JOURNAL OF VIROLOGY, June 1998, p. 5262–5267 Vol. 72, No.

6
0022-538X/98/$04.0010
Copyright © 1998, American Society for Microbiology

Nucleotide Sequence of Porcine Circovirus Associated with

Postweaning Multisystemic Wasting Syndrome in Pigs
ANDRE L. HAMEL, LIHUA L. LIN, AND GOPI P. S. NAYAR*
Virology Laboratory, Manitoba Agriculture, Veterinary Services,
Winnipeg, Manitoba R3T 5S6, Canada
Received 27 October 1997/Accepted 12 February 1998

This article describes the nucleotide sequence of a porcine circovirus (PCV) which possesses a high degree
of association with postweaning multisystemic wasting syndrome (PMWS), a newly described disease of young
pigs. The DNA sequence of this PMWS-associated PCV (pmws PCV) has 68% homology with that of a previous-
ly published nonpathogenic strain of PCV. The strains appear to be closely related yet distinct from one another.

A variety of circoviruses have been identified in a range of
animal species (porcine circovirus [PCV] [23], psittacine beak
and feather disease virus [21], and chicken anemia virus [25])
and plant species (subterranean clover stunt virus [SCSV] [4],
coconut foliar decay virus [CFDV] [22], and banana bunch top
virus [BBTV] [12]). Even though all circoviruses have circular
single-stranded DNA genomes and small isometric virions, there
are very limited similarities among them. The animal circovi-
ruses have insignificant similarity at the nucleotide sequence or
protein level with one another and with the plant circoviruses
(1, 26, 27). On the other hand, the plant circoviruses have
limited similarity with one another at the nucleotide sequence
and protein levels (3, 12). Prior to the present study, the only
reported nucleotide sequence of porcine circovirus has been
for the nonpathogenic (np PCV) strain, which is commonly
associated with cultured porcine kidney (PK-15) cells (17). The
np PCV was found to have limited protein similarity with only
some plant circoviruses (BBTV, CFDV, and SCSV), whereas it
has insignificant nucleic acid sequence and protein homology
with animal circoviruses (psittacine beak and feather disease
virus and chicken anemia virus) (17).
Postweaning multisystemic wasting syndrome (PMWS) is a
recently recognized disease of young pigs. Typical clinical signs
of PMWS include progressive wasting, dyspnea, tachypnea,
occasionally, icterus and, in rare cases, jaundice (5, 11). Post-
mortem examinations reveal a wide range of lesions; the most
common include interstitial pneumonia, lymphadenopathy, and
occasionally nephritis and hepatitis (5, 11). Two earlier studies
reported that a circovirus appears to be common in swine
populations, based upon the prevalence of circovirus antibod-
ies (7, 14). Microscopic examination of hematoxylin-and-eosin-
stained tissue sections reveals that PMWS distinctively exhibits
intensely basophilic staining inclusion bodies mostly in lymph
nodes, tonsils, and Peyer’s patches of the ileum (11). A more
recent study on PMWS-affected animals demonstrated the
presence of a circovirus by electron microscopy, virus isolation
by cell culture, in situ hybridization with a cloned PCV plasmid
probe, and immunohistochemical staining with porcine and
rabbit immune serum (8). However, in those studies a PCV
was used that was derived from persistently infected porcine
kidney (PK-15) cell lines (ATCC CCL-33) and was nonpatho-
genic for experimentally infected pigs (24). In previous work in
* Corresponding author. Mailing address: Virology Laboratory,
Manitoba Agriculture, Veterinary Services, 545 University Crescent,
Winnipeg, Manitoba, Canada R3T 5S6. Phone: (204) 945-7643. Fax:
(204) 945-8062. E-mail: gnayar@gov.mb.ca.
our laboratory (18), it was reported that PCR was used to de-
tect a characteristic PCV associated with PMWS, pmws PCV.
Pigs affected by the disease were always found to contain pmws
PCV but not np PCV. The oligonucleotide primers used in that
PCR assay were designed from the nucleotide sequence of an
np PCV. The pmws PCV and np PCV amplification products
were readily distinguishable from one another by restriction
endonuclease fragment length polymorphism (RFLP). The
amplification products obtained from all PCR-positive clinical
tissue specimens exhibited RFLP profiles which were unique
for pmws PCV and quite distinct from that of np PCV (18).
The nucleotide sequences of np PCV, derived from persis-
tently infected PK-15 cell lines, were previously reported by
two groups of researchers, one based in Ireland (GenBank ac-
cession no. U49186 [17]) and the other in Germany (GenBank
accession no. Y09921 [16]). These sequences have small (1,759-
nucleotide [nt]) circular, single-stranded DNA genomes and
over 99% nucleotide sequence homology. We compared the np
PCV genome described by the Irish group with pmws PCV.
DNA was extracted from the lungs, lymph nodes, spleens,
and tonsils of 100 pigs with PMWS from field cases which were
submitted to our facility from several provinces across Canada
(most were from Manitoba, but some were from Alberta, On-
tario, Prince Edward Island, and Saskatchewan) by methods
described elsewhere (10, 10a, 18). We screened DNA samples
from these pig tissues by a PCR assay for pmws PCV described
elsewhere (10a, 18). Amplification products from all 100 PMWS
pigs were analyzed by RFLP. We observed that all PCR pos-
itives exhibited RFLP profiles that were unique to pmws PCV
yet not identical to one another (10a). We randomly chose to
use the tissues from a single PMWS case for PCR and DNA
sequencing. Another laboratory (Western College of Veteri-
nary Medicine, Saskatoon, Saskatchewan, Canada) confirmed
evidence for PMWS and the presence of PCV in tissues from
this random sample by immunohistochemical staining with por-
cine and rabbit immune serum (see reference 8 for the details
about methods).
Sixteen primers suitable for PCR were selected from a pub-
lished np PCV sequence (GenBank accession no. U49186 [17])
with the Primer computer program (15). All of the appropriate
primers were selected for use in several separate PCRs which
would yield several fragments overlapping, overall covering the
entire pmws PCV genome (based upon the assumption that
the pmws PCV genome should at least be similar to that of the
np PCV genome). The sequences of these fragments (59 to 39)
were as follows: 1F (nt 24 to 43), GCACCTCGGCAGCGTC
AGTG; 2F (nt 378 to 399), GGAAGCGCAGCGACCTGTC

5262
VOL. 72, 1998 NOTES 5263

FIG. 1. Map depicting the eight overlapping fragments of pmws PCV genomic DNA that were PCR amplified and sequenced in this study. The scale at the top
represents nucleotide position numbers derived from a published np PCV sequence (17). This is a circular genome; therefore, nucleotide position 1759 abuts nucleotide
position 1. Arrows denote location and orientation of primers that were used for PCR and sequencing. The eight overlapping horizontal lines below the graduated scale
represent the eight portions of pmws PCV genomic DNA that were PCR amplified and sequenced. The dashed line in the 8F/15R PCR product indicates where legible
sequence ended because it was too far from either primer. The nucleotide sequences from all eight PCR products result in an accumulated total of 6,480 nt. After all
of the sequences were aligned, we observed that approximately 1,450 nt were sequenced at least three times and that 320 nt were sequenced twice.

TAC; 3F (nt 426 to 451), GGTCTTTGGTGACTGTAGCCG
AGCAG; 4F (nt 888 to 914), GGAAGACTGCTGGAGAAC
AATCCACGG; 5F (nt 904 to 927), ACAATCCACGGAGG
TACCCGAAGG; 6F (nt 947 to 972), CCACCCTGTGCCCT
TTTCCCATATAA; 7F (nt 1231 to 1253), TGGGGGTGAA
GTACCTGGAGTGG; 8F (nt 1682 to 1704), GCGGGTCCT
TCTTCTGCGGTAAC; 9R (nt 43 to 24), CACTGACGCTG
CCGAGGTGC; 10R (nt 399 to 378), GTAGACAGGTCGC
TGCGCTTCC; 11R (nt 451 to 426), CTGCTCGGCTACAG
TCACCAAAGACC; 12R (nt 914 to 888), CCGTGGATTGT
TCTCCAGCAGTCTTCC; 13R (nt 927 to 904), CCTTCGGG
TACCTCCGTGGATTGT; 14R (nt 972 to 947), TTATATG
GGAAAAGGGCACAGGGTGG; 15R (nt 1253 to 1231),
CCACTCCAGGTACTTCACCCCCA; and 16R (nt 1704 to
1682), GTTACCGCAGAAGAAGGACCCGC.
The PCR was performed as described elsewhere (10) except
that Taq DNA polymerase was the only enzyme used in the
reactions. After thermocycling was complete, PCR products
were analyzed by gel electrophoresis as previously described
(10). A PCR-positive sample was randomly chosen for DNA
sequencing.
Before sequencing, 10 mg of each PCR product for pmws
PCV was purified and concentrated with Microcon-100 (Fisher
Scientific) 100,000-molecular-weight-cutoff microcentrifuge fil-
ter units according to the manufacturer’s recommendations.
Both strands of the purified PCR products were sequenced
with their corresponding PCR primers at a commercial facility
(SeqWright, Houston, Tex.) by the Applied Biosystems Prism
dye-terminator dideoxy system.
All 16 primers generated PCR amplification products of the
expected sizes from DNA of the PK-15 cell line infected with
np PCV; however, only six of these primers (4F, 7F, 8F, 9R,

TABLE 1. Comparison of ORFs in pmws PCV and np PCVa

pmws PCV np PCV
Homology
ORF Genomic DNA Protein Genomic DNA Protein
(%)
Position (nt) Strandb No. of aa kDa Glycc Position (nt) Strand No. of aa kDa Glyc

1 51–995 V 314 35.8 1 47–985 V 312 35.7 1 85

2 1735–1034 C 233 27.8 1 1723–1022 C 233 27.8 1 66
3 671–357 C 104 11.9 2 658–38 C 206 23.2 2 62
4 565–386 C 59 6.5 1 552–205 C 115 13.3 1 83
5 1016–1177 V 53 6.2 2 1163–1450 V 95 9.8 1 None
6 1611–1530 C 27 2.8 2 1518–1330 C 62 6.7 1 None
7 1682–1741 V 19 1.9 2 1670–81 V 56 6.0 2 79
8 753–688 C 21 2.3 2 740–627 C 37 4.3 2 67
9 92–1732 C 42 4.6 2 968–873 C 31 3.4 2 None
10 1524–1631 V 35 4.1 2 1642–1755 V 3.7 3.7 1 None
11 1033–989 C 14 1.8 2 648–719 V 23 2.8 2 None
a
Traits compared were genomic position and orientation of ORF (which viral nucleic acid strand the ORF encoded), predicted size of ORF-encoded protein
(number of amino acids and molecular mass), presence of potential glycosylation sites, and homology between ORFs in pmws PCV and np PCV.
b
V, virus strand; C, complementary strand.
c
Glyc, glycosylation site; 1, contains glycosylation signal (asparagine sequon N-X-S or N-X-T); 2, does not contain asparagine sequon.
5264 NOTES J. VIROL.

FIG. 2. Nucleotide sequence of pmws PCV (GenBank accession no. AF027217 [this study]) aligned with np PCV (GenBank accession no. U49186 [17]). Numbering
used here is based upon numbering that was used for np PCV, where nt position 1 is the first A residue immediately downstream of the putative nick site in the
nonanucleotide motif. Total genome sizes are 1,768 nt for pmws PCV and 1,759 nt for np PCV. Homologous nucleotides are indicated by asterisks. Potential
polyadenylation sites are overlined in the putative viral strand and underlined in the complementary strand.

15R, and 16R) were also able to produce PCR amplification
products from DNA of PMWS-affected pigs (results not
shown). These six primers were used in five different combi-
nations of pairs to produce the following PCRs: 4F/15R (366
nt), 7F/16R (474 nt), 7F/9R (572 nt), 4F/9R (915 nt), and 8F/
15R (1,331 nt). The DNA from a single randomly chosen
PMWS-affected pig was subjected to these five different PCRs,
and both strands of each amplification product were sequenced
(Fig. 1). The raw sequencing data obtained from the three
smaller PCRs (4F/15R, 7F/16R, and 7F/9R) were clearly read-
able in their entirety for both strands. About 850 nt in each of
the two larger PCRs (8F/15R and 4F/9R) could be read with
certainty (a maximum of about 425 nt from each strand). Raw
sequence data for a total of 4,120 nt of pmws PCV were
obtained from these five pairs of PCRs.
The raw sequence data were aligned, creating a preliminary
1,360-nt contiguous sequence of pmws PCV which consisted of
a region of approximately 930 nt that was sequenced four times
and separate 360- and 70-nt regions that were sequenced once.
Six new primers were designed based upon this preliminary
VOL. 72, 1998 NOTES 5265

FIG. 3. Alignments of predicted amino acid sequences of several ORFs in pmws PCV and np PCV. Potential glycosylation signal sequences (asparagine sequons NXS or
NXT, where X 5 any amino acid [6]) are overlined in pmws PCV and underlined in np PCV. The proteins encoded by ORF1 would be 314 aa long and have a molecular
mass of 35.8 kDa in pmws PCV, be 312 aa long and have a molecular mass of 35.7 kDa in np PCV, and have 86% homology. The proteins encoded by ORF2 would be 233
aa long and 27.8 kDa in pmws PCV, 233 aa long and 27.8 kDa in np PCV, and have 66% homology. The proteins encoded by ORF3 would be 104 aa and 11.9 kDa in pmws
PCV and 206 aa and 23.2 kDa in np PCV and have 62% homology. The proteins encoded by ORF4 would be 59 aa and 6.5 kDa in pmws PCV and 115 aa and 13.3 kDa in
np PCV and have 83% homology. The proteins encoded by ORF7 would be 19 aa and 1.9 kDa in pmws PCV and 56 aa and 6.0 kDa in np PCV and have 79% homology.
The proteins encoded by ORF8 would be 21 aa and 2.3 kDa in pmws PCV and 37 aa and 4.3 kDa in np PCV and have 67% homology. All amino acid sequence alignments
shown involve the full-length proteins in pmws PCV and the homologous portions of appropriate lengths for their counterparts in np PCV. Thus, the arrows shown at the ends
of protein sequences encoded by ORFs 3, 4, 7, and 8 in np PCV indicate that these proteins continue further, and their remaining sequences are not shown.

pmws PCV sequence. Their sequences (59 to 39) were as fol-
lows (nucleotide position numbers are based upon the com-
pleted pmws PCV sequence given in Fig. 2): N1f (nt 4 to 22),
AGCGCACTTCGGCAGCGGC; N2r (nt 337 to 306), TATT
CTTTATTCTGCTGATCAGTTCCTTTGGC; N3f (nt 267 to
292), GTGAAGTGGTATTTGGGTGCCCGCTG; N4r (nt
817 to 791), ATTGCTGGTAATCAAAATACTGCGGGCC;
N5f (nt 790 to 819), TGGCCCGCAGTATTCTGATTACCA
GCAATC; and N6r (nt 1242 to 1268), CCACTCCCGTTAA
TTCACACCCAAACC. These six new primers derived from
the preliminary pmws PCV sequence were used to produce the
following three different PCRs: N1f/N2r (334 nt), N3f/N4r (551
nt), and N5f/N6r (469 nt). The three new PCRs were per-
formed on DNA from the same PMWS-affected pig, and both
strands of each amplification product were sequenced (Fig. 1).
A total of about 2,360 nt of raw sequencing data was obtained
from these three new PCR products.
The nucleotide sequences from all eight overlapping PCR
products for pmws PCV were aligned (an accumulated total of
6,480 nt), generating a final 1,768-nt contiguous consensus
sequence for pmws PCV (Fig. 2). Overall, approximately 1,450
nt were sequenced at least three times, and approximately 320
nt were sequenced twice.
The nucleotide sequences were analyzed with the compu-
ter programs Align (20), Basic Local Alignment Search Tool
(BLAST, available on the Internet from the National Center
5266 NOTES
for Biotechnology Information at http://www.ncbi.nlm.nih.gov
[2]), ClustalV (13), and Numseq (9). Analysis of the DNA and
predicted protein sequences of pmws PCV with BLASTn and
BLASTx, respectively, detected any considerable homology
only for np PCV. BLASTx detected scant homology between
the Rep protein of pmws PCV and BBTV, CFDV, and SCSV,
similarly to what was previously reported for np PCV (17).
The DNA genome of pmws PCV is 9 nt larger than that of
np PCV (Fig. 2). Overall, these two genomes have 69% se-
quence homology, with their first halves (nt position 1 to 900)
having over 82% sequence homology and their second halves
(nt 901 to 1768/1759) having 62% homology. The genome of
pmws PCV was determined to be circular, based upon reiter-
ation of sequences flanking the end nucleotide positions (re-
gion between nt 1730 to 1768 and 1 to 30), from several PCR
product sequences (4F/9R, 7F/9R, 8F/15R, and N1f/N2r).
The putative viral single-stranded DNA forms of pmws PCV
and np PCV both contain potential polyadenylation addition
[poly(A)] signal sequences (AATAA [19]) at conserved posi-
tions. Poly(A) sites are found at two places in pmws PCV (nt
positions 327 to 332 and 983 to 988) which align with poly(A)
sites in np PCV (nt positions 314 to 319 and 973 to 978). The
complementary (minus) strand of pmws PCV has only one
poly(A) site (nt positions 1022 to 1027), which aligns with one
of the minus-strand poly(A) sites of np PCV (nt positions 1015
to 1030). The minus strand of np PCV contains an extra pos-
sible poly(A) site (nt positions 1184 to 1189).
The two types of PCVs, np PCV and pmws PCV, both
contain 11 potential open reading frames (ORFs). The loca-
tions and orientations of these ORFs are compared (Table 1),
as are the shared homologies, sizes, and glycosylation sites for
their predicted proteins. The six homologous predicted pro-
teins encoded by ORFs 1, 2, 3, 4, 7, and 8 in pmws PCV and np
PCV are aligned for comparison (Fig. 3).
The proteins encoded by ORF1 are of similar sizes in pmws
PCV and np PCV. Likewise, the proteins encoded by ORF2
are of similar sizes in both PCVs. Most of the remaining nine
ORFs (3 to 11) in pmws PCV are smaller than their counter-
parts in np PCV, except for ORFs 9 and 10, which are larger in
pmws PCV than in np PCV.
Potential glycosylation sequences (also called asparagine se-
quons NXS or NXT, where X represents any amino acid [6])
are indicated in Figure 3. The proteins encoded by ORFs 1, 2,
and 4 in pmws PCV contain sequons. The proteins encoded by
ORFs 1, 2, 4, 5, 6, and 10 in np PCV contain sequons. The
circoviruses have similar first sequons in their ORF1-encoded
proteins, at amino acids (aa) 23 to 25 (NPS) in pmws PCV, and
at aa 20 to 22 (NPS) in np PCV. However, the ORF1-encoded
protein in pmws PCV has two extra sequons, at aa 256 to 258
(NQT) and aa 286 to 288 (NAT). Both viruses have single
sequons in their ORF2-encoded proteins, at aa 143 to 145
(NYS) in pmws PCV and aa 102 to 104 (also NYS) in np PCV.
Both viruses lack sequons in their proteins encoded by ORF3,
ORF7, ORF8, ORF9, and ORF11. Both have similarly placed
sequons in their ORF4-encoded proteins, at aa 30 to 32 (NVT)
in pmws PCV and aa 34 to 36 (NCS) in np PCV. There are
sequons in the proteins encoded by ORF5 (aa 64 to 66 and 69
to 71), ORF6 (aa 6 to 8, 27 to 29, and 37 to 39) and ORF10 (aa
21 to 23) in np PCV but not in pmws PCV.
Both PCV genomes have nearly identical predicted stem-
loop structures and nonanucleotide motif sequences (Fig. 4).
This region is known to be required for np PCV genome
replication (16). The starting point used for numbering the
nucleotide sequence positions in both PCV genomes is located
at the right-most A residue within the nonanucleotide se-
quence motif, 59-AAGTATTAC-39 (nt positions 1762 to 2 in
J. VIROL.
FIG. 4. (a) Alignment of the putative DNA replication sequences in pmws
PCV and np PCV. Homology is indicated by an asterisk. (b) Comparison of the
stem-loop structures predicted from the sequences in panel a. In both panels the
nonanucleotide sequence motifs are in bold-faced type, and arrows mark the
putative nick sites. The A residues immediately downstream of these nick sites
are used as the starting point for numbering these genomes. All sequences are
given in the 59-to-39 direction.
pmws PCV and 1753 to 2 in np PCV), which is immediately
downstream of the putative nick site in between the rightmost
T and A residues (Fig. 3).
It is perhaps not surprising that the proteins encoded by
ORF1 have the most highly conserved sequence (they have
85% homology) considering that they code for the putative
Rep protein, required for genome replication. The proteins
encoded by ORFs 2, 3, 4, 7, and 8 in pmws PCV are obviously
closely related to their respective counterparts in np PCV.
However, their differences are striking, especially for those
proteins encoded by ORFs 3, 4, 7, and 8, which in pmws PCV
are about half the size of their counterparts in np PCV. Fur-
thermore, ORFs 5, 6, 9, 10, and 11 in these two circoviruses
lack any homology with any other ORF. These predicted dif-
ferences in proteins, encoded in pmws PCV, are possibly the
contributing factors for the pathogenesis, clinical signs, and
lesions associated with PMWS.
Work needs to be done in identifying and characterizing the
proteins that are actually produced by pmws PCV before their
functions can be known (by gel electrophoresis and by probing
with antibodies raised against purified pmws PCV). It is hoped
that such research will extend our understanding of the roles
played by these proteins and of their different traits (overall
amino acid sequence, hydrophobic, and hydrophilic domains,
and glycosylation sites) in relation to the differences in viru-
lence between pmws PCV and np PCV.
The recent epidemic of PMWS in North American pigs has
a characteristic PCV, pmws PCV, associated with the disease.
The similarity of pmws PCV to np PCV in nucleotide se-
quence, 6 of 11 protein sequences, genome structure and or-
ganization, and host cell preferences demonstrates that they
are closely related and may have a common ancestor.
The PCR assay is a useful tool for studying diseases such as
PMWS. We had previously reported using PCR and detecting
only pmws PCV in pigs affected by PMWS (18). In an upcom-
ing study, we will fully describe a PCR assay with primers based
upon the pmws PCV sequence given here and its efficacy for
VOL. 72, 1998
detecting pmws PCV in pigs (10a). Studies involving purified
pmws PCV used to experimentally infect pigs can extend our
understanding of the development and pathology of PMWS.
Such studies can make use of probes and PCR assays that are
based upon the pmws PCV nucleotide sequence presented
here.
PMWS is an important new disease in pigs. We hope the
nucleotide sequence of pmws PCV described here will be use-
ful for improving our understanding of the disease PMWS and
developing effective vaccines against the disease and diagnostic
procedures such as the PCR for detecting the etiological agent.
Nucleotide sequence accession number. The GenBank ac-
cession number for the nucleotide sequence of pmws PCV
described in the present study is AF027217.
We are most grateful to Cheryl Sachvie for valuable technical assis-
tance.
REFERENCES
1. Allan, G. M., K. V. Phenix, D. Todd, and M. S. McNulty. 1994. Some
biological and physico-chemical properties of porcine circovirus. J. Vet.
Med. Ser. B 41:17–26.
2. Altshul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990.
Basic local alignment search tool. J. Mol. Biol. 215:403–410.
3. Burns, T. M., R. M. Harding, and J. L. Dale. 1995. The genome organization
of banana bunchy top virus: analysis of six ssDNA components. J. Gen. Virol.
76:1471–1482.
4. Chu, P. G. W., P. Keese, B. S. Qiu, P. M. Waterhouse, and W. L. Gerlach.
1990. Novel ssDNA genome organization of a new plant virus, abstr. W82-
001, p. 125. In VIIIth International Congress of Virology Abstracts.
5. Clark, E. G. 1997. Post-weaning multisystemic wasting syndrome. Proc. Am.
Assoc. Swine Pract. 28:499–501.
6. Darnell, J. E., H. F. Lodish, and D. Baltimore. 1986. Assembly of organelles:
protein glycosylation, p. 961. In Molecular cell biology. Scientific American
Books, New York, N.Y.
7. Dulac, G. C., and A. Afshar. 1989. Porcine circovirus antigens in PK-15 cell
line (ATCC CCL-33) and evidence of antibodies to circovirus in Canadian
pigs. Can. J. Vet. Res. 53:431–433.
8. Ellis, J., L. Hassard, E. Clark, J. Harding, G. Allan, P. Willson, J. Strakappe,
K. Martin, F. McNeilly, B. Meehan, D. Todd, and D. Haines. 1998. Isolation
of circovirus from lesions of pigs with postweaning multisystemic wasting
syndrome. Can. Vet. J. 39:44–51.
9. Fristensky, B., J. T. Li, and R. Wu. 1982. Portable microcomputer software
for nucleotide analysis. Nucleic Acids Res. 10:6451–6463.
10. Hamel, A. L., M. D. Wasylyshen, and G. P. S. Nayar. 1995. Rapid detection
of bovine viral diarrhea virus by using RNA extracted directly from assorted
specimens and a one-tube reverse transcription PCR assay. J. Clin. Micro-
biol. 33:287–291.
NOTES 5267
11. Harding, J. C. 1997. Post-weaning multisystemic wasting syndrome (PMWS):
preliminary epidemiology and clinical presentation. Proc. Am. Assoc. Swine
Pract. 28:503.
12. Harding, R. M., T. M. Burns, G. Hafner, R. G. Dietzgen, and J. L. Dale.
1993. Nucleotide sequence of one component of the banana bunchy top virus
genome contains a putative replicase gene. J. Gen. Virol. 74:323–328.
13. Higgin, D. G., and P. Sharp. 1988. CLUSTAL: a package for performing
multiple sequence alignment on a microcomputer. Gene 45:333–338.
14. Hines, R. K., and D. Lukert. 1995. Porcine circovirus: a serological survey of
swine in the United States. Swine Health and Production 3:71–73.
15. Lincoln, S. E., M. E. Daly, and E. S. Lander. 1990. Primer: a computer
program for automatically selecting PCR primers. MIT Center for Genome
Research and Whitehead Institute for Biomedical Research, Cambridge,
Mass.
16. Mankertz, A., F. Persson, J. Mankertz, G. Blaess, and H. J. Buhk. 1997.
Mapping and characterization of the origin of DNA replication of porcine
circovirus. J. Gen. Virol. 71:2562–2566.
17. Meehan, B. M., J. L. Creelan, M. S. McNulty, and D. Todd. 1997. Sequence
of porcine circovirus DNA: affinities with plant circoviruses. J. Gen. Virol.
78:221–227.
18. Nayar, G. P. S., A. Hamel, and L. Lin. 1997. Detection and characterization
of porcine circovirus associated with post-weaning multisystemic wasting
syndrome in pigs. Can. Vet. J. 38:385–386.
19. Nevins, J. R., and J. E. Darnell, Jr. 1978. Steps in the processing of Ad2
mRNA: poly (A) 1 nuclear sequences are conserved and poly (A) addition
precedes splicing. Cell 15:1477–1493.
20. Pearson, W. R. 1990. Rapid and sensitive sequence comparison with FASTP
and FASTA. Methods Enzymol. 183:63–98.
21. Ritchie, B. W., F. D. Niagro, P. D. Lukert, W. L. Steffens, and K. S. Latimer.
1989. Characterization of a new virus from cockatoos with psittacine beak
and feather disease virus. Virology 171:83–88.
22. Rohde, W., J. W. Randles, P. Langridge, and D. Hanold. 1990. Nucleotide
sequence of a circular single-stranded DNA associated with coconut foliar
decay virus. Virology 176:643–651.
23. Tischer, I., H. Gelderblom, W. Vettermann, and M. A. Koch. 1982. A very
small porcine virus with a circular single-stranded DNA. Nature 295:64–66.
24. Tischer, I., W. Mields, D. Wolff, M. Vagt, and W. Griem. 1986. Studies on the
pathogenicity of porcine circovirus. Arch. Virol. 91:271–276.
25. Todd, D., J. E. Creelan, D. P. Mackie, F. Rixon, and M. S. McNulty. 1990.
Purification and biochemical characterization of chicken anaemia agent. J.
Gen. Virol. 71:819–823.
26. Todd, D., F. D. Niagro, B. W. Ritchie, W. Curran, G. M. Allan, P. D. Lukert,
K. S. Latimer, W. L. Steffens, and M. S. McNulty. 1991. Comparison of three
animal viruses with circular single-stranded DNA genomes. Arch. Virol. 117:
129–135.
27. Todd, D., K. V. Phenix, G. M. Allan, M. S. McNulty, H. J. Buhk, and I.
Tischer. 1993. Comparison of chicken anaemia virus and porcine circovirus,
members of the vertebrate virus family Circoviridae, abstr. P76-2, p. 367. In
IXth International Congress of Virology Abstracts.