G Model

MAT-6500; No. of Pages 13 ARTICLE IN PRESS

Maturitas xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Maturitas
journal homepage: www.elsevier.com/locate/maturitas

The MAOA, COMT, MTHFR and ESR1 gene polymorphisms are

associated with the risk of depression in menopausal women
Różycka Agata a,∗,1 , Słopień Radosław b,1 , Słopień Agnieszka c , Dorszewska Jolanta d ,
Seremak-Mrozikiewicz Agnieszka e,f , Lianeri Margarita a , Maciukiewicz Małgorzata g ,
Warenik-Szymankiewicz Alina b , Grzelak Teresa h , Kurzawińska Grażyna e ,
Drews Krzysztof e , Klejewski Andrzej i , Jagodziński Paweł P. a
a
Department of Biochemistry and Molecular Biology, Poznan University of Medical Sciences, 6 Swiecickiego St., 60-781 Poznan, Poland
b
Department of Gynecological Endocrinology, Poznan University of Medical Sciences, 33 Polna St., 60-535 Poznan, Poland
c
Department of Child and Adolescent Psychiatry, Poznan University of Medical Sciences, 27/33 Szpitalna St., 60-572 Poznan, Poland
d
Laboratory of Neurobiology, Department of Neurology, Poznan University of Medical Sciences, 49 Przybyszewskiego St., 60-355 Poznan, Poland
e
Department of Perinatology and Women’s Diseases, Poznan University of Medical Sciences, 33 Polna St., 60-535 Poznan, Poland
f
Department of Pharmacology and Phytochemistry, Institute of Natural Fibres and Medicinal Plants, 71b Wojska Polskiego St., 60-630 Poznan, Poland
g
Department of Psychiatric Genetics, Poznan University of Medical Sciences, 27/33 Szpitalna St., 60-572 Poznan, Poland
h
Laboratory of Biology of Civilization-Related Diseases, Poznan University of Medical Sciences, 6 Swiecickiego St., 60-781 Poznan, Poland
i
Department of Nursing, Poznan University of Medical Sciences, 11 Smoluchowskiego St., 60-179 Poznan, Poland

a r t i c l e i n f o a b s t r a c t

Article history: Objective: The aim of the study was assessment of a possible relationship between the polymorphisms of
Received 8 February 2015 the candidate genes participating in the etiology of some neurological and psychiatric disorders and the
Received in revised form 16 October 2015 risk of depression in perimenopausal and postmenopausal women.
Accepted 23 October 2015
Methods: A total of 167 (54 perimenopausal and 113 postmenopausal) Caucasian women from western
Available online xxx
Poland, aged 42–67, were recruited as the patient group in the study because of depressive symptoms, and
another 321 healthy women (102 perimenopausal and 219 postmenopausal) served as the controls. All
Keywords:
study participants were evaluated for climacteric and depressive disorders according to the Kupperman
MAOA
COMT
index and Hamilton rating scale for depression (HRSD), respectively. The following candidate genes were
MTHFR selected for the study: 5HTR2A, 5HTR1B, 5HTR2C, TPH1, TPH2, MAOA, COMT, NET, GABRB1, ESR1, MTHFR,
ESR1 MTR and MTHFD1. In each group the frequencies of the polymorphisms were determined using PCR-RFLP
Gene polymorphism analysis.
Menopausal depression Results: After correcting for Bonferroni multiple tests, we found associations between the MAOA
c.1460C > T (SNP 1137070), COMT c.472G > A (SNP 4680), MTHFR c.677C > T (SNP 1801133) and ESR1
454−351 A > G (SNP 9340799) polymorphisms to mild and moderate depressive symptoms in menopausal
women. In the perimenopausal and postmenopausal women, genotype association of the MAOA c.1460
CT and c.1460 CT + TT (OR = 1.83; pcorr = 0.009 and OR = 1.85; pcorr = 0.003, resp.), and of the MTHFR c.677
TT and c.677 CT + TT (OR = 3.52; pcorr = 0.00009 and OR = 2.06; pcorr = 0.0006, resp.), as well as of the COMT
c.472 GA and COMT c.472 GA + AA genotypes (OR = 2.23; pcorr = 0.03 and OR = 2.17; pcorr = 0.027, resp.)
in the postmenopausal women revealed significantly higher frequencies of these variants in depressed
female patients than in controls, whereas the ESR1 454−351 AG and 454−351 AG + GG genotypes were asso-
ciated with lower risk of depression in postmenopausal women (OR = 0.48; pcorr = 0.012, and OR = 0.52;
pcorr = 0.015, resp.).
Conclusions: Our study substantiates the involvement of the MAOA and MTHFR polymorphisms in climac-
teric depression and offers evidence that the COMT and ESR1 genes may also play a role in the susceptibility
to depressive mood in postmenopausal women.
© 2015 Elsevier Ireland Ltd. All rights reserved.

∗ Corresponding author at: Department of Biochemistry and Molecular Biology, University of Medical Sciences, 6 Swiecickiego St., 60-781 Poznan, Poland.
Fax: +48 61 8546 510.
E-mail address: arozycka@ump.edu.pl (A. Różycka).
1
These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.maturitas.2015.10.011
0378-5122/© 2015 Elsevier Ireland Ltd. All rights reserved.

Please cite this article in press as: A. Różycka, et al., The MAOA, COMT, MTHFR and ESR1 gene polymorphisms are associated with the
risk of depression in menopausal women, Maturitas (2015), http://dx.doi.org/10.1016/j.maturitas.2015.10.011
G Model
MAT-6500; No. of Pages 13 ARTICLE IN PRESS
2 A. Różycka et al. / Maturitas xxx (2015) xxx–xxx
1. Introduction
Epidemiologic studies indicate that the incidence of first onset
or recurrent episodes of clinical depression in women during
midlife ranges from 20 to 30% [1]. The potential relationship
between depressive disorders and menopausal stages has been the
object of intense controversy. Some studies have reported a higher
likelihood of depressive symptoms as women progress through
the menopausal transition [1–5], while others have reported an
increased likelihood in the postmenopausal period [6,7]. The preva-
lent findings suggest that incidence or severity of depressive
symptoms is greatly increased in women during the transition to
and after menopause, and hormonal changes occurring in these
periods are thought to play an important role in this process [1–7].
Moreover, there are some studies clearly indicating that psychoso-
cial factors may influence the risk for depressive symptoms in
middle-aged women [8,9]. Psychological, as well as vasomotor,
symptoms including irritability, agitation, attention deficit, distrust
of family members and partners, sleep disorders, lack of libido,
hyperactivity and quarrelsomeness, is a common clinical disorder
in menopausal women; however, little is known about the risk
and protective factors that influence the occurrence and course of
depression in women during midlife. In particular, the role of family
history of depression in the development of incident and recurrent
depression in middle-aged women is unknown [10]. Similarly, very
few attempts to correlate menopausal depressive traits with gene
polymorphisms have been made to date [11–17].
It has been reported that mood changes, including depression,
may be linked to genes related to the monoamine neurotransmitter
system. Well-studied components of this system are the sero-
tonin (5-HT) receptor 2A (5HTR2A), 1B (5HTR1B), and 2C (5HTR2C)
genes, and the rate-limiting enzyme in the biosynthesis of 5-HT,
tryptophan hydroxylase 1 and 2 (TPH1 and TPH2). Genetic associa-
tions with depressive disorders have been reported for the 5HTR2A
c.102C > T, 5HTR1B c.861G > C, 5HTR2C c.68G > C, TPH1 218C > A, and
TPH2 c.1077G > A polymorphisms [18–22]. After acting at its recep-
tor, 5-HT is metabolized by monoamine oxidase A (MAO-A), which
also exhibits a high affinity for norepinephrine (NE), epinephrine
and dopamine (DA, which is equally deaminated by MAO-A and
MAO-B), and therefore MAO activity plays a critical role in the
regulation of the monoaminergic system [23]. Indeed, several stud-
ies indicate that the gene coding for MAO-A (MAOA), mapped to
the short arm of the X chromosome, may also be involved in
the pathogenesis of depression [11,24–30] (Table 1). Alterations
in monoamine transmitter function and processing in men and
women have been described, and differential sex effects poten-
tially account for the higher female prevalence of mood disorders
[27]. Functional analyses of the MAOA c.1460C > T genetic varia-
tion (SNP 1137070) have revealed the existence of the high activity
T allele and the low activity C allele of this polymorphism [23].
Another regulatory polymorphism, a 30-bp variable number tan-
dem repeat (VNTR) in the MAOA gene promoter (MAOA-uVNTR)
has been demonstrated to affect the transcriptional efficiency of
this gene [31]. It has been reported that women with a high activ-
ity MAOA genotype differ from men and from women with a low
activity genotype, which suggests that previously reported gen-
der differences in serotoninergic mechanisms may be driven in
some women by the variability, either high or low, in activity of
the MAOA genotype [27]. Our previous study [11] substantiates
the genetic contribution of the MAOA c.1460 T high activity vari-
ant in postmenopausal depression and indicates that estradiol (E2)
fluctuations are also associated with this polymorphism (Table 1).
The major enzymatic degradation pathways of catecholamine
neurotransmitters and catechol derivatives of estrogen include
the action of catechol-O-methyltransferase (COMT). COMT cat-
alyzes the transfer of a methyl group from S-adenosylmethionine
Please cite this article in press as: A. Różycka, et al., The MAOA, COMT, MTHFR and ESR1 gene polymorphisms are associated with the
risk of depression in menopausal women, Maturitas (2015), http://dx.doi.org/10.1016/j.maturitas.2015.10.011
(SAM) on the catechol-O-hydroxyl group in the presence of mag-
nesium ions [32]. The demethylated SAM is then immediately
converted to S-adenosyl-l-homocysteine (SAH), which is subse-
quently deadenosylated to form homocysteine (Hcy). The COMT
gene, which is mapped on chromosome 22, codes for an enzyme
mainly involved in the deactivation of DA, although it is also poten-
tially capable of degrading NE. A common functional polymorphism
in COMT, which is the result of a G to A mutation (c.472G > A) that
translates into a valine to methionine substitution at codon 158
(Val158Met), has been linked to a 3–4–fold decrease of the methy-
lation activity of the enzyme [33], and also has been shown to
account for a 40% decrease in enzyme activity in the human brain
[34]. Studies have indicated that the Met 158 COMT allele influ-
ences pre-frontal cortex and limbic activity in response to aversive
or emotionally-negative stimuli and to the endocrine response to
stress [35,36]. A large number of evidence suggests that this poly-
morphism is associated with major depressive disorder (MDD) and
bipolar depression [37–45] (Table 1).
It has been reported that disturbances in the folate-dependent
one-carbon metabolism may contribute to some congenital, neu-
rological, and movement disorders, such as neural tube defects,
non-syndromic cleft lip and palate, epilepsy, cognitive impair-
ment in later life, Alzheimer’s disease (AD), primary dystonia,
Huntington’s disease, and Parkinson’s disease (PD) [46–50].
The reactions performed by the key enzymes of the methyl
cycle, 5,10-methylenetetrahydrofolate reductase (MTHFR), methi-
onine synthase (MTR), and NADP-dependent trifunctional enzyme
MTHFD1, use cofactors of folate, vitamins B12 and B6 as donors
of methyl groups, which are necessary for the synthesis of pro-
teins, DNA, RNA, phospholipids, myelin, and catecholamines. The
MTHFR c.677C > T (Ala222Val) polymorphism reduces the activity
of MTHFR by 50% [30], which is associated with an elevation of
blood plasma Hcy and a low SAM concentration. Other studies
have also reported suggestive associations between decreased for-
mation of SAM and the MTR c.2756A > G (Asp919Gly) or MTHFD1
c.1958G > A (Arg653Gln) polymorphic variants [49,50]. Diminished
activity of MTHFR, a rate-limiting enzyme for a cofactor for cat-
echolamine synthesis, has previously been linked to psychiatric
conditions such as mental retardation, schizophrenia, affective dis-
orders, and depression [51–54]. Our findings [12] also indicate a
significant role of the MTHFR c.677C > T polymorphic variant in the
development of depression in postmenopausal women (Table 1).
E2 likely promotes serotoninergic and norepinephrinergic neu-
rotransmission by influencing synthesis, release, metabolism, or
reuptake of 5-HT and NE [55]. In large part, E2 exerts these biologi-
cal effects through intracellular activation of its principal receptors,
estrogen receptor ␣ (ESR1) and estrogen receptor ␤ (ESR2) [56],
which have been identified in region-specific areas of the brain. Of
the two estrogen receptor subtypes, ESR1 is more predominantly
expressed in brain areas that mediate affective and motivational
processing, including the amygdala and hypothalamus [57]. The
most frequently studied ESR1 polymorphisms are ESR1 454−351 A>G
(SNP 9340799) and ESR1 454−397 C > T (SNP 2234693), otherwise
known as XbaI and PvuII due to the creation of the aforemen-
tioned restriction sites. They are located at position 351 and 397
of intron 1, respectively, and are in strong linkage disequilibrium
(LD). There is some evidence to indicate a significant associa-
tion of the common ESR1 variants with more severe depressive
symptoms in menopausal women [14–17]. Currently, there is no
definitive evidence concerning the functionality of these polymor-
phisms or the biological pathways they affect; however, some
findings support the hypothesis that these SNPs impact estrogen
activity, as they may alter ESR1 gene expression by influencing tran-
scription factor binding [13,58,59]. Moreover, since ESR1 acts as a
ligand-activated transcription factor affecting hundreds of genes,
including regulating the synthesis and metabolism of various neu-
 MAT-6500; No. of Pages 13
G Model
risk of depression in menopausal women, Maturitas (2015), http://dx.doi.org/10.1016/j.maturitas.2015.10.011
Please cite this article in press as: A. Różycka, et al., The MAOA, COMT, MTHFR and ESR1 gene polymorphisms are associated with the

Table 1
Studies across previously investigated MAOA, COMT, MTHFR and ESR1 gene variants associated with depression.

Study reference Ethnicity Patients (n) Controls (n) Gene variant Significance Main finding
(Country)

Mild depressive symptoms

Słopień et al. [11] Caucasian (Poland) 113 219 MAOA CC vs. CT + TT High activity T allele or high activity CT and TT genotypes appeared
Postmenopausal c.1460C > T (OR = 1.77; p = 0.02) with a significantly higher frequency in depressed postmenopausal
women women; Patients with the MAOA TT genotype had a significantly
higher E2 concentration.
Du et al. [24] Caucasian (Canada) 191 233 MAOA CC vs. CT + TT The c.1460C > T polymorphism in male patients carrying allele T was
c.1460C > T (p < 0.05) found to be associated with depression; Haplotype analysis revealed
MAOA uVNTR that one of the EcoRV-uVNTR haplotypes was significantly more
frequent among male patients than male controls.
Grochans et al. [25] Caucasian 184 446 MAOA uVNTR NS No statistically significant differences between the genotype
(Poland) postmenopausal distribution and the allele frequency of the 30-bp VNTR polymorphism
women in the MAOA and depressive symptoms in postmenopausal women.

ARTICLE IN PRESS
Doornbos et al. [26] Caucasian 89 women with – MAOA uVNTR p = 0.044 Significant interaction between the development of depressive
(Netherlands) PPD COMT p = 0.026 symptoms in the course of pregnancy and the low activity variants of
c.472G > A both polymorphisms; COMT × MAOA interaction showed a steep

A. Różycka et al. / Maturitas xxx (2015) xxx–xxx

increase in depressive symptoms during pregnancy and the 6-week
postpartum period.
Comasco et al. [37] Caucasian 275 women with – COMT GG vs. GA + AA The associations between genetic polymorphism and PPD symptoms
(Sweden) PPD c.472G > A (p = 0.005) were statistically significant only at the 6-week time-point; G×E
MAOA uVNTR NS (depression interaction of AA genotype in the presence of previous psychiatric
scores) contact and maternity stressors; Women with the low activity variants
of the COMT A allele and the MAOA uVNTR scored higher for PPD
symptoms.
Słopien et al. [12] Caucasian (Poland) 83 postmenopausal 89 MTHFR TT vs. CC + CT There was a significant contribution of the MTHFR T allele to
women c.677C > T (OR = 3.48; p=0.01) depression in postmenopausal women.
CC vs. CT + TT
(OR = 2.34;
p = 0.009)
Zhou et al. [9] Asian 78 menopausal 72 ESR1 NS The ESR1 454−397 CT genotype was associated with cognitive decrease
(China) women with 454−351 A > G (p = 0.033).
depression and/or
anxiety
Tiemeier et al. [61] Caucasian 2268 men and – ESR1 NS NS in men or women.
(Netherlands) postmenopausal 454−351 A > G
women
Malacara et al. [62] Latino (Mexico) 177 – ESR1 NS Depression was associated with log(estrone) (p = 0.011)
postmenopausal 454−351 A > G
women

Severe depressive symptoms and MDD

Gutiérrez et al. [28] Caucasian (Spain) 301 156 MAOA uVNTR NS (depression Increased frequency of high activity uMAOA alleles was found in MDD
scores) female patients presenting with a seasonal pattern or psychotic
symptoms.
Schulze et al. [29] Caucasian 146 101 MAOA uVNTR p = 0.029 Increased frequency of genotypes containing only high activity alleles
(Germany) in female patients with recurrent MDD.
Rivera et al. [30] Caucasian 242 980 MAOA uVNTR p = 0.001 Significant associations between depression and either high activity
(Spain) alleles or high activity genotype in women.
Cusin et al. [38] Caucasian 212 663 MAOA uVNTR NS (depression MAOA and COMT gene variants are not involved in susceptibility
COMT scores; time course toward different time courses in mood disorders.
c.472G > A of illness)

3
 4

MAT-6500; No. of Pages 13

G Model
risk of depression in menopausal women, Maturitas (2015), http://dx.doi.org/10.1016/j.maturitas.2015.10.011
Please cite this article in press as: A. Różycka, et al., The MAOA, COMT, MTHFR and ESR1 gene polymorphisms are associated with the

Table 1 (Continued)

Study reference Ethnicity Patients (n) Controls (n) Gene variant Significance Main finding
(Country)

Åberg et al. [39] Caucasian 405 2151 COMT GG vs. GA + AA Effect driven by males; Depressed individuals displayed a higher
(Sweden) c.472G > A (OR = 1.49, frequency of the GA and AA genotypes compared to controls; G×E
p = 0.009) interaction with family problems.
Ohara et al. [40] Asian 75 135 COMT GG vs. GA + AA; A allele → MDD
(Japan) c.472G > A (OR = 2.19;
p = 0.012)
Serretti et al. [41] Caucasian 359 116 COMT NS A trend was observed toward an excess of COMT A allele in the pooled
(Italy) c.472G > A sample.
Massat et al. [42] European 378 628 COMT NS (depression G allele → early onset MDD
Caucasian c.472G > A scores); early onset

ARTICLE IN PRESS
MDD (p = 0.009)
Massat et al. [43] European 462 295 COMT AA vs. GG + GA; G allele → early onset MDD
Caucasian c.472G > A (p = 0.03); early

A. Różycka et al. / Maturitas xxx (2015) xxx–xxx

onset MDD
(p = 0.04)
Shen et al. [44] Asian 368 219 COMT GA vs. GG + AA The COMT GA genotype was more common among depressed
(China) c.472G > A (OR = 1.52, p = 0.02) individuals than among controls.
MTHFR C vs. T The MTHFR T allele and CT genotype were significantly more frequent
c.677C > T (OR = 1.81; in patients than in the control group.
p = 0.001)
CT vs. CC + TT
(OR = 3.66;
p = 0.001)
Bjelland et al. [52] Caucasian 243 6806 MTHFR CC vs. TT The strongest relationship was observed between the TT genotype and
(Norway) c.677C > T (OR = 1.69, p < 0.05) depression; The TT genotype has been linked to
hyperhomocysteinemia and folate levels in the subgroup of
middle-aged women, which in turn have been associated with
depression.
Kelly et al. [53] Caucasian 100 89 MTHFR p = 0.03 The low activity variant of MTHFR was significantly more common in
(Ireland) c.677C > T the group with a history of depressive disorder.
Almeida et al. [54] Caucasian 42 198 MTHFR NS MTHFR gene variant does not play an important role in the modulation
(Australia) c.677C > T of mood and cognitive performance in later life.
Ryan et al. [15] Caucasian 564 elderly men 5453 ESR1 AA vs. GG Women having the GG genotype were significantly less likely to have
(France) (n=110) and 454−351 A > G (OR = 0.60, late-life depression compared with women with the AA genotype.
women (n=454) p = 0.009)
Kim et al. [16] Asian 43 63 ESR1 AG vs. AA + GG; Higher frequency of AG heterozygotes in postmenopausal women
(Korea) 454−351 A > G p < 0.001 with MDD.
Ryan et al. [17] Caucasian 466 elderly women 3521 ESR1 AA vs. GG Women having the GG genotype had an increased risk of MDD across
(France) 454−351 A > G (OR = 1.57, their lifetime compared with women who were homozygous for the A
p = 0.009) allele; Women who were heterozygote AG were not at a significantly
increased risk.
Tsai et al. [63] Asian 126 menopausal 89 ESR1 NS The ESR1 454−397 CC genotype (p = 0.01) and C allele (p = 0.004) were
(China) women 454−351 A > G more frequent in MDD.

Abbreviations: VNTR: variable number tandem repeat; MAO: monoamine oxidase; COMT: catechol-O-methyltransferase; MTHFR: methylenetetrahydrofolate reductase; ESR: estrogen receptor; MDD: Major Depressive Disorder;
MD: Mood Disorder; PPD: Postpartum Depression; G × E: Gene–Environment Interaction; NS: non-significant.
G Model
MAT-6500; No. of Pages 13 ARTICLE IN PRESS
A. Różycka et al. / Maturitas xxx (2015) xxx–xxx
rotransmitters in the brain, the exact mechanisms by which ESR1
variants could influence depression are complex [55–63] (Table 1).
Since estrogens also exert an influence on multiple neurotransmit-
ter receptors, such as inhibition of the GABA receptors [60], they
may act on large areas of the nervous system causing a cascade of
effects that are associated with mood improvement.
Emerging evidence suggests that the COMT polymorphic effects
can be modified by epistatic interactions with genes in concurrent
molecular pathways [64,65]. For example, the effects of the COMT
high activity Val158 allele on disease risk have been shown to be
augmented by a low activity variant of the MTHFR gene, which reg-
ulates the bioavailability of SAH, a strong, noncompetitive inhibitor
of COMT [66–69]. Thus, we hypothesize that polymorphisms in
COMT and functionally related genes implicated in depression,
including ESR1 and MTHFR, interact in a concerted manner to influ-
ence COMT enzymatic activity and depression. In order to test this
hypothesis, the present study seeks to estimate the relationship
between SNPs located in these genes and depressive disorder in
menopausal women. Since relatively little information is available
that evaluates genetic association with menopausal depression, the
aim of this study was also the assessment of a possible relation
between polymorphic variants of the candidate genes participat-
ing in the etiology of some neurological and psychiatric disorders
and the risk of depression in perimenopausal and postmenopausal
women. The following genes were selected for the study: genes
of receptors and enzymes of the serotoninergic system (5HTR2A,
5HTR1B, 5HTR2C, TPH1, TPH2, MAOA), genes of enzymes of the nora-
drenergic and dopaminergic systems (COMT, NET), one gene of the
GABAergic system (GABRB1), the gene of estrogen receptor ␣ (ESR1),
and genes of the key enzymes of the methyl cycle (MTHFR, MTR and
MTHFD1).
2. Material and methods
2.1. Patients
The study group consisted of 488 women, aged 42–67 years,
recruited from Polish Caucasian residents of Greater Poland
(Wielkopolska region). All women were admitted to the Outpa-
tient Clinic at the Obstetrics and Gynecology Clinic at the University
Hospital of Medical Sciences in Poznan because of climacteric
complaints, and recruited to the study according to medical doc-
umentation and hormonal levels examined in the Department of
Gynecological Endocrinology. The study participants did not abuse
alcohol or cigarettes, or benzodiazepines; had not been diagnosed
as having endocrinological, cancerous, neurological or mental
diseases, and had undergone neither hysterectomy nor oophorec-
tomy. None of these women had received hormonal replacement
therapy (HRT) for at least 6 weeks before starting the study.
Each participant was assigned to one of the following categories,
based on her bleeding patterns: (1) perimenopausal, changes in
cycle length of ≥7 days in either direction from the participant’s
personal baseline, observed for at least two consecutive cycles in
the study or up to 11 months of amenorrhea during the study, or (2)
postmenopausal, ≥12 months of amenorrhea. Women with regular
menstrual cycles in the 22–35 day range and no change in cycle
length as well as women with primary ovarian insufficiency (POI),
thyroid dysfunction, or hyperprolactinemia, were excluded.
All participants were informed in detail about the purpose and
the course of the study, and gave their written informed consent,
approved by the Ethics Committee, Poznan University of Medical
Sciences.
Height and weight were measured by trained staff according to
a standard protocol and were used to calculate body mass index
(BMI) as weight (kg)/height (m)2 formula. The severity of climac-
Please cite this article in press as: A. Różycka, et al., The MAOA, COMT, MTHFR and ESR1 gene polymorphisms are associated with the
risk of depression in menopausal women, Maturitas (2015), http://dx.doi.org/10.1016/j.maturitas.2015.10.011
5
teric and depressive symptoms in all participants was evaluated
with the Kupperman index [70] and the Hamilton rating scale for
depression (HRSD) [71], respectively. The numerical Kupperman
index scored 11 climacteric symptoms, each rated from 0 to 3
according to severity (where 0 = no symptoms and 3 = most severe),
then weighted and the total sum calculated. According to HRSD,
mild depression was defined as a score more than 7 and less than or
equal to 17, and moderate depression was defined as a score more
than 17 and less than or equal to 25. Family history of depression
was determined by asking one yes/no question about depression
in first-degree relatives.
2.2. Genotyping by RFLP
Genetic testing was carried out on the basis of genomic DNA,
which was extracted from the study participants’ blood lympho-
cytes by salting-out procedure. Isolated and purified DNA was
prepared as the matrix for amplification of fragments of the fol-
lowing genes: 5HTR2A, 5HTR1B, 5HTR2C, MAOA, COMT, NET, TPH1,
TPH2, GABRB1, ESR1, MTHFR, MTR and MTHFD1, using specific PCR
primers (Table 2). All analyzed polymorphic variants were identi-
fied by appropriate restriction enzyme digestion by means of the
polymerase chain reaction-restriction fragment length polymor-
phism (PCR-RFLP) assay. The digested PCR products were analyzed
on a 2% agarose gel containing ethidium bromide, under UV light.
2.3. Statistical analysis
Spearman’s rank R correlation coefficient was used to iden-
tify and test the strength of a relationship between the ordinal
variables. Mann–Whitney nonparametric test for independent
variables was used to examine the possible differences in hor-
monal parameters between investigated groups. Fisher exact test
with two-tailed P values was used for the assessment of differences
in depressive symptom frequencies between perimenopausal and
postmenopausal patient groups. The genotype and allele fre-
quencies of all analyzed polymorphisms were compared between
the group of perimenopausal and postmenopausal women with
depression and without depression using a case-control study
design. The distribution of genotypes in all groups was tested
for deviation from Hardy–Weinberg equilibrium. Significance was
evaluated by the Fisher exact test. Considering the potential
false positive rate incurred by multiple comparisons of several
gene associations in the control and three patient groups (peri-
menopausal, postmenopausal and combined groups), we applied
the Bonferroni correction method to adjust the p value (pcorr ). The
odds ratios (ORs) and the confidence intervals (CIs) were estimated
for each genotype and compared with the homozygous one for
the genotype of higher frequency among controls, which was set
as the reference genotype. The calculations were performed using
the GraphPad (Instant, USA) program. An online (http://ihg.gsf.de/
cgi-bin/hw/hwa1.pl) program for deviation from Hardy–Weinberg
equilibrium was applied. In all cases, p < 0.05 was considered sta-
tistically significant.
3. Results
The study involved 488 (156 perimenopausal and 332 post-
menopausal) Caucasian women recruited from western Poland.
All women were chosen in a consecutive manner because of
menopausal symptoms and examined. According to the HRSD,
65.8% (n = 321) of the women did not show any depressive symp-
toms; however, these symptoms were present in 34.2% (n = 167)
of the women. Two groups of women without depression, 102
perimenopausal and 219 postmenopausal (all with HRSD score
≤7), were considered controls for the purposes of this study. The
G Model
MAT-6500; No. of Pages 13 ARTICLE IN PRESS
6 A. Różycka et al. / Maturitas xxx (2015) xxx–xxx

Table 2
Primers and restriction enzymes used for PCR-RFLP analysis of the investigated polymorphisms.

Gene (fragment) Polymorphism (SNP) Primer sequence Product size Annealing temp. Restriction enzyme

5HTR2A (exon 1) c.102C > T (SNP 6313) F: CAAGGTGAATGGTGAGCAGA 458 bp 62 ◦ C MspI

Ser34Ser R: ATGACAAGGAAACCCAGCAG
5HTR1B (exon 1) c.861G > C (SNP 6296) F: GTGTGGGTCTTCTCCATCTCTA 516 bp 60 ◦ C HindII C
Val287Val R: GCAGGCATCTTTGCAGATAG
5HTR2C (exon 4) c.68G > C (SNP 6318) F: AGCAGTTGTTTGCATGAGC 397 bp 57 ◦ C BsrDI
Cys23Ser R: CCATAAAGGATTGCCAGGAG
MAO-A (exon 14) c.1460C > T (SNP 1137070) F: CGAGCAGCTAGGGAGGTAAG 615 bp 63 ◦ C EcoRV
Asp470Asp R: GTGGCAGGAGCTTGTATTTGTA
◦
TPH1 (intron 7) 218C > A (SNP 1800532) F: ACAGGTTTTTCCATCCGTCCT 657 bp 54 C MaeI
R: ACCACATACACACCCAAATCA
TPH2 (exon 7) c.1077G > A (SNP 7305115) F: ATCAGAAGCACCAAACATGAT 683 bp 64 ◦ C MspI
Pro312Pro R: CATGAACCTCCTTCACATGAAA
COMT (exon 4) c.472G > A (SNP 4680) F: ACCAGGGAGGTGAAATACCC 582 bp 57 ◦ C Hsp92II
Val158Met R: CCTTGGCAGTTTACCCAGAG
◦
NET (exon 9) c.1287G > A (SNP 5569) F: TCACCCTCTCCCACGTAGTT 436 bp 56 C Eco147I
Thr429Thr R: GCCCCAGTTCTAAGGCTAGG
GABRB1 (exon 5) c.537C > A (SNP 6284) F: CCATTTCCACCTGTCCATCT 741 bp 59 ◦ C TaqI
Ile791Ile R: AAGCATAAGCCCCATGAGTG
ESR1 (intron 1) 454−351 A > G (SNP 9340799) F: TCACACATCACCATTCTCAGC 619 bp 63 ◦ C XbaI
R: CTTTCATTACCTCTTGCCGTC
MTHFR (exon 4) c.677C > T (SNP 1801133 ) F: AGGCTGTGCTGTGCTGTTG 477 bp 67 ◦ C HinfI
Ala222Val R: CGCTGTGCAAGTTCTGGAC
◦
MTR (exon 26) c.2756A > G (SNP 1805087) F: GTTGGTGAAGGGAGAAGAAA 583 bp 56 C HaeIII
Asp919Gly R: CTGAAGAATGGGGGTCTGTG
MTHFD1(exon 20) c.1958G > A (SNP 2236225) F: TTCTTCTCATTCTTCCTCACA 416 bp 60 ◦ C MspI
Arg653Gln R: TCTGCTCCAAATCCTGCTTC

Table 3
Prevalence of depressive symptoms evaluated in perimenopausal and postmenopausal women.

Depressive symptoms PERI-M POST-M P valuea

% (n = 54) % (n = 113)

1. Depressive mood 40.7 (22) 42.5 (48) NS

2. Feeling of guilt 20.4 (11) 41.6 (47) P = 0.0089
3. Suicidal thoughts and tendencies 61.1 (33) 25.7 (29) P < 0.0001
4. Sleeping disorders 68.5 (37) 55.7 (63) NS
5. Shallow sleep 61.1 (33) 69.0 (78) NS
6. Waking up early 50.0 (27) 61.1 (69) NS
7. Loss of interest in activities 24.1 (13) 58.4 (66) P < 0.0001
8. Slowing of movement 18.5 (10) 23.0 (26) NS
9. Sensorimotor anxiety 75.9 (41) 65.5 (74) NS
10. Psychic symptoms of anxiety and fear 70.4 (38) 16.8 (19) P < 0.0001
11. Somatic symptoms of anxiety and fear 22.2 (12) 70.8 (80) P < 0.0001
12. Symptoms in the digestive tract 70.4 (38) 17.7 (20) P < 0.0001
13. General somatic symptoms 57.4 (31) 68.1 (77) NS
14. Symptoms in the genital system 24.1 (13) 60.2 (68) P < 0.0001
15. Hypochondria 3.7 (2) 12.4 (14) NS
16. Weight loss 5.5 (3) 5.3 (6) NS
17. Self-criticism 1.8 (1) 6.2 (7) NS
a
Fisher’s exact test with two-tailed P values was used for the assessment of differences in depressive symptom frequencies between perimenopausal (PERI-M) and
postmenopausal (POST-M) patient groups (NS, non-significant).

women with depression (all with HRSD score >7, total n = 167), that
included 54 perimenopausal and 113 postmenopausal, were con-
sidered patients for the purposes of this study. Descriptive data for
the prevalence of depressive symptoms in these study participants
are presented in Table 3. Clinical and hormonal characteristics of
the investigated groups are shown in Table 4. There were no dif-
ferences between the patients and the controls in terms of history
of smoking, alcohol use, comorbidities, family history of depres-
sion, age, socio-demographic backgrounds, and BMI. Additionally,
there was no correlation between severity of depressive or climac-
teric symptoms and age in perimenopausal and postmenopausal
group. The mean BMI was classified as overweight in both
peri- (26.5 ± 4.2 kg/m2 ) and postmenopausal (26.5 ± 5.7 kg/m2 )
women.

Table 4
Clinical and hormonal characteristics of the investigated groups.

Parameter Perimenopausal women (n = 156) Postmenopausal women (n = 332)

BMI (kg/m2 ) 26.5 ± 4.2 26.5 ± 5.7

Kupperman index 27 ± 14 25 ± 13
HRSD 12.0 ± 6.4 10.9 ± 6.7
PRL (ng/mL) 15.2 ± 6.2* 12.4 ± 8.1*
TSH (mIU/L) 1.9 ± 1.11 2.19 ± 2.5

Mann–Whitney nonparametric test for independent variables was used to examine the possible differences in hormonal parameters between investigated groups.
Mean ± SD; statistical significance at *p < 0.05.

Please cite this article in press as: A. Różycka, et al., The MAOA, COMT, MTHFR and ESR1 gene polymorphisms are associated with the
risk of depression in menopausal women, Maturitas (2015), http://dx.doi.org/10.1016/j.maturitas.2015.10.011
G Model
MAT-6500; No. of Pages 13 ARTICLE IN PRESS
A. Różycka et al. / Maturitas xxx (2015) xxx–xxx
Family history of depression in first-degree relatives was
obtained from 301 women participating in the study. Of the par-
ticipants, 187 women did not answer the question about family
history of depression in the family history assessment of the diag-
nostic survey. Approximately 16% of the women who answer the
family history question did confirm a family history of depression,
and among them 54% were patients and 46% were controls.
Climacteric symptoms were diagnosed in 55.9% (n = 273), but
not in 44.1% (n = 215), of the study participants. According to the
Kupperman index, 28.2% (n = 77) of the climacteric women had
minor symptoms, 37.4% (n = 102) had moderate symptoms, and
34.4% (n = 94) had severe climacteric symptoms. The mean values
of the Kupperman index in perimenopausal and postmenopausal
women were 27 ± 14 and 25 ± 13, respectively (Table 4). The mean
value of the HRSD in perimenopausal women was 12 ± 6, whereas
in postmenopausal women 11 ± 7. Among the perimenopausal
patients, the HRSD diagnosed mild depression in 40 women and
moderate depression in 14 women. The postmenopausal patients
included 82 women with mild depression and 31 women with
moderate depression.
The data for genotype distribution and allele frequencies of
all analyzed gene polymorphisms for perimenopausal and post-
menopausal women with depression and for the controls are
shown in Table 5. Distribution of these polymorphisms was consis-
tent with Hardy–Weinberg equilibrium in the patients and in the
control groups. No significant differences were observed in either
the frequencies of the genotypes or alleles between the patients and
the controls in the polymorphic variants of the 5HTR2A, 5HTR1B,
5HTR2C, TPH1, TPH2, COMT, NET, GABRB1, MTR and MTHFD1 genes.
By contrast, we found associations between the MAOA
c.1460C > T (SNP 1137070), COMT c.472G > A (SNP 4680), MTHFR
c.677C > T (SNP 1801133) and ESR1 454−351 A > G (SNP 9340799)
polymorphisms with depression in perimenopausal and/or post-
menopausal women (Table 5 and Table 6). Allele T of the MAOA
c.1460C > T polymorphism appeared with a significantly higher
frequency in the postmenopausal women and in the combined
group of peri- and postmenopausal patients with depression
than in the controls (pcorr = 0.027 and pcorr = 0.009, respectively).
The perimenopausal and postmenopausal carriers of the MAOA
c.1460 CT and c.1460 CT + TT genotypes had doubled their risk
of depression when they were considered separately (OR = 2.28;
p = 0.022 and OR = 2.04; p = 0.039, respectively, in perimenopausal
women, and OR = 1.65; p = 0.043 and OR = 1.77; p = 0.015, respec-
tively, in postmenopausal women), however, this association did
not remain significant after Bonferroni correction (Table 6). On
the other hand, in the combined groups this genotype associa-
tion appeared to be significant even after correction for multiple
testing (OR = 1.83; pcorr = 0.009 and OR = 1.85; pcorr = 0.003, respec-
tively, in peri- and postmenopausal women). Analysis of the COMT
c.472G > A polymorphism revealed that the GA and AA genotypes
were associated with significantly higher risk of depression in the
postmenopausal women (GG vs. GA: OR = 2.23; pcorr = 0.03 and
GG vs. GA + AA: OR = 2.17; pcorr = 0.027). The frequencies of the T
allele (the risk factor) of the MTHFR c.677C > T polymorphism in
the perimenopausal and postmenopausal groups of patients with
depression were significantly higher than in the control groups
(pcorr = 0.021 and pcorr = 0.0015, respectively). The ORs for depres-
sion susceptibility in perimenopausal women carrying the MTHFR
c.677 TT and c.677 CT + TT genotypes were 3.94 (pcorr = 0.042)
and 2.48 (pcorr = 0.033), respectively, and in the postmenopausal
patients were 3.37 (pcorr = 0.0018) and 1.89 (pcorr = 0.021), respec-
tively, whereas in the whole group ORs were 3.52 (pcorr = 0.00009)
and 2.06 (pcorr = 0.0006), respectively. The ESR1 454−351 A > G poly-
morphism in the postmenopausal patient group demonstrated a
significant difference when compared to the control group. In this
menopausal status group, the frequency of the heterozygous ESR1
Please cite this article in press as: A. Różycka, et al., The MAOA, COMT, MTHFR and ESR1 gene polymorphisms are associated with the
risk of depression in menopausal women, Maturitas (2015), http://dx.doi.org/10.1016/j.maturitas.2015.10.011
7
454−351 AG genotype was lower in patients with depression (37%)
than in women without depression (52%), whereas the frequency
of the homozygous ESR1 454−351 AA genotype in these groups
reached 47% and 31%, respectively (Table 5). The carrier status in
the postmenopausal women for the ESR1 454−351 AG and 454−351
AG + GG genotypes was associated with a significantly lower risk
of depression in comparison to the ESR1 454−351 AA genotype
(OR = 0.48; pcorr = 0.012, and OR = 0.52; pcorr = 0.015, respectively)
(Table 6).
4. Discussion
Our study investigated selected polymorphic variants for the
genes of monoaminergic (5HTR2A, 5HTR1B, 5HTR2C, TPH1, TPH2,
MAOA, COMT, NET) and GABAergic (GABRB1) systems, the key genes
of the methyl cycle (MTHRF, MTR and MTHFD1) and ESR1 in the con-
text of depressive symptoms in menopausal women. We found that
depressive mood in climacteric women may be dependent on the
MAOA, COMT, MTHFR and ESR1 polymorphisms; however, this could
also vary relative to individual menopausal status.
Research findings show that the MAOA-uVNTR in the promoter
region may contribute to the development of depression (Table 1).
In some studies, the low activity variants have been linked to
increased depressive symptoms [26,37]; conversely, other stud-
ies have shown no association [25,28,38], or have associated the
high activity variants to depression in females [28–30] or in males
[26]. With MAOA being an X-linked gene, however, such find-
ings should be interpreted with caution. The present results may
emphasize the contribution of the MAOA high activity variants to
depressive mood in women. This study, however, demonstrates
significant differences in the frequency of alleles and genotypes
of the MAOA c.1460C > T polymorphism, located in exon 14, in
relation to menopausal depression. A correlation between that
polymorphism and depressive symptoms of moderate and mild
intensity in postmenopausal women was reported for the first time
in our previous publication [11]. When the MAOA 1460 CC genotype
was used as the reference, the 1460 CT, 1460 TT and 1460 CT + TT
high activity genotypes were associated with significantly higher
risk of depression in this group of women. The present findings
demonstrate that depression in the combined group of peri- and
postmenopausal patients is closely related to the genetic contri-
bution of the MAOA high activity variants as well. These results
may support a sexually dimorphic association between the gen-
der groups as reported by others and the occurrence of alleles of
the MAOA polymorphisms that may in different ways contribute to
depression in females. Indeed, the fluctuations in ovarian hormones
during the transition to menopause and a dramatic drop in E2 levels
in the postmenopausal period might contribute to the modula-
tion of other neuroendocrine and neurotransmitter systems, thus
increasing the incidence of mood disorders in middle-aged women.
The plasma MAO activity has been found to be significantly corre-
lated with E2 levels in women, with high E2 levels leading to low
plasma MAO activity [72]. For healthy women, plasma MAO activity
is lowest at the time of ovulation, when E2 production is greatest,
but MAO activity increases during the luteal phase, when proges-
terone (PRG) is secreted. In our previous study [11], comparison
of the E2 serum concentration between postmenopausal women
with depression, and carrying different genotypes of the MAOA
c.1460C > T polymorphism, demonstrated significantly lower E2
levels in the patients with CC or CT genotypes than those with the
homozygous TT genotype variant. This may have an influence on
the risk of depressive disorders in genetically vulnerable women
that could be more sensitive to the alterations in hormonal activ-
ity during the time of peri- and postmenopause and could be more
prone to develop depressive symptoms.
 8

MAT-6500; No. of Pages 13

G Model
risk of depression in menopausal women, Maturitas (2015), http://dx.doi.org/10.1016/j.maturitas.2015.10.011
Please cite this article in press as: A. Różycka, et al., The MAOA, COMT, MTHFR and ESR1 gene polymorphisms are associated with the

Table 5
Genotype and allele distribution among perimenopausal and postmenopausal women with (w) and without (w/o) depression.
Polymorphism Perimenopausal women (n) Genotype and allele distribution absolute number (frequency) Postmenopausal women (n) Genotype and allele distribution absolute number (frequency) Allele P
valuea
CC CT TT C T CC CT TT C T C vs. T
5HTR2A c.102C > T w/o depression Total 102 35 (0.34) 53 (0.52) 14 (0.14) 123 (0.60) 81 (0.40) w/o depression Total 219 83 (0.38) 107 (0.49) 29 (0.13) 273 (0.62) 165 (0.38) P = 0.677
w depression Total 54 22 (0.41) 23 (0.42) 9 (0.17) 67 (0.62) 41 (0.38) w depression Total 113 50 (0.44) 44 (0.39) 19 (0.17) 144 (0.64) 82 (0.36)
GG GC CC G C GG GC CC G C G vs. C
5HTR1B c.861G > C w/o depression Total 97 57 (0.59) 37 (0.38) 3 (0.03) 151 (0.78) 43 (0.22) w/o depression 125 (0.57) 83 (0.38) 11 (0.05) 333 (0.76) 105 (0.24) P = 0.345
Total 219
w depression Total 54 27 (0.50) 24 (0.44) 3 (0.06) 78 (0.72) 30 (0.28) w depression 62 (0.55) 44 (0.39) 7 (0.06) 168 (0.74) 58 (0.26)
Total 113
GC GC CC G C GG GC CC G C G vs. C
5HTR2C Cys23Ser w/o depression 70 (0.69) 24 (0.24) 7 (0.07) 164 (0.82) 38 (0.18) w/o depression 151 (0.69) 57 (0.26) 11 (0.05) 359 (0.82) 79 (0.18) P = 0.374
Total 101 Total 219
w depression Total 54 43 (0.79) 9 (0.17) 2 (0.04) 95 (0.88) 13 (0.12) w depression 78 (0.69) 30 (0.27) 5 (0.04) 186 (0.82) 40 (0.18)
Total 113
CC CT TT C T CC CT TT C T C vs. T
MAOA c.1460C > T w/o depression Total 99 52 (0.53) 36 (0.36) 11 (0.11) 140 (0.71) 58 (0.29) w/o depression 110 (0.50) 91 (0.42) 18 (0.08) 311 (0.71) 127 (0.29) P = 0.0038
Total 219
w depression Total 54 19 (0.35) 30 (0.56) 5 (0.09) 68 (0.63) 40 (0.37) w depression 41 (0.36) 56 (0.50) 16 (0.14) 138 (0.61) 88 (0.39)
Total 113

ARTICLE IN PRESS
CC CA AA C A CC CA AA C A C vs. A
TPH1 218C > A w/o depression Total 102 41 (0.40) 45 (0.44) 16 (0.16) 127 (0.62) 77 (0.38) w/o depression 86 (0.39) 99 (0.45) 34 (0.16) 271 (0.62) 167 (0.38) P = 0.676
Total 219
w depression Total 54 20 (0.37) 25 (0.46) 9 (0.17) 65 (0.60) 43 (0.40) w depression 44 (0.39) 49 (0.43) 20 (0.18) 137 (0.61) 89 (0.39)

A. Różycka et al. / Maturitas xxx (2015) xxx–xxx

Total 113
GG GA AA G A GG GA AA G A G vs. A
TPH2 c.1077G > A w/o depression Total 99 34 (0.5) 47 (0.34) 18 (0.16) 115 (0.58) 83 (0.42) w/o depression 80 (0.37) 106 (0.48) 33 (0.15) 266 (0.61) 172 (0.39) P = 0.945
Total 219
w depression Total 54 16 (0.43) 28 (0.39) 10 (0.18) 60 (0.56) 48 (0.44) w depression 45 (0.40) 51 (0.45) 17 (0.15) 141 (0.62) 85 (0.38)
Total 113
GG GA AA G A GG GA AA G A G vs. A
COMT c.472G > A w/o depression Total 96 30 (0.31) 41 (0.43) 25 (0.26) 101 (0.53) 91 (0.47) w/o depression 58 (0.30) 94 (0.48) 44 (0,.22) 210 (0.54) 182 (0.46) P = 0.027
Total 196
w depression Total 54 10 (0.18) 29 (0.54) 15 (0.28) 49 (0.45) 59 (0.55) w depression 18 (0.16) 65 (0.59) 28 (0.25) 101 (0.45) 121 (0.54)
Total 111
GG GA AA G A GG GA AA G A G vs. A
NET c.1287G > A w/o depression Total 96 45 (0.50) 40 (0.34) 11 (0.16) 130 (0.62) 62 (0.38) w/o depression 88 (0.45) 82 (0.42) 26 (0.13) 258 (0.66) 134 (0.34) P = 0.884
Total 196
w depression Total 54 24 (0.43) 22 (0.39) 8 (0.18) 70 (0.62) 38 (0.38) w depression 51 (0.46) 45 (0.41) 15 (0.13) 147 (0.66) 75 (0.34)
Total 111
CC CA AA C A CC CA AA C A C vs. A
GABRB1 c.537C > A w/o depression Total 96 69 (0.72) 24 (0.25) 3 (0.03) 162 (0.84) 30 (0.16) w/o depression 158 (0.72) 56 (0.26) 5 (0.02) 372 (0.85) 66 (0.15) P = 0.081
Total 219
w depression Total 54 34 (0.63) 18 (0.33) 2 (0.04) 86 (0.80) 22 (0.20) w depression 68 (0.63) 36 (0.34) 3 (0.03) 172 (0.80) 42 (0.20)
Total 107
AA AG GG A G AA AG GG A G A vs. G
ESR1 454−351 A > G w/o depression Total 97 32 (0.33) 44 (0.45) 21 (0.22) 108 (0.56) 86 (0.44) w/o depression 68 (0.31) 112 (0.52) 37 (0.17) 248 (0.57) 186 (0.43) P = 0.073
Total 217
w depression Total 54 26 (0.48) 18 (0.33) 10 (0.19) 62 (0.65) 46 (0.35) w depression 53 (0.47) 42 (0.37) 18 (0.16) 148 (0.65) 78 (0.35)
Total 113
CC CT TT C T CC CT TT C T C vs. T
MTHFR c.677C > T w/o depression Total 96 49 (0.51) 40 (0.42) 7 (0.07) 138 (0.72) 54 (0.28) w/o depression 113 (0.52) 87 (0.40) 18 (0.08) 313 (0.72) 123 (0.28) P < 0.0001
Total 218
w depression Total 54 16 (0.30) 29 (0.53) 9 (0.17) 61 (0.56) 47 w depression 41 (0.36) 50 (0.44) 22 (0.20) 132 (0.58) 94 (0.42)
(0.44) Total 113
AA AG GG A G AA AG GG A G A vs. G
MTR c.2756A > G w/o depression Total 98 70 (0.71) 25 (0.26) 3 (0.03) 165 (0.84) 31 (0.16) w/o depression 129 (0.59) 75 (0.35) 14 (0.06) 333 (0.76) 103 (0.24) P = 0.623
Total 218
w depression Total 54 36 (0.67) 17 (0.31) 1 (0.02) 89 (0.82) 19 (0.18) w depression 65 (0.58) 39 (0.34) 9 (0.08) 169 (0.75) 57 (0.25)
Total 113
GG GA AA G A GG GA AA G A G vs. A
MTHFD1 c.1958G > A w/o depression Total 98 45 (0.46) 41 (0.42) 12 (0.12) 131 (0.67) 65 (0.33) w/o depression 86 (0.39) 101 (0.46) 32 (0.15) 273 (0.62) 165 (0.38) P = 0.223
Total 219
w depression Total 54 27 (0.50) 23 (0.43) 4 (0.07) 77 (0.71) 31 (0.29) w depression Total 108 47 (0.44) 49 (0.45) 12 (0.11) 143 (0.66) 73 (0.34)
a
Fisher exact test was used for comparison of women with (w) depression versus women without (w/o) depression.
The women were classified into groups based on the severity of depression assessed by Hamilton point scale: w/o depression (0–7), mild depression (8–17), and moderate depression (18–25). The 54 perimenopausal women
with depression included 40 women with mild depression and 14 women with moderate depression. The 113 postmenopausal women with depression included 82 women with mild depression and 31 women with moderate
depression. Two groups without depression, 102 perimenopausal women and 219 postmenopausal women, served as the controls.
G Model
MAT-6500; No. of Pages 13 ARTICLE IN PRESS
A. Różycka et al. / Maturitas xxx (2015) xxx–xxx 9

Table 6
The tests for association* of MAOA, COMT, MTHFR and ESR1 polymorphisms in postmenopausal and/or perimenopausal women with depression, and control subjects.

Gene Polymorphism (GROUP OF WOMEN) Allele freq. difference Heterozygous Homozygous Allele positivity

Risk allele T
[C] vs. [T] [CC] vs. [CT] [CC] vs. [TT] [CC] vs. [CT + TT]
MAOA c.1460C > T (PERI-M) OR = 1.42C.I. OR = 2.281 OR = 1.244 OR = 2.038
C.I. = [0.864–2.332] C.I. = [1.116–4.661] C.I. = [0.382–4.051] C.I. = [1.029–4.038]
2 = 1.93 2 = 5.20 2 = 0.13 2 = 4.22
p = 0.165 p = 0.022 p = 0.717 p = 0.039
pcorr = 0.495 pcorr = 0.066 pcorr = 0.117
Risk allele T
[C] vs. [T] [CC] vs. [CT] [CC] vs. [TT] [CC] vs. [CT + TT]
MAOA c.1460C > T (POST-M) OR = 1.562 OR = 1.651 OR = 2.385 OR = 1.772
C.I. = [1.114–2.189] C.I. = [1.012–2.693] C.I. = [1.112–5.115] C.I. = [1.112–2.824]
2 = 6.73 2 = 4.06 2 = 5.16 2 = 5.85
p = 0.009 p = 0.043 p = 0.023 p = 0.015
pcorr = 0.027 pcorr = 0.129 pcorr = 0.069 pcorr = 0.045
Risk allele T
[C] vs. [T] [CC] vs. [CT] [CC] vs. [TT] [CC] vs. [CT + TT]
MAOA c.1460C > T (PERI-M + POST-M) OR = 1.510 OR = 1.828 OR = 1.955 OR = 1.852
C.I. = [1.146–2.003] C.I. = [1.222–2.737] C.I. = [1.036–3.689] C.I. = [1.260–2.722]
2 = 8.55 2 = 8.69 2 = 4.38 2 = 9.95
p = 0.003 p = 0.003 p = 0.036 p = 0.001
pcorr = 0.009 pcorr = 0.009 pcorr = 0.108 pcorr = 0.003
Risk allele T
[C] vs. [T] [CC] vs. [CT] [CC] vs. [TT] [CC] vs. [CT + TT]
MTHFR c.677C > T (PERI-M) OR = 1.969 OR = 2.220 OR = 3.938 OR = 2.476
C.I. = [1.202–3.226] C.I. = [1.060–4.652] C.I. = [1.262–12.282] C.I. = [1.220–5.026]
2 = 7.33 2 = 4.55 2 = 6.02 2 = 6.45
p = 0.007 p = 0.033 p = 0.014 p = 0.011
pcorr = 0.021 pcorr = 0.099 pcorr = 0.042 pcorr = 0.033
Risk allele T
[C] vs. [T] [CC] vs. [CT] [CC] vs. [TT] [CC] vs. [CT + TT]
MTHFR c.677C > T (POST-M) OR = 1.812 OR = 1.584 OR = 3.369 OR = 1.890
C.I. = [1.294–2.538] C.I. = [0.962–2.608] C.I. = [1.643–6.908] C.I. = [1.185–3.013]
2 = 12.10 2 = 3.29 2 = 11.66 2 = 7.2
p = 0.0005 p = 0.069 p = 0.0006 p = 0.007
pcorr = 0.0015 pcorr = 0.207 pcorr = 0.0018 pcorr = 0.021
Risk allele T
[C] vs. [T] [CC] vs. [CT] [CC] vs. [TT] [CC] vs. [CT + TT]
MTHFR c.677C > T (PERI-M + POST-M) OR = 1.862 OR = 1.768 OR = 3.524 OR = 2.057
C.I. = [1.409–2.458] C.I. = [1.171–2.670] C.I. = [1.920–6.468] C.I. = [1.394–3.035]
2 = 19.40 2 = 7.41 2 = 17.63 2 = 13.40
p = 0.00001 p = 0.006 p = 0.00003 p = 0.0002
pcorr = 0.00003 pcorr = 0.018 pcorr = 0.00009 pcorr = 0.0006
Risk allele A
[G] vs. [A] [GG] vs. [GA] [GG] vs. [AA] [GG] vs. [GA + AA]
COMT c.472G > A (POST-M) OR = 1.382 OR = 2.228 OR = 2.051 OR = 2.171
C.I. = [0.993–1.924] C.I. = [1.203–4.126] C.I. = [1.008–4.171] C.I. = [1.203–3.920]
2 = 3.70 2 = 6.66 2 = 3.99 2 = 6.81
p = 0.054 p = 0.01 p = 0.046 p = 0.009
pcorr = 0.162 pcorr = 0.03 pcorr = 0.138 pcorr = 0.027
Risk allele G
[A] vs. [G] [AA] vs. [AG] [AA] vs. [GG] [AA] vs. [AG + GG]
ESR1 454−351 A > G (POST-M) OR = 0.703 OR = 0.481 OR = 0.624 OR = 0.517
C.I. = [0.503–0.981] C.I. = [0.290–0.797] C.I. = [0.320–1.217] C.I. = [0.324–0.825]
2 = 4.31 2 = 8.19 2 = 1.93 2 = 7.75
p = 0.037 p = 0.004 p = 0.165 p = 0.005
pcorr = 0.111 pcorr = 0.012 pcorr = 0.495 pcorr = 0.015

*The tests for association were adapted from http://ihg.gsf.de/cgi-bin/hw/hwa1.pl.

The Bonferroni correction for multiple comparisons was applied, and both p values, before (p) and after correction (pcorr ), were determined.
C.I., 95% confidence interval; OR, odds ratio.

A growing number of studies demonstrate sex-dependent dif-
ferences in COMT activity levels [73]. Because COMT is involved
in estrogen metabolism, it seems possible that there is a feedback
loop, since ESR1 can bind to estrogen response elements in the pro-
moter region of COMT to down-regulate its transcription [74,75].
Low activity COMT genotypes were independently related to the
increase of serum E2 levels in postmenopausal women [76] and the
COMT genotype seems to play an independent role in the regulation
of plasma E2 levels, which might result in an individual response
to HRT with respect to a specific allele [77]. On the other hand,
estrogen can modulate neurotransmitter turnover, which includes
enhancing the levels of 5-HT and NE. The low activity Met 158 allele
of COMT has also been associated with an increased risk of breast
cancer in postmenopausal women [78], but the role of the high
and low activity COMT alleles in breast carcinogenesis may vary
by menopausal status [79]. The COMT low activity Met 158 variant
has been proposed as a risk factor for moderate, major and bipo-
lar depression [26,37,39,40,44,45]. However, several case-control
association studies of COMT alleles were negative [38,41,42] or
distribution of the high activity Val 158 variant was significantly
increased in MDD [43] (Table 1). Additionally, the involvement
of this polymorphic variant may depend on the effects of stress-
ful life events on depression [35,36] and this vulnerability has
also been implicated in postpartum depressive symptoms (PPD)

Please cite this article in press as: A. Różycka, et al., The MAOA, COMT, MTHFR and ESR1 gene polymorphisms are associated with the
risk of depression in menopausal women, Maturitas (2015), http://dx.doi.org/10.1016/j.maturitas.2015.10.011
G Model
MAT-6500; No. of Pages 13 ARTICLE IN PRESS
10 A. Różycka et al. / Maturitas xxx (2015) xxx–xxx
[26,37]. So far, however, no case-control studies have examined the
association between COMT genotypes and depression in climac-
teric women and this is the first report on the occurrence of the
c.472G > A polymorphism in Caucasian women with menopausal
depression.
Homozygous and heterozygous carriage of the COMT c.472G > A
polymorphism is found in 25% and 50% of Caucasians respectively,
with a frequency of 40–50% for the low activity A allele [80].
According to Bialecka et al. [81], about 56.7% of the healthy Pol-
ish population carries the COMT low activity allele. The present
study confirms a high frequency of the low activity A allele in Pol-
ish Caucasian women, since the carrier status of this allele in the
controls was 46.7%; however, its frequency was 10% lower than in
the study by Bialecka et al. [81]. This discrepancy, however, might
be due to the different groups that were studied in the two inves-
tigations. Significantly, we found that the frequency of the COMT
low activity A allele was higher in the whole group of menopausal
women with depression than in the combined control group. Since
individuals with COMT AA and GA genotypes would be expected
to have higher levels of trans-synaptic catecholamines due to a
reduced COMT degradation of NE and DA, we could hypothesize
that the frequency of the low activity Met variant would be smaller
in depressed women than in the controls. However, when we com-
pared the distribution of COMT c.472 GG, GA and AA genotypes in
both groups, the GA and AA genotypes were associated with signif-
icantly higher risk of depression in postmenopausal women. This
may be partly explained by the fact that the low activity COMT
variant, which leads to altered dopaminergic regulation, may be
associated with a worse response to life stressors that predispose
to the development of depressive symptoms among menopausal
women [35,36,82,83].
COMT participates in the metabolism of estrogens and cate-
cholamines after their hydroxylation by forming O- methylated
derivatives and in this way contributes to Hcy synthesis. It has
been shown that the interaction of the high activity COMT c.472
GG genetic variant with the low activity MTHFR c.677 TT variant
increases plasma total Hcy levels [66,67]. Hence, both COMT and
MTHFR activities are the most important in catabolic pathways of
the catecholamine neurotransmitters and Hcy [68,69]. Individuals
with the MTHFR c.677 TT and COMT c.472 GG genotypes are pre-
disposed to hyperhomocysteinemia, because they have less active
MTHFR available to produce 5-methyltetrahydrofolate, which is
used to re-methylate Hcy to Met, and more active COMT available
to transfer a methyl group from SAM and to form Hcy. In turn, insuf-
ficient SAM concentrations may result in impaired degradation of
catecholamine neurotransmitters via COMT action, which may be
also inhibited by SAH. The interaction of genetic variations of the
COMT and MTHFR enzymes has been investigated in relation to
schizophrenia [66], psychotic disorder [83], PD [84] and depression
[44,52–54] (Table 1). The present study also suggests an important
role of these genes as risk factors for mild and moderate depres-
sion in menopausal females, and supports our previous findings
of an involvement of the MTHFR c.677C > T polymorphism in post-
menopausal depression [12]. In a recent study, in a total group of
83 postmenopausal depressed women and 89 controls, we found
that the MTHFR TT genotype displayed a 3.48-fold increased risk
of depression, and the MTHFR CT and TT genotypes displayed a
2.34-fold increased risk of depression, when MTHFR c.677 CC geno-
type was used as the reference [12]. Similar analyses in the present
study, in the group of 113 postmenopausal patients and 218 con-
trols, have given us statistically significant results for the MTHFR TT
and CT + TT genotypes as well. Moreover, comparison of MTHFR TT
and CT + TT genotypes in perimenopausal women has also demon-
strated a significant contribution of the T allele to a higher risk
of mild and moderate depressive symptoms in this group. These
observations confirmed the findings of Bjelland et al. [52] and Kelly
Please cite this article in press as: A. Różycka, et al., The MAOA, COMT, MTHFR and ESR1 gene polymorphisms are associated with the
risk of depression in menopausal women, Maturitas (2015), http://dx.doi.org/10.1016/j.maturitas.2015.10.011
et al. [53], who demonstrated an association of the MTHFR c.677C > T
polymorphism in women around the menopausal age, although,
with more severe depression. In contrast, Almeida et al. [54] did
not observe such an association in older women. The differences
in the MTHFR c.677C > T polymorphism’s influence on depression
may result from distinct populations that have been investigated
and environmental factors, including those relating to dietary folic
acid and vitamin B supplementation.
There is some evidence indicating a significant association of
the ESR1 454−351 A > G and ESR1 454−397 C > T polymorphisms with
severe depressive symptoms, MDD and anxiety, but not with mod-
erate depression in menopausal women [9,14–17,61–63] (Table 1).
More recent papers [15,17] have examined the association between
the common ESR1 variants and the lifetime incidence of major
depression and the risk of recurrent depressive episodes in older
women. In the Ryan et al. report [15], women aged 65 years and
over, having the GG genotype of the ESR1 454−351 A > G polymor-
phism were significantly less likely to have late-life depression
compared with women with the AA genotype; however, the GG
genotype in this study group was found to be associated with a
higher risk of recurrent depressive episodes. Furthermore, women
who were heterozygote AG of the ESR1 454−351 A > G polymor-
phism were not at a significantly increased risk [17]. This latter
analysis however, has revealed that the G and C alleles of ESR1
454−351 A > G and ESR1 454−397 C > T, respectively, were associ-
ated with an increased risk of lifetime MDD [17].The only other
study on this particular subject supports these findings, in that
the frequency of the ESR1 454−397 CC genotype was significantly
higher in midlife Chinese MDD women compared to the controls
[63]. Our present results substantiate that the ESR1 454−351 A > G
polymorphic variant is indeed associated with a decreased risk of
depression in postmenopausal women. However, we found this
association only in females having mild and moderate depression.
Since the two common ESR1 polymorphisms are in strong LD with
each other, we studied only one of them. Postmenopausal carri-
ers of the ESR1 454−351 AG and AG + GG genotypes had halved
their risk of depression susceptibility as compared to the AA geno-
type carriers. This indicates the probable protective role of the
ESR1 heterozygous AG genotype, in contrast to the homozygous
AA genotype, as a potential factor decreasing the risk of depres-
sive symptoms in postmenopausal women. These findings are
exactly the opposite to those of a Korean case-control study of
postmenopausal women with depression that were significantly
more likely to be heterozygote for the ESR1 454−351 A > G polymor-
phism compared to non-depressed controls (p ≤ 0.001) [16]. The
very small number of other studies, however, which have inves-
tigated the association between ESR1 variants and depression risk
have reported mixed findings and this may relate to heterogene-
ity in terms of the populations studied (i.e., Asian, Caucasian or
Latino origin), age, and menopausal status [14–17,61–63]. These
polymorphisms may also be in LD with as yet unidentified func-
tional ESR1 polymorphisms. Also, it seems conceivable that certain
steroid-related genes may be differentially associated with specific
forms of depression and diverse genetic studies with genes involv-
ing estrogen function are needed to elucidate the pathophysiologic
mechanism of menopausal depression.
In summary, the present findings together with the results
of our recent studies have confirmed the involvement of the
MAOA c.1460C > T and MTHFR c.677C > T polymorphisms in cli-
macteric depression and revealed that, in Polish postmenopausal
women, the polymorphic variants of COMT c.472G>A and ESR1
454−351 A > G may also confer susceptibility to mild and mod-
erate depressive mood. This observation may indirectly imply
the crucial role of gene–gene epistatic interactions in molec-
ular pathways implicated in depression. Considering the small
sample size of our study, a large-scale case-control association
G Model
MAT-6500; No. of Pages 13 ARTICLE IN PRESS
A. Różycka et al. / Maturitas xxx (2015) xxx–xxx
study of common variants is needed to substantiate our find-
ings.
5. Study limitations
1. This study offers preliminary evidence for a relationship
between the MAOA, COMT, MTHFR and ESR1 polymorphisms and
the risk for menopausal depression. Considering the small sam-
ple size of our study, further investigation of these variants’
distribution in other populations is needed.
2. Studies of depression in midlife women have generally relied
on the assessment of depressive symptoms rather than a for-
mal diagnosis of depression, and therefore, it is possible that
misclassification could have occurred. Moreover, these symp-
toms could also occur in normal responses to loss and stress.
The use of instruments providing information about adverse life
events could give a new look at biological and environmental
determinants of depressive symptoms occurring in menopausal
women.
3. An additional limitation of the current study is that family history
of depression was collected only from 61% participants through
their self-report instead of direct family interviews, and it was
determined by asking participants one yes/no question, so the
study could not explore associations of family history with inci-
dent vs. recurrent depression. To improve understanding of the
etiology of depression in midlife women, the influence of family
history of depression on the occurrence of depression in midlife
women in the context of other risk and protective factors should
be determined.
Despite all limitations, which prevent us from drawing general
conclusions for genetics of depression in all women during midlife,
this is an innovative study presenting a new research area and
suggesting a direction for further investigation.
Competing interests
The authors do not have any competing interests to declare.
Funding
This work was supported by grant No. 50305-01109136-
12261-08039 from the Polish Ministry of Scientific Research and
Information Technology.
All participants gave their written informed consent for the
study, approved by the Ethics Committee, Poznań University of
Medical Sciences.
List of contributors
Różycka Agata and Słopień Radosław:
• Substantial contributions to the conception or design of the work;
or the acquisition, analysis, or interpretation of data for the work;
and
• Drafting the work or revising it critically for important intellec-
tual content; and
• Final approval of the version to be published; and
• Agreement to be accountable for all aspects of the work in ensur-
ing that questions related to the accuracy or integrity of any part
of the work are appropriately investigated and resolved.
Please cite this article in press as: A. Różycka, et al., The MAOA, COMT, MTHFR and ESR1 gene polymorphisms are associated with the
risk of depression in menopausal women, Maturitas (2015), http://dx.doi.org/10.1016/j.maturitas.2015.10.011
11
The other author’s role
Słopień Agnieszka: Clinical Investigator: provided and cared for
study patients, and collected data, contributed to the conception of
the work.
Dorszewska Jolanta: served as scientific advisor, revised the
work, interpreted of data for the work.
Seremak-Mrozikiewicz Agnieszka, Grzelak Teresa, Kurzawińska
Grażyna, Drews Krzysztof and Klejewski Andrzej participated in
revision of the manuscript, collected data and made statistical anal-
ysis.
Lianeri Margarita: participated in writing and technical editing
of the manuscript.
Maciukiewicz Małgorzata: collected data, participated in writ-
ing.
Warenik-Szymankiewicz Alina: Clinical Investigator: provided
and cared for study patients.
Jagodziński Paweł P: critically reviewed the study, participated
in technical editing.
References
[1] L.S. Cohen, C.N. Soares, A.F. Vitonis, M.W. Otto, B.L. Harlow, Risk for new onset
of depression during the menopausal transition: the Harvard study of moods
and cycles, Arch. Gen. Psychiatry 63 (2006) 385–390.
[2] J.T. Bromberger, L.L. Schott, H.M. Kravitz, et al., Longitudinal change in
reproductive hormones and depressive symptoms across the menopausal
transition: results from the study of women’s health across the nation
(SWAN), Arch. Gen. Psychiatry 67 (2010) 598–607.
[3] E.W. Freeman, M.D. Sammel, L. Liu, C.R. Gracia, D.B. Nelson, L. Hollander,
Hormones and menopausal status as predictors of depression in women in
transition to menopause, Arch. Gen. Psychiatry 61 (2004) 62–70.
[4] E.W. Freeman, M.D. Sammel, H. Lin, D.B. Nelson, Associations of hormones
and menopausal status with depressed mood in women with no history of
depression, Arch. Gen. Psychiatry 63 (2006) 375–382.
[5] J.T. Bromberger, K.A. Matthews, L.L. Schott, et al., Depressive symptoms
during the menopausal transition: the study of women’s health across the
nation (SWAN), J. Affect. Disord. 103 (2007) 267–272.
[6] J. Ryan, H.G. Burger, C. Szoeke, et al., A prospective study of the association
between endogenous hormones and depressive symptoms in
postmenopausal women, Menopause 16 (2009) 509–517.
[7] J.T. Bromberger, H.M. Kravitz, Y.F. Chang, J.M. Cyranowski, C. Brown, K.A.
Matthews, Major depression during and after the menopausal transition:
study of women’s health across the nation (SWAN), Psychol. Med. 41 (2011)
1879–1888.
[8] J.T. Bromberger, K.A. Matthews, L.L. Schott, et al., Depressive symptoms
during the menopausal transition: the Study of Women’s Health Across the
Nation (SWAN), J. Affect. Disord. 103 (2007) 267–272.
[9] B. Zhou, X. Sun, M. Zhang, Y. Deng, J. Hu, The symptomatology of climacteric
syndrome: whether associated with the physical factors or psychological
disorder in perimenopausal/postmenopausal patients with
anxiety-depression disorder, Arch. Gynecol. Obstet. 285 (2012) 1345–1352.
[10] A. Colvin, G.A. Richardson, J.M. Cyranowski, A. Youk, J.T. Bromberger, Does
family history of depression predict major depression in midlife women?
Study of Women’s Health Across the Nation Mental Health Study (SWAN
MHS), Arch. Womens Ment. Health 17 (2014) 269–278.
[11] R. Słopień, A. Słopień, A. Różycka, A. Warenik-Szymankiewicz, M. Lianeri, P.P.
Jagodziński, The c.1460C > T polymorphism of MAO-A is associated with the
risk of depression in postmenopausal women, Sci. World J. 2012 (2012)
194845.
[12] R. Słopien, K. Jasniewicz, B. Meczekalski, A. Warenik-Szymankiewicz, M.
Lianeri, P.P. Jagodzinski, Polymorphic variants of genes encoding MTHFR,
MTR, and MTHFD1 and the risk of depression in postmenopausal women in
Poland, Maturitas 61 (2008) 252–255.
[13] E.E. Sundermann, P.M. Maki, J.R. Bishop, A review of estrogen receptor alpha
gene (ESR1) polymorphisms, mood, and cognition, Menopause 17 (2010)
874–886.
[14] J. Ryan, M.L. Ancelin, Polymorphisms of estrogen receptors and risk of
depression: therapeutic implications, Drugs 72 (2012) 1725–1738.
[15] J. Ryan, J. Scali, I. Carriere, et al., Oestrogen receptor polymorphisms and
late-life depression, Br. J. Psychiatry 199 (2011) 126–131.
[16] J.J. Kim, C.U. Pae, M.R. Kim, et al., Association between estrogen receptor gene
polymorphisms and depression in post-menopausal women: a preliminary
study, Psychiatry Investig. 7 (2010) 224–227.
[17] J. Ryan, J. Scali, I. Carrière, et al., Estrogen receptor alpha gene variants and
major depressive episodes, J. Affect. Disord. 136 (2012) 1222–1226.
[18] V.D. Khait, Y.Y. Huang, G. Zalsman, et al., Association of Serotonin 5-HT2A
receptor binding and the T102C polymorphism in depressed and healthy
Caucasian subjects, Neuropsychopharmacology 30 (2005) 166–172.
G Model
MAT-6500; No. of Pages 13 ARTICLE IN PRESS
12 A. Różycka et al. / Maturitas xxx (2015) xxx–xxx
[19] C. Fehr, N. Grintschuk, A. Szegedi, et al., The HTR1B 861G > C receptor
polymorphism among patients suff; ;ering from alcoholism, major
depression, anxiety disorders and narcolepsy, Psychiatry Res. 97 (2000) 1–10.
[20] A. Videtic, T.T. Peternelj, T. Zupanc, J. Balazic, R. Komel, Promoter and
functional polymorphisms of HTR2C and suicide victims, Genes Brain Behav.
8 (2009) 541–545.
˛
[21] J. Pawlak, M. Dmitrzak-Weglarz, M. Skibinska, et al., Association between
suicidal behavior and genes of serotonergic system confirmed in men with
affective disorders, J. Med. Sci. 4 (2014) 7–16.
[22] L. Ke, Z.Y. Qi, Y. Ping, C.Y. Ren, Effect of SNP at position 40237 in exon 7 of the
TPH2 gene on susceptibility to suicide, Brain Res. 1122 (2006) 24–26.
[23] G.S. Hotamisligil, X.O. Breakefield, Human monoamine oxidase A gene
determines levels of enzyme activity, Am. J. Hum. Genet. 49 (1991) 383–392.
[24] L. Du, D. Bakish, A. Ravindran, P.D. Hrdina, MAO-A gene polymorphisms are
associated with major depression and sleep disturbance in males,
Neuroreport 15 (2004) 2097–2101.
[25] E. Grochans, A. Grzywacz, A. Jurczak, et al., The 5HTT and MAO-A
polymorphisms associate with depressive mood and climacteric symptoms in
postmenopausal women, Prog. Neuropsychopharmacol. Biol. Psychiatry 45
(2013) 125–130.
[26] B. Doornbos, D.A. Dijck-Brouwer, I.P. Kema, et al., The development of
peripartum depressive symptoms is associated with gene polymorphisms of
MAOA, 5-HTT and COMT, Prog. Neuropsychopharmacol. Biol. Psychiatry 33
(2009) 1250–1254.
[27] F.A. Moreno, C.A. McGahuey, M.P. Freeman, P.L. Delgado, Sex differences in
depressive response during monoamine depletions in remitted depressive
subjects, J. Clin. Psychiatry 67 (2006) 1618–1623.
[28] B. Gutiérrez, B. Arias, C. Gastó, et al., Association analysis between a functional
polymorphism in the monoamine oxidase A gene promoter and severe mood
disorders, Psychiatr. Genet. 14 (2004) 203–208.
[29] T.G. Schulze, D.J. Müller, H. Krauss, et al., Association between a functional
polymorphism in the monoamine oxidase A gene promoter and major
depressive disorder, Am. J. Med. Genet. 96 (2000) 801–803.
[30] M. Rivera, B. Gutiérrez, E. Molina, et al., High-activity variants of the uMAOA
polymorphism increase the risk for depression in a large primary care sample,
Am. J. Med. Genet. B Neuropsychiatr. Genet. 150B (2009) 395–402.
[31] S.Z. Sabol, S. Hu, D. Hamer, A functional polymorphism in the monoamine
oxidase A gene promoter, Hum Genet 103 (1998) 273–279.
[32] H.C. Guldberg, C.A. Marsden, Catechol-O-methyltransferase. Pharmacological
aspects and physiological role, Pharmacol. Rev. 27 (1975) 135–206.
[33] R. Weinshilboum, F.A. Raymond, Inheritance of low erythrocyte
catechol-O-methyltransferase activity in man, Am. J. Hum. Genet. 29 (1977)
125–135.
[34] J. Chen, B.K. Lipska, N. Halim, et al., Functional analysis of genetic variation in
catechol-O-methyltransferase (COMT): effects on mRNA, protein, and enzyme
activity in postmortem human brain, Am. J. Hum. Genet. 75 (2004) 807–821.
[35] E.M. Drabant, A.R. Hariri, A. Meyer-Lindenberg, et al.,
Catechol-O-methyltransferase val158met genotype and neural mechanisms
related to affective arousal and regulation, Arch. Gen. Psychiatry 63 (2006)
1396–1406.
[36] M. Jabbi, I.P. Kema, G. van der Pompe, G.J. te Meerman, J. Ormel, J.A. den Boer,
Catechol-O-methyltransferase polymorphism and susceptibility to major
depressive disorder modulates psychological stress response, Psychiatr.
Genet. 17 (2007) 183–193.
[37] E. Comasco, S.M. Sylvén, F.C. Papadopoulos, I. Sundström-Poromaa, L. Oreland,
A. Skalkidou, Postpartum depression symptoms: a case-control study on
monoaminergic functional polymorphisms and environmental stressors,
Psychiatr. Genet. 21 (2011) 19–28.
[38] C. Cusin, A. Serretti, E. Lattuada, R. Lilli, C. Lorenzi, E. Smeraldi, Association
study of MAO-A, COMT, 5-HT2A, DRD2, and DRD4 polymorphisms with
illness time course in mood disorders, Am. J. Med. Genet. 114 (2002) 380–390.
[39] E. Åberg, A. Fandiño-Losada, L.K. Sjöholm, Y. Forsell, C. Lavebratt, The
functional Val158Met polymorphism in catechol-O-methyltransferase
(COMT) is associated with depression and motivation in men from a Swedish
population-based study, J. Affect. Disord. 129 (2011) 158–166.
[40] K. Ohara, M. Nagai, Y. Suzuki, K. Ohara, Low activity allele of
catechol-o-methyltransferase gene and Japanese unipolar depression,
Neuroreport 9 (1998) 1305–1308.
[41] A. Serretti, A. Rotondo, C. Lorenzi, E. Smeraldi, G.B. Cassano,
Catechol-O-methyltransferase gene variants in mood disorders in the Italian
population, Psychiatr. Genet. 16 (2006) 181–182.
[42] I. Massat, D. Souery, J. Del-Favero, et al., Association between COMT
(Val158Met) functional polymorphism and early onset in patients with major
depressive disorder in a European multicenter genetic association study, Mol.
Psychiatry 10 (2005) 598–605.
[43] I. Massat, N.A. Kocabas, C. Crisafulli, et al., COMT and age at onset in mood
disorders: a replication and extension study, Neurosci. Lett. 498 (2011)
218–221.
[44] X. Shen, Y. Wu, T. Guan, et al., Association analysis of COMT/MTHFR
polymorphisms and major depressive disorder in Chinese Han population, J.
Affect. Disord. 161 (2014) 73–78.
[45] D.F. Papolos, S. Veit, G.L. Faedda, T. Saito, H.M. Lachman, Ultra-ultra rapid
cycling bipolar disorder is associated with the low activity
catecholamine-O-methyltransferase allele, Mol. Psychiatry 3 (1998)
346–349.
Please cite this article in press as: A. Różycka, et al., The MAOA, COMT, MTHFR and ESR1 gene polymorphisms are associated with the
risk of depression in menopausal women, Maturitas (2015), http://dx.doi.org/10.1016/j.maturitas.2015.10.011
[46] L.D. Botto, Q. Yang, 5,10-Methylenetetrahydrofolate reductase gene variants
and congenital anomalies: a HuGE review, Am. J. Epidemiol. 151 (2000)
862–877.
[47] P.N. Kirke, J.L. Mills, A.M. Molloy, et al., Impact of the MTHFR C677T
polymorphism on risk of neural tube defects: case-control study, BMJ 328
(2004) 1535–1536.
[48] A. Mostowska, K.K. Hozyasz, P. Wójcicki, et al., Searching for new genes and
loci involved in cleft lip and palate in the Polish population—genome-wide
association study, J. Med. Sci. 4 (2014) 265–268.
[49] A. Sniezawska, J. Dorszewska, A. Rozycka, et al., MTHFR, MTR, and MTHFD1
gene polymorphisms compared to homocysteine and asymmetric
dimethylarginine concentrations and their metabolites in epileptic patients
treated with antiepileptic drugs, Seizure 20 (2011) 533–540.
[50] J. Dorszewska, J. Florczak, A. Rozycka, et al., Oxidative DNA damage and level
of thiols as related to polymorphisms of MTHFR, MTR, MTHFD1 in Alzheimer’s
and Parkinson’s diseases, Acta Neurobiol. Exp. (Wars) 67 (2007) 113–129.
[51] B. Kempisty, A. Mostowska, I. Górska, et al., Association of 677C > T
polymorphism of methylenetetrahydrofolate reductase (MTHFR) gene with
bipolar disorder and schizophrenia, Neurosci. Lett. 400 (2006) 267–271.
[52] I. Bjelland, G.S. Tell, S.E. Vollset, H. Refsum, P.M. Ueland, Folate, vitamin B12,
homocysteine, and the MTHFR 677C → T polymorphism in anxiety and
depression: the Hordaland Homocysteine Study, Arch. Gen. Psychiatry 60
(2003) 618–626.
[53] C.B. Kelly, A.P. McDonnell, T.G. Johnston, et al., The MTHFR C677T
polymorphism is associated with depressive episodes in patients from
Northern Ireland, J. Psychopharmacol. 18 (2004) 567–571.
[54] O.P. Almeida, L. Flicker, N.T. Lautenschlager, P. Leedman, S. Vasikaran, F.M.
van Bockxmeer, Contribution of the MTHFR gene to the causal pathway for
depression, anxiety and cognitive impairment in later life, Neurobiol. Aging
26 (2005) 251–257.
[55] B.S. McEwen, S.E. Alves, Estrogen actions in the central nervous system,
Endocr. Rev. 20 (1999) 279–307.
[56] N. Heldring, A. Pike, S. Andersson, et al., Estrogen receptors: how do they
signal and what are their targets, Physiol. Rev. 87 (2007) 905–931.
[57] M.K. Osterlund, Y.L. Hurd, Estrogen receptors in the human forebrain and the
relation to neuropsychiatric disorders, Prog. Neurobiol. 64 (2001) 251–267.
[58] D.M. Herrington, T.D. Howard, K.B. Brosnihan, et al., Common estrogen
receptor polymorphism augments effects of hormone replacement therapy
on E-selectin but not C-reactive protein, Circulation 105 (2002) 1879–1882.
[59] H. Maruyama, H. Toji, C.R. Harrington, et al., Lack of an association of estrogen
receptor alpha gene polymorphisms and transcriptional activity with
Alzheimer disease, Arch. Neurol. 57 (2000) 236–240.
[60] D.R. Rubinow, P.J. Schmidt, C.A. Roca, Estrogen-serotonin interactions:
implications for affective regulation, Biol. Psychiatry 44 (1998) 839–850.
[61] H. Tiemeier, S.C. Schuit, T. den Heijer, et al., Estrogen receptor alpha gene
polymorphisms and anxiety disorder in an elderly population, Mol. Psychiatry
10 (2005) 806–807.
[62] J.M. Malacara, E.L. Perez-Luque, S. Martinez-Garza, et al., The relationship of
estrogen receptor-alpha polymorphism with symptoms and other
characteristics in postmenopausal women, Maturitas 49 (2004) 163–169.
[63] S.J. Tsai, Y.C. Wang, C.J. Hong, H.J. Chiu, Association study of oestrogen
receptor alpha gene polymorphism and suicidal behaviours in major
depressive disorder, Psychiatr. Genet. 13 (2003) 19–22.
[64] L. Mandelli, A. Serretti, Gene environment interaction studies in depression
and suicidal behavior: an update, Neurosci. Biobehav. Rev. 37 (2013)
2375–2397.
[65] S.B. Smith, I. Reenilä, P.T. Männistö, et al., Epistasis between polymorphisms
in COMT, ESR1, and GCH1 influences COMT enzyme activity and pain, Pain
155 (2014) 2390–2399.
[66] D. Kontis, E. Theochari, H. Fryssira, et al., COMT and MTHFR polymorphisms
interaction on cognition in schizophrenia: an exploratory study, Neurosci.
Lett. 537 (2013) 17–22.
[67] J.W. Muntjewerff, H. Gellekink, M. den Heijer, et al., Polymorphisms in
catechol-O-methyltransferase and methylenetetrahydrofolate reductase in
relation to the risk of schizophrenia, Eur. Neuropsychopharmacol. 18 (2008)
99–106.
[68] E.M. Tunbridge, P.J. Harrison, D.R. Warden, C. Johnston, H. Refsum, A.D. Smith,
Polymorphisms in the catechol-O-methyltransferase (COMT) gene influence
plasma total homocysteine levels, Am. J. Med. Genet. B Neuropsychiatr. Genet.
147B (2008) 996–999.
[69] J. Dorszewska, M. Prendecki, A. Oczkowska, A. Rozycka, M. Lianeri, W.
Kozubski, Polymorphism of the COMT, MAO, DAT, NET and 5-HTT genes, and
biogenic amines in Parkinson’s disease, Curr. Genom. 14 (2013) 518–533.
[70] H.S. Kupperman, M.H. Blatt, H. Wiesbader, W. Filler, Comparative clinical
evaluation of estrogenic preparations by the menopausal and menorrheal
indices, J. Clin. Endocrinol. Metab. 13 (1953) 688–703.
[71] M. Hamilton, A rating scale for depression, J. Neurol. Neurosurg. Psychiatry 23
(1960) 56–62.
[72] C.L. Bethea, N.Z. Lu, C. Gundlah, J.M. Streicher, Diverse actions of ovarian
steroids in the serotonin neural system, Front. Neuroendocrinol. 23 (2002)
41–100.
[73] P.J. Harrison, E.M. Tunbridge, Catechol-O-methyltransferase (COMT): a gene
contributing to sex differences in brain function, and to sexual dimorphism in
the predisposition to psychiatric disorders, Neuropsychopharmacology 33
(2008) 3037–3045.
G Model
MAT-6500; No. of Pages 13 ARTICLE IN PRESS
A. Różycka et al. / Maturitas xxx (2015) xxx–xxx 13

[74] H. Jiang, T. Xie, D.B. Ramsden, S.L. Ho, Human catechol-O-methyltransferase
down-regulation by estradiol, Neuropharmacology 45 (2003) 1011–1018.
[75] T. Xie, S.L. Ho, D. Ramsden, Characterization and implications of estrogenic
down-regulation of human catechol-O-methyltransferase gene transcription,
Mol. Pharmacol. 56 (1999) 31–38.
[76] C. Worda, M.O. Sator, C. Schneeberger, et al., Influence of the
catechol-O-methyltransferase (COMT) codon 158 polymorphism on estrogen
levels in women, Hum. Reprod. 18 (2003) 262–266.
[77] K. Mitrunen, V. Kataja, M. Eskelinen, et al., Combined COMT and GST
genotypes and hormone replacement therapy associated breast cancer risk,
Pharmacogenetics 12 (2002) 67–72.
[78] Q. Wang, H. Li, P. Tao, et al., Soy isoflavones, CYP1A1, CYP1B1, and COMT
polymorphisms, and breast cancer: a case-control study in southwestern
China, DNA Cell Biol. 30 (2011) 585–595.
[79] P.A. Thompson, P.G. Shields, J.L. Freudenheim, et al., Genetic polymorphisms
in catechol-O-methyltransferase, menopausal status, and breast cancer risk,
Cancer Res. 58 (1998) 2107–2110.
[80] H.L. McLeod, A.C. Syvanen, A. Githang, et al., Ethnic differences in
catechol-O-methyltransferase pharmacogenetics: frequency of the codon
108/158 low activity allele is lower in Kenyan than Caucasian or South–West
Asian individuals, Pharmacogenetics 8 (1998) 195–199.
[81] M. Bialecka, M. Drozdzik, K. Honczarenko, et al.,
Catechol-O-methyltransferase (COMT) and monoamine oxidase B (MAOB)
genes and susceptibility to sporadic Parkinson’s disease in a Polish
population, Eur. Neurol. 53 (2005) 68–73.
[82] L. Mandelli, A. Serretti, E. Marino, A. Pirovano, R. Calati, C. Colombo,
Interaction between serotonin transporter gene,
catechol-O-methyltransferase gene and stressful life events in mood
disorders, Int. J. Neuropsychopharmacol. 10 (2007) 437–447.
[83] O. Peerbooms, B.P. Rutten, D. Collip, et al., Evidence that interactive effects of
COMT and MTHFR moderate psychotic response to environmental stress, Acta
Psychiatr. Scand. 125 (2012) 247–256.
[84] M. Bialecka, M. Kurzawski, A. Roszmann, et al., Association of COMT, MTHFR,
and SLC19A1(RFC-1) polymorphisms with homocysteine blood levels and
cognitive impairment in Parkinson’s disease, Pharmacogenet. Genom. 22
(2012) 716–724.

Please cite this article in press as: A. Różycka, et al., The MAOA, COMT, MTHFR and ESR1 gene polymorphisms are associated with the
risk of depression in menopausal women, Maturitas (2015), http://dx.doi.org/10.1016/j.maturitas.2015.10.011