Moser AH, Fuller J, Grunfeld C. 1998. Regulation of fatty acid transport protein
and fatty acid translocase mRNA levels by endotoxin and cytokines. Am J Physiol 274: E210-217.
Mendoza C, Cremades N, Ruiz-Requena E, Martinez F, Ortega E, Bernabeu S, Tesarik J. 1999.
Relationship between fertilization results after intracytoplasmic sperm injection, and
intrafollicular steroid, pituitary hormone and cytokine concentrations. Human Reproduction 14:
628-635.
Mohlig M, Spranger J, Osterhoff M, Ristow M, Pfeiffer A, Schill T, Schlosser HW, Brabant G, Schofl C.
2004. The polycystic ovary syndrome per se is not associated with increased chronic
inflammation. European Journal of Endocrinology 150: 525-532.
Norman RJ, Dewailly D, Legro RS, Hickey TE. 2007. Polycystic ovary syndrome .Lancet 370: 685-697.
Olszanecka-Glinianowicz M, Banaś M, Zahorska-Markiewicz B, Janowska J, Kocełak P, Madej P, Klimek K.
2007. Is the polycystic ovary syndrome associated with chronic inflammation per se? European
Journal of Obstetrics & Gynecology and Reproductive Biology 133: 197-202.
Salmassi A, Fattahi A, Nouri M, Hedderich J, Schmutzler AG. 2017. Expression of mRNA and protein of IL-
18 and its receptor in human follicular granulosa cells. Journal of endocrinological investigation
40: 447-454.
Sam S .2007 .Obesity and Polycystic Ovary Syndrome. Obesity management 3: 69-73.
Shafaq H. Hussein Al-Musawy, Ihsan E Al-Saimary, Flaifil MS. 2018. Levels of cytokines profile in
polycystic ovary syndrome. Medical Hournal of Babylon 15: 124-128.
Um JY, Chung HS, Song MY, Shin HD, Kim HM. 2004. Association of interleukin-1beta gene
polymorphism with body mass index in women. Clin Chem 50: 647-650.
Villa J, Pratley RE. 2011. Adipose Tissue Dysfunction in Polycystic Ovary Syndrome. Current Diabetes
Reports 11: 17.9
Vujisić S, Lepej SŽ, Emedi I, Bauman R, Remenar A, Tiljak MK. 2006. Ovarian follicular concentration of IL-
12, IL-15, IL-18 and p40 subunit of IL-12 and IL-23. Human Reproduction 21: 2650-2655.
Wolf WM, Wattick RA, Kinkade ON, Olfert MD. 2018. Geographical Prevalence of Polycystic Ovary
Syndrome as Determined by Region and Race/Ethnicity. International journal of environmental
research and public health 15: 2589.
Yang Y, Qiao J, Li R, Li M-Z. 2011a. Is interleukin-18 associated with polycystic ovary syndrome?
Reproductive biology and endocrinology : RB&E 9: 7-7.
Yang Y, Qiao J, Li R, Li MZ. 2011b. Is interleukin-18 associated with polycystic ovary syndrome? Reprod
Biol Endocrinol 9: 7.
Yang Y, Wang H, Kouadir M, Song H, Shi F. 2019. Recent advances in the mechanisms of NLRP3
inflammasome activation and its inhibitors. Cell Death & Disease 10: 128.

15
Zhang YF, Yang YS, Hong J, Gu WQ, Shen CF, Xu M, Du PF, Li XY, Ning G. 2006. Elevated serum levels of
interleukin-18 are associated with insulin resistance in women with polycystic ovary syndrome.
Endocrine 29: 419-423.

16
Figure legends

FIG. 1 Expression of IL-1β and IL-18 genes in Non-PCOS and PCOS groups. (A) There was no

significant difference on IL-1 expression in PCOS and Non-PCOS subjects along with subjects

with BMI <25 or ≥ 25. (B) IL-18 expression ration in PCOS and BMI ≥ 25 subjects was higher

Non-PCOS and BMI <25 subjects, respectively. Futheremore, IL-18 in PCOS subjects with BMI

<25 or ≥ 25 was higher tha Non-pcos subjects with BMI <25 or ≥ 25. * indicated p < 0.05, ***

indicated p < 0.001, **** indicated p < 0.0001 and ns indicated non-significant.

Fig. 2 Comparison of expression of genes involved in inflammasome pathway includinf ASC,

caspase-1, NALP1, NALP3, NALP12, NLRC4,Naip and AIM2 in Non-PCOS and PCOS groups.

** p < 0.01, *** p < 0.001, **** p < 0.0001 and ns; non-significant.

Fig. 3 Heat map of relative changes in the expression of inflammasome genes in PCOS and Non-

PCOS subjects. The heat map depicts the gene expression data of all samples in a color scheme:

red color represents up-regulation and pink represents down-regulation; higher color brightness

indicates a greater magnitude of differential expression and vice versa.

Fig.4 IL-1β levels was measured via ELSA. (A) IL-1β levels in PCOS and non-PCOS

individuals. (B) IL-1β levels in individuals with normal and overweight. (C) IL-1β levels in

PCOS and Non-PCOS individuals with normal or overweight. * indicated p < 0.05 and ns

indicated non-significant.

17
Table 1 Primer sequences used to evaluate the gene expression of inflammasome pathway.

Primer sequence Accession number

Name
GAPDHF AGAAGGCTGGGGCTCATTTG NM_002046
GAPDHR AGGGGCCATCCACAGTCTTC
IL-1βF GCTGCTGAACCAGTAGAAGAC NM_001562.4
IL-1βR CCGATTTCCTTGGTCAATGAAGA
IL-18F CCTGATATCGACCGAACAGC NM_001562.4
IL-18R CCTTCCATCCTTCACAGATAGG
ASCF GCCTGCACTTTATAGACCAGC NM_013258.5
ASCR GCTTCCGCATCTTGCTTGG
AIM2F CAGGAGGAGAAGGAGAAAGTTG NM_004833.3
AIM2R GTGCAGCACGTTGCTTTG
NLRP1F CAGGCAGCACAGATCAACAT NM_014922.4
NLRP1R GTGACCTTGAGGACGGAGAA
NLRP3F CTTCCTTTCCAGTTTGCTGC XM_024452874.1
NLRP3R TCTCGCAGTCCACTTCCTTT
NLRC4F TAGCCGAGCCCTTATTCAAA NM_001199138.2
NLRC4R ACCTTCTCGCAGCAAATGAT
NAIPF AGAGCCGTGGTGAACTTTGT NM_001346870.1
NAIP R CTTCACCCTGTGCCATTTCT
Caspase1F GCCTGTTCCTGTGATGGGAG NM_033295.2
Caspase1R TGCCCACAGACATTCATACAG
NLRP12 -F ATGGATCTCAGTGGCAACG NM_001277126.2
NLRP12 -R GGACTCCAGCTGACACTTCC

18
Table 2 Demographic characteristics and clinical outcomes of the Subjects

Demographic and clinical Non-PCOS PCOS P-value

complication (n= 30) (n= 30)
Age (years) 20-40 20-40
Mean ± SD 27± 0.5 29 ±0.7 0.6

Irregular menstruation 1 30 0.0001

BMI <25 19 8 0.003
BMI ≥25 11 22 0.003
Cyst in Non-Determined 30 0.0001
ultrasound findings
Ratio of LH/FSH>1 2/30 19/30 0.0004
FSH 4.3 ± 0.2 mIU/mL 4.7 ± 0.84 mIU/mL 0.7
TSH 2.3± 0.3 mIU/mL 2.98±0.3 mIU/mL 0.3
LH 4.6±1.2 mIU/mL 7.8 ± 0.8 mIU/mL 0.04

19
 Table 3 The correlation between the genes associated with the inflammation complex and the

expression of IL-1β and IL-18 expression.

Gene expression NALP1 NALP3 NLRC4 AIM2 NAIP NALP12 Casp- ASC IL-1β L-18
1
IL-18 r -0.26 0.59 0.10 0.83 0.21 0.16 0.22 0.10 0.15 -
expression
p 0.06 <0.0001 0.46 0.032 0.13 0.29 0.48 0.45 0.25 -

IL-1β r -0.25 0.18 0.002 0.26 0.84 -0.08 0.28 0.12 - 0.15
expression
p 0.068 0.19 0.98 0.056 <0.0001 0.59 0.62 0.37 - 0.25

IL-1β r 0.04 0.11 0.14 0.13 0.24 -0.13 0.16 0.11 0.17 -0.24
Level
p 0.78 0.44 0.31 0.32 0.07 0.38 0.28 0.44 0.21 0.06

List of abbreviations

AIM2: Absent in melanoma 2

ASC: Associated speck-like protein containing a caspase recruitment domain (CARD)

ELISA: Enzyme-linked immunosorbent assay

NOD: Nucleotide binding and oligomerization domain

20
NLR: NOD-like receptor

NAIP: NLR family apoptosis inhibitory proteins (NAIP),

NLRP1: NOD-like receptor family pyrin domain-containing 1

NLRC4: NLR Family CARD Domain Containing 4

PBMC: Peripheral blood mononuclear cells

PCOS: Polycystic ovary syndrome

Authors' contributions: Design and supervision of the study: HR Nouri. Methodology and

analysis performed by Rostamtabar R, Esmaeilzadeh R, Karkhah A, Amiri M, Rahmani A and

Bakouei F. Writing and correction of the manuscript was accomplished by all authors.

Conflict of interest

There are no conflicts of interest.

Declaration of interests

☒ The authors declare that they have no known competing financial interests or personal relationships
that could have appeared to influence the work reported in this paper.

☐The authors declare the following financial interests/personal relationships which may be considered
as potential competing interests:

21
 Highlight

 Chronic low-grade inflammation is involved in PCOS.

 IL-1β and IL-18 levels were changed in PCOS.

 AIM2 and NALP3 inflammasome components were increased in PCOS.

 IL-18 as well as IL-1β expression, is due to activation of inflammasome.

Article type: Original Article

Elevated expression of IL-18 but not IL-1β gene is associated with NALP3 and
AIM2 inflammasome in Polycystic Ovary Syndrome

Authors: Maryam Rostamtabar1†, Sedigheh Esmaeilzadeh2†, Ahmad Karkhah3, Mania Amiri2,

Abolfazl Rahmani1,Fatemeh Bakouei2 and Hamid Reza Nouri2, 3,4*

Affiliation
1. Student Research Committee, Babol University of Medical Sciences, Babol, Iran.

22
2. Infertility and Reproductive Health Research Center, Health Research Institute, Babol University of Medical
Science, Babol, Iran.
3. Cellular and Molecular Biology Research Center, Health Research Institute, Babol University of Medical
Sciences, Babol, Iran.
4. Immunoregulation Research Center, Health Research Institute, Babol University of Medical Sciences, Babol,
Iran.

† Authors contributed equally.

Running title: AIM2 and NALP3 linked to IL-18 in PCOS.

Corresponding author:
Dr. Hamid Reza Nouri, Cellular and Molecular Biology Research Center, Health Research
Institute, Babol University of Medical Sciences, Babol, Iran (Tel: +98 11 32222033, Fax: +98
11 32229936)
E-mail: nourihr851@gmail.com
ORCID ID : 0000-0001-6521-0875

23
24
25
26