Biocatalysis and Agricultural Biotechnology 16 (2018) 502–506

Contents lists available at ScienceDirect

Biocatalysis and Agricultural Biotechnology

journal homepage: www.elsevier.com/locate/bab

A comparative analysis of biodiesel production and its properties from T

Leptolyngbya sp. BI-107 and Chlorella vulgaris under heat shock stress
⁎
V. Ramesh kumara, , G. Narendrakumara, R. Thyagarajana, G. Melchiasb
a
Department of Biotechnology, Sathyabama University, Jeppiaar Nagar, Chennai, India
b
Department of Botany, St.Joseph's College, Tiruchirappalli, India

A R T I C LE I N FO A B S T R A C T

Keywords: Reliance on fossil fuel energy resources has become economically costly and environmentally unsustainable.
Microalgae With the rapid depletion of fossil fuels due to increased demand, the need for alternative fuel from biological
Heat shock stress resources has gained importance. Although a wide range of alternative energy sources are being experimented,
Transesterification biodiesel from sustainable resources has gained widespread acceptance and importance. Third generation bio-
Biodiesel
fuels from microalgae are particularly promising in their yield and application. The present study aims at tapping
Chlorella vulgaris
Leptolyngbya sp
the highly competent native microalgal species for biodiesel production. Microalgae from kitchen waste water
was isolated and characterized as Leptolyngbya sp. by 16S rRNA sequencing. Chlorella vulgaris was taken as a
standard for comparison of growth, biochemical and biodiesel producing ability. The microalgal cultures were
grown under controlled conditions and their growth rate and lipid productivity were assessed. Temperature
stress (heat shock stress) was induced to understand the effect of rising global temperature on microalgae. The
biochemical parameters were analyzed under normal and stressed conditions for both the microalgae.
Leptolyngbya sp. had better lipid productivity compared to Chlorella vulgaris. The lipids obtained from mi-
croalgae were chemically transesterified to biodiesel. Again it was Leptolyngbya sp. that had a higher biodiesel
yield. Biodiesel blends were made from the biodiesel thus obtained along with commercial diesel. The properties
of Biodiesel 20, Biodiesel 50 and Biodiesel 100 proved them to be suitable for commercial applications. The
present work opens up new avenues for native microalgae with potential for biodiesel production.

1. Introduction Biodiesel from microalgae predominates the third generation of bio-

The economy of many a developing country depends on its oil re-
sources and its fuel requirement. Transportation fuel leaves a dent in
the GDP (Gross Domestic Potential) of every growing nation if it im-
ports oil. Although many renewable energy resources are explored, li-
quid fuel remains the prime focus which demands primary attention (El
Shimi and Moustafa, 2018). With comparable properties to that of
conventional diesel in terms of combustion, biodiesel stands as a
competitive biofuel. Also as there is no major modification that is to be
done in terms of engine design, biodiesel has become the choice for
diesel substitute (Tüccar and Aydin, 2013).
Photosynthetic microalgae, because of its easy availability and cost
effective large scale biomass production capabilities (Giraldo Calderón
et al., 2018), have become a viable option for biodiesel feedstock.
Unlike the edible oil seed crops, which are part of the second generation
feedstock (Schenk and Thomas-hall, 2008) microalgae do not affect the
food web and hence the ecosystem is not brought under imbalance.
fuels due to its versatile growth conditions and high biomass avail-
ability. Increasing the lipid content of microalgae has become the prime
focus of researchers to maximize the use of microalgae as an efficient
feedstock.
The present study focuses on identifying microalgae from waste-
water and assess whether they are comparable with Chlorella vulgaris
which is a freshwater microalga with high lipid content (Marudhupandi
et al., 2014). Wastewaters have been known to enchance the growth of
microalgae (Zhang et al., 2018) which could serve as an effective bio-
mass (Sivaramakrishnan and Incharoensakdi, 2018). The isolated mi-
croalgae would also be subjected to temperature stress and its effect
analyzed. Temperature modulation is known to induce temperature
sensitive proteins (heat shock and cold shock proteins) which in turn
act as regulators of different genes (Omar et al., 2011). A comparison of
the fuel characteristics of the transesterified lipid (biodiesel) with
conventional diesel would reveal the effectiveness of the novel bio-
diesel.

⁎
Corresponding author.
E-mail address: rameshkumar.biotech@sathyabama.ac.in (V. Ramesh kumar).

https://doi.org/10.1016/j.bcab.2018.09.007
Received 11 March 2018; Received in revised form 11 August 2018; Accepted 6 September 2018
Available online 06 September 2018
1878-8181/ © 2018 Elsevier Ltd. All rights reserved.
V. Ramesh kumar et al. Biocatalysis and Agricultural Biotechnology 16 (2018) 502–506

2. Materials and methods tf – Final time

ti – Initial time
2.1. Source of microalgae
3.2. Lipid productivity
The standard microalgae Chlorella vulgaris used for the present study
was obtained from Central Marine Fisheries Research Institute (CMFRI), The lipid productivity for the microalgal culture was calculated as
Cochin (Kerala, India). A wild type microalga found in household do- follows;
mestic waste water drainage was isolated. The wild type microalga was
(Bf x %FAi –Bi x %FA o)
characterized by sequencing its 16s rRNA and comparing the sequence LP =
using BLAST. The microalgal cultures were maintained at a constant (100x(ti –to))
temperature of 25 °C in the culture room at an aseptic conditions in the where,
light ratio 12:12 at an intensity of 2000 lx.
LP – Lipid productivity
2.2. Stress induction Bf – Final biomass
Bi – Initial biomass
In order to induce a temperature stress the microalgal cultures were tf – Final time
kept in an incubator at 550 °C for 2 h every day during their growth. ti – Initial time
%FAf – Final fatty acid content
2.3. Estimation of carbohydrate %FAi – Initial fatty acid content

Carbohydrates were estimated using the anthrone method (Roe,

4. Extraction of oil (Ramesh kumar and Melchias, 2014)
1955) with glucose as standard.
The oil from the microalgal biomass was extracted in a Soxhlet
2.4. Estimation of protein
apparatus using n-hexane as solvent. The algal biomass was subjected
to sonication with hexane and the resulting algal oil was extracted.
Proteins were estimated using the Lowry's method (1951) with BSA
Sonication was done at pulse rate of 0.5 s and at a temperature of 42 °C.
as standard.
The resultant extract was kept for evaporation of hexane. The oil settled
down after the hexane had evaporated.
2.5. Total lipid measurement

5. Lipid profiling
To estimate the total lipid content in algal cells, dried algal cells
were blended with 0.5 ml distilled water and 3 ml chloroform/me-
5.1. Gas chromatography
thanol (2:1). The contents were mixed for 20 min in a shaker and then
centrifuged at 10000 rpm for 10 min. The chloroform phase was col-
The extracted lipid was subjected to gas chromatography using
lected. The pellet was washed with chloroform for five times. All the
column BPX – 70 (50% cyanopropyl, 50% methylsiloxane). The sepa-
chloroform phases were collected and were subjected to evaporation.
rated lipids were detected using CHEMITO GC 8610 Flame Ionization
The final weight was estimated to get the total lipid content.
Detector. The resultant data was analyzed through winchrome soft-
ware.
2.6. Chlorophyll-a estimation

The chlorophyll-a was extracted and its concentration estimated 5.2. Transesterification (Ramesh kumar and Melchias, 2014)
according to Sterman (1988). The chlorophyll-a content was extracted
in 90% acetone and estimated spectrophotometrically using a spectro- The extracted oil was evaporated to release the organic solvents in
photometer (Varian Cary 100). The concentration of chlorophyll-a was it. Also to 0.25 g of sodium hydroxide (catalyst), 24 ml of methanol was
estimated using the following equation; added and stirred for 20 min. To the methoxide thus formed 100 ml of
microalgal oil was added to it. The conical flask containing the mixture
Total chlorophyll−a content = 11.93 A 664 –1.93 A 647 [mg ml−1] was shaken for 3 h at 300 rpm.
A 664 − Absorption at 664 nm After allowing time for transesterification to occur the solution was
A 647 − Absorption at 647 nm kept for 16 h to settle down in a separating funnel. When the biodiesel
and glycerol layers separated clearly, the two layers were segregated.
The biodiesel was washed with 5% water until it was clean. The bio-
3. Productivity determination
diesel was dried at room temperature for 12 h.
3.1. Biomass productivity
6. Assessment of biodiesel properties
The biomass productivity in the batch culture was calculated at
constant culture volume throughout the time of the experiment as fol- The final biodiesel that was obtained from the microalgal lipids was
lows; subjected to a series of tests for standardization. The tests were done
according to the ASTM standards as given in Table 1.
(Bf –Bi)
P=
(t f –ti ) 7. Results and discussion
where,
The Chlorella vulgaris culture that was obtained from CMFRI, India
P – Biomass productivity was acclimatized to the laboratory conditions to which it adapted well.
Bf – Final biomass The other strain of microalgae that was obtained from domestic waste
Bi – Initial biomass waters was characterized as Leptolyngbya sp. by sequencing of its 16S
rRNA and comparing with the help of BLAST software.

503
V. Ramesh kumar et al. Biocatalysis and Agricultural Biotechnology 16 (2018) 502–506

Table 1 Table 6
ASTM standard methods. Fatty acid profile in Chlorella vulgaris.
S.No. Test Standard Fatty acid Fatty acid Control culture Stressed culture
Nomenclature (% Total Lipid) (% Total Lipid)
1. Density ASTM D1298
2. Viscosity ASTM D445 12:0 Lauric acid 3.77 6.51
3. Flash point ASTM D93 14:0 Myristic acid 3.79 5.46
4. Acid value ASTM D664 16:0 Palmitic acid 17.12 29.19
5. Sulphur ASTM D5453 18:0 Stearic acid 18.85 –
6. Cetane number ASTM D613 18:1 Oleic acid 16.67 30.85
18:2 Linoleic acid 7.36 5.10
18:3 γ Linolenic acid – 2.24
20:0 Arachidic acid – 3.45
Table 2
20:1 11 Eicosenoic – 3.21
Measures of proteins, carbohydrates and lipids.
acid
Microalgae mg/L Total Protein Total Total Lipids 20.4 Arachidonic acid 8.64 12.88
Carbohydrates 24:0 Lignoceric acid – 0.40

Chlorella vulgaris Control 131.90 ± 0.56 36.76 ± 0.62 46.28 ± 0.33

Stressed 111.16 ± 0.83a 14.98 ± 0.71a 60.72 ± 0.38a Table 7
Leptolyngbya sp. Control 123.36 ± 0.4 33.64 ± 0.26 70.96 ± 0.88
Fatty acid profile in Leptolyngbya sp.
Stressed 127.74 ± 0.57b 17.76 ± 0.81a 93.62 ± 0.48a
Fatty acid Fatty acid Control culture Stressed culture
a
p < 0.0001. Nomenclature (% Total Lipid) (% Total Lipid)
b
p < 0.001.
12:0 Lauric acid – 1.47
14:0 Myristic acid 1.54 2.04
Table 3 16:0 Palmitic acid 13.34 20.66
Amount of total chlorophyll present in a litre of micro algal culture. 18:0 Stearic acid 17.65 18.10
18:1 Eladic acid – 0.16
Name of the microalgae Culture condition Total Chlorophyll content (mg/L)
(trans Oleic acid)
18:1 Oleic acid 30.60 50.10
Chlorella vulgaris Control 2.48 ± 0.31
18:2 Linoleic acid 16.08 –
Stressed 1.72 ± 0.24a
Leptolyngbya sp. Control 2.48 ± 0.21
Stressed 2.02 ± 0.13a
Table 8
a
p < 0.05. Biodiesel yield (ml/L) in control and stressed microalgal culture.
Parameters Chlorella vulgaris Leptolyngbya sp.
Table 4
Biomass productivity in control and stressed cultures. Control 66 62
Stressed 70 71
Biomass productivity (DW in Percentage reduction in Percentage increase 6 13
mg d−1) biomass productivity (%)

Control Stressed

Chlorella vulgaris 12.40 10.35 16.53 CCTACCTGTAAACGATGGATATTAGGTGTTGGATGTATCGACCC

Leptolyngbya sp. 16.24 14.09 13.24 GTGCAGTACCGTAGCTAACGCGTTAA

GTATCCCGCCTGGGGAGTACGCACGCAAGTGTGAAACTCAAAG
Table 5
GAATTGACGGGGGCCCGCACAAGCGGT
Lipid productivity in control and stressed microalgal cultures.
Name of the microalgae Lipid productivity (mg m−2 d−1) GGCGGATGTGGTTTAATTCGATGCAACGAGAAGCACCTTCCCA
CGGCTTCACATGTCGAGAATCCTTCAG
Control Stressed

Chlorella vulgaris 22.32 30.02 AGAGGAGGGAGCGCTTTCGGGATCGCGAACACAGGTGGCGCAT

Leptolyngbya sp. 37.35 46.50 GGCTGTTCTCAGCTCGTGTCGTGAGAT

GTTGGGTTAAGTCCCGCAACGAGCGCAACCCACCTTTTTAGTTC
CCCGCATTTAGTTGGGCACTCTAAAG
GenBank: HM119583.1
> gi|297598688|gb|HM119583.1| Leptolyngbya sp. BI-107 16S
AGACTGCCGGGGACAAACCGGAGGAAGGTGGGGATGACGTCA
ribosomal RNA gene, partial sequence
AGTCATCATGCCCCTTACGTCCTGGGCT
AAGTCTGTTGTCAAAGGTCACAGCTCAACTGTGGATCGGCAAT
ACACACGTCCTACAATGGTACAGACAAAGGGCAGCCAGCGCGC
GGAAACTGGGTGACTTGAGTGTGGTAG
GAGTGCAAGCAAATCCCATAAACTGTG
GGGTAGAGGAATTTCCCGGTGTAGCGGTGAAATGCGTAGATAT
TCTCAGTTCAGATTGCAGTCTGCAACTCGCCTGCATGAAGTCGG
CGAGAAGAACACCAGTGGCGAAGGCGC
AATCGCTAGTAATCGCAGTCAGCA
TACACTGGGTCACAACTGCCGTTGAGGGACGAAAGCTAGGGGA
GCGAAAGGGATTAGATACCCCTGTAGT

504
V. Ramesh kumar et al. Biocatalysis and Agricultural Biotechnology 16 (2018) 502–506

Table 9
Fuel characteristics of Biodiesel and different blends.
S.No. Biodiesel Parameters Biodiesel blend

Biodiesel 100 Biodiesel 50 Biodiesel 20

Control Stressed Control Stressed Control Stressed

1 Density (Kg/L) Expt 0.874–0.876 0.861–0.863 0.865–0.868 0.857–0.859 0.856–0.858 0.851–0.855

Diesel 0.838 0.838 0.838
ASTM 0.86 – 0.9 0.86 – 0.9 0.86 – 0.9
IS 0.86 – 0.9 0.86 – 0.9 0.86 – 0.9
2 Viscosity (mm2/s) at 40 °C Expt 5.4–5.6 5.0–5.1 4.1–4.3 3.7–3.9 3.2–3.4 2.7–3.0
Diesel 1.9–4.1 1.9–4.1 1.9–4.1
ASTM 1.9 – 6.0 1.9 – 6.0 1.9 – 6.0
IS 2.5 – 6.0 2.5 – 6.0 2.5 – 6.0
3 Flash point (°C) Expt 114–117 110–112 101–102 98–100 92–94 88–91
Diesel 75 75 75
ASTM 130 130 130
IS 120 120 120
4 Acid value (mg KOH/g) Expt 0.352–0.355 0.347–0.350 0.193–0.195 0.186–0.191 0.127–0.129 0.122–0.124
Diesel Max 0.5 Max 0.5 Max 0.5
ASTM Max 0.8 Max 0.8 Max 0.8
IS Max 0.5 Max 0.5 Max 0.5
5 Sulphur (mg/kg) Expt 1.6 – 1.8 1.7 – 1.9 24.6 – 25.8 25.1 – 27.3 52.8 – 53.4 50.3 − 52.5
Diesel 63.1 63.1 63.1
ASTM 50 50 50
IS 50 50 50
6 Cetane number (min) Expt 51–53 49–50 54–57 49–52 56 − 58 53–55
Diesel 55.60 55.60 55.60
ASTM 47 47 47
IS 51 51 51

This suggests that stress can be used as a tool to increase lipid content in
microalgae at the same time balancing its biomass yield would be more
productive.
The fatty acid profile of Chlorella vulgaris as presented in Table 6
shows the presence of considerable amount of saturated fatty acids
(palmitic acid and stearic acid) together with unsaturated oleic acid and
arachidonic acid. While the levels of saturated fatty acids along with
oleic acid are desirable for biodiesel yield and stability, the levels of
arachidonic acid interfere with the properties of biodiesel. Upon heat
Stress had its impact on the major biomolecules and is shown in
shock stress the levels of all these fatty acids increase significantly at the
Table 2. In Chlorella vulgaris the total protein levels decreased sig-
expense of other minor fatty acids. Although this results in a better yield
nificantly (p < 0.0001) when subjected to heat shock stress. The de-
the biodiesel properties would remain the same for both the control and
crease in protein levels indicate that stress has had an impact on the
stressed Chlorella vulgaris.
organism and also shows that specific stress proteins which would be
The fatty acid profile of Leptolyngbya sp. (Table 7) has a balanced
produced due to stress are limited in the microalga. The total carbo-
level of saturated (palmitic acid and stearic acid) and unsaturated
hydrate in the microalga declined by little over 50% due to stress. On
(Oleic acid and linoleic acid) fatty acids. The advantage that Lepto-
the contrary the total lipids rose significantly upon stress at the expense
lyngbya sp. has over Chlorella vulgaris is that, under stress, the micro-
of carbohydrates. Similar effects were observed in Leptolyngbya sp. ex-
algae significantly has an increased level of saturated fatty acids and
cept that there was a statistically significant increase in protein levels.
oleic acid which is desirable for biodiesel stability and vital char-
This indicates the ability of the microalga to sustain heat shock stress as
acteristics. The increase in lipids has happened at the expense of other
the excess protein indicates stress protein production. A highly appre-
biomolecules (Carvalho et al., 2009).
ciable increase in lipid makes the microalga as a suitable resource for
The biodiesel yield from the lipids of Chlorella vulgaris and
biodiesel production (Santhosh Kumar et al., 2017). A phenomenal
Leptolyngbya sp. (Table 8) was appreciable. The percentage increase
decrease in the pigmentation of both the microalgae as shown in
doubled in the case of Leptolyngbya sp. compared to that of Chlorella
Table 3, implies that both the microalgae have been deeply impacted by
vulgaris.
the heat shock stress.
A comparison between the fuel characteristics of pure biodiesel
The critical factor of all biofuel research is that the abundant need
(Biodiesel 100), 50% blend (Biodiesel 50) and 20% blend (Biodiesel 20)
for bioresource (Borowitzka, 1995). Any technique to increase the
are presented in Table 9. It is evident from the analysis that the bio-
biomass does not yield sufficient lipids and those techniques that in-
diesel and the different blends comply within the ASTM and IS stan-
crease lipids drastically reduce the biomass yield (Chisti, 2007). The
dards thereby making them the choice of the next generation. Wang
biomass productivity Table 4 indicates that due to heat shock stress the
et al. (2000) has proved that the emissions of biodiesel were non-toxic
biomass productivity has decreased in both the microalgae. However
even without engine modifications.
compared with Chlorella vulgaris the percentage decrease in Leptolynbya
sp is significantly less making it a productive source for biodiesel. Also a
comparable increase in lipid productivity (Table 5) due to heat shock 8. Conclusion
stress indicates that stress induces certain proteins which in turn in-
crease the lipid content in both Chlorella vulgaris and Leptolyngbya sp. Chlorella vulgaris has been the ideal fresh water microalgae for
biodiesel production. Leptolyngbya sp. has been a competitor for

505
V. Ramesh kumar et al.
Chlorella vulgaris and the present study proves its worth. The biodiesel
transesterified from these microalgae also had desirable characteristics
making it the potential fuel of the future.
References
Borowitzka, M.A., 1995. Microalgae as sources of pharmaceuticals and other biologically
active compounds. J. Appl. Phycol. 1995.
Chisti, Y., 2007. Biodiesel from microalgae. Biotechnol. Adv. 25, 294–306. https://doi.
org/10.1016/j.biotechadv.2007.02.001.
Carvalho, A.P., Carvalho, A.P., Monteiro, C.M., Malcata, F.X., 2009. Simultaneous effect
of irradiance and temperature on biochemical composition of the microalga Pavlova
lutheri. J. Appl. Phycol. 21, 543–552. https://doi.org/10.1007/s10811-009-9415-z.
El Shimi, H.I., Moustafa, S.S., 2018. Biodiesel production from microalgae grown on
domestic wastewater: feasibility and Egyptian case study. Renew. Sustain. Energy
Rev. 82, 4238–4244. https://doi.org/10.1016/j.rser.2017.05.073.
Giraldo Calderón, N.D., Díaz Bayona, K.C., Atehortúa Garcés, L., 2018. Immobilization of
the green microalga Botryococcus braunii in polyester wadding: effect on biomass,
fatty acids, and exopolysaccharide production. Biocatal. Agric. Biotechnol. 14,
80–87. https://doi.org/10.1016/j.bcab.2018.02.006.
Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement with
the Folin phenol reagent. J. Biol. Chem. 193, 265–275.
Marudhupandi, T., Gunasundari, V., Ajith Kumar, T.T., Tissera, K.R.A., 2014. Influence of
citrate on Chlorella vulgaris for biodiesel production. Biocatal. Agric. Biotechnol. 3,
386–389. https://doi.org/10.1016/j.bcab.2014.03.008.
Omar, S.A., Fu, Q.T., Chen, M.S., Wang, G.J., Song, S.Q., Elsheery, N.I., Xu, Z.F., 2011.
Identification and expression analysis of two small heat shock protein cDNAs from
developing seeds of biodiesel feedstock plant Jatropha curcas. Plant Sci. 181,
506
Biocatalysis and Agricultural Biotechnology 16 (2018) 502–506
632–637. https://doi.org/10.1016/j.plantsci.2011.03.004.
Roe, H.J., 1955. The determination of sugar in blood and spinal fluid with anthrone
reagent. J. Biol. Chem. 1, 335–343.
Ramesh kumar, V., Melchias, G., 2014. Effect of temperature on the lipid content in
Nannochloropsis oculata, Dunaliella salina and Isochyrsis galbana for biodiesel pro-
duction. Int. J. Pharma Bio Sci. 5, 499–506. 〈https://doi.org/6(2)(B)36-52-April-
2015〉.
Sterman, N.T., 1988. Spectrophotometric and Fluorometric Chlorophyll Analysis.
Experimental Psychology. Cambridge University Press, Cambridge, pp. 35–46.
Sivaramakrishnan, R., Incharoensakdi, A., 2018. Utilization of microalgae feedstock for
concomitant production of bioethanol and biodiesel. Fuel 217, 458–466. https://doi.
org/10.1016/j.fuel.2017.12.119.
Santhosh Kumar, K., Prasanthkumar, S., Ray, J.G., 2017. Biomass yield, oil productivity
and fatty acid profile of Chlorella lobophora cultivated in diverse eutrophic waste-
waters. Biocatal. Agric. Biotechnol. 11, 338–344. https://doi.org/10.1016/j.bcab.
2017.08.006.
Schenk, P.M., Thomas-hall, S.R., 2008. Second generation biofuels : high-efficiency mi-
croalgae for biodiesel production. BioEnergy Res. 20–43. https://doi.org/10.1007/
s12155-008-9008-8.
Tüccar, G., Aydin, K., 2013. Evaluation of methyl ester of microalgae oil as fuel in a diesel
engine. Fuel 112, 203–207. https://doi.org/10.1016/j.fuel.2013.05.016.
Wang, W.G., Lyons, D.W., Clark, N.N., Gautam, M., Norton, P.M., 2000. Emissions from
nine heavy trucks fueled by diesel and biodiesel blend without engine modification.
Environ. Sci. Technol. 34, 933–939. https://doi.org/10.1021/es981329b.
Zhang, L., Cheng, J., Pei, H., Pan, J., Jiang, L., Hou, Q., Han, F., 2018. Cultivation of
microalgae using anaerobically digested effluent from kitchen waste as a nutrient
source for biodiesel production. Renew. Energy 115, 276–287. https://doi.org/10.
1016/j.renene.2017.08.034.