Bio0150 Lesson 1.

6 Study Guide
Topics and Questions:
• What are nucleic acids?
• What is the central dogma?
• What are the component parts of a nucleotide?
• What is the difference between DNA and RNA?
• What are the five nitrogenous bases?
• How are monomers bonded together into polymers?
• How do strands associate with each other?
• How does DNA replicate?
• How can we determine a complementary strand of DNA, based on a given strand?
• What are Chargaff’s rules, and what do they tell us about DNA?
• What incorrect structure did Pauling propose for DNA?
• How are Francis Crick, James Watson, Maurice Wilkins, and Rosalind Franklin
involved in the discovery of the DNA double helix?

Key Concepts:
• Nucleic acids contain hydroxyl, amino, and phosphate functional groups

• The central dogma of molecular biology has to do with how genes are expressed,

and involves the process of going from DNA to RNA to a functional product

• Nucleic acids are made of nucleotide monomers, which have three parts:

nitrogenous base, a pentose sugar, and a phosphate.

• Together, the pentose sugar and base are referred to as a nucleoside

• RNA is made with ribose, while DNA is made with deoxyribose

• The five nitrogenous bases are cytosine (C), thymine (T), uracil (U), adenine (A), and

guanine (G)

• The bases can be placed into two classes: pyrimidines, which have one ring, and

purines, which have two fused rings.

• Of these bases, DNA contains Cytosine (C), Thymine (T), Adenine (A), and Guanine

(G), and RNA contains Cytosine (C), Uracil (U), Adenine (A), and Guanine (G).
• Nucleotides can be modified by the addition of one or two phosphates to make

ADP and ATP, respectively.

• ADP and ATP are high energy molecules because of the chain of phosphates, which

have one or more negative charges

• Nucleotides undergo condensation/dehydration synthesis to form nucleic acids,

and the bonds between two nucleotides are called phosphodiester bonds

• The bonds between the phosphates and sugars of DNA are known as the sugar-

phosphate backbone

• Because of the way DNA and RNA are put together, they have directionality, with
the 5’ phosphate at one end of the polymer, and the 3’ OH at the other

• These are named after the carbon of the sugar they are attached to, with the

phosphate being attached to carbon 5, and the hydroxyl being attached to carbon

• Strands of DNA or RNA can interact with each other using hydrogen bonds, which

utilize electronegative atoms like nitrogen and oxygen to create partial charges that

facilitate hydrogen bonding

• The two strands of DNA are complementary and antiparallel, and together form a

double helical structure

• C-G pairs have three hydrogen bonds, while A-T pairs have two hydrogen bonds

• This makes it require more heat to “melt” the hydrogen bonds between C-G pairs

than A-T pairs, making CG-rich sequences of DNA, or those that have more C-G

pairs, require more heat to break the two strands apart

• The two strands of DNA are complementary to each other, meaning that you can

determine the sequence of one from the other, and determine the percentage of

different bases in the molecule

• Chargaff’s rules dictate that the percent of As in a molecule is always equal to the

percent of Ts and vice versa, and the percent of Cs is always equal to the percent of

Gs and vice versa

• The double-stranded, antiparallel nature of DNA is also functional for replication,

where the machinery uses the extant strands of DNA as a template for replication

• DNA replication is semiconservative, using old strands as templates for new strands

• Pauling was the first person to publish a structure of DNA, but it was inaccurate,

presenting a triple helix with negatively charged phosphates in the middle, which

would make the structure unstable

• Watson and Crick published the double helical structure, making a massive

contribution to our understanding of the biology of the cell

• Their work was influenced by the X-ray diffraction studies of Rosalind Franklin,

whose contribution they did not recognize in their paper

A selection of things you should be able to do for an exam

(learning outcomes):
• Describe the central dogma
• Identify nucleic acid monomers and polymers
• Differentiate between DNA and RNA
• Differentiate between the various nitrogenous bases
• Name the bond that forms between nucleotides
• Identify the type of bond that connects nucleic acids
• Determine the sequence of a strand of DNA based on its complement
• Conclude the relative melting temperatures of two pieces of DNA, based on the
number of CG pairs
• Determine the percentages of AT vs CG of a given double stranded piece of DNA
• Contextualize the contributions of historical scientists to the discovery of DNA
structure
Practice Problems:
1. Provide the complementary sequence of the following piece of DNA:
5’ GTAACTGGACATGGTCACTGGGA 3’

2. Below is a nucleotide. Label each of the three components with the associated
generic name (i.e. “nitrogenous base”) and number each carbon atom. Is this
nucleotide found in RNA or DNA?

3. The central dogma describes ____________________ being transcribed to

______________, which will later be translated into ________________.

4. What molecule participates in the polymerization and hydrolysis of nucleic acids?

5. The percent of adenine in a molecule of DNA is 40%. Determine the percent of C,

G, and T in this DNA molecule
a. C = 10% / T = 10% / G = 40%
b. C = 40% / T = 60% / G = 40%
c. C = 10% / T = 40% / G = 10%
d. C = 60% / T = 40% / G = 60%
e. Cannot be determined
6. A key step in DNA replication is the denaturation of the DNA strand. This step
separates the two strands of DNA from one another. What bonds are broken during
denaturation?
a. Ionic bonds between nitrogenous base pairs
b. Covalent bonds between the phosphate backbone
c. Hydrogen bonds between the phosphate backbone
d. Hydrogen bonds between the nitrogenous base pairs
e. Covalent bonds between the nitrogenous base pairs
0150 Lecture 6
Nucleic Acids
 Purpose
This lecture and its accompanying materials will help you….

• Describe the central dogma

• Identify nucleic acid monomers and polymers
• Differentiate between DNA and RNA
• Differentiate between the various nitrogenous bases
• Name the bond that forms between nucleotides
• Identify the type of bond that connects nucleic acids
• Determine the sequence of a strand of DNA based on its complement
• Conclude the relative melting temperatures of two pieces of DNA, based on the number of CG pairs
• Determine the percentages of AT vs CG of a given double stranded piece of DNA
• Contextualize the contributions of historical scientists to the discovery of DNA structure
 Atoms in different arrangements have different
chemical properties
Functional Group Structure and Context Example Properties
Polar. Forms Hydrogen bonds with water, helping
Hydroxyl
molecules dissolve

Polar. C=O group is very reactive. Important in building

Aldehyde
molecules.
Carbonyls

Polar. C=O group important in carbohydrates and energy

Ketone
reactions.

Carboxyl Charged; acidic. Ionizes to form COO- and H+. Donates

OH in condensation. AKA carboxylic acid.

Amino Charged; basic. Accepts H+ in living tissues to form NH3+

Nonpolar. Important in interacting with other nonpolar

Methyl
molecules and energy transfer.

Charged; acidic. Donates OH in condensation.

Phosphate
Phosphate-Phosphate bond is high energy (see: ATP).
Nucleic Acids (DNA and RNA) store and
transmit genetic information

Gene Expression: the process through

which information from a gene is used in
the synthesis of a functional gene product.
Nucleic acids are polymers built from
nucleotide monomers
The three parts of a nucleotide are always
arranged in the same way
DNA and RNA are built with nucleotides
that have different sugars

Deoxyribonucleic Acid Ribonucleic Acid

5 nitrogenous bases are used in the
construction of nucleotides

DNA contains
C, T, A, & G

RNA contains
C, U, A, & G
Additional phosphate groups can be added to
nucleotides to make high-energy molecules
Condensation joins two monomers together,
releasing water
 Nucleotide monomers are linked by
phosphodiester bonds to form polymers

Covalent bond:
hard to break!
Nucleic acids have a sugar-
phosphate backbone and
directionality
5’ CUG 3’

5’ CUG 3’
Nucleic acids
grow in the 5’ to
3’ direction!
 Nucleic acid polymer(s) interact through
base pairing
A pairs with T or U
and
C pairs with G
Because the two strands are complementary
to each other, we can tell the sequence of
one strand from the other
Base pairing between two antiparallel
strands of DNA forms a double helix
5’
3’

3’ to 5’

3’ to 5’
3’
5’
 Based on the sequence below, what is the
sequence of its complementary DNA strand?
Make sure to include the 5’ and 3’ identifiers.

5’AGGAAATTCAA 3’
 Which of the following would take more
energy to melt?

5’TGGATAGTCAA 3’ 5’AGGCCCGTCAA 3’
3’ACCTATCAGTT 5’ 3’TCCGGGCAGTT 5’
 You can determine the percentage of a
given nucleotide based on others
Coding:

Template:

# of As- % of As-

#If the bottom strand is the template strand, then the mRNA %
of Ts- of Ts- that
sequence
would result from transcription of this DNA sequence would be:
# of Cs- % of Cs-

# of Gs- % of Gs-

Total= 48
DNA base pairing is functionally significant
for DNA replication
 DNA replication is semiconservative, using
existing strands as the template for the new
ones
 Deciphering the structure of
DNA was a long-term process
involving multiple researchers

Erwin Chargaff Linus Pauling

 Watson and Crick were in the right place at
the right time, data-wise

James Watson Francis Crick Maurice Wilkins

Rosalind Franklin
 Franklin’s
pivotal piece of
data was this X-
ray diffraction
image called
Photo 51
James Watson

If you want to read about his comments (TW/CW: racism, ableism), you can learn more here:
https://www.nytimes.com/2019/01/01/science/watson-dna-genetics-race.html