Theriogenology 86 (2016) 2004–2011

Contents lists available at ScienceDirect

Theriogenology
journal homepage: www.theriojournal.com

GREM1, EGFR, and HAS2; the oocyte competence markers

for improved buffalo embryo production in vitro
Rahul Bhardwaj a, Mohd Matin Ansari a, Sriti Pandey a, Mehtab S. Parmar a,
Vikash Chandra a, *, G. Sai Kumar b, G. Taru Sharma a
a
Reproductive Physiology Lab, Division of Physiology and Climatology, ICAR-Indian Veterinary Research Institute, Izatnagar, UP, India
b
Division of Veterinary Pathology, ICAR-Indian Veterinary Research Institute, Izatnagar, UP, India

a r t i c l e i n f o a b s t r a c t

Article history: Selection of competent oocytes is crucial for successful in vitro embryo production and
Received 16 November 2015 correlating expression profile of oocyte competence markers in cumulus cells with oocyte
Received in revised form 18 June 2016 quality is an important preamble. In the present study, expression profile of oocyte
Accepted 19 June 2016
competence markers (GREM1, EGFR, HAS2, and TNFAIP6) was correlated through brilliant
cresyl blue (BCB) staining and subsequently with in vitro embryo production. Excellent to
Keywords:
good quality buffalo, cumulus oocyte complexes (COCs) were stained with BCB (26 mM)
Buffalo
and based on the blue coloration of cytoplasm COCs were divided in two groups as BCBþve
Oocyte competence markers
Gene expression and BCBve. Mean percentage of BCBþve oocytes was significantly higher (P < 0.05) than
In vitro embryo production BCBve oocytes (56.79  1.22 vs. 43.20  1.22), the mean oocyte diameter was also
BCB staining significantly larger (P < 0.05) for the BCBþve group than that of BCBve group
(145.7  1.8 mm vs. 132.7  1.9 mm). The cleavage rate (%), blastocyst rate (%), and total cell
number was significantly (P < 0.05) higher in BCBþve than BCBve group (71.15  2.17 vs.
52.89  2.65; 31.58  1.11 vs. 7.73  0.97, and 93.14  2.42 vs. 71.42  2.09, respectively).
Relative mRNA expression of marker genes in cumulus cells increased significantly
(P < 0.05) after maturation viz. GREM1 (10.13 folds), EGFR (9.04 folds), HAS2 (27.91 folds),
and TNFAIP6 (64.81 folds). Brilliant cresyl blue positive oocytes showed significantly higher
(P < 0.05) expression of GREM1, EGFR, and HAS2 transcripts than BCBve oocytes, however,
no significant change in the expression of TNFAIP6 gene was observed. It is concluded from
the study that GREM1, EGFR, and HAS2 could be used as molecular markers of oocyte
competence for an improved buffalo embryo production in vitro.
Ó 2016 Elsevier Inc. All rights reserved.

1. Introduction significantly [2]. In vitro embryo production outcome

Research data on in vitro embryo production (IVEP) in-
dicates lower efficiency in buffalo compared with cattle,
and this may further be improved either through the se-
lection of good quality oocytes and/or by improving the
in vitro embryo culture system [1]. The oocytes recovered
from slaughterhouse-derived ovaries are heterogeneous in
quality and the developmental competence varies
* Corresponding author. Tel.: þ91 9411423410; fax: 91-581-2301327.
E-mail address: vikashvet15@gmail.com (V. Chandra).
largely depends on the quality and origin of the oocytes,
therefore, oocyte quality is an important determinant of
oocyte competence, which is defined as an ability of the
oocyte to complete maturation, undergo successful fertil-
ization, and reach the blastocyst stage. Morphological
assessment is based on number of layers and compactness
of cumulus, homogeneity of the ooplasm, and extrusion of
first polar body [3]. However, these morphological evalu-
ations are not reliable enough to act as the sole criteria for
the evaluation of oocyte competence; therefore, other
alternative selection criteria are needed for selecting the
most viable oocytes for IVEP. During the growth phase,

0093-691X/$ – see front matter Ó 2016 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.theriogenology.2016.06.019
 R. Bhardwaj et al. / Theriogenology 86 (2016) 2004–2011
oocytes synthesize a variety of proteins, including glucose-
6-phosphate dehydrogenase (G6PDH) [4]. It is reported
that G6PDH activity is more in the growing oocytes [5], and
its activity decreases in oocytes having completed growth
phase and are likely to have achieved developmental
competence [6]. Brilliant cresyl blue (BCB) staining is
known to be a noninvasive method, as it allows the
selection of competent oocytes among a heterogeneous
pool. Brilliant cresyl blue screening is based on the ability
of G6PDH to reduce the BCB stain present in oocyte.
Growing oocytes, having higher G6PDH activity reduce BCB
relatively in a quicker mode and become colorless,
whereas fully grown oocytes with lesser G6PDH activity
remain blue [7].
The poor developmental competence of IVM oocytes
has been proposed due to failure of the timely onset of
embryonic genome activation resulting from incomplete
cytoplasmic maturation of these oocytes [8]. Earlier studies
on oocyte gene expression have revealed the specific
molecular markers to characterize successful oocyte
maturation, and a good number of genes have been iden-
tified as potential predictors of oocyte competence both in
cattle and buffaloes [9], [10], [11], and [12]. Studies have
also been conducted on oocyte competence marker genes
in bovine cumulus cells [13] because these transcripts are
indicators of the oocyte cytoplasmic maturation status,
identification of the same may provide new knowledge and
powerful tool/s to assess oocyte competence individually
by analyzing its cumulus component. Therefore, the
present study was designed to determine the relative
expression of oocyte competence markers genes (EGFR,
GREM1, HAS2, and TNFAIP6) in cumulus cells along with the
association with BCB staining and subsequent in vitro
buffalo embryo development rate.
2. Materials and methods
Plastic-wares used for oocyte and embryo culture were
procured from Nunc (Denmark), whereas 0.22-mm mem-
brane filters were purchased from Millipore (Molsheim,
France). All the chemicals and culture medium used for the
embryo production were cell culture grade, endotoxin
tested, and procured from the Sigma Chemicals Co.,
(St. Louis, MO, USA). Specifications and description of these
chemicals, molecular reagents, and biochemicals are given
at suitable places in the text.
2.1. In vitro embryo production
2.1.1. Collection and transportation of ovaries
Buffalo ovaries were collected from local slaughter-
house and transported to the laboratory in sterile normal
saline solution fortified with antibiotics at 37 to 39  C
within 2 to 3 hours of slaughter. Ovaries were washed
properly with sterile normal saline solution, and all the
visible ovarian follicles with a diameter of 2 to 8 mm were
aspirated using 18 gauge needle. The aspirated supernatant
follicular fluid was allowed to settle and oocytes were
recovered under stereo zoom microscope (Olympus). The
aspirated cumulus oocytes complexes (COCs) were graded
on the basis of their morphological appearance of the
2005
cumulus cell investments and homogenous granular
ooplasm under the stereo zoom microscope. Excellent
quality COCs (with an unexpanded cumulus mass having
5 layers of cumulus cells and evenly granular homoge-
nous ooplasm) and good quality oocytes (COCs with three–
five layers of compact cumulus cells and with granular
homogenous ooplasm) were selected for the study.
2.1.2. Brilliant cresyl blue (BCB) staining of oocytes
Brilliant cresyl blue staining was done as per protocol of
Manjunatha et al [4], briefly, culture grade COCs were
washed three times in Dulbecco’s PBS, modified by the
addition of 0.4% BSA (mDPBS). The COCs were exposed to
26-mM BCB stain for 90 minutes at 5% CO2 and 38.5  C in a
humidified air atmosphere. After the BCB exposure, COCs
were transferred to a drop of mDPBS and washed twice and
examined under a stereo zoom microscope after 5 minutes.
They were divided into two groups depending upon their
cytoplasm coloration; COCs with any degree of blue
coloration were designated as BCBþve and COCs without
any blue coloration of the cytoplasm were designated as
BCBve, and the percentage of BCBþve and BCBve oocytes
was recorded. Oocyte diameter (including zona) was
measured after denuding oocytes as the mean length of
two perpendicular axes using a micrometric ocular under
an inverted microscope (Olympus).
2.1.3. Isolation of cumulus cells
Cumulus cells from unscreened immature oocytes, IVM
oocytes, immature BCBþve and BCBve oocytes were
isolated by enzymatic treatment. Oocytes of each group
were treated with 0.5% hyaluronidase for 30 minutes fol-
lowed by gentle vortex for 10 minutes. All the naked oo-
cytes were screened under stereo zoom microscope,
cumulus cells were suspended in DPBS and transferred in
an eppendorf tube. Cells were centrifuged at 1500 rpm for
10 minutes followed by proper washings in mDPBS, and
pellet formed was used for further total RNA isolation.
2.1.4. In vitro oocyte maturation (IVM)
Culturable unscreened immature COCs (control), BCBþve
and BCBve COCs were washed with maturation medium
containing TCM-199 (HEPES modified), supplemented with
3% BSA, 5-mg/mL LH, 0.5-mg/mL FSH, 1-mg/mL estradiol-17b,
20-ng/mL EGF, 0.25-mM sodium pyruvate, 0.68-mM
L-glutamine, 10-mg/mL gentamicin, and 10% FBS. About 10
to 15 COCs were kept for maturation in 50-mL droplets of
maturation medium in 35-mm culture dish overlaid with
sterile mineral oil for 24 hours at 38.5  C and 5% CO2 in air
with maximum relative humidity.
2.1.5. In vitro fertilization (IVF)
Frozen-thawed buffalo bull semen from a single bull was
used throughout the study. In vitro matured COCs were
subjected for IVF in Fert-TALP medium supplemented with
0.2-mM sodium pyruvate, 6-mg/mL BSA fatty acid free,
20-mg/mL heparin, and 50-mg/mL gentamycin sulfate. Single
frozen buffalo semen straw (0.25 mL) was thawed at 37  C
for 30 seconds, and semen was washed twice in Fert-TALP
medium by centrifugation at 600 rpm for 10 minutes each.
The supernatant was discarded and the sperm pellet was
2006 R. Bhardwaj et al. / Theriogenology 86 (2016) 2004–2011
Table 1
Primer pairs used for PCR/qPCR, amplicon size, and annealing temperatures.
Genes Primer pairs
GAPDH F- CGACCACTTTGTCAAGCTCA
R- GGACCTTACTCCTTGGAGGC
EGFR F- CCAGGAGGTTGCCGGCTATGT
R- GCAGCTCCCTCAGTCCGGTTTT
GREM1 F- AACAGCCGTACCATCATCAAC
R- TTCAGGACAGTTGAGAGTGACC
HAS2 F- ATAAATGTGGCAGGCGGAAGAAGG
R- GTCTTTGTTCAAGTCCCAGCAGCA
TNFAIP6 F- ATGGGAAGAGGCTCACGGATG
R- TCTGGCTGCCTCTAACTGCTTGT
Abbreviations: EGFR, epidermal growth factor receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GREM1, gremlin 1; HAS2, hyaluronan
synthase 2; PCR, polymerase chain reaction; TNFAIP6, tumor necrosis factor alpha-induced protein 6.
resuspended and kept in CO2 incubator to allow the motile
sperm to reach the supernatant by swim up and meanwhile
the IVM oocytes were washed in Fert-TALP medium. Sperm
concentration was adjusted to a final concentration of
2  106 spermatozoa/mL using Fert-TALP medium. Sperm
suspension were placed as 50-mL droplets in 35-mm dish
under mineral oil, and oocytes were coincubated (10–15
oocytes/50 mL droplet) for 18 hours with 5% CO2 in air at
38.5  C with maximum relative humidity.
2.1.6. In vitro culture of embryos (IVC)
The presumptive zygotes were washed 5 to 6 times and
incubated in modified synthetic oviductal fluid supple-
mented with 3-mg/mL BSA fatty acid free, 0.25-mM sodium
pyruvate with 1% essential and nonessential amino acids
each, 0.68-mM L-glutamine, 100-ng/mL IGF1, and 50-mg/
mL gentamycin sulfate. The zygotes were cultured without
FBS for an initial development of 48 hpi and further
cultured with 10% FBS supplemented in modified synthetic
oviductal fluid and medium was changed at alternate day
till blastocyst development/or Day 8 after IVF.
2.1.7. Assessment of total cell number (TCN)
To evaluate the total cell number (TCN), buffalo blasto-
cysts were subjected to Hoechst 33342 (Sigma) staining.
The blastocysts from different culture groups were washed
twice in mPBS. Thereafter, fixed in 4% paraformaldehyde
solution at room temperature for 30 minutes and washed
twice in mPBS. Permeabilization was done by placing
blastocysts in a drop of 0.5% triton X-100 in mPBS for 15 to
20 minutes at room temperature followed by washing in
mPBS. The individual blastocysts were transferred in 50-mL
drop of Hoechst solution, placed on siliconized glass slide
and incubated at 37  C for 15 to 20 minutes. The excess of
stain was removed with fine pipette and washed in mPBS.
A drop (5 mL) of Vectashield mounting medium (for fluo-
rescence) was kept on another siliconized glass slide,
blastocysts were transferred to it with minimum volume of
fluid and a cover slip was placed over it. The blastocysts
were examined under epifluorescence microscope
(Olympus, Japan) with a UV excitation filter of 365 nm with
barrier filter of 400 nm. Bisbenzimide-stained nuclei
appeared blue enabling total cell count. Total cell number
was recorded by counting the cell number of photographed
blastocysts. A sum of 13 blastocysts in each group were
stained with Hoechst and evaluated.
Annealing temp. ( C) Amplicon size (bp) References
62 101 NM_001034034
61 161 HM749883.1
55 155 Assidi et al., 2008
60 183 Assidi et al., 2008
57 193 NM_001007813.2
2.2. Total RNA extraction
Total RNA was isolated from cumulus cells of deferent
groups by trizol method and stored at 80  C until used.
Quality and integrity of the RNA was assessed by subjecting
it to denaturing agarose gel (1%) electrophoresis. Purity and
concentration of total RNA was checked using the Nano-
drop Spectrophotometer reading at OD 260 and 280.
Samples with OD 260/280 values between 1.8 and 2.0 were
used for further study.
2.3. Reverse transcription (RT)
Reverse transcription was carried out using RevertAid H
Minus Reverse Transcriptase system kit (MBI, Fermentas,
USA) in a total volume of 21-mL reaction volume using
Molony–Murine Leukemia Virus Reverse Transcriptase
(MMLV-RT; Fermentas, USA) following the manufacturer’s
instruction. A sum of 1.0 mg of total RNA was used as
template. After thawing, all components were mixed,
briefly centrifuged, and kept on ice. To a sterile, nuclease
free thin-walled prechilled microcentrifuge tube (0.2 mL),
the following components were added in the indicated
order: RNA template, random hexamer 1 mL, nuclease free
water (NFW) to make total volume 12 mL. The reaction
mixture was formulated for the samples and for a no
template negative control. The mixture was incubated for
5 minutes at 65  C followed by quick chilling on ice for
5 minutes. Contents were briefly centrifuged and placed on
ice. Remaining components were added in the following
order: 5X RT buffer 4.0 mL, dNTP mix (10 mM each), riblo-
lock RNAse inhibitor (40 U) 0.5 mL, RevertAid H Minus
Reverse Transcriptase (100 units) 2.0 mL. Contents of tube
were gently vortexed and spun down by brief centrifuga-
tion. The RNA was subsequently reverse-transcribed by
incubating at 70  C for 5 minutes followed by incubation at
25  C for 5 minutes, 42  C for 60 minutes, and final
termination of the reaction by heating for 10 minutes at
70  C. The cDNA were properly labeled and stored at 20  C
for later use. The quality of cDNA was assessed by an
amplification reaction for a house keeping gene GAPDH.
2.4. Primers and PCR amplification
The genes, studied are presented in Table 1, with the
details of their sequences of sense and antisense primer
 R. Bhardwaj et al. / Theriogenology 86 (2016) 2004–2011
Table 2
Mean percentage and average size of BCB-screened oocytes.
Treatment Total no. of oocytes Percentage Average
group screened (n ¼ 1091) size (mm)
BCBve 472 43.20  1.22a 132.7  1.9a
BCBþve 619 56.79  1.22b 145.7  1.8b
Values (mean  SEM) in the column with different superscripts differ
significantly (P < 0.05).
Abbreviation: BCB, brilliant cresyl blue.
sequences, primer references, specific annealing tempera-
ture, and product length. The amplification reaction
mixture consisted of following components in order: 10x
Dream Taq Green Buffer 2.5 mL, dNTP mix 10 mM each,
forward and reverse primers (10 pM each), template DNA,
Dream Taq DNA polymerase 0.25 U, and NFW to
make mixture 25 mL. An initial 5 minutes denaturation step
at 94  C was followed by cDNA amplification cycles
including denaturation at 94  C, annealing temperature
(as in Table 1) and elongation at 72  C. Both negative
reverse transcriptase control and negative template control
were maintained for each set of primers. The polymerase
chain reaction (PCR) reactions ended with a final elonga-
tion step at 72  C for 10 minutes.
PCR products were analyzed by agarose gel electro-
phoresis (1.5% agarose) and visualized on a UV trans-
illuminator, electrophoresed PCR products were run
simultaneously with 50-bp ladder (Fermentas) for deter-
mining their tentative molecular sizes. Results were
recorded on a gel documentation system with CCD camera
(Alpha Imager-2200, Alpha Innotech Corporation).
2.5. Real-time PCR
Quantitative real-time PCR was performed with TaKaRa
SYBR Premix Ex Taq kit and Smart Cycler Real Time qPCR
(Cepheid, USA) spectroflourometer. The annealing
temperature of each determined factors was standardized
in qPCR using cDNA synthesized from cumulus cells
extracted total RNA. Efficiencies of primer pairs were
determined by running a standard curve for each assay
before processing experimental samples. The slope values
Fig. 1. BCB-stained oocytes and measurement of oocyte diameter: (A). BCBþve oocytes retained the blue stain (red arrow), whereas BCBve oocytes returned
colorless (black arrow); (B) diameter measured as length of two perpendicular axes included zona thickness. BCB, brilliant cresyl blue. (For interpretation of the
references to color in this figure legend, the reader is referred to the Web version of this article.)
2007
were calculated using MxPro qPCR software for each primer
used in the study (Smart Cycler, Cepheid, USA). Primer pairs
with efficiency 95% to 100% were used. No template control
was placed for gene quantification for checking contami-
nation in reaction components other than cDNA. In nega-
tive control, only the real-time master mix and primers
were added. Master mix was prepared as following: SYBR
Premix Ex Taq/qPCR master mix 12.5 mL, forward primer
(10 pM), reverse primer (10 pM), cDNA template 2.0 mL,
NFW to make total volume 25 mL. GAPDH was taken as the
house keeping gene. Smart cycler protocol of real-time PCR
was kept as: initial denaturation 95  C for 30 seconds,
denaturation 95  C for 5 seconds, annealing (Table 1)
10 seconds, extension 72  C for 10 seconds for 40 cycles.
After the run has ended, cycle threshold values, amplifica-
tion plot, and dissociation curve for all the transcripts were
acquired and recorded. Relative gene expression was
calculated by using method described by Pfaffl [14].
2.6. Statistical analysis
Statistical analysis of data was carried out using the SAS
9.2 software (SAS Institute Inc., Cary, NC, USA). Differences
in BCB oocytes percentage and diameter, embryo devel-
opment (cleavage rate, blastocyst rate, and TCN), and
relative mRNA expression between experimental groups
were analyzed using one-way ANOVA with Duncan post
hoc multiple comparison test. Values are expressed as the
mean  standard error of the mean. A probability of
P < 0.05 was considered significant.
3. Results
The mean percentage of BCBþve oocytes was signifi-
cantly (P < 0.05) higher compared with BCBve oocytes
(56.79  1.22 vs. 43.20  1.22; Table 2). The diameter of the
BCB-screened oocytes was measured microscopically
(magnification 200; Fig. 1B), the mean diameter of BCBþve
oocytes was significantly (P < 0.05) higher than BCBve
oocytes (145.7  1.8 mm vs. 132.7  1.9 mm; Table 2). The
cleavage rate (%) was significantly (P < 0.05) higher in
BCBþve than BCBve group (71.15  2.17 vs. 52.89  2.65),
2008 R. Bhardwaj et al. / Theriogenology 86 (2016) 2004–2011
Table 3
Embryo development rate in different group of oocytes.
Treatment group No. of oocytes cultured
Control 259
BCBve 264
BCBþve 251
Values (mean  SEM) in the column with different superscripts differ significantly (P < 0.05).
Abbreviation: BCB, brilliant cresyl blue.
d
In each group, 13 blastocysts were taken for TCN recording.
but it was nonsignificant (P > 0.05) than control group
(65.29  2.65); similarly blastocyst rate (%) was also
significantly (P < 0.05) higher in BCBþve group as compared
with BCBve group and control group (31.58  1.11 vs.
7.73  0.97 and 17.22  1.36, respectively; Table 3, Fig. 2).
The mean TCN were significantly (P < 0.05) higher in
BCBþve and control group compared with BCBve group
(93.14 vs. 85.57 and 71.42, respectively; Table 3).
A single and specific band of 155 bp for GRME1, 163 bp
for EGFR, 183 bp for HAS2, and 193 bp for TNFAIP6 was
amplified from the cDNA (Fig. 3), the PCR product was
identified by the characteristic melting curves of GAPDH,
GREM1, EGFR, HAS2, and TNFAIP6. The relative expression
profile of the genes of interest (GREM1, EGFR, HAS2, and
TNFAIP6) is presented in Figure 4A–D. The values of
unscreened immature oocyte group were used as calibrator
for all genes. The mRNA expression of GREM1 was found
significantly (P < 0.05) higher in mature oocytes (10.13
times) compared with immature oocytes. The GREM1
mRNA expression between BCBþve and BCBve group also
differed significantly (P < 0.05; 2.84 vs. 0.49; Fig. 4A). The
EGFR mRNA expression of BCBþve group was significantly
(P < 0.05) higher than BCBve group (2.95 vs. 0.47) but both
were statistically nonsignificant (P > 0.05) with the
immature group. However, the mature oocyte group
showed significantly (P < 0.05) higher EGFR mRNA
expression as compared with all other three groups (9.04
vs. 2.95 and 0.47; Fig. 4B). There was a significant (P < 0.05)
difference in HAS2 mRNA expression in mature oocyte
group than that of other three groups (7.91 vs. 2.78 and
0.44). The mRNA expression of HAS2 in BCBþve group was
significantly (P < 0.05) higher compared with BCBve group
(2.78 vs. 0.44) but nonsignificant (P > 0.05) compared with
Fig. 2. In vitro-produced embryos: (A). embryonic stages at Day 2 after IVF; (B). embryonic stages at Day 8 after IVF.
Cleavage rate Blastocyst rate Mean total cell
n (%) n (%) number (TCN)d
167 (65.29  2.65)a 29 (17.22  1.36)a 85.57  2.59a
139 (52.89  2.65)b 11 (7.73  0.97)b 71.42  2.09b
179 (71.15  2.17)a 57 (31.58  1.11)c 93.14  2.42a
the immature group (Fig. 4C). The TNFAIP6 mRNA expres-
sion was found significantly (P < 0.05) higher in mature
oocyte group as compared with all other three groups
(4.81  0.85 vs. 0.97  0.23 and 1.01  0.2; Fig. 4D). How-
ever, the mRNA expression level among other three groups
was found nonsignificant (P > 0.05).
4. Discussion
Although the multiple factors play important role in
determining the outcome of IVEP, but the major determi-
nant of successful IVF outcome is developmental compe-
tence of oocyte [15] and [16]. Developmental competence is
gained gradually as oocyte grows during folliculogenesis.
Bidirectional communication between oocyte and cumulus
cells is utmost importance, as differentiated cumulus cells
not only provide nutrients but they also send regulatory
signals to promote oocyte nuclear and cytoplasmic matu-
ration. Morphological appearance of oocytes, which is
generally used as marker for the selection of oocytes for
IVC, is not sufficient to accurately predict the competence
of oocytes. Defined molecular signatures of oocyte
competence acquired during maturation by the surround-
ing somatic cells would be useful to predict the develop-
mental potential of oocytes. Present study reports a close
association between relative expression of putative oocyte
competence markers in cumulus cells and the develop-
mental competence of oocytes which has been verified by
the BCB differential staining and embryo development rate
in vitro. These findings suggest that the differentially
expressed genes may be used as potential biomarker for
oocyte developmental competence.
 R. Bhardwaj et al. / Theriogenology 86 (2016) 2004–2011 2009

secretory factors (GDF9 and BMP15, and so forth) act upon

Fig. 3. RT-PCR for oocyte competence markers genes: M: 50-bp DNA ladder;
1: CCs from immature oocytes; 2: CCs from BCBþve immature oocytes; 3: CCs
from BCBve immature oocytes; 4: CCs from IVM oocytes. BCB, brilliant
cresyl blue.
Experiments conducted in this study highlights the
relative mRNA expression of GREM1, EGFR, HAS2, and
TNFAIP6 gene in unscreened immature oocytes, BCBþve
oocytes, BCBve oocytes, and IVM oocytes. Expression
pattern of all these four transcripts revealed a significantly
(P < 0.05) higher expression in mature oocytes compared
with the immature oocytes. During maturation, oocyte
the cumulus cells and enhance the mRNA expression of
cumulus expansion enabling factors (HAS2, PTGS2, PTX3
and TNFAIP6, and so forth) [17]. Further, there was signifi-
cantly (P < 0.05) higher expression of GREM1, EGFR, and
HAS2 in BCBþve than BCBve oocytes, but insignificant
change was observed in TNFAIP6 gene expression. Assidi
et al [13] also reported upregulation of GREM1, HAS2, EGFR,
and TNFIP6 in cumulus cells that were differentially
expressed in bovine COCs matured in medium supple-
mented with FSH and/or phorbol myristate acetate. HAS2
expression was found higher in BCBþve than BCBve oocytes
as it is an enzyme which helps in the production of hya-
luronan by cumulus cells. The timing of HAS2 mRNA
expression in cumulus cells is correlated with hyaluronan
sysnthesis [18], thus, its role in cumulus expansion is
assumed to be closely related to oocyte quality. An
increasing trend of EGFR expression in relation to follicle
size of cattle has been observed by Caixeta et al. [19],
revealing its role in oocyte developmental competence.

Fig. 4. Relative mRNA expression of GREM1 (A), EGFR (B), HAS2 (C), and TNFAIP6 (D) genes in cumulus cells. Control group that is cumulus cells derived from
unscreened immature oocytes was used as reference for comparison. Different letters in bar graphics represent different least square means (P < 0.05).
2010 R. Bhardwaj et al. / Theriogenology 86 (2016) 2004–2011
Researchers in earlier studies also noticed higher level of
GREM1 in cumulus cells surrounding oocytes that devel-
oped into high-quality embryos [20], [21], and [22].
GREM1 is known to exert control on gene expression in
cumulus cells by inhibiting BMPs [23], it was earlier
reported that GREM1 expression can accurately predict the
embryo quality, as its higher levels were found in cumulus
cells isolated from oocytes that developed into high-quality
embryos [20], [21], and [22]. HAS2 expression is controlled
by GDF9 [24] and is considered as an important prerequi-
site for extrusion of oocyte form follicle at time of ovulation
and sperm-oocyte interaction mediated by hyaluronan
[25], therefore, its role in cumulus expansion is expected to
be closely related to oocyte quality. TNFAIP6 protein is
known to interact with molecules that form the backbone
of the COC matrix, as it contains hyaluronan binding
domain which is important for matrix stability and cell
migration [26] and [27], thus, its expression is found at the
time of maturation. Its expression was reported to occur
upstream of PTGS2 in mice [27].
To prove the higher competence of BCBþve oocytes than
BCBve oocytes, BCB staining was done and morphological
evaluation and embryo development rate was recorded.
Pujol et al. [28] concluded in their work that the BCB
screening test could be effectively used for selecting
competent bovine oocytes. In the present study, BCBþve
oocytes recorded significantly greater (P < 0.05) diameter
compared with BCBve oocytes. The values of mean oocyte
diameter were similar to those reported in cattle [28],
buffalo [4], goats [29], and pigs [30]. Positive correlation
between follicle size and blastocysts rate has been observed
in sheep, depicting the oocyte diameter as a determining
factor in acquiring meiotic competence in various species,
including buffalo [31]. It has been reported that develop-
mental competence is acquired in buffalo oocytes after
reaching about 145-mm diameter [31]. Data obtained dur-
ing this work depict significantly (P < 0.05) higher cleavage
rate in BCBþve oocytes compared with BCBve oocytes, with
an insignificant (P > 0.05) difference between BCBþve
oocytes and control group. Similar trend was also reported
earlier in buffalo [4] and pigs [30], however, there was no
difference in cleavage rate in BCBþve and BCBve oocytes in
cattle [32] and sheep [33]. Lower cleavage rate in BCBve
oocytes could be due to an incomplete oocyte cytoplasmic
maturation, as Roca et al. [30] reported a lower rate of
sperm penetration in BCBve oocytes compared with
BCBþve oocytes. Present study revealed a significantly
higher blastocyst rate in BCBþve than BCBve and control
group, which are in consensus with earlier documented
reports in buffalo [4], cattle [34], sheep [33], and goat [29].
However, our results differ with the previous reports in
goats [29] and pigs [30], where the workers found no
difference in blastocyst rate in BCBþve and control group.
Above variations in the findings might be due to the fact
that BCB staining is manual method and discoloration is
time-dependent phenomenon, leaving a possible scope for
individual variations. It is now evident that there is a direct
and positive corelation among the follicle size, oocyte
diameter, and the embryo development [35] and [20]. Thus,
the BCB test is found to be very effective in selecting
competent oocytes.
In conclusion, our results demonstrate that oocyte
competence markers (GREM1, HAS2, and EGFR) could be
used effectively for the selection of competent buffalo
oocytes for IVEP and TNFAIP6 along with GREM1, HAS2, and
EGFR can be used as oocyte maturation markers; such
markers are assumed to be of significant use, where in
oocyte culture regime is being optimized.
Acknowledgments
The authors are thankful to the Director IVRI, Izatnagar
for the financial support.
References
[1] Bhardwaj R, Ansari MM, Parmar MS, Chandra V, Sharma GT. Stem
cell conditioned media contains important growth factors and
improves in vitro buffalo embryo production. Anim Biotechnol
2016;27:118–25.
[2] Gordon I. Laboratory production of cattle embryos. Second edition.
Cambridge, UK: CABI; 2003.
[3] Torner H, Ghanem N, Ambros C, Holker M, Tomek W, Phatsara C,
et al. Molecular and subcellular characterisation of oocytes screened
for their developmental competence based on glucose-6-phosphate
dehydrogenase activity. Reproduction 2008;135:197–202.
[4] Manjunatha BM, Gupta PSP, Devaraj M, Ravindra JP, Nandi S.
Selection of developmentally competent buffalo oocytes by brilliant
cresyl blue staining before IVM. Theriogenology 2007;68:1299–304.
[5] Mangia F, Epstein CJ. Biochemical studies of growing mouse
oocytes: preparation of oocytes and analysis of glucose-6-phosphate
dehydrogenase and lactate dehydrogenase activities. Dev Biol 1975;
45:211–20.
[6] Wassarman M. The mammalian ovum. In: Knobil E, Neil D, editors.
The physiology of Reproduction (Text book) 1988;vol. 1. p. 69–102.
[7] Ericsson SA, Boice ML, Funahashi H, Day BN. Assessment of porcine
oocytes using brilliant cresyl blue. Theriogenology 1993;39:214.
[8] Schramm RD, Paprocki AM, VandeVoort CA. Causes of developmental
failure of in vitro matured rhesus monkey oocytes: impairments in
embryonic genome activation. Hum Reprod 2003;18:826–33.
[9] Robert C, Barnes FL, Hue I, Sirard MA. Subtractive hybridization used
to identify mRNA associated with the maturation of bovine oocytes.
Mol Reprod Dev 2000;57:167–75.
[10] Sirard MA, Dufort I, Coenen K, Tremblay K, Massicotte L, Robert C.
The use of genomics and proteomics to understand oocyte and early
embryo functions in farm animals. Reprod Suppl 2003;61:117–29.
[11] Krisher RL. The effect of oocyte quality on development. J Anim Sci
2004;82:E14–23.
[12] Nath A, Sharma V, Gade NE, Pratheesh MD, Kumar R, Dubey PK.
Temporal expression of marker transcripts: key to successful
maturation and development of mammalian oocytes. Vet World
2012;2:121–7.
[13] Assidi M, Dufor I, Ali A, Hamel M, Algriany O, Dielemann S, et al.
Identification of potential markers of oocyte competence expressed in
bovine cumulus cells matured with follicle-stimulating hormone and/
or phorbol myristate acetate in vitro. Biol Reprod 2008;79:209–22.
[14] Pfaffl MW. A new mathematical model for relative quantification in
real time RT-PCR. Nucleic Acids Res 2001;29:2002–7.
[15] Rodriquez KF, Farin CE. Gene transcription and regulation of oocyte
maturation. Reprod Fertil Dev 2004;16:55–67.
[16] Jiang Jin-Yi, Xiong H, Cao M, Xia X, Sirard M, Tsang BK. Mural
granulosa cell gene expression associated with oocyte develop-
mental competence. J Ovarian Res 2010;3:6.
[17] Buccione R, Schroeder AC, Eppig JJ. Interactions between somatic
cells and germ cells throughout mammalian oogenesis. Biol Reprod
1990;43:543–7.
[18] Fulop C, Salustri A, Hascall VC. Coding sequence of a hyaluronan
synthase homologue expressed during expansion of the mouse
cumulus oocyte complex. Arch Biochem Biophys 1997;337:261–6.
[19] Caixeta ES, Ripamonte P, Franco MM, Junior JB, Dode MAN. Effect of
follicle size on mRNA expression in cumulus cells and oocytes of Bos
indicus: an approach to identify marker genes for developmental
competence. Reprod Fertil Dev 2009;21:655–64.
[20] McKenzie LJ, Pangas SA, Carson SA, Kovanci E, Cisneros P, Buster JE,
et al. Human cumulus granulosa cell gene expression: a predictor of
 R. Bhardwaj et al. / Theriogenology 86 (2016) 2004–2011
fertilization and embryo selection in women undergoing IVF. Hum
Reprod 2004;19:2869–74.
[21] Cilo F, Brevini TA, Antonini S, Paffoni A, Ragni G, Gandolfi F. Association
between human oocyte developmental competence and expression
levels of some cumulus genes. Reproduction 2007;134:645–50.
[22] Gebhardt KM, Feil DK, Dunning KR, Lane M, Russell DL. Human
cumulus cell gene expression as a biomarker of pregnancy outcome
after single embryo transfer. Fertil Steril 2011;96:47–52.
[23] Pangas SA, Jorgez CJ, Matzuk MM. Growth differentiation factor 9
regulates expression of the bone morphogenetic protein antagonist
gremlin. J Biol Chem 2004;279:32281–6.
[24] Gui LM, Joyce IM. RNA interference evidence that growth differen-
tiation factor-9 mediates oocyte regulation of cumulus expansion in
mice. Biol Reprod 2005;72:195–9.
[25] Schoenfelder M, Einspanier R. Expression of hyaluronan synthases
and corresponding hyaluronan receptors is differentially regulated
during oocyte maturation in cattle. Biol Reprod 2003;69:269–77.
[26] Parkar AA, Day AJ. Overlapping sites on the Link module of human
TSG-6 mediate binding to hyaluronan and chrondroitin-4-sulphate.
FEBS Lett 1997;410:413–7.
[27] Carrette O, Nemade RV, Day AJ, Brickner A, Larsen WJ. TSG-6 is
concentrated in the extracellular matrix of mouse cumulus oocyte
complexes through hyaluronan and inter-alpha-inhibitor binding.
Biol Reprod 2001;65:301–8.
[28] Pujol M, Lopez-Bejar M, Paramio MT. Developmental competence of
heifer oocytes selected using the brilliant cresyl blue (BCB) test.
Theriogenology 2004;61:735–44.
2011
[29] Rodriguez-Gonzalez E, Lopez-Bejar M, Velilla E, Paramio MT.
Selection of prepubertal goat oocytes using the brilliant cresyl blue
test. Theriogenology 2002;57:1397–409.
[30] Roca J, Martinez E, Vazquez JM, Lucas X. Selection of immature pig
oocytes for homologous in vitro penetration assays with the
brilliant cresyl blue test. Reprod Fertil Dev 1998;10:479–85.
[31] Raghu HM, Nandi S, Reddy SM. Follicular size and oocyte diameter
in relation to developmental competence of buffalo oocytes. Reprod
Fertil Dev 2002;14:55–61.
[32] Alm A, Torner H, Lohrke T, Ghoneim IM, Kanitz W. Bovine blastocyst
development rate in vitro is influenced by selection of oocytes by
brilliant cresyl blue staining before IVM as indicator for glucose-
6-phosphate dehydrogenase activity. Theriogenology 2005;63:
2194–205.
[33] Catala MG, Izquierdo D, Uzbekova S, Morato R, Roura M,
Romaquera R, et al. Brilliant cresyl blue stain selects largest oocytes
with highest mitochondrial activity, maturation-promoting factor
activity and embryo developmental competence in prepubertal
sheep. Reproduction 2011;142:517–27.
[34] Bhojwani S, Alm H, Torner H, Kanitz W, Poehland R. Selection of
developmentally competent oocytes through brilliant cresyl blue
stain enhances blastocyst development rate after bovine nuclear
transfer. Theriogenology 2007;67:341–5.
[35] Gilchrist RB, Nayudu PL, Nowshari MA, Hodges JK. Meiotic
competence of marmoset monkey oocytes is related to follicle
size and oocyte-somatic cell associations. Biol Reprod 1995;52:
1234–43.