Vaccine 38 (2020) 4640–4648

Contents lists available at ScienceDirect

Vaccine
journal homepage: www.elsevier.com/locate/vaccine

Development and evaluation of a new recombinant protein vaccine

(YidR) against Klebsiella pneumoniae infection
Marjory Xavier Rodrigues, Yongqiang Yang, Enoch Brandão de Souza Meira Jr., Josiane do Carmo Silva,
Rodrigo Carvalho Bicalho ⇑
Department of Population Medicine and Diagnostic Sciences, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853, United States

a r t i c l e i n f o a b s t r a c t

Article history: Vaccination is a promising approach to prevent Klebsiella infection; however, the high heterogeneity of
Received 7 August 2019 strains is a limiting factor. The best antigenic target for an anti-Klebsiella vaccine should be expressed
Received in revised form 24 February 2020 by all or most of strains. We previously found YidR protein to be highly conserved among K. pneumoniae
Accepted 30 March 2020
strains independently of antigen serotype. Therefore, in the present study, we developed a recombinant
Available online 20 May 2020
YidR protein vaccine and evaluated its protective efficacy against lethal challenge with K. pneumoniae in a
mouse model. The yidR gene was cloned in Escherichia coli for recombinant expression. The lethal dose
Keywords:
(LD100) of K. pneumoniae was determined and lethal challenge was carried out after immunization with
Klebsiella
Vaccine
recombinant purified YidR. After immunization, the concentration of total serum IgG was significantly
YidR higher in YidR-immunized mice than in non-immunized mice, indicating strong induction of antibodies.
Lethal challenge Mice were challenged with LD100 of K. pneumoniae, and significantly lower murine sepsis and higher body
weight were observed in YidR-immunized mice compared to unvaccinated controls. Moreover,
90% of
YidR-immunized mice survived beyond 10 days of observation, whereas none of the control mice sur-
vived past 48 h. The protective effect of YidR recombinant protein vaccine was demonstrated and YidR
may be a promising vaccine candidate to prevent klebsiellosis.
Ó 2020 Elsevier Ltd. All rights reserved.

1. Introduction
Klebsiella pneumoniae is a gram-negative, encapsulated, non-
motile bacterium [1] that belongs to the Enterobacteriaceae family
[2]. This bacterium is extremely resilient, having the ability to
evade, survive, and suppress many components of the immune
system and grow at different sites in the host [1]. The bacterium
has a large accessory genome of chromosomal gene loci and plas-
mids, which divides the strains into opportunistic, hypervirulent
(hypervirulent K. pneumoniae, kvKP), and multidrug resistant vari-
ants [3]. The antibiotic resistance of this pathogen has been
increasing [3–9]. The highly antibiotic-resistant strains can also
act as opportunists and are extremely difficult to treat [3]. Conse-
quently, the high prevalence of resistant strains has become a pub-
lic health concern worldwide [4,10]. Treatment with antibiotics
may have limited efficacy owing to the increased prevalence of
infections by drug-resistant strains and adverse reactions caused
by the use of high or prolonged doses [4]. According to the Center
⇑ Corresponding author.
E-mail addresses: mxr2@cornell.edu (M.X. Rodrigues), rcb28@cornell.edu
(R.C. Bicalho).
for Disease Control and Prevention (CDC) (US CDC report – Antibi-
otic Resistance Threats 2013), more than 9000 healthcare-
associated infections were reported in the United States due to
carbapenem-resistant Enterobacteriaceae (CRE) each year and it is
estimated that 7900 cases were caused by carbapenem-resistant
Klebsiella spp. This bacterium is also considered the most common
cause of hospital-acquired pneumonia in the United States [11].
Even with optimal therapy, lung infection results in 30–50% mor-
tality [11].
As control methods for K. pneumoniae infection are already
challenging, the emergence of multidrug-resistant strains high-
lights the importance of developing preventive measures [12].
Immunization against Klebsiella has been discussed in the context
of its pathogenesis and identification of protective antigens as pos-
sible vaccine candidates [13]. Previous studies have attempted to
develop vaccines against K. pneumoniae [2,12,14–21]. However,
with one exception, none of the preparations have been commer-
cialized due to their cost and approach [4]. The exception, K. pneu-
moniae siderophore receptor protein (SRP) vaccine (Kleb-SRP) [21],
is currently used for reduction of Klebsiella mastitis in lactating
cattle. Nevertheless, Klebsiella may be difficult to control by
vaccines due to strain heterogeneity [4]. The ideal target for an

https://doi.org/10.1016/j.vaccine.2020.03.057
0264-410X/Ó 2020 Elsevier Ltd. All rights reserved.
 M.X. Rodrigues et al. / Vaccine 38 (2020) 4640–4648 4641

anti-Klebsiella vaccine should be expressed by all strains, unlike the
O- and K-antigens [2].
Previously, we described the pan-genomic profiles, virulence
profile, genomic structure, and resistome of 308 K. pneumoniae iso-
lates from dairy cows and humans [22]. A unique IncN-type plas-
mid (pC5) co-harboring the blaCTX-M-1 and mph(A) genes was
identified in two dairy farms and the complete annotated sequence
of the plasmid was generated [22]. Furthermore, 177 functional
protein families were significant across all isolates, and sidero-
phore systems were prevalent in both the bovine and human iso-
lates [22]. That study also revealed a previously undescribed
profile of virulence determinants of K. pneumoniae isolates [22].
From the our existing genomic database [22], we noticed the
ubiquitous occurrence of the yidR gene (308/308, 100%) in bovine
and human isolates. Moreover, and importantly, the gene was
found to be highly conserved between the different isolates, with
an overall sequence homology of 97.6%. This prevalence and
sequence conservation led us to study yidR as a potential target
antigen against K. pneumoniae. The yidR gene encodes a putative
ATP/GTP-binding protein which mediates the hyperadherence
phenotype [23,24] and contributes to biofilm formation in Sal-
monella enterica [24]. The YidR protein contains two conserved
domains which are associated with Tol-dependent translocation
of colicins into Escherichia coli [25], and it is implicated in the
pathogenesis of Enterobacteriaceae [26]. Therefore, in the present
study, we developed a new recombinant protein vaccine for pre-
vention of K. pneumoniae infection based on the highly conserved
YidR protein, and evaluated the vaccine’s protective efficacy
against lethal challenge with K. pneumoniae in a mouse model.
2. Material and methods
2.1. Ethics statement
The mouse trial was conducted at the Center for Animal
Resources and Education (CARE) at Cornell University, Ithaca, NY.
The research protocols were reviewed and approved by the Institu-
tional Animal Care and Use Committee of Cornell University (Pro-
tocol number: 2017-0105; 2017-0073). The methods were carried
out in accordance with the approved guidelines.
2.2. Cloning, expression and purification of recombinant YidR protein
2.2.1. Plasmid vector harboring yidR gene
The plasmid vector was constructed by VectorBuilder (Vec-
torBuilder Inc., TX, USA). The vector type, expression host, and
cloning host used were bacterial protein expression vector pET,
BL21 (DE3), and Stbl3, respectively. The construct includes
6884 bp, and its components are shown in Table 1 along with
the inserted open reading frame (ORF) sequence (6his-yidR (YidR)).
2.2.2. Transformation of plasmid vector into E. coli
The host glycerol stock received was streaked onto Luria Bertani
(LB) agar with 100 mg/mL of ampicillin and incubated overnight at
37 °C. A single colony was used to inoculate LB Lennox broth con-
taining 100 mg/mL of ampicillin, followed by incubation at 37 °C
overnight. The cells were harvested, and plasmid extraction was
carried out using a QIAprep Spin Miniprep Kit (Qiagen Sciences,
MD, USA). Transformation of E. coli [One ShotTM BL21(DE3) chemi-
cally competent E. coli, Invitrogen, Life Technologies Corporation,
NY, USA] was performed using a heat shock method as previously
described [27]. After transformation, clones were selected, and an
induction test was carried out. For the induction test, flasks with
200 mL of LB Lennox broth with antibiotic (100 mg/mL of ampi-
cillin) were inoculated with 6 mL of culture corresponding to each
clone, and the flasks were incubated at 37 °C with shaking. The
optical density (OD) at 600 nm was checked every hour until
OD
0.6 was reached. Isopropyl b-D-1-thiogalactopyranoside
(IPTG, final concentration 1 mM) was added and the temperature
was decreased to 25 °C and the cells were incubated overnight.
Samples of cultures were processed and subjected to sodium dode-
cyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) [28] to
verify the presence of the target protein band (44.9 kDa) and to
select the clone with the best protein expression. The plasmid
extracted from the E. coli clone was submitted to the Biotechnology
Resource Center, Cornell University, for Sanger sequencing using
8 pmol of primer pET-Flank-50 Seq (50 GTC CGG CGT AGA GGA
TCG AGA TC 30 ). The sequence obtained was compared with the
plasmid vector sequence described in the VectorBuilder report
using Geneious software (Biomatters, Auckland, New Zealand) for
pairwise sequence alignment.

Table 1
Description of vector components.

Name Position Size (bp) Type Description

T7 promoter 1–17 17 Promoter T7 promoter
LacO 20–44 25 Miscellaneous Lac operator
RBS 76–80 5 RBS Ribosome binding site
6  His 91–108 18 Protein tag 6 tandem histidine tag
6his-yidR (YidR) 109–1335 1227 ORF 6his-yidR (YidR) of Klebsiella pneumoniae
T7 terminator 1400–1446 47 Terminator T7 transcription terminator
Ampicillin 1867–2727 861 ORF Ampicillin resistance gene
pBR322 2898–3486 589 rep_origin pBR322 origin of replication
Rop Complement (3913–4104) 192 ORF Repressor of primer
LacI Complement (5416–6498) 1083 ORF Lac repressor

6his-yidR (YidR) sequence (50 –30 ):

ATGAAACAAGTCACTTTTGCTCCCCGTCATCACCAGCTTACCAATATTAATACCTGGACTCCCGACAGCCAGTGGCTGGTATTCGACGTTCGTCCGTCCGGCGCATCGTTTACCGGCGAAACCAT
TGAGCGAGTGAACGTAAACAGCGGTACTGTGGAGACCATTTATCGTGCCACGCAGGGCGCGCACGTGGGCGTGGTAACCGTGCATCCAACCCAGGAGCGCTATGTGTTTATTCATGGCCCCG
AGCGGCCGGATGCGCAGTGGCAGTATGATTTTCATCATCGCCGCGGGGTGGTGGCCTTTCAGGGGGCTGTCGAGAATCTGGACGCCATGGACATTACCCCCCCCTACACGCCCGGCGCGCTG
CGCGGCGGCAGCCACGTCCATGTCTATAGCCCCAACGGTCAGTTTGTCAGTTTTACCTACAACGATCACGTGCTGCACCAGCGCGATCCGGCGCTGGATCTGCGCAACGTCGGCGTGGCGGCG
CCCTATGGACCGGTGACGCCGCAGGGACAGCATCCGCGCGAATATGGCGGCAGCCACTGGTGTGTGCTGGTAAGCCGCACGACGCCGGCACCCGCGCCGGGCAGCGATGAGATTAATCGCG
CCTATGAGGAGGGCTGGGTCGGGAACCATACTCTGGCGTTTATTGGCGATACGCTGGCGGAAAATGGCGATAAAGTGCCTGAGCTGTTTATTGTCGATCTGCCGCAGGATGAAGCCGGCTGG
AAGCAGCCTGGCGGGGCGCCGCTGGCCGGTACCGCAACCACAATGCCGGCGCCGCCGGCGGGCGTCAGCCAGCGTCGTTTGACCTTCACCCACCATCGCCGCTACCCGGGACTGGTGAACGT
CCCGCGCCACTGGGTGCGCGCCAATCCCCAGGCGACGGCGATAGCCTTTCTGATGCGCGACGACGCCGGCGTAGTGCAGCTGTGGCTTATTTCCCCGCAGGGGGGCGAGCCGCGGCAGTTGA
CGCATCACGCGTCGGGTATCCAGTCGGCGTTTAACTGGCATCCGTCGGGAGAGTGGCTGGGTTTTGCGCTGGAGGATCGGATTGCCTGCTGCCATGCCGGTACGGGAGATATCACCTTTTTAA
CCGATACGCATGCGCATGCGCCCTCGGCGGACGCGATCGTCTTTTCGCCAGACGGTAAACAGATTGCCTGGATGGAGGAGGTGGACGGTTATCGTCAGCTGTGGGTTACGCAGACCGGACGA
TAA.
4642 M.X. Rodrigues et al. / Vaccine 38 (2020) 4640–4648
2.2.3. Fermentation of E. coli BL21(DE3) harboring pET-6xHis/6his-
yidR (YidR)
2.2.3.1. Medium. Chemically defined medium previously described
[29] was used for E. coli BL21(DE3) fermentation. Initial fermenta-
tion medium contained 450 mL of 10  phosphate/citric acid buf-
fer (133 g/L KH2PO4, 40 g/L (NH4)2HPO4, 17 g/L citric acid) in 4.05
L of deionized water. The glass vessel containing the initial med-
ium was sterilized for 40 min and cooled to room temperature.
Additional sterile components were added to the vessel, which
were: 45 mL of 240 g/L MgSO4, 1.02 mL of 20 g/L thiamine, 45 mL
of 100  trace element solution, and 66 mL of 70% glucose solution.
The 100x trace element solution was prepared according to Li and
Sha (2015) [29]. Ampicillin was added to the medium to a final
concentration of 100 mg/mL. For the fed-batch phase, a concen-
trated feeding medium was prepared as follows: 202.5 mL of
240 g/L MgSO4, 7.47 mL of 20 g/L thiamine solution, 67.5 mL of
100  trace element solution, and 70% glucose solution were added
to a final volume of 2 L.
2.2.3.2. Fermentation parameters. The E. coli fermentation was per-
formed using a BiofloÒ & CelligenÒ 310 Fermenter/Bioreactor (New
Brunswick Scientific, NJ, USA). The fermenter system was con-
trolled by calibrated probes for pH, temperature, and dissolved
oxygen (DO). Ammonium hydroxide (30% solution) and antifoam
(8% solution; Antifoam B Emulsion, Sigma Life Science, MO, USA)
were automatically pumped (Pump 1 and 2) into the vessel as
needed to maintain the medium pH at 6.8 and a low level of foam.
Feeding medium was pumped (Pump 3) for high-density E. coli fer-
mentation; the pump speed was based on the glucose concentra-
tion in the medium. During this stage the system was controlled
to avoid glucose accumulation in the medium and to maintain
DO around 25%. The DO level was controlled by a probe, which
controlled the ultra-high purity oxygen sparging and agitation
speed.
2.2.3.3. Inoculum preparation and fermentation process. The E. coli
BL21(DE3) clone harboring the pET-6xHis/6his-yidR (YidR) vector
was streaked onto Luria Bertani (LB) agar containing 100 mg/mL
of ampicillin and incubated overnight at 37 °C. A single colony
was inoculated into 500 mL of LB Lennox broth supplemented with
ampicillin (100 mg/mL), followed by incubation at 37 °C for 8 h
with shaking. The fermenter medium was inoculated with
500 mL of inoculum, which was approximately 10% of the fer-
menter medium.
The batch fermentation was carried out for 12 h at 30 °C. Then,
the fed-batch fermentation was begun by using pump 3 adjusted
manually. Glucose concentration was monitored hourly using DO
spikes, which allowed us to control the optimal glucose concentra-
tion. Samples were collected every hour to verify the cell growth
by measuring wet cell weight (WCW) and OD. For OD, 1 mL of cul-
ture sample was added into a cuvette and the OD was read at
600 nm using a Genova spectrophotometer (JenwayÒ, Essex, Eng-
land). For WCW determination, 30 mL of culture were collected
and centrifuged (4,200 rpm/40 min, 4 °C), and the supernatant
was removed. The WCW was calculated as described by Li and
Sha (2015)[29]. When WCW was greater than 40%, protein expres-
sion was induced. For induction, IPTG was added at 1 mM final
concentration, the temperature was adjusted to 25 °C, and the
feeding medium reduced to 5% (27 mL/h); the induction of protein
expression was completed in 24 h. Cells were harvested using a
continuous flow centrifuge (Carr Powerfuge Pilot, Barry-
Wehmiller, MO, USA) at 15,000 rpm. Pellets of cells were resus-
pended in 1x buffer A (50 mM NaH2PO4; 300 mM NaCl, pH 7.4)
and sonicated on ice, performing 5-min pulses for 5 times, with
5-min intervals. A Misonix Ultrasonic Liquid Processor Q500
(QSonica LLC, CT, USA) was used at 80% amplitude. Sonicated cells
were centrifuged (12,000 rcf/30 min, 4 °C) and the supernatant was
stored at 4 °C for further purification.
2.2.4. YidR protein purification
The clear lysate obtained was processed using a custom-packed
60 mL column of TALONÒ Metal Affinity Resin (Tanaka Bio USA Inc.,
CA, USA). The automated purifications were performed based on
immobilized metal-affinity chromatography followed by desalting
[30] using an ÄKTA Pure (GE Healthcare, IL, USA) chromatography
system controlled by UNICORN 7 software (GE Healthcare, IL, USA).
The column, equilibrated with 1x buffer A (50 mM NaH2PO4;
300 mM NaCl, pH 7.4), was loaded with lysate and the elution
was performed using 1x buffer B (150 mM imidazole; 50 mM
NaH2PO4; 300 mM NaCl, pH 7.4). The concentration of 1x buffer
B was increased from 0% to 100% in a linear gradient, over 10 col-
umn volumes (CV). The eluted protein fractions were collected into
50-mL centrifuge tubes and examined by SDS-PAGE to verify the
presence of the target protein band. Fractions containing the pro-
tein were pooled and loaded onto a 1,200-mL Sephadex G-25 (GE
Healthcare, IL, USA) column for buffer exchange.
The final protein product was sterilized by filtration using a
0.22 mm vacuum filter system (Millipore Sigma, MA, USA). The
purified and sterilized protein was stored in 50% glycerol at
20 °C. Purified protein was quantified using a Quick StartTM Brad-
ford Protein Assay (Bio-Rad, CA, USA) according to the manufac-
turer’s instructions. The endotoxin content was verified with the
ToxinSensor Chromogenic LAL Endotoxin Assay Kit (Genscript, Pis-
cataway, NJ). This test was performed according with the manufac-
turer’s guidelines, a total of 1,000 ng of protein was used. The
initial 1,000 ng was then diluted 1:100, 1:1,000, and 1:10,000 with
endotoxin-free water.
2.3. Western blot analysis
Samples of E. coli culture were obtained from different phases of
the fermentation process. Whole-cell lysates were separated by
15% SDS-PAGE and electrotransferred to nitrocellulose membrane.
The membrane was blocked with 5% skim milk solution at room
temperature for 1 h and probed overnight at 4 °C with 6xHis mon-
oclonal antibody (albumin free) (Clontech, CA, USA), dilution
1:5,000. After washing, the membrane was treated with 1:2,500
dilution of goat anti-mouse IgG antibody HRP (horseradish perox-
idase) conjugate (Sigma Life Science, MO, USA) for 1 h at room tem-
perature, with shaking. The blot was developed using 1-StepTM
chloronaphthol substrate solution (ThermoFischer Scientific, MA,
USA).
2.4. Determination of lethal dose of Klebsiella pneumoniae
2.4.1. Bacterial strain
A collection of K. pneumoniae isolates from bovine clinical mas-
titis cases was previously characterized [22]. From this collection
the wild strain Klebsiella pneumoniae C6 was selected for the lethal
dose challenge. This strain was isolated on January 2, 2017 from
milk of a cow presenting clinical mastitis. K. pneumoniae C6
belongs to sequence type (ST) 79 and serotype K62, and harbors
37 virulence genes.
2.4.2. Pilot study for determination of lethal dose (LD100)
A pilot study with a small subset of mice (female, strain
C57BL/6J, Stock#000664, Area AX29, The Jackson Laboratory) was
performed to delimit a dose range (in colony forming units; CFUs)
of K. pneumoniae to be tested in an absolute lethal dose (LD100)
trial. The pilot study included six groups of 3 mice per group that
received intraperitoneal injections of 103, 104, 105, 106, 107, and
108 CFU of K. pneumoniae C6 in 100 mL of 1x phosphate buffered
 M.X. Rodrigues et al. / Vaccine 38 (2020) 4640–4648
saline (1x PBS, pH 7.4). A control group was injected with 100 mL of
1x PBS without bacterial cells. Standard bacterial plate counts were
performed to assess each dose tested. During the first 14 h post-
intraperitoneal inoculation, each animal’s health status was
checked every two hours, and then every 4 h. After 24 h, the mice
were evaluated twice a day. To assess murine health status, each
animal was evaluated at every time point according to the Murine
Sepsis Score (MSS) proposed by Shrum et al. (2014) [31]. Appear-
ance, level of consciousness, level of activity, responsiveness to
stimulus, eyes, respiration rate and quality were evaluated and
scored. An ethical choice for an end point was a total score 21,
or a respiratory rate or respiratory quality score 3. At the conclu-
sion of the experiment or at the end point, the mice were eutha-
nized according to CARE guidelines.
Post-mortem laparotomy was performed at the end of the study
to collect tissues and determine bacterial load. Liver, spleen and
lungs were collected for total bacterial count per organ sampled.
Tissues were kept on ice and immediately weighed and homoge-
nized in 1x PBS. Serial dilutions were plated onto plate count agar,
and CFU counting was carried out after overnight incubation at
37 °C.
2.4.3. Determination of absolute lethal dose (LD100)
A lethal dose trial was carried out to define the minimum dose
needed to kill 100% of the animals using doses within the range
identified in the pilot study. In this trial, MSS and body weight
were used to evaluate health status. The examinations were per-
formed before injection (time zero) and every 4 h during the first
24 h post-inoculation, and then twice a day for 10 days after the
challenge. Body weight was checked daily. Seven groups of mice
were tested, 5 mice per group: a control group and six groups inoc-
ulated with 1  107, 2  107, 4  107, 6  107, 8  107, and 1  108
CFU of K. pneumoniae in 100 mL of 1x PBS.
2.5. Immunization
Fourteen seven-week-old female mice (strain C57BL/6J,
Stock#000664, Area AX29, The Jackson Laboratory) were injected
intraperitoneally with 100 mL of vaccine containing 1,000 ng of
YidR protein, 20% of vaccine adjuvant (aluminum hydroxide gel,
AlhydrogelÒ adjuvant 2%, InvivoGen, CA, USA), and 1.75 mg of kana-
mycin. Two vaccinations were performed, 7 days apart. Sixteen
seven-week-old female mice (strain C57BL/6J, Stock#000664, Area
AX29, The Jackson Laboratory) were enrolled in the control group,
which received 1x PBS, pH 7.4, only. Blood samples were collected
from the tail veins of both immunized and mock-immunized mice
7 days from the last immunization to evaluate antibody produc-
tion. The blood samples were centrifuged and the serum samples
were stored at 20 °C.
2.6. Enzyme-linked immunosorbent assay (ELISA)
A portion of the antigen produced for preparation of YidR vac-
cine was used in ELISA for the determination of mouse
immunoglobulin G (IgG) antibody. ELISA micro-titer plates (Grei-
ner Bio-One, Germany) were coated with 250 mg/mL of YidR puri-
fied protein, and remaining protein binding sites was blocked
overnight at 4 °C. For the anti-YidR IgG assay, mouse serum sam-
ples were diluted 1: 1,000 followed by overnight incubation at
4 °C. Goat anti-mouse IgG antibody HRP (Horseradish Peroxidase)
conjugate (Sigma Life Science, MO, USA), diluted 1: 10,000, was
added followed by addition of 3,30 ,5,50 -tetramethylbenzidine
(TMB; Sigma Life Science, MO, USA). Optical density was measured
at 650 nm using an ELISA plate reader (Synergy HT Microplate
Reader BioTek Instruments, VT, USA).
4643
2.7. Challenge study
Three weeks after the last immunization, all mice (immunized
and non-immunized) were challenged with K. pneumoniae C6.
Before lethal challenge, all cages were coded and reorganized to
blind the researchers. The mice were injected intraperitoneally
with 4  107 CFU of K. pneumoniae C6 in 1x PBS. Survival was eval-
uated once during the first 12 h post-inoculation, then every 2 h
until 24 h post-inoculation (a critical time period), and then evalu-
ated twice per day during the next 10 days. Evaluations were car-
ried out for each mouse by using MSS for each time point, and the
body weight was checked daily. Surviving mice were euthanized at
the end of the experiment.
2.8. Phylogenetic analysis and antigenic region prediction
Phylogenetic analysis and antigenic region prediction were per-
formed to evaluate the potential effect of YidR vaccine against
other gram-negative bacteria. The NCBI-Nucleotide database
(https://www.ncbi.nlm.nih.gov/nucleotide/) was accessed to
obtain YidR nucleotide sequences of several gram-negative bacte-
ria. A phylogenetic tree from Clustal Omega [32] aligned sequences
was built by neighbor-joining analysis [33] using Geneious Prime
2020.0.5 software (Biomatters, Auckland, New Zealand). Amino
acid sequences of YidR herein used as subunit vaccine, Escherichia
coli O157:H7 strain CB9615 and Salmonella enterica subsp. enterica
strain SC-B67 were analyzed by EMBOSS package [34] from within
Geneious Prime for secondary structure and antigenic regions
prediction.
2.9. Statistical analysis
Mean and standard error of the mean were calculated using JMP
Pro 14 (SAS Institute Inc., Cary, NC, USA) and all graphs were built
using GraphPad Prism 7 (GraphPad Software LLC, CA, USA). All
Gaussian data were analyzed by analysis of variance (ANOVA)
and the Tukey-Kramer test (P-value 0.05) were applied for mul-
tiple comparisons using JMP Pro 14. The survival rate was deter-
mined using a Kaplan-Meier survival graph, from time point zero
(rated 100%) to stabilization of mouse health (days post-challenge).
3. Results
3.1. YidR protein production
Fermentation using a bioreactor produced a high density of
E. coli at 24 h (12 h pre-feeding and 12 h fed-batch). The WCW
achieved in 24 h was > 40% (Fig. 1A). Then, the protein-induction
phase was initiated and conducted for 24 h. Culture samples were
collected directly from the fermenter vessel to verify protein
expression. These samples were submitted to SDS-PAGE and Wes-
tern blot analysis. The expected recombinant protein band size was
identified in a stained SDS-PAGE gel (Fig. 1B, left panel) 12 h and
24 h post-induction. A Western blot probed with anti-histidine
antibodies confirmed the presence of 6x-His tagged YidR protein,
as shown in Fig. 1B (right panel). After bacterial cell processing,
the target protein in the supernatant was purified by chromatogra-
phy using an elution buffer gradient (0–100%). The peak fractions
identified were subjected to SDS-PAGE (Fig. 1C) to confirm separa-
tion of the YidR protein. A summary of the chromatography pro-
cess is illustrated in the chromatogram in Fig. 1D. The selected
fractions (fractions 5 to 15) were pooled, desalted and sterilized,
and glycerol was added for storage at 80 °C; the final protein
concentration was 1.8 mg/mL. Final protein was analyzed by chro-
matography and SDS-PAGE and the high purity was verified
4644 M.X. Rodrigues et al. / Vaccine 38 (2020) 4640–4648

A B C Protein fractions 5 to 15

250kD

60 150
WCW% 50kD

OD 600nm 37kD
50 125
250kD 250kD
20kD
75kD 75kD
40 100
WCW %

50kD yidR 50kD

OD600
37kD 44.9kD 37kD
30 75
15kD
25kD 25kD
20 50 20kD 20kD

10 25 15kD 15kD
10kD
0 0
10kD 10kD
g
1h
2h
3h
4h
5h
6h
7h
8h
9h

h
h
h
in

10
11
12
ed
fe
e-

Feeding
Pr

D E

53kD
41kD

Fig. 1. Overview of YidR protein production and purification. (A) Growth curve of an E. coli BL21(DE3) clone harboring pET-6xHis/6his-yidR (YidR) vector. This illustration
shows wet cell weight (WCW%) and optical density (OD) starting at the end of the batch fermentation (12 h post-inoculation) and throughout the fed-batch period (12 h); (B)
Stained SDS-PAGE gel of whole-cell lysates showing expressed YidR protein following IPTG induction (left panel) and Western blot probed with 6xHis antibodies showing his-
tagged YidR protein post-induction (right panel); (C) Stained SDS-PAGE gel showing protein fractions obtained from chromatographic separation; (D) Chromatogram showing
column equilibration, sample loading, column wash, linear gradient elution (green line = elution buffer concentration, Conc B), peak separation at the ultraviolet (UV)
absorbance detector (blue line = UV absorbance), and fractions collected, which are also shown in panel (C); (E) Chromatogram showing purified YidR used in the
immunization, peak area of 97%, and SDS-PAGE gel loaded with the purified protein. (For interpretation of the references to colour in this figure legend, the reader is referred
to the web version of this article.)

(Fig. 1E), chromatogram showed a peak area of 97%. Also, mea- 3.3. Evaluation of the protective effect of vaccination
sured endotoxin levels was confirmed to be <20 EU/mL [35].
For the vaccine trial, 14 mice were injected intraperitoneally
with 1,000 ng of purified YidR protein in a 100-mL volume. Two
3.2. Lethal dose (LD100) determination of Klebsiella pneumoniae in a vaccinations were performed, 7 days apart. Sixteen mice were
mouse model enrolled in the control group and received 1x PBS only. Weeks after
the second vaccination, all mice were challenged with 4  107 CFU
An initial dose-finding trial using different bacterial loads of K. of K. pneumoniae C6. Evaluation post-challenge showed a signifi-
pneumoniae C6 (103, 104, 105, 106, 107, and 108 CFU) injected cant difference in disease manifestation between the immunized
intraperitoneally into mice was carried out to determine an accu- and non-immunized (control) groups. Twelve hours post-
rate LD100. Based on laparotomy, progressive presentation of liver challenge, the MSS was significantly lower (P-value <0.001) in
and bowel lesions with escalating dose was observed. The total the immunized mice (Fig. 4A), and body-weight loss was higher
bacterial counts of mouse organs (liver, spleen, lungs) from the dif- (P-value = 0.19) in the control group (Fig. 4B). None of the non-
ferent groups are shown in Fig. 2(A–C). These first results also immunized mice survived beyond 48 h (Fig. 4C). In contrast, the
showed that mice injected with 103–107 CFU of K. pneumoniae C6 immunized group showed a survival rate of 92.3% (Fig. 4C), indicat-
recovered from the challenge within 24 h post-inoculation, pre- ing the strong protective effect of the vaccine. An ELISA assay was
senting few or no signs of disease (Fig. 2D). Mice injected with conducted to compare the concentration of immunoglobulin G
108 CFU of K. pneumoniae C6 exhibited significant signs of disease (IgG) in the immunized and control groups. The concentration of
and were euthanized 12 h post-inoculation; these animals were all total serum IgG was significantly higher in the immunized mice
graded at MSS > 21 (Fig. 2D). Therefore, it was necessary to identify (P-value <0.0001) (Fig. 4D), indicating a positive effect of the vac-
a minimal lethal dose between 107 and 108 CFU for the vaccine cine on antibody induction.
trial. Thus, an LD100 determination was performed by testing bac-
terial loads of 1  107, 2  107, 4  107, 6  107, 8  107, and 3.4. Potential cross-protection
1  108 CFU of K. pneumoniae C6. In this challenge, the MSS at
12 h post-challenge was not significantly different in the dose Using the aligned nucleotide sequences of YidR from several
range 2  107–1  108 CFU (Fig. 3A), although score values varied species of gram-negative bacteria we built the phylogenetic tree
from 4 to 18. As expected from the results of the earlier challenge, illustrated in Fig. 5. Noteworthy, is the high level of sequence
all mice injected with 1  107 CFU survived and all mice injected homology observed within each species and between all coliforms
with 1  108 CFU succumbed to infection (Fig. 3B) and were euth- and the Salmonella genus. The species level nucleotide sequence
anized according to CARE guidelines. Most importantly, the abso- pairwise identity was 99.6%, 100%, 96%, 98.7% for the K. oxytoca,
lute lethal dose of K. pneumoniae in this model was identified as K. pneumoniae, E. coli, and Salmonella enterica, respectively. When
4  107 CFU, able to kill 100% of mice within 62 h post-challenge the protein sequences of the rYidR subunit was aligned against
(Fig. 3B). the sequence of an E. coli O157:H7 and S. enterica str. SC-B67 a
 M.X. Rodrigues et al. / Vaccine 38 (2020) 4640–4648 4645

Fig. 2. Evaluation of lethal dose using different loads of Klebsiella pneumoniae C6. (A, B, and C) Bacterial counts of tissues from groups of challenged mice; (D) Murine sepsis
score of mice 12 h post-challenge; and (E) Survival rate of groups of mice hours post-challenge. Different letters indicate significant differences among bacterial loads tested
(P  0.05). Asterisk (*) means significance: P-value  0.05).

Fig. 3. Determination of lethal dose (LD100) using different loads of Klebsiella pneumoniae C6. (A) Murine sepsis score as a function of K. pneumoniae C6; (B) Kaplan-Meier
survival curves of mice challenged with different loads of K. pneumoniae C6. Different letters indicate significant differences among the bacterial loads tested (P  0.05).
4646 M.X. Rodrigues et al. / Vaccine 38 (2020) 4640–4648

Fig. 4. Immunological assessment. (A) Murine sepsis score of immunized and non-immunized mice 12 h post-challenge with Klebsiella pneumoniae C6; (B) Body weight loss
of immunized and non-immunized mice post-challenge; (C) Kaplan-Meier survival curves of immunized and non-immunized mice post-challenge; (D) Optical density values
at 650 nm from enzyme-linked immunosorbent assay to detect total immunoglobulin G (IgG) in serum of non-immunized and immunized mice.

pairwise identity of 79% and 80% was determined, respectively
(Fig. 5). Predicted antigenic regions and secondary structures were
also very similar between the 3 different species (Fig. 6).
4. Discussion
Active immunization and passive immunotherapy approaches
for prevention and treatment of K. pneumoniae infection should
be considered due to the extensive spread of multidrug-resistant
K. pneumoniae strains and the severe nature of the infections they
cause [2]. Nosocomial Klebsiella infections continue to be a sub-
stantial societal burden in terms of mortality and healthcare costs
worldwide [36]. Thus, in the present study, we developed and eval-
uated a new recombinant protein vaccine candidate to prevent K.
pneumoniae infection. Immunization with recombinant YidR pro-
tein provided protection against lethal challenge with the K. pneu-
moniae C6 strain belonging to ST 79 and serotype K62. The results
obtained demonstrate the strong potential of recombinant YidR as
a vaccine target antigen. The immunized mice presented a signifi-
cantly higher concentration of total serum IgG, a significantly
lower MSS, higher body weight, and much higher survival rate
post-challenge compared to non-immunized mice.
The higher concentration of total serum IgG measured in immu-
nized mice indicates stimulation of antibodies induced by YidR
vaccine. Babu et al. (2017) [2] similarly reported significant pro-
duction of antibody in their tests of r-AK36 vaccine, and IgG1
was the most prevalent in their study. The protective efficacy of
IgG1 and IgG3 generated against K1-serotype polysaccharide cap-
sules (K1-CPS) was previously demonstrated in a murine sepsis
model and in pulmonary infection [37]. Hussein et al. (2018) [15]
found serum IgG1 antibodies to be the most predominant post-
vaccination, suggesting a bias toward a T helper type 2 (Th2)
immune response. Likewise, Kurupati et al. (2011) [38], in their
test of a DNA vaccine based on outer membrane proteins (OMPs),
observed a strong humoral response in mice due to a predomi-
nance of IgG1 over IgG2a [38].
In the present study, we observed higher body weight and bet-
ter appearance, activity, and responses to stimuli post-challenge in
YidR-immunized mice compared to controls. The survival rate was
higher than 90% in immunized mice, whereas none of the non-
immunized mice survived. Babu et al. (2017) [2] reported a sur-
vival rate of 83% in their evaluation of a recombinant r-AK36 can-
didate subunit vaccine comprising portions of the OmpA and
OmpK36 proteins. Another research group, Hussein et al. (2018)
[15], investigated recombinant OmpK17, OmpK36 and their fusion
protein cognate F36/17 as vaccine candidates with different
immunoadjuvants. The best results were obtained with IFA-
adjuvanted OmpK17, OmpK36 and F36/17, showing survival per-
centages of 50%, 60% and 50%, respectively [15]. Lee et al. (2015)
[12] reported superior survival rates following vaccination with
K. pneumoniae-derived extracellular vesicles (EVs, comprising
OMPs): 80% and 100% of their mice survived after vaccination with
 M.X. Rodrigues et al. / Vaccine 38 (2020) 4640–4648 4647

responses [39]. Kuipers et al. (2018) [39] pointed out there are gaps
in the understanding of the broad group of pathogen-derived EVs.
The majority of K. pneumoniae immunogenic proteins are extra-
cellular toxins or cell-surface proteins, such as fimbriae proteins
and OMPs [4]. In summary, vaccines have been developed based
on OMPs [2,15], EVs [12], siderophore receptor protein (SRP)
[21], cytoxin [16], capsular polysaccharide (K-antigen) [17], and
lipopolysaccharide (O-antigen) [14,18–20]. Additional virulence
factors are being identified, but they still require characterization
[1]. Thus, knowledge of the pathogenic mechanisms used by K.
pneumoniae to cause infection is still limited [2].
It is important to highlight that there is high genetic hetero-
geneity in K. pneumoniae strains, and not every virulence factor
plays the same role in all virulent Klebsiella strains [1]. The capsular
polysaccharide (CPS, K-antigen) and lipopolysaccharide (LPS, O-
antigen) are of limited use as vaccine targets due to strain hetero-
geneity [2]. For example, at least 79 K-antigen types [40] and nine
O-antigen types [41] have been described. Here, we studied the
first vaccine based specifically on YidR protein, which is highly
conserved in K. pneumoniae isolates. YidR protein could be an ideal
target to provide specific protection against K. pneumoniae strains
with different serotypes. Anti-YidR antibodies may react strongly
against all K. pneumoniae strains and many other gram-negative
strains, such as Salmonella spp., Shigella spp., E. coli, and other
members of the Enterobacteriaceae family. Herein, we showed the
potential cross-protection based on phylogenetic analysis and anti-
genic region prediction. The possibility of cross-immunity and
cross-protection properties were also indicated in previous studies
of vaccines to prevent K. pneumoniae infection. Babu et al. (2017)
[2] in their study showed the potential of cross-protection of a
purified outer membrane preparation using in vitro assays. Simi-
larly, Gorden et al. (2018) [21] found that K. pneumoniae SRP vac-
cine (Kleb-SRP, bacterial extract), tested in 569 dairy cows and
heifers that were naturally exposed to the pathogen, also has
potential for cross-protection.

5. Conclusion

This study demonstrated the efficacy in mice of a new vaccine

Fig. 5. Phylogenetic tree illustrating the similarity of nucleotide sequences of yidR
gene of several species of gram-negative bacteria. The scale bar indicates the
percentage of sequence divergence.
0.5 lg and 1 lg of EVs, respectively. Recent findings indicate that
pathogen EV-associated molecules can promote survival and
spreading of pathogens, but also induction of host-immune
containing YidR recombinant protein to prevent K. pneumoniae dis-
ease. Significant differences of sepsis score, body weight, and sur-
vival were observed between challenged immunized and control
mice. Notably, the protective role of this YidR recombinant protein
vaccine was striking, as measured by the survival rate of mice chal-
lenged with a lethal dose of K. pneumoniae: >90% survival in immu-
nized mice versus 0% in non-immunized mice. Therefore, YidR
vaccine is suggested as a novel vaccine candidate against K. pneu-
moniae infection. Further studies, including pulmonary investiga-
tions, in other mammalian models are encouraged to corroborate
and extend this pioneering finding.

Identity

rYidR protein Bicalho

YidR protein E. coli
O157:H7
Identity

rYidR protein Bicalho

YidR protein S.
enterica strain SC-B67

Fig. 6. Amino acid sequence alignment of the YidR sequence herein used as the subunit vaccine (K. pneumoniae) and the amino acid sequence of the E. coli O157:H7 strain
CB9615 and the S. enterica subsp. enterica strain SC-B67. Sequence identity is shown by the green bars, predicted antigenic regions (red arrows), and predicted secondary
structure (pink, yellow, gray, and blue symbols). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
4648 M.X. Rodrigues et al. / Vaccine 38 (2020) 4640–4648

Author contributions Klebsiella pneumoniae: implication in vaccine design. Front Microbiol

2014;5:608.
[19] Jain RR, Mehta MR, Bannalikar AR, Menon MD. Alginate microparticles loaded
R.C.B. and Y.Y. conceived and designed the experiments. Y.Y., E. with lipopolysaccharide subunit antigen for mucosal vaccination against
B.S.M. Jr, M.X.R. and J.C.S performed the experiments. R.C.B. and M. Klebsiella pneumoniae. Biologicals 2015;43:195–201.
[20] Hegerle N, Choi M, Sinclair J, Amin MN, Ollivault-Shiflett M, Curtis B, et al.
X.R. analyzed the data and wrote the article. All authors reviewed
Development of a broad spectrum glycoconjugate vaccine to prevent wound
and approved the manuscript. and disseminated infections with Klebsiella pneumoniae and Pseudomonas
aeruginosa. PLoS ONE 2018;13:e0203143.
[21] Gorden PJ, Kleinhenz MD, Ydstie JA, Brick TA, Slinden LM, Peterson MP, et al.
Declaration of Competing Interest
Efficacy of vaccination with a Klebsiella pneumoniae siderophore receptor
protein vaccine for reduction of Klebsiella mastitis in lactating cattle. J Dairy
The authors declare that they have no known competing finan- Sci 2018;101:10398–408.
cial interests or personal relationships that could have appeared [22] Yang Y, Higgins CH, Rehman I, Galvao KN, Brito IL, Bicalho ML, et al. Genomic
diversity, virulence, and antimicrobial resistance of klebsiella pneumoniae
to influence the work reported in this paper. strains from cows and humans. Appl Environ Microbiol 2019;85.
[23] Megias E, Megias M, Ollero FJ, Draft Hungria M. Genome sequence of pantoea
References ananatis strain AMG521, a rice plant growth-promoting bacterial endophyte
isolated from the guadalquivir marshes in Southern Spain. Genome Announc
2016;4.
[1] Paczosa MK, Mecsas J. Klebsiella pneumoniae: going on the offense with a
[24] Kroupitski Y, Brandl MT, Pinto R, Belausov E, Tamir-Ariel D, Burdman S, et al.
strong defense. Microbiol Mol Biol Rev 2016;80:629–61.
Identification of Salmonella enterica genes with a role in persistence on lettuce
[2] Babu L, Uppalapati SR, Sripathy MH, Reddy PN. Evaluation of recombinant
leaves during cold storage by recombinase-based in vivo expression
multi-epitope outer membrane protein-based klebsiella pneumoniae subunit
technology. Phytopathology 2013;103:362–72.
vaccine in mouse model. Front Microbiol 2017;8:1805.
[25] Cascales E, Buchanan SK, Duche D, Kleanthous C, Lloubes R, Postle K, et al.
[3] Martin RM, Bachman MA. Colonization, infection, and the accessory genome of
Colicin biology. Microbiol Mol Biol Rev 2007;71:158–229.
klebsiella pneumoniae. Front Cell Infect Microbiol 2018;8:4.
[26] Dubuisson JF, Vianney A, Hugouvieux-Cotte-Pattat N, Lazzaroni JC. Tol-Pal
[4] Ahmad TA, El-Sayed LH, Haroun M, Hussein AA, El Ashry SH. Development of
proteins are critical cell envelope components of Erwinia chrysanthemi
immunization trials against Klebsiella pneumoniae. Vaccine
affecting cell morphology and virulence. Microbiology 2005;151:3337–47.
2012;30:2411–20.
[27] Froger A, Hall JE. Transformation of plasmid DNA into E. coli using the heat
[5] Elemam A, Rahimian J, Mandell W. Infection with panresistant Klebsiella
shock method. J Vis Exp 2007:253.
pneumoniae: a report of 2 cases and a brief review of the literature. Clin Infect
[28] Al-Tubuly AA. SDS-PAGE and western blotting. Methods Mol Med
Dis 2009;49:271–4.
2000;40:391–405.
[6] Krapp F, Ozer EA, Qi C, Case Hauser AR. Report of an extensively drug-resistant
[29] Li B, Sha M. Successful high density escherichia coli fermentation using the
klebsiella pneumoniae infection with genomic characterization of the strain
eppendorf BioFloÒ 320. Adv Bioprocess Control Syst BioProcess J 2015:20–4.
and review of similar cases in the United States. Open Forum Infect Dis 2018;5:
[30] Sigrell JA, Eklund P, Galin M, Hedkvist L, Liljedahl P, Johansson CM, et al.
ofy074.
Automated multi-dimensional purification of tagged proteins. J Struct Funct
[7] Martins-Loureiro M, de Moraes BA, de Mendonca VL, Rocha-Quadra MR, dos
Genomics 2003;4:109–14.
Santos-Pinheiro G, Dutra-Asensi M. Molecular epidemiology of extended-
[31] Shrum B, Anantha RV, Xu SX, Donnelly M, Haeryfar SM, McCormick JK, et al. A
spectrum beta-lactamase-producing Klebsiella pneumoniae isolated from
robust scoring system to evaluate sepsis severity in an animal model. BMC Res
neonatal intensive care unit patients involved in hospital infection cases in
Notes 2014;7:233.
Rio de Janeiro. Brazil Rev Latinoam Microbiol 2001;43:88–95.
[32] Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, et al. Fast, scalable
[8] Wyres KL, Holt KE. Klebsiella pneumoniae population genomics and
generation of high-quality protein multiple sequence alignments using Clustal
antimicrobial-resistant clones. Trends Microbiol 2016;24:944–56.
Omega. Mol Syst Biol 2011;7:539.
[9] Freystatter C, Radtke C, Ihra G, Thalhammer F, Fochtmann-Frana A. Sepsis
[33] Saitou N, Nei M. The neighbor-joining method: a new method for
caused by multidrug-resistant klebsiella pneumoniae infection in a 23-year-
reconstructing phylogenetic trees. Mol Biol Evol 1987;4:406–25.
old burn patient: case report and literature review. Ann Burns Fire Disasters
[34] Rice P, Longden I, Bleasby A. EMBOSS: the European molecular biology open
2018;31:113–7.
software suite. Trends Genet 2000;16:276–7.
[10] Dorman MJ, Short FL. Genome watch: Klebsiella pneumoniae: when a
[35] Brito LA, Singh M. Acceptable levels of endotoxin in vaccine formulations
colonizer turns bad. Nat Rev Microbiol 2017;15:384.
during preclinical research. J Pharm Sci 2011;100:34–7.
[11] Ashurst JV, Pneumonia Dawson A, Klebsiella. StatPearls. FL: Treasure Island;
[36] Lundberg U, Senn BM, Schuler W, Meinke A, Hanner M. Identification and
2018.
characterization of antigens as vaccine candidates against Klebsiella
[12] Lee WH, Choi HI, Hong SW, Kim KS, Gho YS, Jeon SG. Vaccination with
pneumoniae. Hum Vaccin Immunother 2013;9:497–505.
Klebsiella pneumoniae-derived extracellular vesicles protects against
[37] Diago-Navarro E, Calatayud-Baselga I, Sun D, Khairallah C, Mann I, Ulacia-
bacteria-induced lethality via both humoral and cellular immunity. Exp Mol
Hernando A, et al. Antibody-based immunotherapy to treat and prevent
Med 2015;47:e183.
infection with hypervirulent klebsiella pneumoniae. Clin Vaccine Immunol
[13] Cryz SJ. Progress in immunization against Klebsiella infections. Eur J Clin
2017;24.
Microbiol 1983;2:523–8.
[38] Kurupati P, Ramachandran NP, Poh CL. Protective efficacy of DNA vaccines
[14] Ahmad TA, Haroun M, Hussein AA, El Ashry SH, El-Sayed LH. Development of a
encoding outer membrane protein A and OmpK36 of Klebsiella pneumoniae in
new trend conjugate vaccine for the prevention of Klebsiella pneumoniae.
mice. Clin Vaccine Immunol 2011;18:82–8.
Infect Dis Rep 2012;4:e33.
[39] Kuipers ME, Hokke HC, Smits HH, Nolte-tHoen ENM. Pathogen-derived
[15] Hussein KE, Bahey-El-Din M, Sheweita SA. Immunization with the outer
extracellular vesicle-associated molecules that affect the host immune
membrane proteins OmpK17 and OmpK36 elicits protection against Klebsiella
system: an overview. Front Microbiol 2018;9:1–13.
pneumoniae in the murine infection model. Microb Pathog 2018;119:12–8.
[40] Hsu CR, Liao CH, Lin TL, Yang HR, Yang FL, Hsieh PF, et al. Identification of a
[16] Singh BR, Sharma VD. Potential of Klebsiella pneumoniae cytotoxin toxoid as
capsular variant and characterization of capsular acetylation in Klebsiella
vaccine against klebsiellosis in rabbits and mice. Vaccine 2001;19:4505–10.
pneumoniae PLA-associated type K57. Sci Rep 2016;6:31946.
[17] Seeberger PH, Pereira CL, Khan N, Xiao G, Diago-Navarro E, Reppe K, et al. A
[41] Fang CT, Shih YJ, Cheong CM, Yi WC. Rapid and accurate determination of
semi-synthetic glycoconjugate vaccine candidate for carbapenem-resistant
lipopolysaccharide O-antigen types in klebsiella pneumoniae with a novel
klebsiella pneumoniae. Angew Chem Int Ed Engl 2017;56:13973–8.
PCR-Based O-genotyping method. J Clin Microbiol 2016;54:666–75.
[18] Hsieh PF, Wu MC, Yang FL, Chen CT, Lou TC, Chen YY, et al. D-galactan II is an
immunodominant antigen in O1 lipopolysaccharide and affects virulence in