Molecular Identification of Bird Sex Using CHD1 Marker

A. O. AL-Rumhia, A. N. AL-Wehaibib
(87142) a, (86986) b technique in molecular biodiversity course ( BIOL5600), lab 1022, Department Of Biology,
Collage of Science, Sultan Qaboos University,P.O.Box33, AL-Khod 123, Oman;

‫ـــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــ‬

Abstract:
A study was done for molecular identification of Sooty falcon (Falco concolor) sex using CHD1
molecular marker. Blood samples were collected from sooty falcon in Fahal and Daynamiyat regions in
Oman. DNA extraction, PCR and gel electrophoresis were carried out. The results obtained after seeing
the samples under UV light. Samples which have got one band (Z- band) at about 1000bp were
considered to be males while samples which got smaller bands (W- band) around 500bp were identified
as females. Some samples had not get DNA bands and considered as experimental errors. Positive and
negative controls were used to confirm the results. This study represents an important knowledge about
sex determination of sooty falcon in Oman thus management and conservation.
Keywords: sooty falcon (Falco concolor), CHD1 gene, Fahal, Daynamiyat, PCR

‫ـــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــ‬

Contents:
1. Introduction ............................................................................................................. ................2-3
2. Materials and methods............................................................................. 3-4
2.1. DNA extraction) ...................................................................... 3
2.2. PCR amplification of partial CHD gene..................................................................... 3
2.3. Gel electrophoresis........................................................................ 4
3. Results...................................................................... 5-6
4. Discussion and conclusion................................................................................................... ............... 6 -7
Acknowledgements.............................................................................................. 7
Reference .....................................................................................................7

1
1. Introduction:
Accurate identification of sex in birds is important for the management and conservation of
birds’ diversity and it is a powerful tool in research domain. Due to decline in avian population
as a result of hunting, environmental destroying and illegal trade, sex determinations become
extremely important. Gender identification is relevant to veterinary, medical and ecological
sciences, and is helpful in enforcing legislation and resolving paternity disputes [Lee et al.,
2010]. More than 50% of bird species are monomorphic [Griffits et al., 1998] so, determining the
sex according to external morphology is impossible.
The PCR-based methods were developed based on chromosome-specific markers, considering
the variations among the heterogametic sex (females present Z and W chromosomes) and
homogametic sex (males have two Z chromosomes). The chromodomain helicase DNA binding
1(CHD1) was the first gene proposed as a valid sex linked marker for sex differentiation in a
wide range of bird species. The CHD1 is highly conserved and has slight differences in size and
nucleotide sequence between some intronic regions of CHD1Z and CHD1W [Morinha et al.,
2012].
Recently, novel sex-linked markers involving the Drosophila Nipped-B homolog (NIPBL) and
RAS p21 protein activator 1 (RASA1) genes were proposed The NIPBL was reported as a
universal marker and RASA1 was presented as an innovative approach for sex identification in
Phasianidae species .The 0.6 kb EcoRI fragment (EE0.6) is a W-located conserved sequence also
utilized for sex typing. The variations in the W- and Z-linked EE0.6 sequences allowed the
accurate sex determination of several bird species. All these markers were analyzed by PCR
methods. The most commonly used primers are the CHD1-linked primers P2/P8 (5´-
TCTGCATCGCTAAATCCTTT-3´/5´-CTCCCAAGGATGAGRAAYTG-3´) [GRIFFITHS et al.
1998], 1237L/1272H (5´GAGAAACTGTGCAAAACAG-3´/5´TCCAGAATATCTTCTGCTCC
-3´) [KAHN et al. 1998] and 2550F/2718R (5´GTTACTGATTCGTCTACGAGA-3´/5´-ATTGA
AATGATCCAGTGCTTG-3´) [FRIDOLFSSON & ELLEGREN 1999]. Based on these
sequences, a large diversity of primer sets have been developed for molecular sexing. In theory,
the amplified products should migrate as a single band in males (ZZ) and as two bands in
females (ZW). These molecular marker used in avian molecular sexing have been identify
through many molecular methods e.g. (Single strand conformation polymorphism (SSCP) ,
Restriction fragment length polymorphism (RFLP), Random amplified polymorphic DNA
(RAPD), Amplified fragment length polymorphism (AFLP), Microsatellites, specific PCR (AS-
PCR), Capillary electrophoresis and Real-time quantitative PCR (qPCR) using TaqMan probes.
[Morinha et al., 2012].
The sooty falcon is a medium-sized falcon that breeds in the Middle East and north-eastern
Africa and winters along the south-eastern coast of Africa and on Madagascar. The conservation
status of sooty falcon is “Near-threatened”, and Oman may hold up to 10% of the global
population (McGrady et al., 2010). The first survey in Oman was done in 1978 so, Oman lead
the world in sooty falcon researches (ESO, 2007). Sultan Qaboos University (SQU) faculty and
students and Ministry of Environment and Climate Affairs (MECA) staffs participated in the
survey which made in 2010 and more information were added to the data collected in 2007-2009.
Little is known about sooty falcon behavior, nesting and migration which established challenges
in conservation of these avian types.
The objectives of this work were (i) Determinations of sooty falcon sex using their blood by
apply through: (i) DNA extraction (ii) Checkup quality of extracted DNA using 1% agarose. (iii)

2
Amplify extracted product of sooty falcon from Fahal and Daynamiyate Island. (iv) Using PCR
product to determine the sex of sooty falcon through gel electrophoresis. (v) Identification of CHD1
(Z&W) gene to determine bird sex using band size of PCR product. Knowledge in these areas will
provide basic information for the establishment of strategies in avian gender identification,
management and conservation.

2. Materials and methods

2.1. DNA extraction:

The blood samples were collected in 2008 by environmental society of Oman from Fahal Island
and Daynamiyate Island regions according to table1. Most of the blood samples were from chick.
DNA was extracted according to purification of total DNA from animal blood (spin-column
protocol) from QIAGENE Company. One hundred eighty µl of the samples were transferred to
new eppendorf tubes and 200µl of buffer AL, 10µl of proteinase K were added and incubate at
56°C for 10 minute. 200µl ethanol was added and mixed. The mixtures were transferred to 2ml
collection tube and centrifuged for 1 minute at 8000 rpm. The filtrates were discarded and 500µl
of AW1 and AW2 were added separately and centrifuged at (8000 rpm for 1 minute, 14000 rpm
for 3 minute) respectively. The filtrates were discarded, the columns were transfer to new
eppendorf tubes, 100µl AE buffer added, incubated for 1 minute and centrifuged for 1 minute at
8000 rpm. The quality of extracted DNA was checked using 1% agarose gel.

Table 1: samples ID and the regions.

Sample ID region
ET05038 Fahal Island
ET65035 Fahal Island
ET65106 Fahal Island
ET65020 Fahal Island
ET65017 Fahal Island
EW59545 Daynamiyate Island
EW59542 Daynamiyate Island
EW59526 Daynamiyate Island
EW54524 (+ control) Daynamiyate Island
ET65048(+ control) Fahal Island
Negative control -

2.2. PCR amplification of partial CHD gene:

For 12 samples the reagents (table 2) required for PCR mix were added in 0.5µl eppendorf tube
except for DNA sample and mixed. Using 0.2µl eppendorf tubes with label from 1 to 11, 2µl of
PCR mix was transferred in order as shown in table1. The PCR was programmed for 35 cycles as
following (95°C for 4 min) (95°C for 30 sec, 55°C for 30 sec and 72°C for 45sec) (72°C for 4
min) and hold at 4°C for infinity.

3
Table 2: PCR Mix

PCR reagents Mix for 12

samples
DNA variable
dd H2O 170.4µl
10x buffer 30µl
2mM dNTPs 30µl
50% (v/v) Glycerol 30µl
25 mM MgCl2 24µl
50 pmol/µl (50 M) Forward Primer 14.4µl
2550F(5ʾ-
GTTACTGATTCGTCTACGAGA-
3 ʾ)
50 pmol/µl (50mM) Reverse Primer 14.4µl
2718R(5ʾ-
ATTGAAATGATCCAGTGCTTG-
3 ʾ)
5 U/µlTaq polymerase 14.4µl
Total 25X5

2.3. Gel electrophoresis:

2% of agarose gel was prepared in 1X TBE buffer. Roti-safe stain (3-4 µl) was used as a dye for
the gel. 3- 4 µl of easy ladder birlin (BIOLINE #: HTS12-1007) was loaded in the lane. 8 µl of
PCR products were mixed with 2 µl of loading buffer and loaded in the wells. The
electrophoresis was run for 20 minute and the results were analyzed according to the bands size.
A second 2% agarose gel was prepared for other group samples to analyze many results.

Well Samples ID
#
1 ET65106
2 EW59542
3 ET103
4 ET022 Table 3: samples ID for the second gel.
5 ET65018
6 EW59543
7 EW59517
8 ET65014
9 ET65037
10 ET65107
11 ET034
12 EW14
13 ET025
14 EW54524 (+ control)
15 ET65048 (+ control)

4
3. Results:
Primers 2550F and 2718R allowed the amplification of a specific fragment with approximately
500-1000 bp. The difference between bands detected on agarose gel was obviously allowing
reliable sex identification (Fig. 1). According to difference in band size the results in figure 1 are
shown four females with a ratio of 0.8 and no band for one sample. In the second gel four
females and six males and no band for three samples were obtained (Fig. 2). The ratio of female
is 0.31 and for the male is 0.46.

Fig.1 DNA band migration of PCR products for first gel

5
 Fig.2 DNA band migration of PCR products for second gel

4. Discussion and conclusion:

In the present work we aimed to identify the sex of sooty falcon which can breed at very high
densities on island of Arabian e.g. Fahal and Daynamiyate in the north coast of Oman. The PCR
using 2550F / 2718R Primers originated a unique band for Z and W therefore determination of
male and female. In sooty falcon the length difference between CHD-Wand CHD-Z fragments is
different enough to allow sexing directly by conventional agarose gel electrophoresis. The Z
band is supposed to be around 1000 bp and the W band is around 500 bp (Vucicevic et al., 2012).
The pattern obtained by PCR in the present work (Fig. 1&2) show four females with a ratio of
0.8, 0.31 and the ratio of male is 0.0, 0.46 respectively. There are experimental errors of about
0.2 in the two gels which may due to insufficient quantity of DNA and improper storage
condition. We don’t know the exact reason for variation in the sex but, it is properly linked to
nesting behavior, inaccessibility of some nest, nest disturbance, food availability and the location
of the islands from the mainland. In the first gel (Fig 1) there are all females which are supposed
to be because of that females are always in nests and males were more susceptible for hunting
and theses samples may collected during the season of the nesting. In the second gel there are
more males may due to unauthorized camping in the islands and disturbance of the nest which
include females and chicks. Additional researches about sooty falcon in Oman are required to
know more about this bird and preserve the species. Monitoring of the breeding population and
productivity should be conducted annually with Genetic Studies. It is important to have large
number of samples as well as timely and reliable samples to have better management and
identification strategies. Early October when chicks are large and seas are calmer after the main
monsoon season is favorable season for samples collection. It is important that human
disturbance is controlled and that ground predators are not brought to the islands. The
Government should offer training in conservation/ecology for university students.

6
The work has led to conclude that sooty falcon is an important species in Oman which is
attractive to tourists. Sooty falcon added values to tourists who visit the waters around the islands
for diving, and provide chance to teach visitors more about Oman natural resources.

Acknowledgements:
The author would like to acknowledge Dr. Alia AL-Ansari for continous teaching, supporting.
Also, Ms. Wafa AL-Alawi, Ms. Ratiba and Mr. Khamis for helping. In addition, they would like
to acknowledge the Environmental Society of Oman for providing the samples.

References:
“ESO | Projects | Project Centre | Terrestrial | Sooty Falcon.” Accessed March 20, 2013.
http://www.environment.org.om/index/list3.php?categoryId=628&Extension=gif.

(FRIDOLFSSON A.-K., ELLEGREN H. 1999. A simple and universal method for molecular sexing of
non-ratite birds. J. Avian Biol. 20: 116.121.)

(GRIFFITHS R., DOUBLE M. C., ORR K., DAWSON R. J. G. 1998. A DNA test to sex most birds.
Mol.Ecol. 7: 1071.1075.)

(KAHN N. W., JOHN J. S., QUINN T. W. 1998. Chromosome-specific intron size differences in the
avian CHD gene provide an efficient method for sex identification in birds. Auk 115: 1074.1078.)

Lee, James Chun-I, Li-Chin Tsai, Pei-Yi Hwa, Chia-Ling Chan, Alex Huang, Shih-Chien Chin, Lih-
Chiann Wang, Jun-Tsong Lin, Adrian Linacre, and Hsing-Mei Hsieh. “A Novel Strategy for Avian
Species and Gender Identification Using the CHD Gene.” Molecular and Cellular Probes 24, no. 1
(February 2010): 27–31. doi:10.1016/j.mcp.2009.08.003.

Morinha, F., J.A. Cabral, and E. Bastos. “Molecular Sexing of Birds: A Comparative Review of
Polymerase Chain Reaction (PCR)-based Methods.” Theriogenology 78, no. 4 (September 1, 2012): 703–
714. doi:10.1016/j.theriogenology.2012.04.015.

Okuda, Masahiko, Masami Horikoshi, and Yoshifumi Nishimura. “Structural Polymorphism of

Chromodomains in Chd1.” Journal of Molecular Biology 365, no. 4 (January 26, 2007): 1047–1062.
doi:10.1016/j.jmb.2006.10.039.

“Sooty Falcon Studies in Oman.” Accessed March 20, 2013. http://www.natural-

research.org/environmental-research-charity/completed-projects/sooty-falcons-in-oman/.

Vucicevic, Milos, Marija Stevanov-Pavlovic, Jevrosima Stevanovic, Jasna Bosnjak, Bojan Gajic,
Nevenka Aleksic, and Zoran Stanimirovic. “Sex Determination in 58 Bird Species and
Evaluation of CHD Gene as a Universal Molecular Marker in Bird Sexing.” Zoo Biology (May 2,
2012). doi:10.1002/zoo.21010.