RE S EA RC H AR TI CL E

Obesity and High-Fat Diet Induce Distinct Changes in

Placental Gene Expression and Pregnancy Outcome

Erica B. Mahany,1 Xingfa Han,2,3 Beatriz C. Borges,2,4

Sanseray da Silveira Cruz-Machado,2,5 Susan J. Allen,2 David Garcia-Galiano,2
Mark J. Hoenerhoff,6 Nicole H. Bellefontaine,2 and Carol F. Elias1,2

Downloaded from https://academic.oup.com/endo/article-abstract/159/4/1718/4847828 by guest on 19 February 2020

1
Department of Obstetrics and Gynecology, University of Michigan, Ann Arbor, Michigan 48109;
2
Department of Molecular and Integrative Physiology, University of Michigan, Ann Arbor, Michigan 48109;
3
Isotope Research Laboratory, Sichuan Agricultural University, Ya’an 625014, China; 4Department of
Physiology, School of Medicine of Ribeir~ ao Preto, University of S~
ao Paulo, 14049-900 Ribeir~ ao Preto, S~
ao
Paulo, Brazil; Department of Physiology, Institute of Biosciences, Cidade Universitária, University of S~
5
ao
Paulo, 05508-090 S~ ao Paulo, Brazil; and 6Unit for Laboratory Animal Medicine, University of Michigan, Ann
Arbor, Michigan 48109

Obese women are at high risk of pregnancy complications, including preeclampsia, miscarriage,
preterm birth, stillbirth, and neonatal death. In the current study, we aimed to determine the effects
of obesity on pregnancy outcome and placental gene expression in preclinical mouse models of
genetic and nutritional obesity. The leptin receptor (LepR) null-reactivatable (LepRloxTB), LepR-
deficient (Leprdb/+), and high-fat diet (HFD)–fed mice were assessed for fertility, pregnancy outcome,
placental morphology, and placental transcriptome using standard quantitative polymerase chain
reaction (qPCR) and qPCR arrays. The restoration of fertility of LepRloxTB was performed by ste-
reotaxic delivery of adeno-associated virus-Cre into the hypothalamic ventral premammillary nu-
cleus. Fertile LepRloxTB females were morbidly obese, whereas the wild-type mice-fed HFD showed
only a mild increase in body weight. Approximately 80% of the LepRloxTB females had embryo
resorptions (;40% of the embryos). In HFD mice, the number of resorptions was not different from
controls fed a regular diet. Placentas of resorbed embryos from obese mice displayed necrosis and
inflammatory infiltrate in the labyrinth and changes in the expression of genes associated with
angiogenesis and inflammation (e.g., Vegfa, Hif1a, Nfkbia, Tlr3, Tlr4). In contrast, placentas from
embryos of females on HFD showed changes in a different set of genes, mostly associated with
cellular growth and response to stress (e.g., Plg, Ang, Igf1, Igfbp1, Fgf2, Tgfb2, Serpinf1). Sexual
dimorphism in gene expression was only apparent in placentas from obese LepRloxTB mice. Our
findings indicate that an obese environment and HFD have distinct effects on pregnancy outcome
and the placental transcriptome. (Endocrinology 159: 1718–1733, 2018)

besity is a worldwide epidemic that affects in-
O dividuals of both sexes and all ages (1). In the United
States, it is estimated that nearly 60% of women of re-
productive age (15 to 49 years) are overweight or obese
(2). Obesity is associated with reproductive deficits, but a
high percentage of obese women is able to conceive.
These women are exposed to increased risk of pregnancy
complications and an increased probability of maternal
and fetal morbidity and mortality. They are more sus-
ceptible to recurrent pregnancy loss, and they have twice
the risk of preterm birth, stillbirth, and neonatal death
(3–6). Congenital abnormalities, including neural tube
and cardiac defects, orofacial malformations, and in-
testinal anomalies (e.g., anorectal atresia and ompha-
locele), are also more common in children of obese
mothers (4, 6–8). However, the exact causes or mechanisms

ISSN Online 1945-7170 Abbreviations: 18s, 18S ribosomal RNA; AAV, adeno-associated virus; ANOVA, analysis
Copyright © 2018 Endocrine Society of variance; bp, base pair; DEG, differentially expressed gene; E, embryonic day; F, for-
Received 19 October 2017. Accepted 29 January 2018. ward; GFP, green fluorescent protein; HFD, high-fat diet; Lep, leptin; LepR, leptin receptor;
First Published Online 9 February 2018 Ly6G, lymphocyte antigen 6 complex locus G6D; MC4R, melanocortin 4 receptor; mRNA,
messenger RNA; Pecam1, platelet and endothelial cell adhesion molecule 1; PMV, ventral
premammillary nucleus; qPCR, quantitative polymerase chain reaction; R, reverse; RD,
regular chow diet; RRID, Research Resource Identifier.

1718 https://academic.oup.com/endo Endocrinology, April 2018, 159(4):1718–1733 doi: 10.1210/en.2017-03053

doi: 10.1210/en.2017-03053
behind these deleterious effects are not completely
known.
Obesity is a condition of chronic low-grade in-
flammation, characterized by sustained secretion of
proinflammatory cytokines by hypertrophic adipocytes
(9–11). Among them, leptin (Lep), tumor necrosis factor,
and interleukin 6 are well described (8, 9, 12–14). High
adiposity also induces the expression of proinflammatory
mediators in the placenta, increasing the chances of
placental inflammation (10, 11, 15). This outcome favors
the installation of an adverse intrauterine milieu—or
fetoplacental dysfunction—impairing placental blood
flow and nutrient exchange (8). In nonhuman primates,
an obesogenic diet increases the risk of placental in-
farction and stillbirth (16), and excess nutrition in
pregnant ewes is associated with a reduction in placental
vascularity and fetal growth restriction (17).
Obesity is also a major risk factor for the development
of type 2 (pregestational) diabetes (14, 18, 19). Hyper-
glycemia, in the early stages of pregnancy, is associated
with inadequate oocyte maturation and blastocyst de-
velopment, increasing the chances of deficient implan-
tation (20). Compromised preimplantation development
may explain the higher rates of early, spontaneous mis-
carriages observed in pregestational diabetic women with
poor glycemic control (21, 22). If pregnancy develops,
hyperglycemia may alter placental angiogenesis, affecting
fetoplacental circulation and normal embryo develop-
ment (22–24).
The effects of obesity in placental differentiation and
function are controversial, probably a result of the in-
herent variability of human cohorts and the high prev-
alence of comorbidities (e.g., diabetes, hypertension) in
human populations (18, 25). Moreover, the causative
role of either high adiposity or obesogenic diets on the
progression of placental dysfunction has been difficult to
determine as a result of limited availability of adequate
preclinical models. For example, it is still unclear if the
dysfunctional placenta and poor pregnancy outcome
reported in animal models of diet-induced obesity are
caused by the adiposity of the mother or by the com-
ponents of the diet.
In the current study, we performed a comparative
analysis of genetic obese mice fed a regular chow diet
(RD) and wild-type mice fed a high-fat diet (HFD) to
unravel differences in fertility, pregnancy outcome,
placental transcriptome, and placental morphology.
We hypothesized that obesity in mice recapitulates the
poor pregnancy outcome observed in obese women
(miscarriages and stillbirths) and that high adiposity
and high fat consumption perturb distinct subsets of
placental genes required for the maintenance of
pregnancy.
https://academic.oup.com/endo 1719
Materials and Methods
Mice
The Lep receptor (LepR)loxTB (kindly provided by Dr. Joel
Elmquist, The University of Texas Southwestern Medical
Center, Dallas, TX; available in JAX® mice, stock no. 018989)
(26), Leprdb/+ (JAX® mice, stock no. 000697), and C57BL/6
mice (JAX® mice, stock no. 000664) were housed in the Uni-
versity of Michigan Unit for Laboratory Animal Medicine
facility with 12-hour light/dark cycles. They were fed
phytoestrogen-reduced standard chow (16% protein/4% fat,
Downloaded from https://academic.oup.com/endo/article-abstract/159/4/1718/4847828 by guest on 19 February 2020
2016 Teklad Global Diet; Envigo) until breeding, at which
point, they were fed phytoestrogen-reduced breeder’s chow
(19% protein/9% fat, 2019 Teklad Global Diet; Envigo).
Phytoestrogen-reduced diets were used to avoid the effects of
exogenous estrogens on the physiology of the mice. Another
group of mice was fed an HFD (42%, TD.88137, or 60% fat,
TD.06414, Teklad Global Diet; Envigo) for 12 or 16 weeks.
Stereotaxic injections and breeding
Stereotaxic injection of adeno-associated virus (AAV) vec-
tors, expressing Cre and/or green fluorescent protein (GFP;
AAV-Cre/GFP or AAV-GFP; Vector Core, University of North
Carolina) unilaterally into the ventral premammillary nucleus
(PMV) of female LepRloxTB/loxTB mice at 7 to 10 weeks of age,
was performed. Cre-mediated excision of the loxP sites induces
endogenous expression of the Lepr gene. As the LepRloxTB mice
are infertile at baseline, we crossed mice heterozygous for the
LepR mutation to generate our experimental group. Genotypes
were defined using DNA extracted from the tail and the fol-
lowing primers: forward (F) 50 CAG TCT GGA CCG AAG
GTG TT 30 and reverse (R) 50 TAG GGC CAA ACC CAC ATT
TA 30 . Mice homozygous for loxTB were used as the experi-
mental group (AAV-Cre/GFP injections), and mice homozygous
for the wild-type allele were used as controls (AAV-GFP in-
jections). Mendelian ratios were obtained; 25% of the offspring
were experimental, 50% were heterozygous, and 25% were
control. Heterozygous mice were used as breeders, as mentioned
previously. Females were housed together postoperatively.
External signs of pubertal maturation were evaluated daily by
vaginal opening for 2 to 3 weeks. Experimental and control mice
were housed with wild-type adult male mice of proven fertility
to breed. The females were weighed every other day, and when
the slope of the weight-gain trajectory increased, the female mice
were euthanized. This strategy was used, because in pilot ex-
periments, we found that copulatory plugs were not a reliable
indication of successful fertilization in obese mice (27).
Histology and immunohistochemistry
Before euthanasia, mice were deeply anesthetized with iso-
flurane (2% to 4%, Fluriso; Vet One). Brain, placentas, and
embryos were harvested, and blood samples were collected
directly from the heart. Brains were snap frozen on dry ice and
stored at 280°C. Reproductive organs and embryos were
postfixed in buffered formalin for histological analyses. The
placentas were microdissected under a dissecting stereoscope
(Zeiss), and maternal tissue was removed. They were divided
into two groups, one for gene expression analyses, which was
snap frozen on dry ice, and the other for histological analyses,
which was placed in buffered formalin. Brains were cut on a
cryostat (30 mm sections, five series frontal plane) and stored
1720 Mahany et al Obesity, High-Fat Diet, and Pregnancy Outcome
at 220°C. Uteri, ovaries, embryos, and placentas were pro-
cessed for standard paraffin-embedded sectioning and hema-
toxylin and eosin staining. Placental tissue was also processed
for markers of endothelial [angiogenesis, platelet and endo-
thelial cell adhesion molecule 1 (Pecam1), 1:50, catalog no.
DIA-310; Dianova, Research Resource Identifier (RRID):
AB_2631039] (28) and immune cells [neutrophils, lymphocyte
antigen 6 complex locus G6D (Ly6G), 1:200, catalog no.
551459; BD Biosciences, RRID: AB_394206] (29) using stan-
dard immunoperoxidase and diaminobenzidine as chromogen.
Brain sections were processed for the detection of GFP im-
munoreactivity (1:10,000, catalog no. GFP-1010; Aves Labo-
ratories, RRID: AB_2307313) (30, 31) using standard
immunoperoxidase and diaminobenzidine as chromogen.
In situ hybridization
Adult female wild-type mice (n = 4) were perfused trans-
cardially with 10% buffered formalin; brains were dissected
out, cryopreserved overnight in 20% sucrose, and sectioned in a
freezing microtome (30 mm sections, five series frontal plane).
To compare the pattern of GFP labeling and LepR messenger
RNA (mRNA) distribution in the PMV, the mouse LepRb was
used as described previously (32). The following primers and
T3/T7 polymerases were used to amplify a 400–base pair (bp)
fragment: F 50 AAA GAG CTC CTT CTC TGG GTC TCA GAG
CAC 30 and R 50 AAA AAG CTT CTC ACC AGT CAA AAG
CAC ACC AC 30 . Tissue sections were mounted onto Super-
Frost plus slides (Fisher Scientific) and microwaved in sodium
citrate buffer, pH 6.0, for 10 minutes. The 35S-labeled LepRb
riboprobe was diluted to 106 cpm/mL in a hybridization so-
lution containing 50% formamide, 10% dextran sulfate, and
13 Denhardt solution. The riboprobe was applied to each slide
following incubation overnight at 57°C. Slides were treated
with 0.02% RNase A (Roche) and subjected to stringency
washes in saline-sodium citrate buffer. Slides were placed in X-
ray film cassettes with BMR-2 film (Kodak) for 2 days, dipped in
NTB-2 autoradiographic emulsion (Kodak) for 2 weeks. Slides
were developed with D-19 developer (Kodak), dehydrated in
graded ethanol, cleared in xylenes, and coverslipped with DPX
(Sigma-Aldrich).
Quantitative polymerase chain reaction
Placentas were initially submitted to a quantitative poly-
merase chain reaction (qPCR) array, and the validation was
performed using standard qPCR. RNA was extracted using the
Qiazol lysis reagent (RNeasy Mini Kit; Qiagen). The cDNA was
generated using 1 mg total RNA from each placenta (RT2 First
Strand Kit; Qiagen). The mRNA quantification was carried out
using a mouse angiogenesis qPCR array with 84 genes per plate
and 12 control wells (RT2 Profiler PCR Array; Qiagen). The
genes were normalized to five housekeeping genes, and the
resulting values were expressed as fold change, above or below
control levels. Data from the qPCR array were represented using
Prism 7 software (GraphPad Software). For validation, qPCR
was performed on a CFX-384 reverse transcription PCR de-
tection system (Bio-Rad) using SYBR® Green Gene Expression
Assays and pairs of primers designed by Sigma-Aldrich or In-
tegrated DNA Technologies. The housekeeping gene 18S ri-
bosomal RNA (18s) was used as an internal reference. The
amplifications were performed in a total volume of 10 mL and
included 5 mL of 23 SYBR Green Master Mix Reagent (Qiagen),
1 mL cDNA, and 0.5 mL each primer (500 nmol/L). All primer
Endocrinology, April 2018, 159(4):1718–1733
sequences are listed in Table 1. To define the sex of the embryos,
genomic expression of Sry and Ddx3y genes was used as specific
male markers. All reactions were run in triplicate and included
negative controls with no template. Relative fold expression of
each gene was calculated using the comparative cycle threshold
method, normalizing to the internal 18s reference and comparing
with the control group.
Data analysis, statistics, and production
of photomicrographs
Sections of brain, uterus, ovary, placenta, and embryo were
Downloaded from https://academic.oup.com/endo/article-abstract/159/4/1718/4847828 by guest on 19 February 2020
analyzed using an Axio Imager M2 microscope (Zeiss). Pho-
tomicrographs were produced by capturing images with a
digital camera (Axiocam; Zeiss), mounted directly on the mi-
croscope using Zen software. Image-editing software (CS6;
Adobe Photoshop) was used to combine photomicrographs into
plates. Only sharpness, contrast, and brightness were adjusted.
Data are expressed as means 6 standard error of the mean.
Comparisons between two groups were carried out using the
unpaired two-tailed Student t test. One-way analysis of variance
(ANOVA), followed by the pairwise Tukey test, was used to
compare three or more groups simultaneously. Statistical an-
alyses were performed using Prism 7 software (GraphPad
Software), and an a value (P) of 0.05 was considered in
all analyses.
Study approval
All animal studies were carried out in accordance with the
guidelines established by the National Institutes of Health Guide
for the Care and Use of Laboratory Animals and approved by
the University of Michigan Institutional Animal Care and Use
Committee (PRO00004380; Ann Arbor, MI).
Results
Mouse models of obesity show poor
pregnancy outcome
In previous studies from our laboratory (33), we ob-
served that the obese LepR-null mice show high rates of
embryo resorptions and fetal death. These mice re-
capitulate the phenotype of the LepR-deficient db/db
(Leprdb) mice (34). They are obese, diabetic, and infertile.
Following endogenous LepR reactivation in PMV neu-
rons, we observed an improvement in the fertility of fe-
male LepR-null mice but a low rate of successful
pregnancies at term. Of five pregnant females, three
showed resorptions, and one delivered pups with mal-
formations (Fig. 1A). The only female to deliver appar-
ently healthy pups was the leanest of all (37.3 vs 45.6 6
1.4 g compared with 18.10 6 0.7 g in wild-type mice).
This observation suggested that the extreme obesity of the
LepR-null females had a negative impact on the pro-
gression of pregnancy.
To test this hypothesis, we used a similar mouse model
functionally null for LepR—the LepRloxTB mouse that has
loxP sites flanking a transcription blocking cassette, inserted
between exons 16 and 17 of the Lepr gene (26, 31, 35).
doi: 10.1210/en.2017-03053 https://academic.oup.com/endo 1721

Table 1. Sequence of Primers Used for qPCR

Genes Forward Reverse
0 0
18s F: 5 TGACTCAACACGGGAAACCT 3 R: 5 AACCAGACAAATCGCTCCAC 30
0

Ang F: 50 CAGCTTTGGAATCTCTGTTG 30 R: 50 GCTTCTTCTCTTCATCATAGG 30

Angpt2 F: 50 AATAAGTAGCATCAGCCAAC 30 R: 50 AGTAGTACCACTTGATACCG 30
Bai1 F: 50 TCATGCTGGTCATCATCTAC 30 R: 50 AAGGATGAGAGCATTAGAGG 30
Bhlhe40 F: 50 CAGGCGGGGAATAAAACGGA 30 R: 50 GGGCACAAGTCTGGAAACCT 30
Cd36 F: 50 AATTTGTCCTATTGGCCAAGCT30 R: 50 AGCGTAGATAGACCTGCAAATG 30
Cpt1b F: 50 CTTAGCCTCTACGGCAAAGC 30 R: 50 CCACGAGTGTTCGGTGTTGA 30
Crh F: 50 AGGCATCCTGAGAGAAGTCC 30 R: 50 ACGACAGAGCCACCAGCA 30
F: 50 CAGATGGAAAACCTAGGGG 30 R: 50 TGGAAGGCAGAAGTGAAG 30

Downloaded from https://academic.oup.com/endo/article-abstract/159/4/1718/4847828 by guest on 19 February 2020

Csf3
Ctgf F: 50 GAGGAAAACATTAAGAAGGGC 30 R: 50 AGAAAGCTCAAACTTGACAG 30
Edn1 F: 50 GAAGTGTATCTATCAGCAGC 30 R: 50 GCACTATATAAGGGATGACTTC 30
Egf F: 50 GTACTCTTGGGTGTGAAAAC 30 R: 50 CAAGTTCGTGACATTGTTTC 30
F2 F: 50 AACATCAATGAGATACAGCC 30 R: 50 GCTCTTCATGACAAAGGTC 30
Fgf2 F: 50 CTGGCTTCTAAGTGTGTTAC 30 R: 50 GAAGAAACAGTATGGCCTTC 30
Figf F: 50 CTCTTTGAGATATCAGTGCC 30 R: 50 GAGGACATTCATCTTCTTCTG 30
Flt1 F: 50 CAAGAGCGATGTGTGGTCCT 30 R: 50 TCCCATCCTGTTGGACGTTG 30
Hif1a F: 50 ACCTTCATCGGAAACTCCAAAG 30 R: 50 ACTGTTAGGCTCAGGTGAACT 30
Ifng F: 50 TGAGTATTGCCAAGTTTGAG 30 R: 50 CTTATTGGGACAATCTCTTCC 30
Igf1 F: 50 GACAAACAAGAAAACGAAGC 30 R: 50 ATTTGGTAGGTGTTTCGATG 30
Igfbp1 F: 50 CCCTGCCAACGAGAACTCTA 30 R: 50 TCTCCATCCAGGGATGTCTC 30
Il1b F: 50 GGATGATGATGATAACCTGC 30 R: 50 CATGGAGAATATCACTTGTTGG 30
Il6 F: 50 AAGAAATGATGGATGCTACC 30 R: 50 GAGTTTCTGTATCTCTCTGAAG 30
Insl3 F: 50 AAGAAGCCCCATCATGACCT 30 R: 50 TTATTTAGACTTTTTGGGACACAGG 30
Lep F: 50 TCTCCGAGACCTCCTCCATCT 30 R: 50 TTCCAGGACGCCATCCAG 30
Lepr F: 50 CCTCTTGTGTCCTACTGCTCG 30 R: 50 GAAATTCAGTCCTTGTGCCCAG 30
Mdk F: 50 CAAAGCCAAGAAAGGAAAG 30 R: 50 CACTGGTGGGTTATATCTTG 30
Nfkbia F: 50 CCACTCCACTTGGCTGTGAT 30 R: 50 GACACGTGTGGCCATTGTAG 30
Nos3 F: 50 AAAGCTGCAGGTATTTGATG 30 R: 50 AGATTGCCTCTATTTGTTGC 30
Pecam1 F: 50 CATCGCCACCTTAATAGTTG 30 R: 50 CCAGAAACATCATCATAACCG 30
Plg F: 50 ATTTCCCCTGCAAAAATCTG 30 R: 50 ATGGAATCTCACAGTACTCC 30
Serpinf1 F: 50 CCAAGTTTGACTCGAGAAAG 30 R: 50 CAATCTTGCAGTTGAGATCAG 30
Slc2a1 F: 50 GGGAGAGGTGTCACCTACAGC 30 R: 50 ATTGCCCATGATGGAGTCTAA 30
Slc2a3 F: 50 GGAGCAGGCGTGGTCAATAC 30 R: 50 TGAAAACGGAGCAAACAGCC 30
Sphk1 F: 50 GGTACTCTCATCTCGACTTC 30 R: 50 GCCAGATTTTTAGCTTCCAG 30
Tgfb2 F: 50 GAGATTTGCAGGTATTGATGG 30 R: 50 CAACAACATTAGCAGGAGATG 30
Timp2 F: 50 GGATTCAGTATGAGATCAAGC 30 R: 50 GCCTTTCCTGCAATTAGATAC 30
Tlr3 F: 50 GTCTTCTGCACGAACCTGAC 30 R: 50 GAGCAGTTCTTGGAGGTTCTC 30
Tlr4 F: 50 AATCCCTGCATAGAGGTAGTTCCTA 30 R: 50 GTCTCCACAGCCACCAGATT 30
Tnf F: 50 CTATGTCTCAGCCTCTTCTC 30 R: 50 CATTTGGGAACTTCTCATCC 30
Tymp F: 50 GCAACTGGAGTGGCCCAAAG 30 R: 50 GATCCCATCAGCAGGAACCA 30
Vegfa F: 50 TAGAGTACATCTTCAAGCCG 30 R: 50 TCTTTCTTTGGTCTGCATTC 30
Abbreviations: Ang, angiogenin; Angpt2, angiopoietin 2; Bai1, brain-specific angiogenesis inhibitor 1; Bhlhe40, basic helix-loop-helix family member E40;
CD36, cluster of differentiation 36; Cpt1b, carnitine palmitoyltransferase 1b; Crh, corticotropin-releasing hormone; Csf3, colony-stimulating factor 3;
Ctgf, connective tissue growth factor; Edn1, endothelin 1; Egf, epidermal growth factor; F2, coagulation factor 2; Fgf2, fibroblast growth factor 2; Flt1,
fms-related tyrosine kinase 1 (VegfR1); Hif1a, hypoxia-inducible factor-1 a subunit; Ifng, interferon g, Igf1, insulinlike growth factor 1; Igfbp1, insulinlike
growth factor-binding protein 1; Il1b, interleukin 1b; Il6, interleukin 6; Insl3, insulinlike 3; Mdk, midkine; Nfkbia, NF kB inhibitor a; Nos3, nitric oxide
synthase 3; Plg, plasminogen; Serpinf1, serpin family F member 1; Slc2a1, glucose transporter 1 (Glut1); Slc2a3, glucose transporter 3 (Glut3); Sphk1,
sphingosine kinase 1; Tgfb2, transforming growth factor b 2; Timp2, tissue inhibitor of metalloproteinases; Tlr3, Toll-like receptor 3; Tlr4, Toll-like receptor
4; Tymp, thymidine phosphorylase; Vegfa, vascular endothelial growth factor a.

This mouse line is also obese, diabetic, and infertile.
One cohort of LepRloxTB (n = 18) was injected with AAV-
Cre/GFP into the PMV to re-express endogenous LepR
and restore sexual maturation and fertility. Of the 18
injected LepRloxTB mice, 11 correctly targeted the PMV
(named PMV-hits). All 11 showed sexual maturation
(vaginal opening), but only five became pregnant in
4 weeks of fertility testing. Of the five pregnant mice,
three were euthanized at midgestation owing to a sud-
den decrease in body weight. All three females had a
normal number of implantations (8.6 6 0.6) but a high
percentage of resorptions (54.2% 6 4.2; Fig. 1B and
1C). The other two pregnant mice delivered pups at
term. One female delivered eight normal-appearing
pups; the other delivered three pups and was eutha-
nized shortly after as a result of delivery complications.
Seven fetuses were retained, six of which were dead. The
three pups that were delivered had no signs of de-
velopmental abnormalities. Control littermates (n = 8)
had no pregnancy complications.
1722 Mahany et al Obesity, High-Fat Diet, and Pregnancy Outcome Endocrinology, April 2018, 159(4):1718–1733

Downloaded from https://academic.oup.com/endo/article-abstract/159/4/1718/4847828 by guest on 19 February 2020

Figure 1. Poor pregnancy outcome in LepRloxTB obese mice with re-expression of LepR in the PMV. (A) Embryos with malformations delivered
by a PMV-hit LepR-null (LepRneo/neo) female mouse. (B and C) Implantations in (B) wild-type and (C) PMV-hit LepRloxTB mice, euthanized at
midgestation [embryonic day (E)10.5)]. (C) Note the high number of resorptions (arrows) and high adiposity. (D) Darkfield images showing the
distribution of LepR mRNA in the PMV of a wild-type female mouse. (E) Brightfield image showing injection of AAV-Cre/GFP targeting the PMV
(example of a PMV-hit). Image shows GFP immunoreactive (GFP-ir) cells. (F) Brightfield image showing a LepRloxTB mouse with AAV-Cre/GFP
outside the PMV (PMV-miss). (D–F) Original scale bar, 300 mm. 3V, third ventricle.

Metabolic phenotype and pregnancy outcome of
the obese fertile and infertile LepRloxTB mice
Two more cohorts of LepRloxTB mice (first cohort n = 21
females; second cohort n = 8 females) and wild-type
littermates (first cohort n = 13 females, six with AAV-
GFP injection; second cohort n = 7 without injections)
were evaluated. At the time of euthanasia, brains were
collected and sections processed for immunohisto-
chemistry to detect GFP immunoreactivity and confirm
the injection sites (Fig. 1D–1F). Of the 29 injected mice,
19 had injections targeting the PMV (PMV-hits). All
PMV-hits showed a vaginal opening (external sign of
puberty onset) between postoperative days 6 and 14
(average 9.9 6 0.5 days). The mice were then bred with
wild-type males of proven fertility; 10 females became
pregnant after 6 weeks of fertility testing. Pregnant
(n = 10) and nonpregnant (n = 9) PMV-hit mice showed
no differences in body weight on the day of surgery,
but by 12 weeks of age (before pregnancy), the non-
pregnant group was significantly heavier (Fig. 2A and
2B). As expected, as a result of sexual maturation and
increase in sex steroids, PMV-hits showed decreased
weight gain compared with those outside the PMV
(PMV-misses; at 12 weeks of age; Fig. 2C). Increased
latency to pregnancy was observed compared with
wild-types (Fig. 2D). Females were euthanized at
midpregnancy [embryonic day (E)11.5 to E15.5]. At
this time window, the number of implantations was
similar to controls (P = 0.26), but a substantially higher
percentage of resorptions was apparent in PMV-hit
mice (P = 0.01; Fig. 2E).
As all PMV-hits showed vaginal opening, but ap-
proximately one-half of them had no signs of preg-
nancy, we assessed uterine and ovarian morphology.
Nonpregnant PMV-hit mice had a comparable uterine
size to wild-type diestrous mice, whereas the uterus of
PMV-misses had no signs of pubertal development
(Fig. 2F–2I). The ovaries of PMV-hits had corpora
lutea, which was not observed in the ovaries of PMV-
misses (Fig. 2J–2L). These data indicate that although
re-expression of LepR in PMV neurons had restored
sexual maturation and ovulation, a subset of these
mice was unable to become pregnant or sustain
pregnancy.
As expected (26), LepRloxTB mice had higher fasting
glucose levels before surgery compared with wild-type
littermate controls (Fig. 3A). Random glucose and insulin
levels were obtained at the time of euthanasia. Fasting
glucose levels and glucose or insulin tolerance were not
assessed to avoid interference with pregnancy progres-
sion and gene-expression analysis. The obese PMV-miss
mice had very high glucose and insulin levels compared
with wild-type pregnant mice. PMV-hits also had higher
glucose levels compared with wild-type controls, but no
difference in insulin levels was detected as a result of high
variability in obese females. Glucose levels were lower in
PMV-hit pregnant compared with PMV-hit nonpregnant
mice (Fig. 3B and 3C).
doi: 10.1210/en.2017-03053 https://academic.oup.com/endo 1723

Downloaded from https://academic.oup.com/endo/article-abstract/159/4/1718/4847828 by guest on 19 February 2020

Figure 2. Metabolic phenotype and pregnancy outcome of LepRloxTB mice with re-expression of LepR in the PMV. (A–C) Bar graphs showing differences
in body weight and weight gain of LepRloxTB mice following reactivation of LepR in the PMV (PMV-hits). (B) Note that nonpregnant females have higher
body weight following surgery. (D–F) Bar graphs showing (D) increase in latency to pregnancy, (E) percentage of resorptions, and (F) normalization of
uterus weight to wild-type (WT) levels in PMV-hits. (G–O) Brightfield images showing sexual maturation [increased uterus size and presence of corpora
lutea (CL)] in PMV-hit compared with PMV-miss mice. (H, K, and N) Higher magnification of G, J, and M (boxes), respectively. Note development and the
myometrium (Myo) and endometrium (Endo) layers in PMV-hit mice. *P , 0.05; **P , 0.01; ***P , 0.001; ****P , 0.0001. Unpaired two-tailed
Student t test for comparisons between two groups; one-way ANOVA, followed by the pairwise Tukey test for comparisons of three groups; and (B) two-
way ANOVA, followed by Sidak multiple comparison test. Original scale bar, (G, I, J, L, M, and O) 3 mm; (H, K, and N) 200 mm. Fol, follicles; Lu, lumen.
1724 Mahany et al Obesity, High-Fat Diet, and Pregnancy Outcome Endocrinology, April 2018, 159(4):1718–1733

Downloaded from https://academic.oup.com/endo/article-abstract/159/4/1718/4847828 by guest on 19 February 2020

Figure 3. LepRloxTB mice have high glucose and insulin levels but no difference in the expression of the Lepr gene in the placentas. (A) Bar
graphs showing fasting glucose levels of wild-type and LepRloxTB mice before surgery. Note the high glucose levels of LepR-null mice. (B and C)
Bar graphs showing glucose levels of wild-type and LepRloxTB mice before euthanasia. Note that although an improvement in glucose levels was
observed in PMV-hits, they have not been normalized to wild-type levels. Furthermore, note the higher glucose levels in nonpregnant vs pregnant
PMV-hits. (D) Image of a gel showing the genotyping of eight embryos (e1 to e8) from a LepR-null PMV-hit dam. All embryos are heterozygous
for the Lepr allele (wild-type allele = 540 bp, LepR-null allele = 300 bp). (E and F) Bar graphs showing relative mRNA expression of Lepr and Lep
genes in placentas of male and female embryos from wild-type (white bars) and PMV-hit LepRloxTB (black bars) dams. No difference was noticed
between genotypes. (G–J) Bar graphs showing (G) body weight, (H) blood glucose, (I) number of implantations, and (J) percentage of resorptions
comparing wild-type with Leprdb/+ mice. A small difference in body weight between genotypes was observed. Unpaired two-tailed Student t test
for comparisons between two groups and one-way ANOVA, followed by the pairwise Tukey test for comparisons of three or more groups.
Different letters represent differences (P , 0.05) comparing groups. *P , 0.05; ***P , 0.001.

Expression of the Lepr gene is not altered in
placentas of embryos from LepRloxTB mice
The genotypes of one litter of a PMV-hit female (n = 8
embryos) were assessed for validation. As expected,
all embryos were heterozygous for the LepR-null
mutation (LepRloxTB/+; Fig. 3D); therefore, the cor-
responding placentas had one functional copy of the
Lepr gene. To assess if the poor pregnancy outcome of
the PMV-hit LepR loxTB mice was caused by a decrease
in the expression of Lepr gene, we performed qPCR
analysis on the placentas from PMV-hit and from
wild-type male and female embryos. No differences in
the expression of either Lepr or Lep genes were ob-
served between the genotypes in both sexes (Fig. 3E
and 3F).
To assess if lack of one copy of the Lepr gene
predisposes mice to embryo resorption, we bred mice
heterozygous for the Lepr gene mutation (Leprdb/+)
doi: 10.1210/en.2017-03053 https://academic.oup.com/endo 1725

with wild-type males to generate Leprdb/+ and wild-
type (Lepr+/+) embryos in the same litter. Compared
with wild-type females, Leprdb/+ had slightly higher
body weight on the first mating day (10 weeks of age,
difference between means = 3.7 6 1.6 g, P = 0.048),
but glucose levels were comparable (Fig. 3G and 3H).
No differences in latency to pregnancy (P = 0.89),
number of implantations, or percentage of resorptions
were observed (Fig. 3I and 3J). The genotyping of the
placentas of all resorbed embryos from Lepr db/+ mice
Placentas of embryos from obese LepRloxTB mice
show necrosis and defective angiogenesis
Placentas from wild-type and LepRloxTB pregnant mice at
midgestation were submitted for histological analyses (n = 4
placentas from wild-type, and n = 7 placentas from Lep-
RloxTB mice). Three out of four placentas from wild-type
embryos showed small, focal areas of necrosis (Fig. 4A),
although overall, the tissue architecture was preserved.
Moderate-to-severe necrosis was observed in all seven
LepRloxTB resorbed placentas (Fig. 4A–4C). Large zones of

Downloaded from https://academic.oup.com/endo/article-abstract/159/4/1718/4847828 by guest on 19 February 2020

(n = 11) showed that 45.5% of embryos were wild-
types (Lepr +/+, n = 5), and 55.5% were Leprdb/+ (n = 6),
suggesting that lack of one functional Lepr allele in the
fetoplacental unit cannot explain the increased rate of
resorptions in LepR loxTB mice.
placental necrosis centered on the vasculature, with influx of
inflammatory cells into the vascular walls were also evident
(Fig. 4D–4F). Necrosis within the placental labyrinth and/or
the syncytiotrophoblast layer within the basal zone and the
decidua basalis was often associated with fibrin deposition

Figure 4. Placentas of embryos from obese LepRloxTB mice show necrosis, inflammatory infiltrate, and defective angiogenesis. (A–C) Brightfield
images showing sections of placentas from (A and B) LepRloxTB and (C) wild-type for comparison. Note the zone of necrosis within labyrinth zone
(asterisk), bordered by spongiotrophoblasts at the margin of necrosis (arrowheads) and multifocal foci of neutrophilic inflammation (arrow). (D)
Higher magnification of region denoted by arrow in (B), showing focal infiltration of neutrophils and fibrin adjacent to zone of necrosis. (E and F)
Ly6G immunohistochemistry for neutrophils in region shown in (C). Several inflammatory cells show diffuse immunoreactivity to antibody for
Ly6G (Ly6G-ir), indicative of neutrophil lineage. (G) Higher magnification of the spongiotrophoblasts layer at the margin of necrosis denoted by
the arrowhead in (B). (H and I) Pecam1 immunohistochemistry for endothelial cells in the region shown in (G). Positive immunoreactivity (Pecam1-
ir) in the labyrinth zone and spongiotrophoblast layer consistent with endothelial cells. Note the disorganized structure in (H) compared with (I).
Original scale bar, (A) 400 mm; (B and C) 200 mm; (D–I) 100 mm. BZ, basal zone; DB, decidua basalis; GC, giant cell layer; LZ, labyrinth zone.
1726 Mahany et al Obesity, High-Fat Diet, and Pregnancy Outcome Endocrinology, April 2018, 159(4):1718–1733

and inflammatory infiltrate. In affected areas, we observed
dilation of labyrinth blood vessels and altered expression of
angiogenesis markers, Pecam1, a.k.a. as CD31 (Fig. 4G–4I).
Pecam1 is a membrane glycoprotein associated with cell-
to-cell adhesion and angiogenesis (36). There were also
multifocal areas of low-to-mild mineralization, randomly
scattered within the labyrinth in all resorbed placentas,
and mild cystic structures in the basal zone.
Differentially expressed genes in the placentas of
analyses. We compared placentas of resorbed embryos
from PMV-hit LepRloxTB mice with placentas of normal
developing embryos from wild-type mice at midgestation
(Fig. 5A). Of 10 obese LepRloxTB pregnant females, eight
had resorptions (80%). In two females, resorptions were at
advanced stages and were not used for analysis. Of the
remaining six obese females with resorbed placentas, we
obtained five placentas from female embryos and one
from a male embryo. For consistency, only placentas from

Downloaded from https://academic.oup.com/endo/article-abstract/159/4/1718/4847828 by guest on 19 February 2020

embryos from obese LepRloxTB mice female embryos were used in the array. Genes within 2.5-
Because of the histopathological findings, we initially fold difference in expression were reassessed using stan-
ran a mouse angiogenesis qPCR array for gene-expression dard qPCR for data validation (one placenta per dam).

Figure 5. Gene-expression analysis of resorbed placentas from obese LepRloxTB mice and normal placentas from wild-type mice at midgestation.
(A) Heat map showing the relative expression levels of genes associated with angiogenesis in mice. (B–E) Bar graphs showing expression levels
of genes found on the qPCR array to be 2.53 differentially expressed compared with controls. The genes were clustered in four functional
categories, i.e., (B) angiogenesis, (C) inflammation, (D) cellular growth, and (E) response to stress. Unpaired two-tailed Student t test for
comparisons between two groups. *P , 0.05; **P , 0.01; ***P , 0.001. R, resorbed; Wt, wild-type.
doi: 10.1210/en.2017-03053
Expression of the housekeeping gene 18s was not different
between groups (mean comparative cycle threshold values:
11.86 6 0.4 in controls vs. 12.05 6 0.3 in obese, P = 0.91).
The differentially expressed gene (DEG) clustered into four
functional categories: angiogenesis (Vegfa, Hif1a), in-
flammation (Nfkbia, Il6, Il1b, Nos3, Pecam1, Tlr3, Tlr4),
cellular growth (Mdk, Ctgf), and response to stress (Edn1,
Crh; Fig. 5B–5E).
We further assessed gene expression in placentas with
no morphological signs of resorption (classified as nor-
mal) from embryos of obese LepRloxTB and control wild-
type females. Placentas from male and female embryos
were evaluated independently (n = 4 to 6 per genotype
and sex). Striking sex differences were observed. In-
creased expression of genes associated with angiogenesis
(Vegfa, Bai1, Angpt2, Bhlhe40, Hif1a, Flt1), inflam-
mation (Nfkbia, Pecam1, Tlr3, Tlr4), cellular growth
(Egf, Sphk1, Ctgf), and response to stress (Tgfb2, Edn1,
Crh) was observed in placentas from female embryos of
LepRloxTB dams (Fig. 6A–6D). In contrast, only Insl3
expression was augmented in normal placentas from
male embryos of obese dams (P = 0.02, Supplemental
Table 1).
Because Lep levels are increased in the obese mice
(26), and placental Lepr is not altered, we assessed the
expression of Lep-associated downstream signaling
molecules in the placentas of male and female embryos.
We found an increase in the expression of Stat3 and
Foxo1 (P , 0.05) and a trend to increase in Socs3 (P =
0.08) only in placentas from female embryos. No dif-
ference was detected in placentas from male embryos.
Glucose transporter 1 (Slc2a1) and lipid transporters
(Cd36 and Cpt1b) were decreased (P , 0.05) in
resorbed and nonresorbed placentas of embryos from
obese LepRloxTB mice. No difference in glucose
transporter 3 (Slc2a3) was observed (Supplemental
Table 1).
Pregnancy outcome in mice fed an HFD
To assess if the findings in LepRloxTB mice are re-
capitulated in mice on an obesogenic diet, two cohorts of
females fed an HFD were evaluated. The first cohort
consisted of Leprdb/+ mice fed an HFD (42%, n = 7) for
12 weeks, and the second cohort consisted of wild-type
mice fed an HFD (60%, n = 7) for 16 weeks.
In the first cohort, the Leprdb/+ mice were used to assess
the potential effect of a lack of one Lepr allele in an
obesogenic environment. Only a small, nonsignificant
weight gain (29.61 6 1.03 g in Leprdb/+ vs 27.27 6 1.2 g
in control mice fed RD, n = 6 to 7, P = 0.17) and no change
in glucose levels (168.4 6 6.7 mg/dL in Leprdb/+ vs
170.5 6 8.8 mg/dL in control mice fed a RD, n = 6 to 7,
P = 0.85) were observed. The percentage of resorptions
https://academic.oup.com/endo 1727
was not different between groups (16.2 6 8.8% in Leprdb/+
vs 10.9 6 6.3% in control mice, n = 6 to 7, P = 0.65).
A second cohort consisting of wild-type (C57BL/6J)
mice fed an HFD (60% fat) for 16 weeks was analyzed. In
this cohort, an increase in body weight (28.7 6 0.28 g
in HFD mice vs 20.3 6 1.12 g in control mice fed a RD,
n = 7/group, P , 0.01) but no difference in blood glucose
levels (184.7 6 6.4 mg/dL in HFD mice vs 181 6 3.7 mg/dL
in control mice, n = 7/group, P = 0.63) was observed. All
control wild-type mice on a RD were fertile, and latency
Downloaded from https://academic.oup.com/endo/article-abstract/159/4/1718/4847828 by guest on 19 February 2020
to pregnancy spanned from 2 to 4 days. Of the seven
females on 60% HFD, one did not become pregnant (no
implantations) in 2 months of the fertility trial, and one
had one dead embryo (one implantation) at the time of
euthanasia (;E18.5). In the remaining five females on an
HFD, no difference in the percentage of implantations or
resorptions was observed compared with control mice
(P = 0.52 and P = 0.68, respectively).
Placental DEG of embryos from mice on an HFD are
distinct from those of obese LepRloxTB mice on an RD
Wild-type females fed an HFD showed a mild increase
in body weight and a small impairment in pregnancy
outcome. To assess the potential differences in gene ex-
pression caused by the diet, we compared the expression
levels of genes identified in the qPCR array (2.5-fold
difference in obese LepRloxTB mice). In contrast to
findings in obese PMV-hit LepRloxTB mice, differences in
gene expression were observed in placentas from em-
bryos of both sexes. In HFD mice, we found that the DEG
were associated with cellular growth and response to
stress in female and male placentas (Plg, Ang, Ctgf, Igf1,
Igfbp1, Fgf2, Tgfb2, Serpinf1, F2, Csf3, n = 6/group;
Fig. 6, Supplemental Fig. 1, and Supplemental Table 1).
Virtually no sexual dimorphism was apparent.
Discussion
We observed poor pregnancy outcome following resto-
ration of the reproductive function in the obese LepRloxTB
mice. The obese mice had increased latency to pregnancy
and a high percentage of embryonic resorptions per litter.
These effects are not a result of the lack of one copy of the
Lepr gene in the placentas, as roughly equal numbers of
wild-type and heterozygous resorptions were observed in
the Leprdb/+ litter. The histological analyses revealed
necrosis in the labyrinth (the site of maternal fetal ex-
change) and inflammatory infiltrate centered on blood
vessels. The differences in gene expression between
resorbed or normal placentas from obese mice and
normal placentas from wild-type mice also support a
mechanism of defective angiogenesis and inflammation.
Notably, placentas from mice on an HFD showed a
1728 Mahany et al Obesity, High-Fat Diet, and Pregnancy Outcome Endocrinology, April 2018, 159(4):1718–1733

Downloaded from https://academic.oup.com/endo/article-abstract/159/4/1718/4847828 by guest on 19 February 2020

Figure 6. Gene-expression analysis of placentas from obese LepRloxTB and from mice on an HFD at midgestation. (A–H) Bar graphs showing
relative expression of genes associated with (A and E) angiogenesis, (B and F) inflammation, (C and G) cellular growth, and (D and G) response to
stress (A–D) in placentas from female embryos of obese LepRloxTB mice and (E–H) in placentas from male and female embryos of mice fed
an HFD. Unpaired two-tailed Student t test for comparisons between two groups. *P , 0.05; **P , 0.01; ***P , 0.001; ****P , 0.0001;
#
P , 0.1 (trend).

distinct set of DEG associated with cellular growth and
response to stress (Fig. 7), suggesting that an HFD may
alter the genetic program in placental function in-
dependent of obesity.
Pregnancy is a physiological condition of high energy
demands. Endocrine and metabolic adaptations develop
throughout the different phases of pregnancy to ensure
adequate nutrition of mother and offspring. An increase
in white adipose tissue mass, changes in adipokine pro-
duction and secretion, development of mild insulin re-
sistance, and virtually no change in lean mass are
expected in women of normal body mass index and
doi: 10.1210/en.2017-03053 https://academic.oup.com/endo 1729

Downloaded from https://academic.oup.com/endo/article-abstract/159/4/1718/4847828 by guest on 19 February 2020

Figure 7. Schematic illustration of genes altered in nonresorbed placentas of embryos from obese LepRloxTB (PMV-hit) and wild-type mice fed an
HFD. Ang, angiogenin; Angpt2, angiopoietin 2; Bai1, brain-specific angiogenesis inhibitor 1; Bhlhe40, basic helix-loop-helix family member E40;
CD36, cluster of differentiation 36; Cpt1b, carnitine palmitoyltransferase 1b; Crh, corticotropin-releasing hormone; Csf3, colony-stimulating factor
3; Ctgf, connective tissue growth factor; Edn1, endothelin 1; Egf, epidermal growth factor; F2, coagulation factor 2; Fgf2, fibroblast growth
factor 2; Flt1, fms-related tyrosine kinase 1 (VegfR1); Foxo1, forkhead box o1; Hif1a, hypoxia-inducible factor 1 a subunit; Igf1, insulinlike
growth factor 1; Igfbp1, insulinlike growth factor–binding protein 1; Nfkbia, NF k B inhibitor alpha; Plg, plasminogen; Serpinf1, serpin family F
member 1; Slc2a1, glucose transporter 1 (Glut1); Shpk1, sphingosine kinase 1; Stat3, signal transducer and activator of transcription 3; Tgfb2,
transforming growth factor b 2; Timp2, tissue inhibitor of metalloproteinases; Tlr3, Toll-like receptor 3; Tlr4, Toll-like receptor 4; Vegfa, vascular
endothelial growth factor a.

uncomplicated pregnancies (37, 38). In obese women,
however, pregnancy starts in a very different metabolic
state; i.e., increased adipose tissue mass associated with
low-grade inflammation, hyperleptinemia, and increased
insulin resistance (1, 18, 39–41). The deleterious con-
sequences of obesity in pregnancy are well described by
different groups using epidemiological approaches in
large population studies (3, 4, 7, 11, 42–44). Whereas the
outcome is well known, the causes and associated
mechanisms are poorly defined.
Rodents are relevant preclinical models for trans-
lational research in women’s health because of the
physiological similarities during pregnancy. Placentation
in both humans and rodents is defined as hemochorial,
which means that maternal blood comes in direct contact
with the fetal chorion (45, 46). Other examples of sim-
ilarities are the analogous function of the labyrinth layer
of mice and the chorionic villi of human placentas, as well
as the effects of hypoxia on placental development in both
species (45, 47, 48). Moreover, a substantial advance-
ment in the understanding of the genetic control of
placental development has been achieved using targeted
mutations in mice (45). Although differences should be
noted, short generation times, large litter size, and recent
development of mouse genetics and related molecular
tools are all advantages of use of the mouse as a pre-
clinical model (49).
The LepRloxTB mouse is a model of monogenic mu-
tation causing obesity and infertility (26, 31, 35). In
previous and present studies, we showed that re-
expression of endogenous Lepr in the PMV of LepR-
null mice improved the fertility but had no effect on
metabolism; mice were still morbidly obese (33). Females
were able to conceive but showed high rates of re-
sorptions. The lack of Lep signaling in trophoblast or
placental tissue is unlikely to cause this phenotype, as the
placentas express one copy of functional Lepr gene and
are responsive to Lep. Whether the placental dysfunction
and resorptions were caused by a gene dosage effect was
further tested in the Leprdb/+ mice. As there was a similar
frequency of resorptions between wild-type and Leprdb/+
embryos and also, given that Mendelian ratios of off-
spring were seen in all litters when crossbreeding the
heterozygous LepRloxTB/+ mice, the lack of one copy of
Lepr gene in the placentas is not the cause of pregnancy
loss. Our findings are also in agreement with previous
1730 Mahany et al Obesity, High-Fat Diet, and Pregnancy Outcome
studies showing that Lep signaling is required for fertility
but is not necessary for pregnancy progression in mice
(50, 51). However, Lep does exert a regulatory role in
placental perfusion and nutrient transport in both mice
and humans (52–55). In this regard, it is important to
mention that obese LepRloxTB fertile mice are still di-
abetic and show decreased expression of placental
glucose and lipid transporters. Further studies are
necessary to assess the contribution of these factors to
the pregnancy outcome. Moreover, as the obese Lep-
RloxTB mice are hyperleptinemic (26), excess Lep sig-
naling may be associated with the placental dysfunction.
In fact, a growing body of literature has demonstrated
that Lep levels are increased in preeclamptic pregnan-
cies (56–59). Dysregulation of genes associated with
preeclampsia in humans (e.g., Vegfa, Hif1a, Bhlhe40,
Pecam1, Flt1, Il6, Il1b) (60–65) was also observed in
placentas from obese LepRloxTB mice. However, Lep
signaling-deficient mice, albeit obese, are normotensive
(66). Whether expression of one copy of Lepr in pla-
centas is sufficient to trigger preeclamptic responses
requires further investigation.
In contrast to our genetic model of obesity, mice on an
HFD showed disruption of a different set of placental
genes compared with obesity alone. This is particularly
relevant for a translational perspective, as most of the
studies using animal models of obesity rely on obesogenic
diets (16, 67). As female rodents are usually resistant to
an HFD as a result of the protective effects of estradiol
(68), a diet high in fat and sometimes in sugar content is
commonly used as an experimental approach to induce
obesity (67, 69). However, the toxicity of this artificial
manipulation is not always clear. Our findings argue in
favor of dissociated effects between high adiposity and
the consumption of a diet high in fat content. In obese
LepRloxTB female mice, high resorption rates were as-
sociated with defective angiogenesis and inflammation
observed in histological analyses and changes in placental
transcriptome (e.g., Vegfa, Flt1, Tlr3, Tlr4). On the other
hand, mice fed an HFD (mildly overweight compared
with the LepRloxTB line) had small resorption rates at
midgestation but showed changes in genes associated
with cellular growth and response to stress (e.g., Igf1,
Igfbp, Fgf2, Edn1).
The use of genetic rodent models of obesity on
RD has become an important experimental strategy
to dissociate the effects of adiposity/low-grade in-
flammation from an HFD. For example, loss-of-
function mutation of the melanocortin 4 receptor
(Mc4r/MC4R) gene causes obesity in rodents and
humans (70–72). The MC4R+/2 rats were overweight
(;7.5% above control) but had a very small number of
resorptions (73). The LepRloxTB mice, however, were
Endocrinology, April 2018, 159(4):1718–1733
morbidly obese (twice the weight of control mice at-
tributed to an increase in fat mass) (26) and showed
;40% of embryo resorptions per litter. In addition,
approximately one-half of the obese females had no
successful pregnancies during the fertility testing.
These mice were significantly more obese and hyper-
glycemic than the fertile LepRloxTB mice, suggesting
that the differences in metabolic conditions may have
an important impact on the infertility phenotype.
Together, our findings and those from other labora-
Downloaded from https://academic.oup.com/endo/article-abstract/159/4/1718/4847828 by guest on 19 February 2020
tories (73) suggest that pregnancy loss is correlated
with the degree of adiposity in rodents. The LepRloxTB
mouse may open opportunities for understanding
the idiopathic infertility observed in morbidly obese
women.
One of the strengths of our study is the effects of
obesity on placental morphology. Scant data on the
histopathological changes of unsuccessful pregnancies
are currently available in the scientific literature. Al-
though some degree of necrosis is expected at term, the
embryonic resorptions in our study had massive necrosis
of the labyrinth at midgestation, likely causing utero-
placental insufficiency and acute death of the embryos.
The expression of genes associated with vascular growth
and remodeling was also dysregulated, reinforcing the
histological findings. Of those, the homologs of Vegfa,
Flt1, Hif1a, and Bhlhe40 genes have been associated with
preeclampsia and recurrent pregnancy loss in humans
(61, 62, 74–77). Similar data have also been described for
Nfkbia, Tlr3, and Tlr4 genes associated with in-
flammation (78–81). Notably, when resorbed and non-
resorbed placentas from obese mice were evaluated,
opposite changes (i.e., decreased and increased expres-
sion, respectively) were observed. Further studies will be
necessary to inform the significance of these findings, but
these apparently opposing effects are suggestive of a
compensatory or adaptive process in the face of lip-
otoxicity (43). This is in line with findings showing that
female physiology and placental tissue undergo various
adaptations and compensatory responses before a poor
pregnancy outcome ensues (17, 43).
The effects of obesity on poor pregnancy outcome
have been described in a series of epidemiological
studies, with an important impact for populations
worldwide. However, the causative players, as well as
the development of intervention strategies, have been
difficult to determine as a result of lack of experi-
mental models and tools. Our findings indicate that
the degree of obesity disrupts the ability of the pla-
centa to overcome the metabolic insults—ultimately
leading to defective angiogenesis, tissue necrosis, and
fetal death. This mouse model highlights the striking
similarities of obesity-induced placental dysfunction
doi: 10.1210/en.2017-03053
between rodents and humans. It also emphasizes the
necessity of a clear dissociation between the effects of
high adiposity and excess calorie or fat consumption
for pregnancy outcome.
Acknowledgments
We thank Drs. Vasantha Padmanabhan and Kartik Shankar for
insightful discussions and Drs. Yolanda Smith and Sandeep
Kalantry for critical comments on the manuscript. We also thank
Sarah Block for editing the manuscript.
Financial Support: This work was supported by the Re-
productive Endocrinology and Infertility fellowship (to E.B.M.),
US National Institutes of Health Grant R01-HD-069702 (to
C.F.E.), pilot grants from the Reproductive Sciences Program
(to C.F.E.), and the Michigan Diabetes Research Center (Grant
P30DK020572 from National Institute of Diabetes and Di-
gestive and Kidney Diseases, University of Michigan, to C.F.E.).
Fellowships were supported by the National Council for Sci-
entific and Technological Development (to B.C.B.) and the S~ ao
Paulo Research Foundation (to S.d.S.C.-M.).
Correspondence: Erica B. Mahany, MD, Department of
Obstetrics and Gynecology, University of Michigan, 1500 E.
Medical Center Drive, Ann Arbor, Michigan 48109. E-mail:
emahany@med.umich.edu.
Disclosure Summary: The funding agencies played no role
in the study design; collection, analysis, and interpretation of
data; writing of the report; or decision to submit the article for
publication. The authors have declared that no conflict of
interest exists.
References
1. Kopelman PG. Obesity as a medical problem. Nature. 2000;
404(6778):635–643.
2. Flegal KM, Carroll MD, Ogden CL, Curtin LR. Prevalence and
trends in obesity among US adults, 1999–2008. JAMA. 2010;
303(3):235–241.
3. Salihu HM. Maternal obesity and stillbirth. Semin Perinatol. 2011;
35(6):340–344.
4. Racusin D, Stevens B, Campbell G, Aagaard KM. Obesity and the
risk and detection of fetal malformations. Semin Perinatol. 2012;
36(3):213–221.
5. Aune D, Saugstad OD, Henriksen T, Tonstad S. Maternal body
mass index and the risk of fetal death, stillbirth, and infant death:
a systematic review and meta-analysis. JAMA. 2014;311(15):
1536–1546.
6. Persson M, Cnattingius S, Villamor E, Söderling J, Pasternak B,
Stephansson O, Neovius M. Risk of major congenital malforma-
tions in relation to maternal overweight and obesity severity: cohort
study of 1.2 million singletons. BMJ. 2017;357:j2563.
7. Rankin J, Tennant PW, Stothard KJ, Bythell M, Summerbell CD,
Bell R. Maternal body mass index and congenital anomaly risk:
a cohort study [published corrigendum appears in Int J Obes. 2010;
34:1449]. Int J Obes. 2010;34(9):1371–1380.
8. Higgins L, Greenwood SL, Wareing M, Sibley CP, Mills TA.
Obesity and the placenta: a consideration of nutrient exchange
mechanisms in relation to aberrant fetal growth. Placenta. 2011;
32(1):1–7.
9. Hotamisligil GS. Inflammation and metabolic disorders. Nature.
2006;444(7121):860–867.
https://academic.oup.com/endo 1731
10. Challier JC, Basu S, Bintein T, Minium J, Hotmire K, Catalano PM,
Hauguel-de Mouzon S. Obesity in pregnancy stimulates macro-
phage accumulation and inflammation in the placenta. Placenta.
2008;29(3):274–281.
11. Aye IL, Lager S, Ramirez VI, Gaccioli F, Dudley DJ, Jansson T,
Powell TL. Increasing maternal body mass index is associated with
systemic inflammation in the mother and the activation of distinct
placental inflammatory pathways. Biol Reprod. 2014;90(6):129.
12. Peraçoli JC, Rudge MV, Peraçoli MT. Tumor necrosis factor-alpha
in gestation and puerperium of women with gestational hyper-
tension and pre-eclampsia. Am J Reprod Immunol. 2007;57(3):
177–185.
Downloaded from https://academic.oup.com/endo/article-abstract/159/4/1718/4847828 by guest on 19 February 2020
13. Galic S, Oakhill JS, Steinberg GR. Adipose tissue as an endocrine
organ. Mol Cell Endocrinol. 2010;316(2):129–139.
14. Könner AC, Brüning JC. Toll-like receptors: linking inflammation
to metabolism. Trends Endocrinol Metab. 2011;22(1):16–23.
15. van der Burg JW, Allred EN, McElrath TF, Fichorova RN, Kuban
K, O’Shea TM, Dammann O, Leviton A. Is maternal obesity as-
sociated with sustained inflammation in extremely low gestational
age newborns? Early Hum Dev. 2013;89(12):949–955.
16. Frias AE, Morgan TK, Evans AE, Rasanen J, Oh KY, Thornburg
KL, Grove KL. Maternal high-fat diet disturbs uteroplacental he-
modynamics and increases the frequency of stillbirth in a non-
human primate model of excess nutrition. Endocrinology. 2011:
152(6):2456–2464.
17. Carr DJ, David AL, Aitken RP, Milne JS, Borowicz PP, Wallace JM,
Redmer DA. Placental vascularity and markers of angiogenesis in
relation to prenatal growth status in overnourished adolescent
ewes. Placenta. 2016;46:79–86.
18. Doshani A, Konje JC. Review: diabetes in pregnancy: insulin re-
sistance, obesity and placental dysfunction. Br J Diabetes Vasc Dis.
2009;9(5):208–212.
19. Kebede MA, Attie AD. Insights into obesity and diabetes at the
intersection of mouse and human genetics. Trends Endocrinol
Metab. 2014;25(10):493–501.
20. Moley KH. Hyperglycemia and apoptosis: mechanisms for con-
genital malformations and pregnancy loss in diabetic women.
Trends Endocrinol Metab. 2001;12(2):78–82.
21. Temple R, Aldridge V, Greenwood R, Heyburn P, Sampson M,
Stanley K. Association between outcome of pregnancy and gly-
caemic control in early pregnancy in type 1 diabetes: population
based study. BMJ. 2002;325(7375):1275–1276.
22. Dunne F, Brydon P, Smith K, Gee H. Pregnancy in women with type
2 diabetes: 12 years outcome data 1990-2002. Diabet Med. 2003;
20(9):734–738.
23. Arany E, Hill DJ. Fibroblast growth factor-2 and fibroblast growth
factor receptor-1 mRNA expression and peptide localization in
placentae from normal and diabetic pregnancies. Placenta. 1998;
19(2–3):133–142.
24. Jirkovská M, Kubı́nová L, Janácek J, Moravcová M, Krejcı́ V,
Karen P. Topological properties and spatial organization of villous
capillaries in normal and diabetic placentas. J Vasc Res. 2002;
39(3):268–278.
25. Barbour LA. Unresolved controversies in gestational diabetes:
implications on maternal and infant health. Curr Opin Endocrinol
Diabetes Obes. 2014;21(4):264–270.
26. Berglund ED, Vianna CR, Donato J Jr, Kim MH, Chuang JC, Lee
CE, Lauzon DA, Lin P, Brule LJ, Scott MM, Coppari R, Elmquist
JK. Direct leptin action on POMC neurons regulates glucose ho-
meostasis and hepatic insulin sensitivity in mice. J Clin Invest. 2012;
122(3):1000–1009.
27. Borges BC, Garcia-Galiano D, da Silveira Cruz-Machado S, Han X,
Gavrilina GB, Saunders TL, Auchus RJ, Hammoud SS, Smith GD,
Elias CF. Obesity-induced infertility in male mice is associated with
disruption of Crisp4 expression and sperm fertilization capacity.
Endocrinology. 2017;158(9):2930–2943.
28. Fianco G, Mongiardi MP, Levi A, De Luca T, Desideri M, Tris-
ciuoglio D, Del Bufalo D, Cinà I, Di Benedetto A, Mottolese M,
1732 Mahany et al Obesity, High-Fat Diet, and Pregnancy Outcome
Gentile A, Centonze D, Ferrè F, Barilà D. Caspase-8 contributes to
angiogenesis and chemotherapy resistance in glioblastoma. eLife.
2017;6:e22593.
29. Yuan D, Huang S, Berger E, Liu L, Gross N, Heinzmann F,
Ringelhan M, Connor TO, Stadler M, Meister M, Weber J, Öllinger
R, Simonavicius N, Reisinger F, Hartmann D, Meyer R, Reich
M, Seehawer M, Leone V, Höchst B, Wohlleber D, Jörs S, Prinz
M, Spalding D, Protzer U, Luedde T, Terracciano L, Matter M,
Longerich T, Knolle P, Ried T, Keitel V, Geisler F, Unger K,
Cinnamon E, Pikarsky E, Hüser N, Davis RJ, Tschaharganeh DF,
Rad R, Weber A, Zender L, Haller D, Heikenwalder M. Kupffer cell-
derived Tnf triggers cholangiocellular tumorigenesis through JNK
due to chronic mitochondrial dysfunction and ROS. Cancer Cell.
2017;31(6):771–789.e6.
30. Torsoni MA, Borges BC, Cote JL, Allen SJ, Mahany E, Garcia-
Galiano D, Elias CF. AMPKa2 in Kiss1 neurons is required for
reproductive adaptations to acute metabolic challenges in adult
female mice. Endocrinology. 2016;157(12):4803–4816.
31. Cravo RM, Frazao R, Perello M, Osborne-Lawrence S, Williams
KW, Zigman JM, Vianna C, Elias CF. Leptin signaling in Kiss1
neurons arises after pubertal development. PLoS One. 2013;8(3):
e58698.
32. Scott MM, Lachey JL, Sternson SM, Lee CE, Elias CF, Friedman
JM, Elmquist JK. Leptin targets in the mouse brain. J Comp Neurol.
2009;514(5):518–532.
33. Donato J Jr, Cravo RM, Fraz~ ao R, Gautron L, Scott MM, Lachey J,
Castro IA, Margatho LO, Lee S, Lee C, Richardson JA, Friedman J,
Chua S Jr, Coppari R, Zigman JM, Elmquist JK, Elias CF. Leptin’s
effect on puberty in mice is relayed by the ventral premammillary
nucleus and does not require signaling in Kiss1 neurons. J Clin
Invest. 2011;121(1):355–368.
34. McMinn JE, Liu SM, Dragatsis I, Dietrich P, Ludwig T, Eiden S,
Chua SC Jr. An allelic series for the leptin receptor gene generated by
CRE and FLP recombinase. Mamm Genome. 2004;15(9):677–685.
35. Allen SJ, Garcia-Galiano D, Borges BC, Burger LL, Boehm U, Elias
CF. Leptin receptor null mice with reexpression of LepR in GnRHR
expressing cells display elevated FSH levels but remain in a pre-
pubertal state. Am J Physiol Regul Integr Comp Physiol. 2016:
310(11):R1258–R1266.
36. Zhou Y, Fisher SJ, Janatpour M, Genbacev O, Dejana E, Wheelock
M, Damsky CH. Human cytotrophoblasts adopt a vascular phe-
notype as they differentiate. A strategy for successful endovascular
invasion? J Clin Invest. 1997;99(9):2139–2151.
37. Larciprete G, Valensise H, Vasapollo B, Altomare F, Sorge R,
Casalino B, De Lorenzo A, Arduini D. Body composition during
normal pregnancy: reference ranges. Acta Diabetol. 2003; 40(Suppl 1):
S225–S232.
38. Mouzon SH, Lassance L. Endocrine and metabolic adaptations to
pregnancy; impact of obesity. Horm Mol Biol Clin Investig. 2015;
24(1):65–72.
39. Ryan D. Obesity in women: a life cycle of medical risk. Int J Obes.
2007;31::S3–S7.
40. Ziemke F, Mantzoros CS. Adiponectin in insulin resistance: lessons
from translational research. Am J Clin Nutr. 2010;91(1):
258S–261S.
41. Huda SS, Brodie LE, Sattar N. Obesity in pregnancy: prevalence
and metabolic consequences. Semin Fetal Neonatal Med. 2010;
15(2):70–76.
42. Chavatte-Palmer P, Tarrade A, Rousseau-Ralliard D. Diet before
and during pregnancy and offspring health: the importance of
animal models and what can be learned from them. Int J Environ
Res Public Health. 2016;13(6):586.
43. Saben J, Lindsey F, Zhong Y, Thakali K, Badger TM, Andres A,
Gomez-Acevedo H, Shankar K. Maternal obesity is associated with a
lipotoxic placental environment. Placenta. 2014;35(3):171–177.
44. Cnattingius S, Villamor E, Johansson S, Edstedt Bonamy AK,
Persson M, Wikström AK, Granath F. Maternal obesity and risk of
preterm delivery. JAMA. 2013;309(22):2362–2370.
Endocrinology, April 2018, 159(4):1718–1733
45. Rossant J, Cross JC. Placental development: lessons from mouse
mutants. Nat Rev Genet. 2001;2(7):538–548.
46. Knott JG, Paul S. Transcriptional regulators of the trophoblast
lineage in mammals with hemochorial placentation. Reproduction.
2014;148(6):R121–R136.
47. Genbacev O, Zhou Y, Ludlow JW, Fisher SJ. Regulation of human
placental development by oxygen tension. Science. 1997;
277(5332):1669–1672.
48. Maltepe E, Simon MC. Oxygen, genes, and development: an
analysis of the role of hypoxic gene regulation during murine
vascular development. J Mol Med (Berl). 1998;76(6):391–401.
49. Carter AM. Animal models of human placentation–a review.
Downloaded from https://academic.oup.com/endo/article-abstract/159/4/1718/4847828 by guest on 19 February 2020
Placenta. 2007;28(Suppl):S41–S47.
50. Chehab FF, Lim ME, Lu R. Correction of the sterility defect in
homozygous obese female mice by treatment with the human
recombinant leptin. Nat Genet. 1996;12(3):318–320.
51. Mounzih K, Qiu J, Ewart-Toland A, Chehab FF. Leptin is not
necessary for gestation and parturition but regulates maternal
nutrition via a leptin resistance state. Endocrinology. 1998;
139(12):5259–5262.
52. Jansson N, Greenwood SL, Johansson BR, Powell TL, Jansson T.
Leptin stimulates the activity of the system A amino acid transporter
in human placental villous fragments. J Clin Endocrinol Metab.
2003;88(3):1205–1211.
53. Henson MC, Castracane VD. Leptin in pregnancy: an update. Biol
Reprod. 2006;74(2):218–229.
54. Jones HN, Woollett LA, Barbour N, Prasad PD, Powell TL, Jansson
T. High-fat diet before and during pregnancy causes marked up-
regulation of placental nutrient transport and fetal overgrowth in
C57/BL6 mice. FASEB J. 2009;23(1):271–278.
55. Farley DM, Choi J, Dudley DJ, Li C, Jenkins SL, Myatt L,
Nathanielsz PW. Placental amino acid transport and placental
leptin resistance in pregnancies complicated by maternal obesity.
Placenta. 2010;31(8):718–724.
56. McCarthy JF, Misra DN, Roberts JM. Maternal plasma leptin is
increased in preeclampsia and positively correlates with fetal cord
concentration. Am J Obstet Gynecol. 1999;180(3):731–736.
57. Hauguel-de Mouzon S, Lepercq J, Catalano P. The known and
unknown of leptin in pregnancy. Am J Obstet Gynecol. 2006;
194(6):1537–1545.
58. Tessier DR, Ferraro ZM, Gruslin A. Role of leptin in pregnancy:
consequences of maternal obesity. Placenta. 2013;34(3):205–211.
59. Spradley FT, Palei AC, Granger JP. Increased risk for the devel-
opment of preeclampsia in obese pregnancies: weighing in on the
mechanisms. Am J Physiol Regul Integr Comp Physiol. 2015;
309(11):R1326–R1343.
60. Kristensen J, Vestergaard M, Wisborg K, Kesmodel U, Secher NJ.
Pre-pregnancy weight and the risk of stillbirth and neonatal death.
BJOG. 2005;112(4):403–408.
61. Pereza N, Ostojic S, Kapovic M, Peterlin B. Systematic review
and meta-analysis of genetic association studies in idiopathic
recurrent spontaneous abortion. Fertil Steril. 2017;107(1):
150–159.e2.
62. Xu X, Du C, Li H, Du J, Yan X, Peng L, Li G, Chen ZJ. Association
of VEGF genetic polymorphisms with recurrent spontaneous
abortion risk: a systematic review and meta-analysis. PLoS One.
2015;10(4):e0123696.
63. Goksu Erol AY, Nazli M, Elis Yildiz S. Significance of platelet
endothelial cell adhesion molecule-1 (PECAM-1) and intercellular
adhesion molecule-1 (ICAM-1) expressions in preeclamptic pla-
centae. Endocrine. 2012;42(1):125–131.
64. Nakada E, Walley KR, Nakada T, Hu Y, von Dadelszen P, Boyd
JH. Toll-like receptor-3 stimulation upregulates sFLT-1 production
by trophoblast cells. Placenta. 2009;30(9):774–779.
65. Taylor BD, Tang G, Ness RB, Olsen J, Hougaard DM, Skogstrand
K, Roberts JM, Haggerty CL. Mid-pregnancy circulating immune
biomarkers in women with preeclampsia and normotensive con-
trols. Pregnancy Hypertens. 2016;6(1):72–78.
doi: 10.1210/en.2017-03053
66. Simonds SE, Pryor JT, Ravussin E, Greenway FL, Dileone R, Allen
AM, Bassi J, Elmquist JK, Keogh JM, Henning E, Myers MG Jr,
Licinio J, Brown RD, Enriori PJ, O’Rahilly S, Sternson SM, Grove
KL, Spanswick DC, Farooqi IS, Cowley MA. Leptin mediates the
increase in blood pressure associated with obesity. Cell. 2014;
159(6):1404–1416.
67. Rosario FJ, Powell TL, Jansson T. Activation of placental insulin
and mTOR signaling in a mouse model of maternal obesity as-
sociated with fetal overgrowth. Am J Physiol Regul Integr Comp
Physiol. 2016;310(1):R87–R93.
68. Shi H, Seeley RJ, Clegg DJ. Sexual differences in the control of
energy homeostasis. Front Neuroendocrinol. 2009;30(3):396–404.
69. Aye ILMH, Gao X, Weintraub ST, Jansson T, Powell TL. Adi-
ponectin inhibits insulin function in primary trophoblasts by
PPARa-mediated ceramide synthesis. Mol Endocrinol. 2014;28(4):
512–524.
70. Huszar D, Lynch CA, Fairchild-Huntress V, Dunmore JH, Fang Q,
Berkemeier LR, Gu W, Kesterson RA, Boston BA, Cone RD, Smith FJ,
Campfield LA, Burn P, Lee F. Targeted disruption of the melanocortin-
4 receptor results in obesity in mice. Cell. 1997;88(1):131–141.
71. Vaisse C, Clement K, Guy-Grand B, Froguel P. A frameshift mu-
tation in human MC4R is associated with a dominant form of
obesity. Nat Genet. 1998;20(2):113–114.
72. Yeo GS, Farooqi IS, Aminian S, Halsall DJ, Stanhope RG, O’Rahilly
S. A frameshift mutation in MC4R associated with dominantly
inherited human obesity. Nat Genet. 1998;20(2):111–112.
73. Spradley FT, Palei AC, Granger JP. Obese melanocortin-4 receptor-
deficient rats exhibit augmented angiogenic balance and vaso-
relaxation during pregnancy. Physiol Rep. 2013;1(4):e00081.
74. Salimi S, Yaghmaei M, Tabatabaei E, Mokhtari M, Naghavi A.
Vascular endothelial growth factor (VEGF)-634G/C poly-
morphism was associated with severe pre-eclampsia and lower
https://academic.oup.com/endo 1733
serum VEGF level. J Obstet Gynaecol Res. 2015;41(12):
1877–1883.
75. Galbiati S, Inversetti A, Causarano V, Stenirri S, Soriani N,
Ambrosi A, Valsecchi L, Candiani M, Cremonesi L, Ferrari M,
Smid M. HIF1A and MIF as potential predictive mRNA biomarkers
of pre-eclampsia: a longitudinal prospective study in high risk
population. Clin Chem Lab Med. 2015;53(9):1339–1347.
76. Zhao M, Zhu Z, Liu C, Zhang Z. Dual-cutoff of sFlt-1/PlGF ratio in
the stratification of preeclampsia: a systematic review and meta-
analysis. Arch Gynecol Obstet. 2017;295(5):1079–1087.
77. Kaartokallio T, Cervera A, Kyllönen A, Laivuori K, Kere J, Laivuori
H, Group FCI; FINNPEC Core Investigator Group. Corrigendum:
Downloaded from https://academic.oup.com/endo/article-abstract/159/4/1718/4847828 by guest on 19 February 2020
Gene expression profiling of pre-eclamptic placentae by RNA se-
quencing. Sci Rep. 2016;6(1):17245.
78. Simsek Y, Gul M, Celik O, Aydin NE, Arda Düz S, Celik E, Ozerol
E, Özerol IH, Tanbek K. Nuclear transcription factor-kappa beta-
dependent ultrastructural alterations within the placenta and sys-
temic inflammatory activation in pregnant patients with hemolysis,
elevated liver functions and low thrombocyte count (HELLP)
syndrome: a case-control study. Hypertens Pregnancy. 2013;32(3):
281–291.
79. Vaughan JE, Walsh SW. Activation of NF-kB in placentas of
women with preeclampsia. Hypertens Pregnancy. 2012;31(2):
243–251.
80. Chatterjee P, Weaver LE, Doersch KM, Kopriva SE, Chiasson VL,
Allen SJ, Narayanan AM, Young KJ, Jones KA, Kuehl TJ, Mitchell
BM. Placental Toll-like receptor 3 and Toll-like receptor 7/8 ac-
tivation contributes to preeclampsia in humans and mice. PLoS
One. 2012;7(7):e41884.
81. Li P, Wu HL, Dong BH. Relationship between TLR4 and CCL2
expression and recurrent spontaneous abortion. Genet Mol Res.
2016;15(1):1–8.