296 BRAY ET AL.

HUMAN MUTATION 17:296–304 (2001)

METHODS

High-Throughput Multiplex SNP Genotyping With

MALDI-TOF Mass Spectrometry: Practice,
Problems and Promise
Molly S. Bray,1* Eric Boerwinkle,1,2 and Peter A. Doris2
1
Human Genetics Center, University of Texas Health Science Center at Houston, Houston, Texas
2
Institute of Molecular Medicine, University of Texas Health Science Center at Houston, Houston, Texas

For the SNP 2000 Special Issue

Single nucleotide polymorphisms (SNPs) are currently being identified and mapped at a remark-
able pace, providing a rich genetic resource with vast potential for disease gene discovery, phar-
macogenetics, and understanding the origins of modern humans. High-throughput, cost effective
genotyping methods are essential in order to make the most advantageous and immediate use of
these SNP data. We have incorporated the use of matrix-assisted laser desorption/ionization time-
of-flight mass spectrometry (MALDI-TOF) in our laboratory as a tool for differentiating geno-
types based on the mass of the variant DNA sequence, and have utilized this method for production
scale SNP genotyping. We have combined a 4 ml PCR amplification reaction using 3 ng of ge-
nomic DNA with a secondary enzymatic reaction (mini-sequencing) containing oligonucleotide
primers that anneal immediately upstream of the polymorphic site, dideoxynucleotides, and a
thermostable polymerase used to extend the PCR product by a single base pair. Mass spectrom-
etry (MS) analysis of mini-sequencing reactions was performed using a MALDI-TOF instrument
(Voyager-DE, Perseptive Biosystems, Framingham, MA). We performed both single and multi-
plex PCR and mini-sequencing reactions, and genotyped seven different variant sites in a ran-
dom sample of 989 individuals. Genotypes generated with MS methods were compared with
genotypes produced using a 5¢ exonuclease fluorescence-based assay (Taqman, Applied Biosystems,
Foster City, CA) and a gel-based genotyping protocol. Because multiple polymorphisms can be
detected in a single reaction, the MS technique provides a cost-effective and efficient method for
high-throughput genotyping. Hum Mutat 17:296–304, 2001. © 2001 Wiley-Liss, Inc.

KEY WORDS: SNP; genotyping; MALDI-TOF; mass spectrometry; polymorphism; multiplex; ADD1;
ADRB2; AGT; AGTR1; GNB3; LPL

DATABASES:
ADD1 – OMIM: 102680; GDB:134672; Genbank: NM_001119; HGMD: ADD1
ADRB2 – OMIM: 109690; GDB: 120541; Genbank: NM_000024;HGMD: ADRB2
AGT – OMIM: 106150; GDB:118750; Genbank: X15323, NM_000029; HGMD: AGT
AGTR1 – OMIM: 106165; GDB: 132359; Genbank: Z11162, NM_000685; HGMD: AGTR1
GNB3 – OMIM: 139130; GDB: 120005; Genbank: NM_002075; HGMD: GNB3
LPL – OMIM: 238600; GDB: 120700; Genbank: M76722, NM_000237; HGMD: LPL

Received 8 November 2000; accepted revised manuscript 12 Contract grant sponsor: CDC; Contract grant number: UR6/
January 2001. CCU617218-01; Contract grant sponsor: NIH; Contract grant
*Correspondence to: Molly S. Bray, Ph.D., Human Genetics numbers: HL54481; HL54526; HL54457; HL54464; DDK45538.
Center, University of Texas Health Science Center at Houston,
P.O. Box 20334, Houston, TX 77225.
E-mail: molly.s.bray@uth.tmc.edu

© 2001 WILEY-LISS, INC.


INTRODUCTION
Single nucleotide polymorphisms (SNPs),
common alterations in DNA sequence, repre-
sent the largest quantity of interindividual ge-
netic variation. Analytical techniques such as
association analyses of SNPs located within can-
didate genes and linkage disequilibrium mapping
using SNPs throughout the genome show great
promise for disease gene discovery. Other po-
tential applications of SNPs in contemporary
biomedical research include pharmacogenetics
and investigations of the origins of modern hu-
mans. Due to the complexity of many common,
chronic diseases and quantitative traits and the
confounding effects of disease heterogeneity,
gene-gene interaction, and gene-environment
interaction, a large number of SNPs must be sur-
veyed in numerous individuals in order to de-
tect single gene effects that are likely to be small
to moderate in size. To date, thousands of SNPs
have been identified across the genome, and this
information currently resides in both public and
private databases [Altshuler et al., 2000; Gray
et al., 2000; Porter et al., 2000]. Therefore, a
critical step forward in the post-genomic era is
the development of efficient and accurate tools
that permit high-throughput SNP genotyping.
Matrix-assisted laser desorption/ionization
time-of-flight mass spectrometry (MALDI-TOF)
has recently been developed as a tool for differ-
entiating genotypes based on the mass of variant
DNA sequence [Haff and Smirnov, 1997; Ross
et al., 1998]. The delayed extraction technology
increases resolution and sensitivity by introduc-
ing a time delay between ionization and extrac-
tion of ions into the mass analyzer, reducing matrix
background and increasing accuracy of mass de-
termination. This technique has the potential to
provide highly accurate identification of oligo-
TABLE 1. PCR Primers for Genes Selected for Comparative Analysis of MS Genotyping
Gene Variant Foward primer sequence
ADD1 G460W CGGGGCGACGAAG
ADRB2 R16G CAGCGCCTTCTTGCTG
ADRB2 Q27E CGGACCACGACGTCAC
ADRB2 Both Sites CAGCGCCTTCTTGCTG
AGT -6G>A AAATAGGGCCTCGTGAC
AGTR1 1166A>C CTGCAGCACTTCACTACCAAA
GNB3 825C>T TCATCTGCGGCATCAC
LPL S447Ter TGCCATGACAAGTCTCTGA
SNP GENOTYPING WITH MALDI-TOF 297
nucleotide sequence variation [Haff and Smirnov,
1997; Griffin and Smith, 2000; Sun et al., 2000].
Because multiple polymorphisms can be detected
in a single reaction, the use of MALDI-TOF mass
spectrometry is a cost-effective and efficient
method for high-throughput genotyping.
In the present study, we have extended SNP
genotyping by MALDI-TOF mass spectrometry
from proof of principle to an evaluation of its per-
formance in the context of an academic high-
throughput SNP genotyping laboratory. A
summary of costs and concerns involved in
MALDI-TOF genotyping methods is presented
below.
MATERIALS AND METHODS
DNA Sample Preparation and PCR
A set of 989 DNA samples with genotypes gen-
erated using alternative methods was utilized for
the current study. Seven variant sites in six genes
were selected for study: adducin (ADD1, MIM#
102680), β 2-adrenergic receptor (ADRB2,
MIM# 109690), angiotensinogen (AGT, MIM#
106150), angiotensin receptor 1 (AGTR1,
MIM# 106165), G-protein β3 subunit (GNB3,
MIM# 139130), and lipoprotein lipase (LPL,
MIM# 238600) (Table 1). The seven variants
comprise a panel of hypertension candidate poly-
morphisms, each with putative functional effects
[Jeunemaitre et al., 1992; Cusi et al., 1997; Wang
et al., 1997; Siffert et al., 1998; Timmermann et
al., 1998; Sass et al., 2000]. Two of the SNPs
reside within 33 base pairs of one another in the
β2-adrenergic receptor gene, and the other five
remaining SNPs are each located in the sepa-
rate genes listed in Table 1. PCR primers were
designed to amplify from 40 to 83 base pairs sur-
rounding the variant sites, and reactions were
performed using 3 ng genomic DNA, 2.0 mM
Reverse primer sequence PCR length
TGGGACTGCTTCCATTC 46
CGGCGCATGGCTTC 40
CCACCACCCACACCTC 45
CCACCACCCACACCTC 83
AACGGCAGCTTCTTCC 42
TCCTTCAATTCTGAAAAGTAGC 52
GTAGGCGGCCACTGAG 48
GCCCAGAATGCTCACC 50
298 BRAY ET AL.

MgCl2, standard concentrations of other PCR extended oligonucleotides could be distinguished

reagents, and .25 U AmpliTaq Gold DNA poly-
merase (Applied Biosystems) in a total reaction
volume of 4 µl. For multiplex reactions, primers
were diluted and mixed in order to simplify PCR
cocktail assembly.
Reactions were carried out in 96-well micro-
titer plates. To aid in sample tracking, two barcode
labels were placed on each plate, one to indicate
the source plate of the DNA samples and the sec-
ond to indicate the primer(s) being utilized. Trans-
fer of PCR cocktail was made with the use of the
Multimek robotic system (Beckman-Coulter, Inc.,
Indianapolis, IN). Prior to the addition of PCR
reagents, the barcode labels were scanned and
recorded in a sample-tracking database.
Mini-sequencing Reactions
Before performing the mini-sequencing reac-
tions, 2 µl of a solution containing 2.5 U of exonu-
clease I (ExoI; Amersham Pharmacia, Piscataway,
NJ) and .25 U of shrimp alkaline phosphatase
(SAP; Roche Molecular Biochemicals, Indianapo-
lis, IN) was added directly to the PCR reaction
and incubated at 37°C for 30 min in order to di-
gest unincorporated dNTPs and PCR primers.
Mini-sequencing reactions were performed using
oligonucleotide primers that anneal immediately
5′ of each polymorphic site, dideoxynucleotides,
and a thermostable polymerase used to extend the
PCR product by a single base pair in a total reac-
tion volume of 10 µl. Extension primers and prod-
ucts utilized in mini-sequencing reactions were
designed so that the masses of unextended and
from one another (see Table 2). PCR, ExoI-SAP
digestion, and mini-sequencing extension reactions
were all performed in the same vessel, limiting the
number of liquid transfers and the possibility of
contamination. Two different thermostable poly-
merases, both of which incorporate ddNTPs effi-
ciently, were utilized in the mini-sequencing
reactions: Thermosequenase (Amersham Pharma-
cia, Inc.), a highly stable DNA polymerase origi-
nally used for manual sequencing reactions, and
Tth polymerase (Applied Biosystems), an RNA
polymerase that acts as a DNA polymerase in the
presence of manganese chloride. The mini-se-
quencing thermal protocol consisted of 25 cycles
of 20 sec at 95°C, 30 sec at 54°C, and 40 sec at
72°C. Despite the very low Tm of the smaller mini-
sequencing primers, varying annealing temperature
had little or no effect on efficiency of the exten-
sion reaction (data not shown).
Sample Purification and MALDI Plate
Spotting
Prior to mass determination, extension reaction
products were purified by mixing each sample with
Poros 50-R1 reversed phase chromatography ma-
trix (Perseptive Biosystems) and centrifuging the
samples through 96-well purification spin plates.
DNA was bound to the reverse phase media in
the presence of triethylammonium acetate, rinsed
with aqueous buffer, and eluted with either 25%
acetonitrile or MALDI matrix consisting of either
trihydroxyacetophenone (THAP) or 3-hydroxy-
picolinic acid (3-HPA). For optimal results, samples

TABLE 2. Mini-sequencing Primer Sequences and Masses for Unextended and Extended Products
PCR product Unextended Variant Extended
Gene Variant length Extension oligo sequence oligo mass alleles oligo mass
AGT -6G>A 42 CGTGACCCGGCC(A/G) 3607.4 A 3904.6
G 3920.6
AGTR1 1166A>C 52 CTACCAAATGAGC(A/C) 3927.6 A 4224.8
C 4200.8
GNB3 825C>T 48 AGGGAGAAGGCCAC(A/G) 4346.9 A 4644.1
G 4660.1
ADRB2 Q27E 45 CACGACGTCACGCAG(C/G) 4547.0 C 4820.2
G 4860.2
LPL S447X 50 GAATGCTCACCAGCCT(G/C) 4826.2 C 5099.4
G 5139.4
ADD1 G460W 46 ACGAAGCTTCCGAGGAA(G/T) 5228.5 G 5541.7
T 5516.7
ADRB2 R16G 40 GAGGCGGCGCATGGCTTC(C/T) 5556.6 C 5829.8
T 5844.8

eluted with matrix can be spotted directly onto
the MALDI plates but must be analyzed within
approximately 24 hr. Samples eluted in acetoni-
trile can be stored for extended periods if frozen
but must first be mixed with an equal amount of
matrix prior to plate spotting. Approximately 400
nl of matrix-sample mixture was spotted onto a
384 well MALDI plate using a Symbiot I robotic
workstation (Perseptive Biosystems). Barcode
labels were used to verify and record the sample
transfer from reaction plates to MALDI plates.
Mass Spectrometry and Genotype
Determination
Masses of the mini-sequencing primers and ex-
tension products were assessed using linear de-
layed extraction mass spectrometry and a
Voyager-DE MALDI-TOF instrument (Perseptive
Biosystems). Genotypes for the samples were re-
solved with the aid of the Genespectrometer soft-
ware package. Such allele-calling software is
critical in order to achieve high throughput
genotyping. The software first targets the ioniza-
tion laser to accumulate mass data from regions
of a sample spot that yield high signal-to-noise
ratio. When sufficient signal has been accumu-
lated, the laser is directed to the next spot, allow-
ing a 384-well MALDI plate containing multiplex
genotyping reaction products to be analyzed au-
tomatically. The software then uses the mini-se-
quencing primers in each extension reaction as
internal mass calibrants and automatically iden-
tifies the primers, calibrates each mass spectrum,
and determines genotypes based on the mass dif-
ferences between primer and extension peaks.
Genotypes are written to an electronic database
that can be queried to produce data files in a
spreadsheet format suitable for further analysis.
Genotype Determination Using Alternative
Methods
Genotypes generated using mass spectrometry
were compared to two alternative methods, ei-
ther gel-based restriction fragment length (RFLP)
enzyme digest assays (ADD1, AGT, AGTR1,
GNB3, and LPL) or the Taqman hybridization
assay (ADRB2-R16G and ADRB2-Q27E). PCR
reactions for RFLPs included 30 ng DNA, 1.5 mM
MgCl2, standard concentrations of PCR reagents,
SNP GENOTYPING WITH MALDI-TOF 299
and 0.5 U Taq polymerase (Life Technologies,
Rockville, MD) in a 20 µl reaction volume. The
amplified products were then digested overnight
with 6 U of the appropriate restriction enzyme,
and digested products were separated on 3% aga-
rose gels, stained with ethidium bromide, and vi-
sualized using UV light. A 100 bp size standard
was included on each of the typing gels for geno-
type identification, and two individuals scored
each gel independently. For the Taqman assay,
PCR products were generated using 30 ng DNA,
5.0 mM MgCl2, and 1X Taqman Universal PCR
Master Mix containing AmpliTaq Gold DNA
Polymerase in a 27 µl reaction volume. A total of
0.2 µM of each of the allele-specific probes was
used in the allele discrimination assays, and al-
lele detection and genotype calling were per-
formed using an ABI 7700 and Sequence
Detection System software (Applied Biosystems).
RESULTS AND DISCUSSION
Single and Multiplex PCR
Single locus amplification reactions were gen-
erated for each of the variant sites (data not
shown), as well as multiplex PCRs that contained
sets of six (Fig. 1A), three (Fig. 1B), or four (Fig.
1C) target genes. A subset of samples visualized
on 9% polyacrylamide gels demonstrated that
the 4 µl reactions were reliable, with only slight
variation in amplification efficiency due to vari-
ability of DNA sample quality and/or concen-
tration. PCR primers were designed so that the
3′ end of each primer was at least two base pairs
from the variant site (Fig. 1D) both to ensure
that mini-sequencing primers would bind and
extend only on specific targets and to negate the
need to remove any non-specific PCR products.
Limiting the PCR product size to less than 100
bp was found to produce the most robust multi-
plex PCR and mini-sequencing reactions. We
have also successfully performed extension re-
actions using larger PCR products (up to 500
bp) that contain multiple SNPs (data not
shown). The reaction volume for PCR was re-
duced to 4 µl, both to minimize reaction costs
and in order to perform all steps of the sample
preparation in a single vessel. Small reaction
volumes also reduced the amount of DNA
needed, thereby maximizing sample resources.
300 BRAY ET AL.

FIGURE 1. Multiplex PCR products. The six-plex reaction (A) contains PCR products for AGT (42 bp), ADD1 (46 bp), GNB3
(48 bp), LPL (50 bp), AGTR1 (52 bp), and ADRB2 (83 bp). The three-plex reaction (B) contains PCR products for ADD1 (46
bp), AGTR1 (52 bp), and ADRB2-Q27E (45 bp), and the four-plex reaction (C) contains products for AGT (42 bp), GNB3
(48 bp), LPL (50 bp), and ADRB2-R16G (40 bp). PCR primers were designed so that the 3′ end of each primer was 2–3 bp
from the variant site to ensure that mini-sequencing primers would extend only when bound to specific PCR targets (D).

Mini-sequencing Reactions and MALDI
Chemistry
Mini-sequencing extension reactions resulted
in easily separable peaks in single locus reactions
and only moderate loss of signal in multiplex
reactions. With smaller sets of three (Fig. 2A)
and four (Fig. 2B) multiplexed PCR products,
each set of extension products could be sepa-
rated by two or more nucleotides, providing eas-
ily differentiated signals for each genotype. The
seven-plex extension reaction also produced dif-
ferentiable extension products, and higher-level
multiplexing can be accomplished by extending
the mass range beyond 6000 Daltons. Neverthe-
less, due to the close spacing of extension and
primer peaks in the seven-plex reactions, there
was some interference with depurination peaks
when THAP was used as the matrix chemical
(Fig. 3A). Alternatively, when 3-HPA matrix
was used, depurination peaks were no longer
present, providing clear signals for more closely
spaced extension products (Fig. 3B).
In all cases, the use of Thermosequenase in
the mini-sequencing reaction resulted in more
reliable primer extension than did Tth poly-
merase. Nevertheless, samples that amplified and
extended well did so with either enzyme. The
use of Thermosequenase is preferred when ge-
nomic DNA samples are sub-optimal, but pre-
liminary experiments have shown that the
addition of ammonium sulfate to the Tth reac-
tion buffer greatly enhances extension efficiency
(data not shown). Because the largest cost asso-
ciated with MALDI-TOF SNP genotyping is the
polymerase enzyme for the extension reactions,
and because Tth costs less than Thermo-
sequenase, further investigation of its use in pro-
duction genotyping is warranted.
Genotype Determination and Comparison to
Alternative Methods
Genotypes generated using mass spectrometry
were compared to two alternative methods, ei-
ther RFLP assays (ADD1, AGT, AGTR1,
GNB3, and LPL) or the Taqman hybridization
assay (ADRB2-R16G and ADRB2-Q27E). A
concordance score was calculated by compar-
ing the genotypes generated using MS to geno-
types generated with the alternative method.
Allele frequencies for each comparison were not

FIGURE 2. Mass spectra for multiplex mini-sequencing re-
actions. Three-plex reactions (A) contain products for
ADD1, AGTR1, and ADRB2-Q27E, and four-plex reac-
tions (B) contain products for AGT, GNB3, LPL, and
ADRB2-R16G. Masses for each product are provided in
parentheses.
significantly different from one another, with the
exception of ADD1, AGT, and ADRB2-Q27E.
Agreement between the methods ranged from
69 to 98% for each variant. In most cases, dis-
agreement was due to inadequate design and/or
performance of the MS method, with the ex-
ception of ADRB2-Q27E variant, in which the
Taqman data were found to be in error. Possible
sources of error for each variant are provided in
Table 3. These results serve to illustrate a num-
ber of issues related to MALDI-TOF genotyping
that are discussed in more detail below.
Unequal signal intensities for alleles within
the same SNP. Inequality of variant allele ex-
tension peaks within a given SNP is a common
occurrence in mass detection of mini-sequenc-
ing reactions [Sun et al., 2000]. This inequality
is not usually problematic except in extreme
SNP GENOTYPING WITH MALDI-TOF 301
FIGURE 3. Mass spectra for seven-plex mini-sequencing
reactions using THAP (A) or 3-HPA matrix (B). Seven plex
reactions contain products for ADD1, AGTR1, ADRB2-
Q27E, AGT, GNB3, LPL, and ADRB2-R16G. Depurination
peaks in reaction A are noted with arrows.
cases in which the signal from one allele is less
than 10 percent of the other and falls below the
signal-to-noise criterion for allele recognition,
as for the G→ T variant alleles within ADD1
(Fig. 2A). Two main factors can contribute to
inequality in signal intensity: a) preferential in-
corporation of one dideoxynucleotide over the
other, or b) sequence-specific differences in ion-
ization and desorption of oligonucleotide mol-
ecules. Changing the primer sequence to the
complement strand may alleviate the first fac-
tor, and the second factor may be improved by
making modifications to the primer sequence,
such as adding a short poly-T tail to one primer
[Lichtenwalter et al., 2000].
Disagreement due to inaccuracy of the alterna-
tive method. The Taqman assay, a genotyping
method that involves allele-specific hybridization
of fluorescently labeled probes to a variant sequence
302 BRAY ET AL.

TABLE 3. Comparison of Genotyping Using Mass Spectrometry Versus Alternative Methods

% match Type of
Gene or between MS alternative
variant and alternative method Allele frequencies Comments
ADD1- 71.2 Restriction G=0.838/ T=0.162 Differential efficiencies of extension for each
G460W digest allele; T allele extends more poorly than
G and was often missed
ADRB2- 70.0 Taqman C=0.504/ G=0.496 Poor allele discrimination with the Taqman
Q27E may have produced disparate results
ADRB2- 83.9 Taqman C=0.610/ T=0.390 These extension products had the highest
R16G masses and weakest signals
AGT 68.6 Restriction White: A=0.455/ G=0.545 The high signal intensity of the AGT extension
-6G>A digest Black: A=0.840/ G=0.160 primer produced relatively weak extension
peaks for this variant site, particularly
for the larger mass “G” allele
AGTR1 91.0 Restriction A=0.779/ C=0.221 Some interference with depurination peaks
1166A>C digest for these extended products-redesign of
extension primers would improve this system
GNB3 91.8 Restriction White: A=0.316/ G=0.684 Good agreement for a fairly polymorphic
825C>T digest Black: A=0.804/ G=0.196 system
LPL 97.6 Restriction C=0.074/ G=0.926 Variant allele is fairly rare and this many be
S447X digest one reason for the very high agreement here

of interest, has been demonstrated to provide ac-
curate genotypes for numerous polymorphisms.
Nevertheless, certain variant DNA sequences
are difficult to differentiate using this method
due to similar affinity of both perfect-match and
mismatch probes for the target sequence. Since
there is little flexibility in the design of the probe
sequences, some variant sites are not well suited
for hybridization genotyping methods. The use
of mini-sequencing extension reactions and mass
spectrometry circumvents the problems involved
in allele-specific hybridization, since alleles are
differentiated based on the mass of the extended
products rather than hybridization signals.
Disagreement due to weak signals or excess
primer concentration. As extension primers and
products are expanded into the higher mass
ranges, some decrease in signal is to be expected.
This decrease in signal intensity may be due to
less efficient desorption and/or decreasing sen-
sitivity of the detector for higher mass molecules.
Differences in PCR efficiency as well as com-
petitive ionization in multiplex reactions may
also contribute to uneven extension signals.
Therefore, it is critical to minimize background
noise and optimize the concentrations of prim-
ers so that primer signal does not mask exten-
sion signals. This is especially true in multiplex
reactions, where high signal intensities for low
mass primers may result in comparably weak sig-
nals for the higher mass products.
Interference of depurination peaks with ex-
tension peaks in multiplex reactions. The use of
THAP matrix can produce substantial depur-
ination peaks that can mask or interfere with
detection of extension peak signals in multiplex
reactions. THAP is used often when assessing
oligonucleotides with MALDI-TOF methods
due to its even crystallization in the sample well,
which is especially useful when sampling in the
instrument’s automatic mode. Interference from
depurination peaks can make THAP undesir-
able for high level multiplexing, however. Be-
cause depurination peaks have a predictable
mass that is approximately 150 Daltons less than
the primer peaks, careful design of primer and
extension masses can help to avoid depurination
peak interference when using THAP matrix. An
alternative to THAP is the use of 3-HPA, which
produces an even baseline and clearly resolved
peaks. However, 3-HPA crystallizes in a circular
pattern, leaving the center of the well void,
which can make autosampling difficult.
Cost Comparison of Alternative Methods
A comparison of genotyping supply costs for MS,
RFLP, and Taqman is presented in Table 4. Esti-
mates include the cost of all plasticware and
consumables. Instrument costs amortized over a
large number of locus tests were assumed to be
negligible and personnel costs were assumed to be
equivalent among methods. Taqman assay costs

TABLE 4. Cost (in U.S. Dollars) Comparison of Genotyping Using Mass Spectrometry Versus Alternative Methods
Mass spec typing
Total Single
rxn vol. locus 4-plex
PCR 4 µl $0.16 $0.04
Enzyme digest 6 µl $0.08 $0.02
Post PCR 10 µl TS $0.92 $0.23
10 µl Tth $0.73 $0.18
Purification $0.14 $0.04
Total $1.11–$1.30 $0.28–$0.33 $0.15–$0.18
were calculated using Taqman master mix (Ap-
plied Biosystems), which contains AmpliTaq Gold
DNA polymerase, dNTPs, PCR additives, and
normalizing dye. For each genotyping method, the
cost of enzymes is the primary expense, and single
locus MS genotyping is comparable to other meth-
ods. Nevertheless, multiplexing up to seven prim-
ers in a single MS reaction can reduce the cost per
genotype to approximately $0.15 US. The capac-
ity to multiplex makes MS genotyping an extremely
cost-effective method. In addition, even modest
levels of multiplexing and automation made pos-
sible with MS will reduce personnel costs below
that of the other two methods.
Genotyping Throughput With MS Methods
Critical to any evaluation of production
genotyping methods is the consideration of sample
throughput. Low volume PCR and mini-sequenc-
ing reactions using MS methods allow for reduced
cycling times, with PCR completed in approxi-
mately 1 hr and 15 min and mini-sequencing re-
actions lasting around 1 hr. ExoI-SAP digestion
takes 30 min and can be performed in a water bath
or incubator. Preparing a sufficient quantity of
sample cocktail at the start of each day minimizes
reagent transfer time. Sample purification using ro-
botic transfer takes approximately 30 min, and
when samples are eluted in matrix, sample spot-
ting from four 96-well reaction plates to one 384-
well MALDI plate using the Symbiot I robotic
workstation takes approximately 40 min. Auto-
sampling of the MALDI plate using the Voyager-
DE takes approximately 90 min. With eight thermal
blocks, we can prepare approximately 2,300
samples using 96-well plates and more than 9,200
samples using 384-well plates per eight-hour day.
Approximately 12 384-well MALDI plates (∼4,600
samples) can be spotted in an eight-hour day, and
SNP GENOTYPING WITH MALDI-TOF 303
RFLP typing Taqman assay
Total Single Total Single
7-plex rxn vol. locus rxn vol. locus
$0.02 20µl $0.48 20µl $0.93
$0.01 25µl $0.60 – –
$0.13 2% $0.13 – –
$0.10 gel
$0.02
$1.21 $0.93
currently about six MALDI plates (∼2,300 samples)
can be analyzed per day. By incorporating as few
as five variants into a multiplex reaction, more than
11,500 genotypes can be produced in a regular
eight-hour day. Extending robotic spotting and
analysis of MALDI plates into the off hours can
greatly improve throughput.
Issues in High Throughput Genotyping With
Mass Spectrometry
In order to bring the use of MS genotyping
into the laboratory at a production level, there
are a number of factors that must be considered.
First, performing the multi-step sample prepa-
ration in a single vessel is critical for minimizing
sample contamination and labor steps. Second,
reaction volumes should be kept low in order to
minimize cost, concentrate template, and maxi-
mize DNA sample resources. Third, as with any
high throughput genotyping methods, the use
of robotics greatly improves productivity. Ro-
botic spotting of MALDI plates is essential due
to the difficulty in manual transfer of sub-mi-
croliter sample volumes. Fourth, barcoding of
both sample and MALDI plates greatly assists
in tracking samples from preparation to data
analysis. Fifth, mass detection of samples must
take place automatically, requiring robust reac-
tions and consistent sample preparation, spotting,
and laser targeting. And sixth, interpretation of
mass spectra and genotype calling must be au-
tomated, reliable, and fully integrated with a
general data management utility.
CONCLUSIONS
The identification of a large number of SNPs
throughout the genome provides a valuable tool
for identifying and characterizing genes under-
lying human disease, for understanding inter-
304 BRAY ET AL.
individual variation in drug response, and for
tracking the origins and migrations of human
populations. Additionally, it is becoming increas-
ingly clear that both coding and non-coding re-
gions of genes can be highly variable, and both
encode information necessary for proper gene
function and regulation. To date, more than 60
polymorphisms have been identified in the gene
encoding lipoprotein lipase alone [Templeton et
al., 2000]. Characterizing all of the variation in
a gene or genes may be necessary before the ef-
fects of sequence variation in the gene can be
determined. These facts emphasize the need for
efficient and cost-effective methods for high
throughput SNP genotyping.
Genotyping technologies are advancing rap-
idly, and the ultimate technology for high
throughput, cost effective SNP genotyping has
possibly not yet been envisioned. Nevertheless,
of the techniques currently available, MALDI-
TOF genotyping methods show great promise
for high-throughput, economical genotyping.
Reducing reaction volumes saves cost in these
high-throughput applications; however, it also
increases the need for sensitivity. Mass spectrom-
etry provides sufficient sensitivity for sequence
detection in low-volume reactions, and this sen-
sitivity is particularly useful for multiplex
genotyping reactions that typically produce large
numbers of low concentration oligonucleotides.
The capacity for high level multiplexing, com-
bined with low cost and high sensitivity, make
MALDI-TOF genotyping methods a desirable
alternative for production genotyping.
ACKNOWLEDGMENTS
This work was supported by grants from CDC
(UR6/CCU617218-01 to MSB), and NIH
(HL54481, HL54526, HL54457, and HL54464
to EB, and DDK45538 to PAD). We thank
Marjorie Minkoff, Larry Haff, Philip Ross, and
Jon Speak, and Perseptive Biosystems for pre-
liminary use of the Genespectrometer software.
REFERENCES
Altshuler D, Pollara V, Cowles C, Van Etten W, Baldwin J,
Linton L, Lander E. 2000. An SNP map of the human
genome generated by reduced representation shotgon se-
quencing. Nature 407:513–516.
Cusi D, Barlassina C, Azzani T, Casari G, Citterio L, Devoto
M, Glorioso N, Lanzani C, Manunta P, Righetti M, Rivera
R, Stella P, Troffa C, Zagato L, Bianchi G. 1997. Polymor-
phisms of alpha-adducin and salt sensitivity in patients with
essential hypertension. Lancet 349:1353–1357.
Gray I, Campbell D, Spurr N. 2000. Single nucleotide poly-
morphisms as tools in human genetics. Hum Mol Genet
9:2403–2408.
Griffin T, Smith L. 2000. Genetic identification by mass spec-
trometric analysis of single-nucleotide polymorphisms: ter-
nary encoding of genotypes. Anal Chem 72:3298–3302.
Haff L, Smirnov I. 1997. Singel nucleotide polymorphism iden-
tification assays using a thermostable DNA polymerase and
MALDI-TOF MS. Genome Res 7:378–388.
Jeunemaitre X, Soubrier F, Kotelevtsev Y, Lifton R, Williams
C, Charru A, Hunt S, Hopkins P, Williams R, Lalouel J-M,
Corvol P. 1992. Molecular basis of human hypertension:
role of angiotensinogen. Cell 71:169–180.
Lichtenwalter K, Apffel A, Bai J, Chakel J, Dai Y, Hahn-
enberger K, Li L, Hancock W. 2000. Approaches to func-
tional genomics: potential of matrix-assisted laser
desorption ionization—time of flight mass spectrometry
combined with separation methods for the analysis of DNA
in biological samples. Chromatogr B Biomed Sci Appl J
745:231–241.
Porter C, Talbot Jr C, Cuticchia A. 2000. Central mutation
databases—a review. Hum Mutat 15:36–44.
Ross P, Hall L, Smirnov I, Haff L. 1998. High level multiplex
genotyping by MALDI-TOF mass spectrometry. Nat
Biotechnol 16:1347–1351.
Sass C, Herbeth B, Siest G, Visvikis S. 2000. Lipoprotein li-
pase (C/G)447 polymorphism and blood pressure in the
Stanislas Cohort. J Hypertens 18:1775–1781.
Siffert W, Rosskopf D, Siffert G, Busch S, Moritz A, Erbel R,
Sharma A, Ritz E, Wichmann H, Jakobs K, Horsthemke
B. 1998. Association of a human G-protein beta3 subunit
variant with hypertension. Nat Genet 18:45–48.
Sun X, Ding H, Guo B. 2000. A new MALDI-TOF based
mini-sequencing assay for genotyping SNPs. Nucleic Ac-
ids Res 28:E68.
Templeton A, Clark A, Weiss K, Nickerson D, Boerwinkle E,
Sing C. 2000. Recombinational and mutational hotspots
within the human lipoprotein lipase gene. Am J Hum
Genet 66:69–83.
Timmermann B, Mo R, Luft F, Gerdts E, Busjahn A, Omvik P,
Li G, Schuster H, Wienker T, Hoehe M, Lund-Johansen P.
1998. Beta-2 adrenoceptor genetic variation is associated
with genetic predisposition to essential hypertension: The
bergen blood pressure study. Kidney Int 53:1455–1460.
Wang W, Zee R, Morris B. 1997. Association of angiotensin II
type 1 receptor gene polymorphiszm with essential hyper-
tension. Clin Genet 51:31–34.