Anal. Chem.
2005, 77, 4273-4277
Technical Notes
Polylysine-Coated Diamond Nanocrystals for
MALDI-TOF Mass Analysis of DNA Oligonucleotides
Xianglei Kong, L. C. Lora Huang, S.-C. Vivian Liau, Chau-Chung Han, and Huan-Cheng Chang*
Institute of Atomic and Molecular Sciences, Academia Sinica, P.O. Box 23-166, Taipei, Taiwan 106
A protocol based on aminated diamond nanocrystals has
been developed to isolate, concentrate, purify, and digest
DNA oligonucleotides in one microcentrifuge tube for
matrix-assisted laser desorption/ionization (MALDI) time-
of-flight (TOF) mass spectrometry. It is shown that use of
diamond nanocrystals as a solid-phase extraction support
not only permits concentration of oligonucleotides in
highly diluted solutions but also facilitates separation of
oligonucleotides from proteins in heavily contaminated
solutions. Enzymatic digestions can be conducted on
particle, and additionally, the digests can be easily recov-
ered from the solution for base sequencing. In this
method, the aminated diamond nanocrystals (∼100 nm
in diameter) were prepared by noncovalent coating of
carboxylated/oxidized diamonds with poly(L-lysines) (PL),
which form stable complexes with DNA oligonucleotides.
While the complexes are sufficiently stable to sustain
repeated washing with deionized water, the DNA mol-
ecules can be readily eluted after incubation of the
diamond adducts in aqueous ammonium hydroxide at
elevated temperatures. No preseparation of PL or dia-
mond nanocrystals is required for subsequent MALDI-
TOF mass analysis.
Matrix-assisted laser desorption/ionization (MALDI) time-of-
flight (TOF) mass spectrometry (MS)1 is an effective diagnostic
tool for mass analysis of biopolymers including proteins and
nucleic acids.2 However, due to low ionization efficiency and facile
fragmentation of oligonucleotides, the overall performance of the
technique is less satisfactory for nucleic acids than for proteins.2
Earlier reports on DNA MALDI-TOF MS mainly focused on the
selection of matrixes and improvement of sample deposition
methods.3-8 Recently, increasingly more efforts are made to lower
* To whom correspondence should be addressed. E-mail: hcchang@
po.iams.sinica.edu.tw.
(1) Karas, M.; Hillenkamp, F. Anal. Chem. 1988, 60, 2299-2301.
(2) Dass, C. Principles and Practices of Biological Mass Spectrometry; Wiley:
New York, 2001.
(3) Wu, K. J.; Shaler, T. A.; Becker, C. H. Anal. Chem. 1994, 66, 1637-1645.
(4) Wang, B. H.; Biemann, K. Anal. Chem. 1994, 66, 1918-1924.
(5) Kirpekar, F.; Nordhoff, E.; Kristiansen, K.; Roepstorff, P.; Hahner, S.;
Hillenkamp, F. Rapid Commun. Mass Spectrom. 1995, 9, 525-531.
(6) Liu, Y. H.; Bai, J.; Liang, X.; Lubman, D. M.; Venta, P. J. Anal. Chem. 1995,
67, 3482-3490.
10.1021/ac050213c CCC: $30.25 © 2005 American Chemical Society
Published on Web 05/20/2005
detection limit as well as to increase mass measurement
accuracy,9-15 both of which are of importance in analyzing complex
or low-concentration samples, or both. The biotin-streptavidin
system is one of the technologies developed to selectively extract
and preconcentrate DNA prior to MS analysis.16,17 In this method,
DNA molecules or fragments are biotinylated and then captured
by streptavidin-coated magnetic microbeads, while nonbiotinylated
components are removed by washing. Although the method has
become a routine protocol in nucleic acids research, it is
inapplicable to analysis of nonbiotinylated DNA, unknown DNA,
or DNA fragments that are difficult to be amplified by polymerase
chain reactions.
Poly(L-lysine) (PL) is a polyelectrolyte frequently used as a
DNA delivery tool.18,19 The compound forms stable complexes with
oligonucleotides, enhancing their cellular uptake via nonspecific
endocytosis. While PL has attracted much interest used as a gene
carrier, its application to facilitate MALDI-TOF MS of DNA is little
explored, except for proteins.20 In a previous work,21 we found
that carboxylated/oxidized diamond nanocrystals are remarkably
good adsorbents for proteins and polypeptides in highly diluted
solution because of their high affinity for amino acids with basic
side-chain groups. In particular for PL, the adsorption is so strong
that a PL coating can endure repeated washing with deionized
(7) Gut, I. G.; Jeffery, W. A.; Pappin, D. J. C.; Beck, S. Rapid Commun. Mass
Spectrom. 1997, 11, 43-50.
(8) Tang, W.; Zhu, L.; Smith, L. M. Anal. Chem. 1997, 69, 302-312.
(9) Berlin, K.; Gut, I. G. Rapid Commun. Mass Spectrom. 1999, 13, 1739-
1743.
(10) Langley, G. J.; Herniman, J. M.; Davies, N. L.; Brown, T. Rapid Commun.
Mass Spectrom. 1999, 13, 1717-1723.
(11) Koomen, J. M.; Russell, W. K.; Hettick, J. M.; Russell. D. H. Anal. Chem.
2000, 72, 3860-3866.
(12) Smirnov, I. P.; Hall, L. R.; Ross, P. L.; Haff, L. A. Rapid Commun. Mass
Spectrom. 2001, 15, 1427-1432.
(13) Distler, A. M.; Allison, J. Anal. Chem. 2001, 73, 5000-5003.
(14) Kjellstrom, S.; Jensen, O. N. Anal. Chem. 2004, 76, 5109-5117.
(15) Weng, M. F.; Chen, Y. C. Rapid Commun. Mass Spectrom. 2004, 18, 1421-
1428.
(16) Jurinke, C.; van den Boom, D.; Collazo, V.; Luchow, A.; Jacob, A.; Koster,
H. Anal. Chem. 1997, 69, 904-910.
(17) Kim, S.; Ruparel, H. D.; Gilliam, T. C.; Ju, J. Nat. Rev. Gen. 2003, 4, 1001-
1008.
(18) Molas, M.; Bartrons, R.; Perales, J. C. Biochim. Biophys. Acta 2002, 1572,
37-44.
(19) Parker, A. L.; Oupicky, D.; Dash, P. R.; Seymour, L. W. Anal. Biochem.
2002, 302, 75-80.
(20) Zhang, L.; Orlando, R. Anal. Chem. 1999, 71, 4753-4757.
(21) Huang, L. C. L.; Chang, H.-C. Langmuir 2004, 20, 5879-5884.
Analytical Chemistry, Vol. 77, No. 13, July 1, 2005 4273
water and is stable in aqueous solution over several months. This
unique feature endows PL-coated diamond nanocrystals with the
potential to be used as solid-phase extraction (SPE) supports for
DNA oligonucleotides.
In adsorption of oligomeric DNA molecules, polystyrene
particles are often used as the affinity substrate. Detailed studies
of the adsorption have been made for single-stranded DNA
fragments on amino polystyrene nanospheres.22 It is found that
high-affinity capture of DNA occurs at neutral pH, and the amount
of the DNA fragments captured decreases smoothly with solution
pH, evidence that the adsorption is dominated by electrostatic
forces. The maximal amount of DNA adsorbed at pH 5 is 0.8 mg/
m2, independent of the chain length of the oligonucleotides Figure 1. Comparison between the maximal amounts of d(ATCG-
investigated, suggesting that the molecules are attached to the GCTAATCGGCTA) adsorbed to 100-nm PL-coated diamonds (O) and
surface in a flat configuration.22 carboxylated/oxidized diamonds (9) as a function of solution pH. The
PL-coated diamond crystallites of an average size of 100 nm typical error involved in these measurements is (3 mg/g as indicated
are chosen as the DNA SPE supports in this work. The particles at pH 7.
are crystalline, easy to purify, and therefore, undesirable ion
entrapment during synthesis of nanoparticles (such as porous in dilute NaOH and HCl solutions, the particles were thoroughly
silica nanoparticles23) does no occur. Previous infrared spectro- washed with deionized water and collected by centrifugation. Such
scopic measurements21 indicated that PL is adsorbed to the surface oxidative acid-treated powders were then mixed with PL in boric
of carboxylated/oxidized diamonds with multiple adsorption sites acid buffers, forming noncovalently coated diamond nanocrystals.
in an extended configuration, covering the particles with amino DNA Adsorption. An UV-visible spectrophotometer served
groups. Although the ionic interaction between protonated PL and to determine the amounts of DNA adsorbed to PL-coated
deprotonated DNA is strong, which can be a serious impediment diamonds in 20 mM phosphate buffers at pH 3-9. The specific
to MS analysis, we found that incubation of the complexes in pH as reported in Figure 1 was achieved by fine adjustment of
aqueous ammonium hydroxide at elevated temperatures ef- the pH value of the buffer with 1 N HCl and NaOH.28 The
fectively elutes the oligonucleotides (and/or the whole complexes) adsorbed quantities were determined from the changes in optical
from the aminated diamond surfaces. Direct analysis of the target density of dissolved oligonucleotides before and after addition of
molecules without preseparation of the particles is viable for the diamond nanocrystals to the solution. To ensure equilibration
MALDI-TOF MS. The method is general and applicable to of the adsorption, the oligonucleotide solution and the diamond
biotinylated DNA, nonbiotinylated DNA, and DNA fragments from suspension were thoroughly mixed by vortexing for 2 h, after
enzymatic digestion.24-26 which the mixture was centrifuged and the supernatant was
collected for optical absorption measurement at 260 nm.
EXPERIMENTAL SECTION MADLI-TOF MS. The matrix solution consisted of 3.3 mg of
Chemicals and Materials. Synthetic abrasive diamond pow-
THAP and 4 mg of ammonium citrate in 500 µL of 50% aqueous
ders with a nominal size of 100 nm were obtained from Kay
acetonitrile, optimized empirically for detection of DNA oligo-
Industrial Diamond.27 Biological samples including snake venom
nucleotides. The sample for MALDI-TOF MS was prepared by
phosphodiesterase (SVP), ubiquitin, d(ATCGGCTAATCGGCTA)
adding 1 µL of diamond suspension (typically 10 mg/mL) to 500
(mass 4881), poly(L-lysine) (mass ∼30 000), and chemicals includ-
µL of oligonucleotide solution (typically 50 nM) in a microcen-
ing urea, sodium dodecyl sulfate (SDS), 2,4,6-trihydroxyacetophe-
trifuge tube. After incubation for 2 min and removal of the
none (THAP), and ammonium citrate were all from Sigma and
supernatant from centrifugation, an aliquot (2 µL) of 28% am-
used without further purification. Components (Na2HPO4 and
monium hydroxide solution was added to rinse the inner wall of
NaH2PO4) for phosphate buffers were obtained from Acros
the tube and immerse the centrifuged diamonds. The resulting
Organics.
slurry was then mixed with 2 µL of matrix solution, from which
PL-Coated Diamond Nanocrystals. Poly(L-lysine)s were
1 µL of the mixture was sampled and deposited on the probe. In
noncovalently coated on carboxylated/oxidized diamonds, de-
the cases that DNA oligonucleotides cannot be effectively eluted
scribed in detail previously.21 Briefly, diamond powers were
from the PL-coated diamond nanocrystals, the slurry was heated
carboxylated and oxidized in concentrated H2SO4/HNO3 (9:1
in the original centrifuge tube to 90 °C for 2 min prior to MALDI
volume ratio) at room temperature. After subsequent treatments
analysis.
(22) Ganachaud, F.; Elaissari, A.; Pichot, C.; Laayoun, A.; Cros, P. Langmuir Mass spectra were acquired in the negative ion mode using a
1997, 13, 701-707. home-built delayed ion extraction linear time-of-flight mass
(23) Turney, K.; Drake, T. J.; Smith, J. E.; Tan, W.; Harrison, W. W. Rapid
Commun. Mass Spectrom. 2004, 18, 2367-2374.
spectrometer with a flight length of 2.2 m and at an acceleration
(24) Nordhoff, E.; Crammer, R.; Karas, M.; Hillenkamp, F.; Kirpekar, F.; voltage of -20 kV.29 A pulsed Nd:YAG laser operating at 355 nm
Kristiansen, K.; Roepstorff, P. Nucleic Acids Res. 1993, 21, 3347-3357.
(25) Smirnov, I. P.; Roskey, M. T.; Juhasz, P.; Takach, E. J.; Martin, S. A.; Haff, (28) Concentrations of the buffers were maintained in the range of 2 × 10-2 M.
L. A. Anal. Biochem. 1996, 238, 19-25. In this range, the ionic strength plays an insignificant role in the DNA
(26) Zhang, L. K.; Rempel, D.; Gross, M. L. Anal. Chem. 2001, 73, 3263-3273. adsorption process (ref 22).
(27) Abrasive diamond nanocrystals are relatively inexpensive with a cost of (29) Lynn, E. C.; Chung, M. C.; Tsai, W. C.; Han, C.-C. Rapid Commun. Mass
∼1 US dollar per carat. Spectrom. 1999, 13, 2022-2027.

4274 Analytical Chemistry, Vol. 77, No. 13, July 1, 2005

Figure 2. MALDI-TOF mass spectra of d(ATCGGCTAATCGGCTA) from 50 nM solutions prepared with (a) deionized water, (b) 2 M urea, and
(c) 2 M urea but pretreated with PL-coated diamonds prior to MS analysis. The corresponding mass spectra for sample solutions containing
0.1% SDS are shown in (d-f). Curves a and d are shifted vertically for clarity, and asterisks in (e) denote SDS cluster ions.
evaporated and ionized the molecules under vacuum for detection
with a z-stacked triple microchannel plate. All mass spectra were
acquired by signal averaging of 30 laser shots.
Concentration and Extraction. Sample solutions were diluted
serially with deionized water. The diluted solutions were mixed
with the diamond suspensions and analyzed directly with MALDI-
TOF MS following the procedures described above. The same
procedures applied to analysis of DNA extracted from highly
contaminated solutions containing 2 M urea, 0.1% SDS, or ubiquitin
at a 500-fold higher concentration. In these experiments, to
facilitate elimination of undesired molecules or ions, the oligo-
nucleotide-bound diamond nanocrystals were additionally rinsed
with deionized water twice (500 µL in each rinse) prior to addition
of ammonium hydroxide and matrix solutions.
Enzymatic Digestion. DNA oligonucleotides were digested
in solution by mixing 1 µL of SVP (0.01 munit/µL in pH 8.8
ammonium citrate solution) with 100 µL of 200 nM DNA solution.
The mixture was incubated at 40 °C for 3 min. A 1-µL aliquot was
removed for direct MALDI-TOF mass analysis, while the remain-
ing was mixed with 4 µL of the PL-coated diamond suspension
for 2 min and then analyzed by MALDI.
On-particle enzymatic digestion was conducted by adding 40
µg of PL-coated diamonds to 100 µL of 200 nM DNA solution.
The DNA adducts, after one wash with deionized water, were
mixed with 10 µL of 0.005 munit/µL SVP and heated to 40 °C for
8 min. Centrifuged diamonds were then mixed with 3 µL of
ammonium hydroxide and 3 µL of matrix solution sequentially in
the same tube. A 1-µL aliquot of the mixture was deposited on
the probe for final MALDI-TOF mass analysis.
RESULTS AND DISCUSSION
Adsorption of DNA to PL-Coated Diamond Surfaces.
Figure 1 shows the maximal amount of d(ATCGGCTAATCG-
GCTA) adsorbed to PL-coated diamonds as a function of solution
pH. The quantities decrease nearly monotonically with solution
pH from 3 to 9. This behavior is in marked contrast to the
adsorption of proteins on carboxylated/oxidized diamonds, to
which the amounts of the proteins attached increase with solution
pH and reach their maximums at the respective isoelectric points.30
Since PL is protonated up to pH 10.5 and DNA oligonucleotides
are polyelectrolytes containing only negatively charged (phos-
phate) groups, such a monotonic decrease is a reflection that
electrostatic forces dominate the adsorption process.
The maximal amount of the DNA oligonucleotide adsorbed to
the PL-coated diamond surface at neutral pH is ∼22 mg/g (Figure
1). Given a specific surface area of ∼40 m2/g (determined by BET
isotherms31) for the diamond powders, an adsorbate density of
∼0.6 mg/m2 is revealed at saturation. With reference to the area
of 20 Å × 3.4 Å occupied by each nucleotide pair for a double-
stranded DNA helix,32 this measured density suggests that nearly
half of the diamond surface is covered with the single-stranded
DNA oligonucleotides. The full coverage can be reached only at
pH e3.
In Figure 1, we also include the adsorption of DNA to
carboxylated/oxidized diamonds for comparison. No adsorption
of the oligonucleotides is detected within the experimental
uncertainty of our measurements in the pH range 7-9. Significant
adsorption occurs only at pH e5 when the repulsion between the
negatively charged surface groups and DNA oligonucleotides
diminishes. The amount of the DNA adsorbed is roughly half that
adsorbed to PL-coated diamonds at the corresponding pH.
Mass Analysis of Dilute DNA Solutions with Contami-
nants. Figure 2a displays the mass spectrum acquired directly
for d(ATCGGCTAATCGGCTA) from a 1-µL solution at 50 nM
prepared with deionized water. Both singly and doubly charged
ions of the oligonucleotides can be identified at m/z 4880 and
(30) Kong, X. L.; Huang, L. C. L.; Hsu. C.-M.; Chen, W.-H.; Han, C.-C.; Chang,
H.-C. Anal. Chem. 2005, 77, 259-265.
(31) Measured with a surface area analyzer (Gemini V, Micrometrics) by
nitrogen adsorption at -196 °C.
(32) Cantor, C. R.; Schimmel, P. R. Biophysical Chemistry; Freeman: San
Francisco, 1980.
Analytical Chemistry, Vol. 77, No. 13, July 1, 2005 4275
Figure 3. MALDI-TOF mass spectra of d(ATCGGCTAATCGGCTA)
from (a) 10 nM solution (1 µL) without pretreatment and (b) 5 nM
solution (500 µL) pretreated with PL-coated diamonds. Asterisks
denote DNA fragment ions (ref 33).
2440, respectively, in the spectrum. However, when the same
sample solution was contaminated with 2 M urea, no signal can
be detected at all as shown in Figure 2b. The oligonucleotide
signals, in contrast, can be easily recovered after pretreatment
with the PL-coated diamond nanocrystals (Figure 2c). Similar
results are obtained for oligonucleotide solutions containing 0.1%
SDS, where a series of peaks (separated by 288 Da) associated
with the surfactant cluster ions dominate the spectrum (Figure
2e). The interfering signals are effectively removed after facile
purification of the sample with the nanocrystals and deionized
water (Figure 2f). No features corresponding to PL, its fragments,
and adduct ions were identifiable in the mass spectra.
Figure 3a shows the mass spectrum of d(ATCGGCTAATCG-
GCTA) in a 10 nM solution without pretreatment. The concentra-
tion is close to the lowest detection limit of our instrument for
this oligonucleotide. With the aid of the PL-coated diamonds to
enrich the sample, the ion signals can be easily detected for a
500-µL solution at 5 nM (Figure 3b). Moreover, the mass spectrum
can be readily registered for sample solutions at concentrations
as low as 100 pM, which amounts to a 100-fold improvement in
sensitivity. It is worth noting that, in all cases, no adverse peak
broadening and mass shift are observed in the mass spectra,
demonstrating the advantage of using diamond nanocrystals over
argarose microbeads as the SPE supports.30
In addition to the 16-mer, longer DNA oligonucleotides such
as λ gt11 [d(GGTGGCGACGACTCCTGGAGCCCG)] and biotinyl-
ated T7 primer [5′-biotin-d(CTCGAGTAATACGACTCACTCTAT-
AGG)-3′] also show similar sensitivity improvement with the
diamond nanocrystal pretreatment. The improvement factor varies
somewhat for different samples but is always greater than 10 (see
Supporting Information for details).
Selective Extraction of DNA from Solutions Containing
Proteins. One of the outstanding features of PL-coated diamond
nanocrystals is that the material is capable of concentrating
oligonucleotides selectively in the presence of an excessive
amount of proteins in solution. This capability is manifested by
the fact that most proteins are positively charged whereas DNA
oligonucleotides are negatively charged at neutral pH. Figure 4
(33) Zhu, Y. F.; Taranenko, N. I.; Allman, S. L.; Taranenko, N. V.; Martin, S. A.;
Haff, L. A.; Chen, C. H. Rapid Commun. Mass Spectrom. 1997, 11, 897-
903.
4276 Analytical Chemistry, Vol. 77, No. 13, July 1, 2005
Figure 4. MALDI-TOF mass spectra of d(ATCGGCTAATCGGCTA)
from a 50 nM solution containing 25 µM ubiquitin. The spectra were
obtained for the solution (a) without pretreatment, (b) pretreated with
carboxylated/oxidized diamonds, and (c) pretreated with PL-coated
diamonds. The ubiquitin peaks are denoted by “U”, and asterisks
denote ubiquitin-matrix adducts.
shows the result for a 500-µL solution composed of 50 nM
d(ATCGGCTAATCGGCTA) and 25 µM ubiquitin, a situation
where the protein is 500 times more concentrated than that of
the oligonucleotide. The mass spectrum was obtained at neutral
pH by performing purification, concentration, and analysis of the
sample in the same centrifuge tube. As shown in panel a of the
figure, direct MALDI-TOF mass analysis of the starting sample
produces strong signals for singly and doubly charged ions of
ubiquitin only. No sign of the oligonucleotide ions can be found.
However, by adding 50 µg of acid-treated diamonds to the same
solution, the 16-mer DNA peak can be identified on the particles
as shown in Figure 4b. Most likely, the DNA signals originate
from oligonucleotides indirectly bound to the diamond surface
through underlying ubiquitin ions. In contrast, when the sample
solution was pretreated with the same amount of PL-coated
diamonds, the DNA signals become dominant, accompanied with
a weak peak for the singly charged ubiquitin ion in the spectrum
(Figure 4c). A comparison between Figure 4a and c clearly
indicates a dramatic (∼103-fold) increase in detection sensitivity
for the oligonucleotide owing to coating of the diamond nano-
crystal with PL.
The PL-coated diamond nanocrystals also serve as a useful tool
to enrich DNA fragments from enzymatic digestion. Panels a and
b in Figure 5 show, respectively, the mass spectra of enzymatic
digests for d(ATCGGCTAATCGGCTA) without and with enrich-
ment of the sample after digestion by SVP, a 3′ f 5′ acting
exonuclease. As noticed, a 10-fold enhancement of the signals can
be easily achieved without the need to preseparate the enzyme,
PL, and diamond nanocrystal from the target molecules for

Figure 5. MALDI-TOF mass spectra of enzymatic d(ATCG-
GCTAATCGGCTA) digests. The digestion was conducted in solution
and analyzed (a) without preconcentration and (b) with preconcen-
tration using PL-coated diamonds. The corresponding on-particle
digestion result is shown in (c). Asterisks denote doubly charged DNA
fragment ions.
MALDI-TOF MS. It should be noted that the oligonucleotide
concentration used in this experiment is 200 nM, which is lower
than the concentration typically used in exonuclease digestion for
base sequencing24-26 by 2 orders of magnitude.
A potentially important application of the presently developed
method is to conduct the enzymatic digestion directly on particle.
We demonstrate the feasibility of this approach with SVP at pH
close to 8. In this pH range, a large fraction of the oligonucleotides
remains attached to the surface for digestion (Figure 1) and the
enzyme retains its optimum catalytic activity. While it is likely
that the bonding between the PL-coated diamonds and the DNA
fragments is weakened because of shortening of the oligonucle-
otide length, they can be easily recovered by decreasing the
solution pH (cf. Figure 1). Figure 5c shows the mass spectrum
of the DNA fragments extracted from an on-particle enzymatic
digest of the 16-mer. More than half of the expected sequence
peaks for this oligonucleotide is resolved by comparing the mass
difference between adjacent peaks generated by the digestion in
the mass spectrum.
CONCLUSION
We have developed a method to improve the performance of
MALDI-TOF MS for DNA oligonucleotides in highly diluted and
contaminated solutions based on microextraction using poly(L-
lysine)-coated diamond nanocrystals as the solid supports. The
method integrates isolation, concentration, purification, digestion,
and analysis of DNA in one microcentrifuge tube (in the sense
that target molecules are always retained on the diamond substrate
and interfering molecules are always left in the solution and can
thereupon easily disposed of), and it performs exceptionally well
for mass analysis of oligonucleotides in solution containing an
excessive amount of proteins such as ubiquitin. The method is
general and is expected to be applicable to mass analysis of DNA
in more complex protein solutions and even cell lysates. The
simplicity of the method makes automation feasible.
ACKNOWLEDGMENT
The research was supported by Academia Sinica and the
National Science Council (Grant NSC 92-3112-B-001-012-Y under
the National Research Program for Genomic Medicine) of Taiwan,
Republic of China.
SUPPORTING INFORMATION AVAILABLE
Additional information as noted in text. This material is
available free of charge via the Internet at http://pubs.acs.org.
Received for review February 3, 2005. Accepted March 7,
2005.
AC050213C
Analytical Chemistry, Vol. 77, No. 13, July 1, 2005 4277