Biocatalysis and Agricultural Biotechnology 28 (2020) 101758

Contents lists available at ScienceDirect

Biocatalysis and Agricultural Biotechnology

journal homepage: http://www.elsevier.com/locate/bab

Functional identification and characterization of midgut microbial flora

derived from lepidopteran larvae Spodoptera litura Fab.
Sengodan Karthi a, b, Babyshalini Panneerselvam a, Sengottayan Senthil-Nathan b,
Prabhakaran Vasantha-Srinivasan c, Muthugoundar Subramaniam Shivakumar a, **,
Patcharin Krutmuang d, e, *
a
Molecular Entomology Lab, Department of Biotechnology, School of Biosciences, Periyar University, Salem, 11, Tamil Nadu, India
b
Division of Biopesticides and Environmental Toxicology, Sri Paramakalyani Centre for Excellence in Environmental Sciences, Manonmaniam Sundaranar University,
Alwarkurichi, 627 412, Tirunelveli, Tamil Nadu, India
c
Department of Biotechnology, St. Peter’s Institute of Higher Education and Research, Avadi, 600 054, Chennai, Tamil Nadu, India
d
Department of Entomology and Plant Pathology, Faculty of Agriculture, Chiang Mai University, Muang, Chiang Mai, Thailand
e
Innovative Agriculture Research Center, Faculty of Agriculture, Chiang Mai University, Muang, Chiang Mai, Thailand

A R T I C L E I N F O A B S T R A C T

Keywords: Spodoptera litura are important agricultural pest, and they have a worldwide distribution. The microbiota gut is
Tobacco cutworm vital for the host with significant activity in metabolism. Lepidopteran species is one of the prominent orders in
16s rRNA insect group of phytophagous pests, and their linkage with microbes are presently practiced and others with
Sequencing
future perspectives. In this present investigation of gut microbiota isolation and identification from larvae of
Microbes
S. litura and to assess the midgut bacteria role of in promoting survival to pesticides. Based on the preliminary
Pesticides
screening, we screened three different bacterial species isolated from the gut microbial communities of S. litura,
viz. gram-positive bacteria Clostridium botulinum, Clostridium butyricum, gram-negative bacteria Pseudomonas
putida. Present study the detection of bacteria in the midgut by using general microbial technique and the 16s
rRNA sequence was used for characterizing the selected microbes. Besides, the bacterial DNA quality was tested
by using agarose gel electrophoresis techniques. Phylogenetic analysis using the neighbor-joining tree shows
similarity with other bacterial genera. And also pesticide tolerant ability was analyzed with isolated midgut
bacterial communities of the bioassay method. It concludes the C. botulinum bacterium was tested for its role in
protecting S. litura larvae against cypermethrin toxicity. The results displayed that S. litura survived well in the
combinations of cypermethrin along with C. botulinum. Pesticide metabolism in insects, helping to survive in
unfavorable environments.

1. Introduction anti-cancerous peptides (Chernysh et al., 2002).

The gut of insects signifies a huge number of diversity of microbes.
The microbial diversity in a species can be triggered by the existence of
diverse digestive enzymes, and also the ingested food source (Dillon and
Dillon, 2004). Microbes play a vital role in the nutrition and physiology
of insect hosts (Nardiet et al., 2002). In general, gut microbiota also
supports the pest by debasing insecticide and xenobiotics which are
toxic to the pests (Xia et al., 2013). There has been rising enthusiasm for
knowledge on insect gut microbiota, as a potential source of novel
bioactive molecules, including antiviral, antimalarial, and
Insect midgut is colonized by diverse microbes which is a result of
their interaction with their immediate environment (Walker et al.,
1999). The midgut microbiota delivers a dual system where the syner­
gistic works take place among the microbial and insect gut enzymes to
digest the leaf resources (Cornelis et al., 1982; Shi et al., 2013). The
present study was mainly focused on amylase producing microbial
strains from insect gut since only a few types of research are available in
the literature (Breman et al., 2001; Aksoy et al., 2008; Coutinho-Abreu
et al., 2009). The selected microbes are hereditarily changed to create an
anti-parasitic factor and then introduced into the midgut of insects,

* Corresponding author. Department of Entomology and Plant Pathology, Faculty of Agriculture, Chiang Mai University, Muang, Chiang Mai, Thailand.
** Corresponding author.
E-mail addresses: skentomology@gmail.com (M.S. Shivakumar), patcharink26@gmail.com (P. Krutmuang).

https://doi.org/10.1016/j.bcab.2020.101758
Received 22 May 2020; Received in revised form 13 August 2020; Accepted 14 August 2020
Available online 15 August 2020
1878-8181/© 2020 Elsevier Ltd. All rights reserved.
S. Karthi et al.
there they decline the mortality rate of malarial parasites to obstruct the
pathogens transmitted vector inside the cycle, or decrease their vector
limit (Aksoy et al., 2008; Coutinho-Abreu et al., 2009).
Insects have a cosmopolitan distribution, occupying a variety of
ecological niches. This is made possible due to the endosymbionts,
which help the insects to digest certain food thus playing a vital role in
the nutrition of hosts (Bourtzis and Miller, 2003). Endosymbionts help
the insects by providing vitamins, lipids, and essential amino acids
which are important for insect development (Douglas, 1998).
The gut microbiota of insects has been inherent for its dynamic
features such as i) biomass deconstruction ii) the nutrient biosynthesis.
The dietary role of the endosymbiotic insect microorganisms has been
well studies by nourishing experiments with unbalanced or poor diets
deficient vital nutrients (Douglas, 1998). The production of nutrients
and biomass both are fundamental functions of gut microbiota that can
be exploited for biotechnology applications.
In addition to providing nutrients to hosts, gut symbionts also protect
the insects, by metabolizing toxic xenobiotic chemicals and thus are
thought to play an important role in insecticide resistance in pests
(Whalon et al., 2008). However, the microbial transmission to the hosts
will impact the symbiotic mediated resistance. Bacteria surviving in the
midgut of larvae display to join a similar part in certain hosts, though in
other ways they decline the growth of pathogens and host mortality due
to pathogen-induction(Broderick et al., 2009). The majority research
focusing on the interface between Bacillus thuringiensis and other mi­
crobes surviving in the midgut of larvae depends on the mortality of
hosts as the variable assessment, and not pathway the growth of bacteria
in tested and not tested hosts in establish to validate planned mecha­
nisms of mortality rate.
Regular screening of culture sovereign methods including Polymer­
ase Chain Reaction (PCR) and DNA sequencing through metagenomics,
which can deal with diversified microbiota. Though, microbial isolation
from pests by using standardized protocols of microbial techniques
needs broad research of the activities related to the activities of enzymes
and individual strain depiction in edict to investigate the concept of
individual isolates of bacteria for the wide applications of biotech­
nology. Thus the present study aims to isolate and characterize the
major midgut microbiota derived from the tobacco cutworm larvae
S. litura and investigating the role of midgut bacteria to the pesticide
survival.
2. Materials and methods
2.1. Insect culture
Larval cultures of S. litura were purchased from the National Bureau
of Agricultural Important insects, Bangalore, India. The castor leaf was
provided as feed and preserved in sterile in-vitro conditions at Relative
Humidity (RH) of 55% and constant Temperature (T) at 27±1 ◦ C lacking
any treatment. The 3rd instars of S. litura were utilized for further
experiments.
2.2. Isolation of gut microbiota
The whole gut from the S. litura larvae was immobilized surface
sterilized by 70% ethanol and was dichotomized under a sterile envi­
ronment in laminar airflow to get rid of the gut. The gut was homoge­
nized in 1 mL of Phosphate Buffer Solution (PBS) (Broderick et al.,
2004). Then larval gut was serially diluted in 10− 1 to 10− 7. After serial
dilution 0.1 mL of the solution was taken using a sterile micropipette and
cultured using the medium supplemented with Nutrient agar. Further,
the cultures were then gestated at 37 ◦ C for one day. The isolated col­
onies of bacteria were further characterized for their morphological and
biochemical characters by following standard Key of Bergey’s Manual of
Determinative Bacteriology.
2
Biocatalysis and Agricultural Biotechnology 28 (2020) 101758
2.3. Characterization of morphological and biochemical features
The biochemical and morphological characterization of the bacterial
colonies was performed by the standard protocols followed by Bergey’s
manual of determinative bacteriology. Further, the morphological as­
says were performed using gram staining kit. The biochemical charac­
terization was executed by using Oxidase and Catalase assay.
2.4. Gene sequencing of 16S rRNA
The gene sequencing assay was performed based on the adapted pro­
tocol of Sambrook et al. (1989). The DNA isolates were preserved at –20 ◦ C
for further experiments. The amplification of 16s rRNA gene sequences
using PCR was performed with the standard primers 295267-F
(5′ -TGCTGCAGAGAGTTTGATCCTGGCTCAG-3′ ) as the forward and
295268-R (5′ -CACGGATCCTACGGGTACCTTGTTACGACTT-3′ ) as a
reverse primer. Conditions of thermal cycler were fixed at 5 min at 95 ◦ C for
the template DNA denaturation, thirty-six amplification cycles, and final
extension was maintained at 10 min with 72 ◦ C. Products of PCR were
isolated on Agarose gels (1%) followed by ethidium bromide staining and
observed under Ultra Violet (UV) light. After analyzing the products of PCR,
they were subjected to gene sequencing. The acquired sequences were
utilized to execute the searches using BLAST tools of the NCBI Gen-Bank
database. Also, phylogenetic characterization of gene sequencing was
performed for microbial characterization.
2.5. Phylogenetic analysis
Sequences of nucleotide (16S rRNA genes) were analyzed with Bio-
Edit and assigned with Cluster W Software. A complete gene sequence
of 16S rRNA including eight isolates of lepidopteran pests and their
twenty-seven carefully linked species were utilized in the analysis of
phylogenetics. The phylogenetic assay was analyzed using the neighbor-
joining (NJ) method, conceded out using MEGA-6 software (Hall et al.,
1999). The NJ analysis was established on the Kimura2-parameter
assay. Gaps of alignment were taken as missing data. The phylogenetic
reliability was analyzed by boots-trap analysis with approximate repli­
cates of 1000 using MEGA 6 software.
2.6. Bacterial suspension preparation
Stock culture isolates of bacteria were shifted to new plates supple­
mented with Nutrient agar to attain each colony of the isolates. The
individual colonies were transferred to freshly prepare Nutrient broth
and preserved at 37 ◦ C for 24 h. Further, the density of bacteria was
analyzed through Optical Density (OD) at 440 nm. Individual cultures
were spin at 3000 rpm for 10 min. Further, the pellet was re-suspended
in 5 ml of sterilized Phosphate Buffer Solution (PBS) and the culture will
be utilized for further assays (Tamura et al., 2013).
2.7. Bioassay
Bioassays were performed based on the adapted methodology
(Vasantha-Srinivasan et al., 2019) and the isolated midgut bacterial
strains using the leaf dip method against the third instar of S. litura. For
experiments, the leaves of the castor plant were surface-sterilized
washing with distilled water. The cypermethrin (Sigma-Aldrich, PES­
TANAL®, analytical standard) dosage was prepared in the recom­
mended dosage of 0.2 g a.i /hectare and the bacterial strains were using
(Clostridium botulinum) different concentrations (5, 10, and 15 ml/l).The
combination of pesticides (Cypermethrin) and bacterial culture selected
with based on the concentration low range (10 μl/l +5 ml/l), mid-range
(50 μl/l + 10 ml/l) and high range (100 μl/l + 15 ml/l) in bioassay with
combination of mixtures. Three experimental groups were taken they
are, treated with indifferent concentration1.Control 2. Cypermethrin3.
Clostridium botulinum + Cypermethrin. For individual dosage, twenty
S. Karthi et al.
3rd instar larvae of S. litura was used and control was treated as water.
The experiments were done in triplicate and mortality data were
recorded after the treatment for 24, 48, and 72 h of post-treatment. The
lethal concentrations, LC50 and LC90, and their 95% confidence limit
were calculated with Probit analysis (Minitab®17).
2.8. Statistical analysis
Experimental data from mortality were exposed to the analysis of
variance (ANOVA of arcsine) and data were expressed as a mean of five
replicates. Significant differences between treatment groups were
examined by Tukey’s multiple range test (significance at p < 0.05) using
Minitab®17 programs.
3. Results
3.1. 1. bacterial characterization
The growth of bacteria was observed post 48h of incubation of insect
homogenized midgut in nutrient agar media plates for serial dilution
ranging from 10− 1 to 10− 7. Bacterial growth observed plates in 10− 1 to
10− 7 concentration. The individual colonies of bacteria were screened
on the size basis and morphology from the culture agar plates partic­
ularly10− 5,10− 6, 10− 7concentration (Fig. 1).
3.2. 2. morphological and biochemical characterization of gut bacteria by
gram staining
The isolates characterization was performed based on Bergey’s
Manual of Determinative Bacteriology and the obtained results were
tabulated (Table 1).
Fig. 1. Isolation of bacterial colonies (Clostridium butyricum, Pseudomonas putida, Clostridium botulinum) in the midgut of S. litura larvae. From the preliminary
screening of eight colonies three isolates were selected and cultured in the nutrient agar plates in the three dilutions such as (A) Clostridium butyricum 10− 5, (B)
Pseudomonas putida-10− 6, (C) Clostridium botulinum-10− 7.
3
Biocatalysis and Agricultural Biotechnology 28 (2020) 101758
3.3. DNA isolation
The eight isolated overnight growth bacterial culture was taken from
the nutrient-rich broth and the presence of bacterial DNA was checked
by using agarose gel electrophoresis method and the genomic DNA
bands were visualized under UV transilluminator. With the help of the
gel documentation method the genomic DNA bands were imaged
(Fig. 2).
3.4. PCR amplification and 16s rRNA sequence analysis
295267F- 5′ GTGCTGCAGAGAGTTTGATCCTGGCTCAG 3’
295268R- 3′ CACGGATCCTACGGGTACCTTGTTACGACTT 5’
The eight colonies were isolated and the 16s rRNA universal primers
are used to amplifying 3 bacterial DNA strains (Clostridium butyricum,
Pseudomonas putida, Clostridium botulinum) were amplified. In the PCR
technique, we amplified the PCR product that was observed under the
UV transilluminator. The sequence was assembled using the sequencer
BLAST program to deposit in Clostridium butyricum, Pseudomonas putida,
Clostridium botulinum the gene bank the show’s similarity with the cor­
responding microorganism in the study with the help of 1 kb ladder the
amplified PCR product was compared their size (Fig. 3).
3.5. Phylogenetic analysis
Align the sequence from the database with the help of the MEGA 6.0
software program the phylogenetic tree was constructed (Fig. 4).
3.6. Bioassay
The results showed moderate toxicity levels post 24, 48, and 72 h of
observation. The LC50 and LC90values of S.litura show high toxicity in 24
S. Karthi et al. Biocatalysis and Agricultural Biotechnology 28 (2020) 101758

Table: 1
Morphological and biochemical characterization of the isolates was done according to Bergey’s Manual of Determinative Bacteriology. Were RS1 indicates Clostridium
butyricum, RS2 indicates Pseudomonas putida and RS3 denotes Clostridium botulinum respectively and (+) Positive; (− ) Negative; (*) Late Reaction.
Morphology and Characterization test Colony 1 Colony 2 Colony 3 Colony 4 (RS1) Colony 5 Colony 6 (RS2) Colony7 (RS3) Colony8

Gram Staining + + + + + – + +
Shape Cocci Cocci Cocci Rod Cocci Rod Rod Cocci
Indole Test – – – – – – – –
Methyl Red + + + + + + + +
VP Test + + + * * * + *
Oxidase Test + + + + + + + +
Hydrogen Peroxide (H2O2) + + + + + + + +

respectively. Despite there is no mortality rate was observed in the

control (Table .2).

4. Discussion

The midgut microbes of insects play a vital role in the cellular

Fig. 2. Genomic DNA was isolated from the presence of midgut bacteria. Lane
1:10− 5 Colony1; Lane 2:10− 6 Colony 2; Lane 3:10− 6 Colony 3; Lane 4:10− 6
Colony 4; Lane 5:10− 6 Colony 5; Lane 6: 10− 7 Colony 6; Lane 7: 10− 7 Colony 7;
Lane 8: 10− 7 Colony 8.
Fig. 3. PCR Amplification product of S. litura larval midgut bacteria Well 1:
marker (1 kb) Lane 1: RS 1 Clostridium butyricum, (10− 6) 4th Colony; Lane 2: RS
2 Pseudomonas putida, (10− 6) 6th Colony and Lane 3: RS 3 Clostridium botulinum
(10− 7) 7th Colony respectively.
h as compared with 48 and 72 h. The Lethal concentration (LC50 and
LC90) value post 24 h treatment displayed 13.9286 μg/ml and 19.1042
μg/ml respectively and it is significant (F4,20 = 17.32; P < 0.0001) with
the lethal dosage obtained after 48 h(LC50-14.8231 μg/ml and LC90-
27.0021 μg/ml) and 72 h(LC50-16.3224 and LC90-32.8811 μg/ml
mechanisms and establish a vital part in insect resistance to pesticides
(Naik et al., 2010). The midgut microbial groups of S. litura larvae from
the diverse location displayed that the environs have a desirable bearing
on the group of microorganisms in the S. litura larval midgut, Clostridium
butyricum, Pseudomonas putida, Clostridium botulinum, have been re­
ported to be fairly prevailing, while another genesis also a portion of the
insect gut microbial groups (Moar et al., 1995). There is a vital gap in
data given the significance of such microbes to other pests. Besides, the
dependence until recently on culture-based methods for the study of
microbial symbionts has likely provided an incomplete view of the
phylogenetic diversity of bacteria within the insect midgut (Indir­
agandhi et al., 2007). The alignment of the bacterial group is lightly
depending on both biotic and abiotic factors including food availability
and climatic conditions. Most bacteria are transitory organisms native to
the soil or the guts of animals (Derakshani et al., 2001). The tobacco
cutworm microbial groups are highly dynamic, shifting over time, and
also response to get changes in important biological patterns of insect.
However, in this present research, there is a lack of growth in bac­
teria was pragmatic in the insect hemocoel which evidences that larval
mortality is chiefly due to the production of toxins and not due to the
admittance of Clostridium botulinum in the hemocoel. The implication of
this research includes both bids and primary data of enteric microbes in
the pests for devious tactics to the pest management by connecting their
native communities. The peritrophic membrane of pests might influence
simply as a physiological barrier that retains the bolus of the food from
unswervingly contacting the epithelial cells of the midgut thus giving
shield against the injury created mechanically.
In this present research, three bacterial colonies were determined in
the midgut of S. litura. Characterization of insect microflora of this
research might be attributed to the specimen’s basis and also the culture
media. The selection force of the in-vitro conditions may decline the
bacterial attainment at the stages of larvae (Favia et al., 2007). The
bacterial communities in the midgut of bacterial isolated in 10− 1 to 10− 7
concentration and 8 colonies were identified in morphological and
biochemical characterization. Gram staining of all the cultures was
complete for all the strains to decide and identification of Gram-positive
or Gram-negative. Also, their morphology was determined by the iso­
lated several cultures of midgut microbiota from the S. litura. The eight
isolated cultures were present in gram-positive or gram-negative. These
cultures were rod and cocci shaped bacteria. All the culture were tested
in the indole test was experimental in a negative result, MR-VP test for
positive result Oxidase test and hydrogen peroxide (H2O2) test also
positive results. The genomic DNA was isolated from 8 different col­
onies, the isolated colonies were identified using 16s rRNA techniques.
Our results show three colonies were amplified and the amplified col­
onies, we also sequenced from 16S rRNA gene for individual isolates to
endorse the isolation of different isolates. As an outcome of all charac­
terization assays and sequencing procedures, midgut microbial isolates

4
S. Karthi et al.
Fig. 4. Phylogenetic tree (NJ) was constructed for the partial 16s rRNA gene of isolates bacteria culture from larvae midgut. (A) Clostridium butyricum AY072928.1.
1, (B) Pseudomonas putida-KM488442.1 and (C) Clostridium botulinum AF396966.2.
Table 2
Third instar larvae of S. litura after treatment with Cypermethrin.
Insecticide No. of insect LC50 (μg/ml)(LCL-UCL)
Cypermethrin 270 0.00012
Treatment:24 h 270 13.9286(11.16316–14.2016)
48 h 270 14.82131(11.28163–15.16210)
72 h 270 16.3224(13.1121–19.2480)
of S. litura to identify as Clostridium butyricum, Pseudomonas putida, and
Clostridium botulinum. Phylogenetic characterization through the
16S-rRNA gene also ropes these detections. Similarly, microbial di­
versity alignment has been widely illustrated in diverse insect pests
(Broderick et al., 2004).The midgut microbial groups of Helicoverpa
armigera Hub. Larvae from diversified regions recommended that bio­
logical surroundings have a substantial deportment on the midgut mi­
crobial group. In Lactococcus and Enterococcus have been studied to be
fairly leading, though alternative genera including Acinetobacter, Fla­
vobacterium, and Stenotro phomonasis also the source of midgut microbial
group(Broderick et al., 2004). Similarly, considerable intra-specific de­
viations were observed in the microbial midgut flora of the H. armigera
field populations indicating that the inter biological nature of larvae can
response to deviate exterior settings like novel microbial ingestion and
phyto-compounds derived from the surface area of the leaves (Xiang
et al., 2006). Though potential impacts of food, environs, and
intra-specific gut microbial deviations fit bacterial order Bacillales and
belongs to the family Entero bacteriaceae were existed in all the species,
and these might be the collective members of the midgut larval micro­
flora of H. armigera. Despite, the importance of physiological functions
and nutrition of H. armigera microbes. The pest midgut is serene of
regenerative and epithelial cells and it is accountable for secretion, ab­
sorption, and digestion (Rost-Roszkowska et al., 2010). There is ami­
crobial similarity derived from the food sources of the plants and their
5
Biocatalysis and Agricultural Biotechnology 28 (2020) 101758
LC90 (μg/ml)(LCL-UCL) χ2 Df
0.0019 0.116 2
19.1042(18.5672–21.8206) 0.261 2
27.0021(25.8231–30.1681) 6.284 2
32.8811(29.1684–35.0032) 3.168 2
isolates from the microbial gut-flora of insects that used up them. This
specifies that the microbes are essentially from the food plants
consumed. This is reliable with the postulation that locusts Schistocerca
gregaria derived from their ingested microbiota from plants (Dillon and
Dillon, 2004). Locusts own close by indigenous microbial communities
serene variety of species regularly stumble upon their surroundings. In a
similar study reported that Enterobacter agglomerans and Enterococcus sp.
derived from the midgut part of the drifting grasshopper Melanopluss
anguinipes, the isolation, and identification gut microbes used as a bio­
pesticide against pests (Mead et al., 1998).
The toxicity of some phytochemicals including pine terpenes derived
from its resin is a major feature influential the comparatively threatened
species diversity in the beetle guts of respect to the Anoplophora. The
observed stability in the structure of the bacterial group at a prominent
level of toxicity in diverse pests. This may designate that its supreme
symbionts are derived environmental fleeting bacteria, minimally some
of them might play a significant part in affecting insect physiology
(Sudakaran et al., 2012). In specific, the ascendancy of Gammaproteo
Enterobacteriaceae bacteria in both adult and larvae forms recommends
that they are continual fractions of the microbial groups and may be
favorable to the fitness of the hosts due to diverse knacks to ferment and
hydrolyze carbohydrates, catalyzing nitrogen fixation, and yield pher­
omones and vitamins (Sharon et al., 2010).
It must be eminent that microbial groups of phylogenies have been
S. Karthi et al.
normally spotted in the diversified insect gut orders and the diets of the
host, with the exemption of pollenivorous, detritivores, and Xylopha­
gous pests. Remarkably, Gama proteo-bacterial presence is usually the
bacterial group confirmation that is relatively similar in diverse beetles
belongs to xylophagous and suggestively diversified from feeding insects
on the tissues of dead lignocellulose of termites. The diet subsequently
linked to the digestive mechanisms progress in the host of insects in­
cludes those associated with the anatomy of the host gut, and it plays a
significant role in constructing the group of bacteria (Colman et al.,
2012).
A mono-linkage of leading bacteria may eradicate or block the
grouping of other competitive microbes, possibly by synthesizing side­
rophore, which impounds and blocks the persistent iron, as an important
factor for microbial growth inside the insect midgut tissues. Moreover,
the incidence at which S. marcescens emerged crossways the diverse
populations and rate of growths of Plutella xylostella advocated a con­
stant symbiosis amid DBM and this taxon, as formerly reported for gypsy
moths and sugar beetroot maggots with the genus of Serratia (Indir­
agandhi et al., 2007). All are known to S. litura pest is one of the enemies
of agricultural former. In the present study, of the three species of
midgut microbiota, Clostridium botulinum increases the survival value of
S. litura exposed to Cypermethrin treatment. Hence it is possible that in
addition to detoxifying enzymes of S. litura, gut microbes may also aid in
metabolizing Cypermethrin to non-toxic compounds.
5. Conclusion
Thus the present investigation concludes that the three midgut
bacterial communities of Clostridium butyricum, Pseudomonas putida, and
Clostridium botulinum. These colonies were identified using molecular
and biochemical methods. 16s rRNA sequencing was completed for the
three isolated colonies which were followed by Phylogenetic analysis to
find their relatedness with other bacterial species. Besides, the Clos­
tridium botulinum bacterium was tested for its role in protecting S. litura
larvae against Cypermethrin toxicity. The result showed S. litura larvae
to survive better when cypermethrin was given along with C. botulinum.
The result of our study shows that gut bacteria also contribute to
pesticide metabolism in insects, thus helping insects to survive in un­
favorable environments.
Declaration of competing interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Acknowledgments
We would like to thank the Department of Biotechnology, Periyar
University, Salem, Tamil Nadu, India for providing the infrastructure for
carrying out this research work. Also, this research work was partially
supported by Chiang Mai University, Thailand.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.bcab.2020.101758.
References
Aksoy, S., Weiss, B., Attardo, G., 2008. Paratransgenesis applied for control of tsetse
transmitted sleeping sickness. Adv. Exp. Med. Biol. 627, 35–48.
Bourtzis, K., Miller, T.A., 2003. Insect Symbiosis. CRC Press, Boca Raton, FL.
Breman, J.G., Egan, A., Keusch, G.T., 2001. The intolerable burden of malaria: a new
look at the numbers. Am. J. Trop. Med. Hyg. 64, 4–7.
Biocatalysis and Agricultural Biotechnology 28 (2020) 101758
Broderick, N.A., Raffa, K.F., Goodman, R.M., Handelsman, J., 2004. Census of the
bacterial community of the gypsy moth larval midgut by using culturing and culture-
independent methods. Appl. Environ. Microbiol. 70, 293–300.
Broderick, N.A., Robinson, C.J., McMahon, M.D., Holt, J., Handelsman, J., Raffa, K.F.,
2009. Contributions of gut bacteria to Bacillus thuringiensis-induced mortality vary
across a range of Lepidoptera. BMC Biol. 7, 11.
Chernysh, S., Kim, S.I., Bekker, G., Pleskach, V.A., Filaova, F.A., Anikin, V.B.,
Plantonov, V.G., Bulet, P., 2002. Antiviriral and antitumor peptides from insect.
P. Natl. Acad. Sci. U.S.A. 99, 12628–12632.
Colman, D.R., Toolson, E.C., Takacs-Vesbach, C.D., 2012. Do diet and taxonomy
influence insect gut bacterial communities? Mol. Ecol. 21, 5124–5137.
Cornelis, P., Digneffe, C., Willemot, K., 1982. Cloning and expression of a Bacillus
coagulans amylase gene in Escherichia coli. Mol. Genet. 186 (4), 507–511.
Coutinho-Abreu, I.V., Zhu, K.Y., Ramalho-Ortigao, M., 2009. Transgenes and
paratransgenesis to control insect-borne diseases: current status and future
challenges. Parasitol. Int. 59, 1–8.
Derakshani, M., Lukow, T., Liesack, W., 2001. Novel bacterial lineages at the (sub)
division level as detected by signature nucleotide-targeted recovery of 16S rRNA
genes from bulk soil and rice roots of flooded rice microcosms. Appl. Environ.
Microbiol. 67, 623–631.
Dillon, R.J., Dillon, V.M., 2004. The gut bacteria of insects: nonpathogenic interactions.
Annu. Rev. Entomol. 49, 71–92.
Douglas, A.E., 1998. Nutritional interactions in insect-microbial symbioses: aphids and
their symbiotic bacteria Buchnera. Annu. Rev. Entomol. 43, 17–37.
Favia, G., Ricci, I., Damiani, C., Raddadi, N., Crotti, E., Marzorati, M., Rizzi, A., Urso, R.,
Brusetti, L., Borin, S., Mora, D., Scuppa, P., Pasqualini, L., Clementi, E., Genchi, M.,
Corona, S., Negri, I., Grandi, G., Alma, A., Kramer, L., Esposito, F., Bandi, C.,
Sacchi, L., Daffonchio, D., 2007. Bacteria of the genus Asaia stably associate with
Anopheles stephensi, an Asian malarial mosquito vector. P. Natl. Acad. Sci. USA. 104,
9047–9051.
Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and
analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98.
Indiragandhi, P., Anandham, R., Madhaiyan, M., Poonguzhali, S., Kim, G.H.,
Saravanan, V.S., Tongmin, S., 2007. Cultivable bacteria associated with larval gut of
prothiofos-resistant, prothiofos-susceptible and field-caught populations of
diamondback moth, Plutellaxylostella and their potential for, antagonism towards
entomopathogenic fungi and host insect nutrition. J. Appl. Microbiol. 103,
2664–2675.
Mead, L.J., Khachatouriana, G.G., Jones, G.A., 1998. Microbial ecology of the gut in
laboratory stocks of migratory grasshopper, Melanoplussanguiniped (Fab)
(Orthoptera: acrididae). Appl. Environ. Microbiol. 54, 1174–1180.
Moar, W.J., Pusztzai-Carey, M., Mac, T.P., 1995. Toxicity of purified proteins and HD-
strain from Bacillus thuringiensis against lesser cornstalk borer (Lepidoptera:
Pyralidae). J. Econ. Entomol. 88, 606–609.
Naik, S.N., Vaibhav, V., Goud, K., Prasant, R., Ajay Dalai, K., 2010. Production of first
and second generation biofuels: a comprehensive review. Renew. Sustain. Energy
Rev. 14, 578–597.
Nardiet, J.B., Mackie, R.I., Dawson, J.D., 2002. Could microbial symbionts of arthropod
gut contribute significantly to nitrogen fixation in terrestrial ecosystems. J. Insect
Physiol. 48, 751–763.
Rost-Roszkowska, M.M., Vilimova, J., Chajec, L., 2010. Fine structure of midgut
epithelium of Ateluraformicaria (Hexapoda; Zygentoma; Ateluridae), with special
reference to its regeneration and degeneration. Zool. Stud. 49, 10–18.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual.
Cold Spring Harbor, New York.
Sharon, G., Segal, D., Ringo, J.M., Hefetz, A., Zilber-Rosenberg, I., Rosenberg, E., 2010.
Commensal bacteria play a role in mating preference of Drosophila melanogaster.
P. Natl. Acad. Sci. USA. 107, 20051–20056.
Shi, W., Xie, S., Chen, X., Sun, S., Zhou, X., 2013. Comparative genomic analysis of the
endosymbionts of herbivorous insects reveals eco-environmental adaptations:
biotechnology applications. PLoS Genet. 9 (1), e1003131 https://doi.org/10.1371/
journal.pgen.1003131.
Sudakaran, S., Salem, H., Kost, C., Kaltenpoth, M., 2012. Geographical and ecological
stability of the symbiotic midgut microbiota in European firebugs, Pyrrhocorisapterus
(Hemiptera, Pyrrhocoridae). Mol. Ecol. 21, 6134–6151.
Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. Mega 6: molecular
evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729.
Vasantha-Srinivasan, P., Karthi, S., Chellappandian, M., Ponsankar, A., Thanigaivel, A.,
Senthil-Nathan, S., Chandramohan, D., Ganesan, R., 2019. Aspergillus flavus (Link)
toxins reduces the fitness of dengue vector Aedesaegypti (Linn.) and their non-target
toxicity against aquatic predator. Microb. Pathog. 128, 281–287.
Walker, A.J., Glen, D.M., Shewry, P.R., 1999. Bacteria associated with the digestive
system of the slug Derocerasreticulatumare not required for protein digestion. Soil
Biol. Biochem. 31, 1387–1394.
Whalon, M.E.D., Mota-Sanchez, Hollingsworth, 2008. Global Pesticide Resistance in
Arthropods. CAB International, Oxfordshire, UK).
Xiang, H., Fang, G., Wei, S., Jia, J., Huang, X., Xia, M., Zhou, Z., Ping Zhao, L., Ping
Huang, Y., 2006. Microbial communities in the larval midgut of laboratory and field
populations of cotton bollworm (Helicoverpaarmigera). Can. J. Microbiol. 52,
1085–1092.
Xia, X., Zheng, D., Zhong, H., Qin, B., Gurr, G.M., et al., 2013. DNA sequencing reveals
the midgut microbiota of Diamondback Moth, Plutellaxylostella (L.) and a possible
relationship with Insecticide Resistance. PloS One 8 (7), e68852. https://doi.org/
10.1371/journal.pone.0068852.