Journal of Steroid Biochemistry and Molecular Biology 190 (2019) 44–53

Contents lists available at ScienceDirect

Journal of Steroid Biochemistry and Molecular Biology

journal homepage: www.elsevier.com/locate/jsbmb

Modulation of exercise training related adaptation of body composition and T

regulatory pathways by anabolic steroids
⁎
Stefan Markus Reitznera, , Jonas Hengevossb, Eduard Isenmannb, Patrick Dielb
a
Department of Physiology and Pharmacology, Karolinska Institutet, Stockholm, Sweden
b
Department of Molecular and Cellular Sport Medicine, German Sport University Cologne, Germany

A R T I C LE I N FO A B S T R A C T

Keywords: Anabolic steroids have a long history of abuse in amateur and professional athletics. However, their interaction
Metandieone with training and the resulting effects on body composition and tissue adaptation, relying on a concert of factors
Gene expression and pathways, remain under investigation. This study aims at investigating the changes of body composition and
TNF-β the expression of selected genes and pathways essential for this adaptation process. Therefore, male wistar rats
Androgen receptor
were treated with the anabolic steroid metandienone in two groups (n = 16; metandienone, metandienone +
MyoD
Myogenin
exercise) alongside with control groups (n = 16; control, exercise). Following a 6-week steep-angle treadmill
Myostatin training protocol, weight of organs, visceral fat and muscles was determined. M. gastrocnemius was histologically
Follistatin assessed by ATPase staining, mRNA and protein levels of factors of regeneration, hypertrophy and myogenesis
Smad3 and selected master regulators and markers were determined. Results show additive effects of anabolic steroids
Smad7 and exercise on body, tibia and reproductive organs weight. Mm. gastrocnemius and soleus weight was increased
eMHC by training but not anabolic steroids. Muscle fiber diameter and composition remained unchanged. Visceral fat
IL-6 mass and fat cell size was affected by training and anabolic steroids but no additive effects could be observed.
IL-10
Exercise and anabolic steroids result in a complex regulation of the expression of genes in M. Gastrocnemius
IGF-1
involved in skeletal muscle metabolism, hypertrophy, inflammation and regeneration. In summary, our data
suggests distinct molecular mechanisms involved in the adaptation of the skeletal muscle to anabolic androgenic
steroids and exercise. Metandienone treatment neither results in skeletal muscle hypertrophy nor liver-toxic
effects but in an induction of skeletal muscle regeneration and an activation of endocrine negative feedback.
Moreover our study demonstrates that visceral fat and bone responds with higher sensitivity to ASS and exercise
than the skeletal muscle. This apparent plasticity of adipose and bone tissue rather than skeletal muscle could
indicate a potentially superior future role of fat rather than muscle related parameters to detect and AAS abuse in
a biologic passport strategy in professional athletes.

1. Introduction combination with training. Here, a key mechanism is their ability to

Anabolic androgenic steroids (AAS) are steroidal androgens in-
cluding natural compounds like testosterone as well as synthetic
structually related compounds that are in their effect similar to tes-
tosterone. As such, AAS are important therapeutic drugs but also have a
long history of abuse in amateur and professional athletics [1,2]. Ath-
letes abuse AAS to build muscle, prolong endurance and enhance per-
formance [3]. Anabolic agents are prohibited in amateur and profes-
sional sports and appear on both the World Anti-Doping Agency
(WADA) and U.S. Anti-Doping Agency (USADA) list of prohibited
substances. Nevertheless their use is widespread and the numbers of
abusers are still increasing especially in amateur sports. On a physio-
logical level AAS are believed to be performance-enhancing agents in
increase lean muscle protein synthesis and body weight, without in-
creasing fat mass [4–6]. However systematic human intervention stu-
dies confirming these findings are limited.
Mechanistically, as for testosterone, molecular activities of AAS are
mediated via the androgen receptor (AR), a member of the family of
nuclear receptors [7,8]. As a ligand-activated transcription factor
binding of androgens like dihydrotestosterone (DHT) or testosterone
together with co-regulatory proteins it is directly responsible for reg-
ulation in target genes containing an androgen-response element se-
quence [8,9]. Testosterone is produced in the Leydig cells of testis and
in lower levels in the adrenal gland [10]. As most of the circulating
testosterone is bound to serum proteins, only the remaining 1–3 % are
free and available for diffusion into cells and interaction [11]. In

⁎
Corresponding author at: Biomedicum C5, Department of Physiology and Pharmacology, Karolinska Institutet, 171 77, Stockholm, Sweden.
E-mail address: stefan.reitzner@ki.se (S.M. Reitzner).

https://doi.org/10.1016/j.jsbmb.2019.03.023
Received 28 February 2019; Received in revised form 25 March 2019; Accepted 25 March 2019
Available online 26 March 2019
0960-0760/ © 2019 Elsevier Ltd. All rights reserved.
S.M. Reitzner, et al.
androgen responsive tissues like prostate and epididymis 5α-reductase
converts testosterone to DHT which has a much higher affinity to the
AR and therefore triggers a higher androgenic stimulation [12]. In this
context the AR is responsible for the androgenic phenotype in males
and sexual maturation. Highest expression levels of the AR, the can be
found in androgen-responsive tissues like the seminal vesicles, testis,
genitalia, prostate and epididymis. Furthermore, in rat, AR can con-
tribute to increased growth of muscle, maximal force production, fa-
tigue resistance and even has an impact on fiber composition [13].
Resistance training has been demonstrated to increases the expression
of AR in the distinct tissues [13]. However in rat in contrast to the
described effects of AAS in humans, AR was not found to correlate with
skeletal muscle hypertrophy but with regeneration [14].
The complex interaction of metabolism and the endocrine system
plays a substantial role in the individual response of an athlete towards
training. A variety of molecular pathways have been identified with
relevance for the athletic performance. Whereas some directly influence
the equilibrium of muscle protein breakdown and protein biosynthesis,
like follistatin [15] and myostatin [16], some play a role in the clear-
ance of remainders of wasted muscle fibers in the framework of the
immune system like the interleukins 6 and 10 (IL-6, IL-10) or Tumor
Necrosis Factor Alpha (TNFα) [17]. Others affect and facilitate the
development of progenitor satellite cells to myotubes, like Pax7 [18],
MyoD or myogenin [19]. Still others show a general effect on all re-
levant factors - hypertrophy, proliferation, differentiation and muscle
cell survival, like the Insulin-like growth factor 1 (IGF-1) [20] and its
upstream Androgen receptor [13] or can serve as a marker for newly
formed muscle cells, like the embryonic form of Myosin Heavy Chain
[21]. Together these effectors and factors maintain an adaptive home-
ostasis in the biological system of the skeletal muscle but also other
tissues. Training and AS are variables, triggering this system and re-
sulting in an adaptation of tissue homeostasis.
To improve the mechanistic insight into the systemic response of an
organism towards combined exposure to AS and training this study
investigates changes of body composition, tissue selective adaptation of
muscle, fat and bone and the expression of genes involved in the
complex signal transduction pathways related to regeneration, hyper-
trophy and myogenesis in the model organism rat. Male intact Wistar
rats were allocated into four groups: two non-treated groups, control
and exercise (EX), and two metandienone (anabolic steroid) treated
groups, metandienone (MD) and metandienone + exercise (MD + EX).
This experimental design (see Figs. 1 and 2) allows for the isolation of
exercise- and metandienone-specific effects as well as providing insight
into the additive effect of both treatments over a time course of six
Fig. 1. Design of the treadmill based training protocol. 32 wistar rats were subjected to a six week training protocol consisting of in total 20 min exercise each day for
three out of four days on a 25° inclined treadmill with increasing intensity for two out of four groups. Additionally, two groups were injected with 5 mg⋅kg BW−1
metandienone each day. T: training day; R: rest day.
45
Journal of Steroid Biochemistry and Molecular Biology 190 (2019) 44–53
weeks.
In summary, the main aim of this study was to investigate the dif-
ferential effects of hypertrophy exercise and anabolic steroid applica-
tion on physical parameters, histological characteristics in adipose
tissue and skeletal muscle and gene expression specific to skeletal
muscle in rat.
2. Results
2.1. Effects on body and inner organ weight
Both interventions including exercise, exercise alone (EX) and me-
tandienone + exercise (MD + EX) resulted in a significant decrease of
body weight by 9.5% and 12.5% respectively. Metandienone alone
(MD) resulted in a similar tendency with an average decrease in body
weight of 7.1% (p = 0.0653; see Fig. 3a). Relative heart weight in-
creased significantly by 12.4% as a response to MD + EX, exercise
alone resulted in a similar tendency with an average increase by 11.5%
(p = 0.0730). MD alone had no effect on heart weight (Fig. 3b). Re-
lative tibia weight was significantly increased by both interventions
including metandienone treatment, MD and MD + EX by 8% and
17.9% respectively. Additionally, a significant difference can be ob-
served between MD alone and MD + EX (Fig. 3c). Liver weight was
affected neither by EX, MD or the combination of both (Fig. 3d).
2.2. Effects on androgen sensitive tissues
Both interventions including metandienone, MD and MD + EX re-
sulted in a significant decrease of relative prostate weight by 24.3% and
25.8% respectively while exercise had no effect (Fig. 4a). Relative
weight of the seminal vesicle was significantly increased following EX
by 24.3% and significantly decreased by both intervention that in-
cluded metandienone, MD and MD + EX, by 32.6% and 43% respec-
tively (Fig. 4b). Relative testis weight was decreased in a similar way as
in prostate, both interventions including metandienone, MD and
MD + EX resulted in a significant decrease by 21% and 21.6% respec-
tively (Fig. 4c).
2.3. Effects on body and muscle composition
Both the leg muscles, Mm. soleus and gastrocnemius responded with a
similar positive tendency in exercise-containing interventions groups
EX and MD + EX by 8.9% and 7.6% (M. soleus) and 6.5% and 5% (M.
gastrocnemius) respectively (Fig. 5a and c). M. soleus cross-sectional
S.M. Reitzner, et al.
Fig. 2. The chemical structures of the closely related substances, the natural compound testosterone and the artificial metandienone.
Fig. 3. Physiological characteristics of experimental rats after six weeks of training and metandienone supplementation. Organ weights (b-d) are normalized by body
weight (a). (*=p < 0.05).
area and M. gastrocnemius muscle fiber cross-sectional area remained
unaffected by any intervention (see Fig. 5b and d-f) as was muscle fiber
composition in M. gastrocnemius. Relative visceral fat weight was sig-
nificantly reduced in both interventions including exercise, EX and
MD + EX, by 41.6% and 40.2% respectively, while MD alone had no
effect (Fig. 5g). Visceral fat cell cross-sectional area was significantly
reduced in all intervention groups, EX, MD and MD + EX, by 27.6%,
22.3% and 46.2% respectively. Furthermore, the combination of
MD + EX resulted in a significantly lower visceral fat cell cross-sec-
tional area than MD alone (Fig. 5h).
2.4. Effects on gene and protein expression in M. gastrocnemius
The expression of TGF-β pathway related myostatin and follistatin
both was significantly upregulated in MD only group. Both genes were
furthermore significantly downregulated in MD + EX compared to
both, EX and MD only (Fig. 6a and b). Activin Receptor IIB was sig-
nificantly downregulated compared to control following exercise only
(Fig. 6c). The intracellular TGF-β pathway signalling protein Smad3
46
Journal of Steroid Biochemistry and Molecular Biology 190 (2019) 44–53
was significantly downregulated following all intervention groups, the
antagonist Smad7 only following MD + EX intervention. However, EX
only showed the same tendency for downregulation (p = 0.0906; see
Fig. 6d and f).
Interleukin 6 was significantly downregulated following both in-
tervention protocols containing exercise, EX and MD + EX, while MD
only showed no effect on gene expression (Fig. 6f). In contrast, inter-
leukin 10 was not regulated following any intervention protocol
(Fig. 6g). Tumor Necrosis Factor α was significantly downregulated
following MD + EX intervention only (see Fig. 6h).
Expression of Androgen receptor was significantly downregulated
following both intervention protocols containing metandienone, MD
and MD + EX (Fig. 6i), IGF-1 expression was significantly upregulated
only in response to MD (Fig. 6l). Pax7 was not significantly regulated in
any intervention group (Fig. 6j), while the expression of embryonal
Myosin Heavy Chain was significantly downregulated in both exercise
groups, EX and MD + EX, and significantly upregulated following MD
only treatment (Fig. 6m). Expression of MyoD was significantly upre-
gulated following MD only treatment (Fig. 6k), while myogenin
S.M. Reitzner, et al.
Fig. 4. Physiological characteristics the reproductive system of experimental rats after six weeks of training and metandienone supplementation. Organ weights (a-c)
are normalized by body weight (see Fig. 3a). (*=p < 0.05).
expression was not significantly regulated by any intervention protocol
(Fig. 6n). MyoD protein levels showed the same pattern of regulation as
on gene expression level (Fig. 7).
3. Discussion
The abuse of anabolic steroids has been on the rise with the in-
creased popularity of fitness training and weight lifting in recent dec-
ades [22]. Scientific advances and the development of new, more ef-
fective and easy to manufacture substances further the wide spread
availability, in turn decreasing potential user inhibition thresholds de-
spite the increasing number of countries introducing potent anti-doping
legislation [23]. With this background in mind this study was designed
to get a better insight into the mechanisms of exercise, anabolic steroids
and their effect on the body composition the expression of relevant
genes. In the context of the anti-doping background it aimed at im-
proving and developing novel methods to detect doping in sports and to
help improve understanding of its potential targets and their complex
web of interactions.
To ensure comparability to previous studies the training protocol
was based on previous publications [24–27]. It was designed (see
Fig. 1) to induce an adaptive, positive progression of a hypertrophic
stimulus [28,29] on muscles that are exceptionally loaded in steep-
angle locomotion [30]. To achieve this, treadmill speed modulated
training load was progressively increased while observing sufficient
regeneration periods between exercise interventions. As anabolic agent,
the widely used anabolic steroid metandienone (Dianabol) was chosen,
which has a moderate myotrophic and androgenic effect compared to
other anabolic steroids but a high myotrophic effect compared to tes-
tosterone [31]. The drug was administered at the dose of 5 mg⋅kg
BW−1⋅day−1, which has demonstrated to induce an adaptive response
in tissues in previous studies by results from others [32,33] and our lab
[34] and can be reconfirmed by the results of this study, showing sig-
nificant changes in body, heart and tibia weight in response to the
47
Journal of Steroid Biochemistry and Molecular Biology 190 (2019) 44–53
application of metandienone at the same dosage (Fig. 3).
In this present study, reduction of bodyweight is significantly af-
fected by training and by trend by metandienone (MD). In the combi-
natory group, reduction of body weight in particular seems to be pri-
marily driven by the parameter exercise (Fig. 3a). Training has a
responder-dependent effect on body weight with a coefficient of var-
iation of 9.7% in the training only group, while in combination with
MD reduction in body weight seems to be more profound across all
individuals, resulting in a coefficient of variation of 4.59%. In this case,
MD seems to act as a normalizer of different responder types to exercise.
This need for physical activity for the manifestation of body weight
change has been demonstrated before for different anabolic agents
[35]. The extend and specificity of the effect depends on the specific
chemical compound [31]. The reduction of body weight in response to
exercise is comparable to the reduction of visceral fat weight observed
in this study (Fig. 5g) and is in agreement of own previous investiga-
tions using a lower MD dose (0.5 mg⋅kg BW−1⋅day−1) and three weeks
of intervention [24]. In our present study relative heart weight is in-
creased by exercise, however a significant increase could be only ob-
served in the combination of MD + EX (Fig. 3b). This finding is in
agreement with previously published data were additive effects of AAS
and exercise, on heart hypertrophy have been reported [36,37].
Changes in liver weight and morphology are common side effects of
AAS [38,39]. However, no effect of metandienone application on liver
weight could be observed (Fig. 3d), suggesting that a dosage higher
than 5 mg⋅kg BW−1⋅day−1 MD might be necessary to induce an effect
in this tissue. The influence of exercise on bone mass and bone mineral
density is well described in both rat and human [40–43]. Furthermore,
bone tissue is also known to be responsive to the application of AAS
[44,45]. Consistent with these findings, this present study shows that
exercise and MD application results in an increase of bone mass of the
tibia and an additive effect after co-administration (Fig. 3c). Me-
tandienone, like all testosterone-derived anabolic steroids, has a broad
androgenic effect [31]. Exogenous application of MD results in a
S.M. Reitzner, et al.
Fig. 5. Parameters of body compositions of rats after six weeks of training and metandienone supplementation. Muscle (a-f) and visceral fat (g-h) weight and cell
cross sectional area. (*=p < 0.05).
suppression of the hypothalamic-pituitary-gonadal axis and inhibits
endogenous testosterone production in the testicular leydig cells
[46–48]. Like demonstrated in a previous study from our lab this sup-
pression results in atrophy of the androgen sensitive tissues prostate,
seminal vesicle and testis in intact male rats [49]. In this study we
observe similar effects following MD treatment (Fig. 4a–c).
However, experimental design in this study did not affect weight,
fiber composition or cross-sectional area in Mm. gastrocnemius and so-
leus (Fig. 5a–f). There is conflicting data regarding hypertrophy effects
of training and ASS administration in rodent animal models. Some
studies demonstrate that hypertrophy in Mm. gastrocnemius and soleus
48
Journal of Steroid Biochemistry and Molecular Biology 190 (2019) 44–53
cannot be induced by either [50–53]. Both, exercise and anabolic
steroids have been described to modulate body composition by af-
fecting fat mass-, -distribution and -cell size in animal models
[27,54,55]. In our study, reduction of visceral fat mass can be observed
in response to exercise, and by tendency in response to MD treatment.
Furthermore, combinatory application of MD + EX results in a sig-
nificant additive effect (Fig. 5g). These results are also reflected by a
similar modulation of the visceral fat cell size (Fig. 5h). In summary
adipose and bone tissue seems to be more responsive to exercise and the
application of anabolic steroids than skeletal muscle.
Even though skeletal muscle is not structurally affected by
S.M. Reitzner, et al. Journal of Steroid Biochemistry and Molecular Biology 190 (2019) 44–53

Fig. 6. Regulatory pattern of gene expression following a six week intervention program. TGF-β pathway related (a-e), immune system related (f-h) and hypertrophy
modulating (i-n) genes.

49
S.M. Reitzner, et al. Journal of Steroid Biochemistry and Molecular Biology 190 (2019) 44–53

(Fig. 6b). Also Smad7, a gene acting antagonistic to the inhibitory

signal of Myostatin is regulated by exercise but not ASS (Fig. 6e). This
exercise effect is also visible for Smad3. Adaptation of skeletal muscle is
also regulated by the immune system. Therefore, gene expression of the
pro-inflammatory cytokine TNFα [59] and the anti-inflammatory cy-
tokines IL-6 and IL-10 was analyzed [60]. The clear downregulation of
IL-6 in response to exercise only indicates a close relationship between
exercise and IL-6 regulation, but no susceptibility to AAS (Fig. 6f).
Previous studies provide evidence that IL-6 expression of skeletal
muscle cells affects glucose energy metabolism by increasing GLUT4
transporter activity and translocation to the plasma membrane
[61–63]. In our study, IL-6 gene expression in skeletal muscle was
downregulated in response to exercise. These conflicting findings may
be explained by time dependent effects. Skeletal muscle in this study
was prepared two days after a last bout of exercise. Upregulation of IL-6
in serum has been shown to return to baseline 24 h after one acute bout
of exercise [63]. Another cytokine involved in the regulation of glucose
uptake is TNF-α, which acts by impairing glucose uptake through
GLUT4 downregulation and inhibition of the susceptibility to insulin
signaling [64,65]. In our study IL-6 expression is not affected by AAS
treatment. In contrast TNF-α expression is decreased combining ex-
ercise- and AAS treatment (Fig. 6h).
While pharmacological doses of AAS upregulate expression of an-
Fig. 7. MyoD protein expression is upregulated in the same pattern as MyoD drogen receptor mRNA [66], supraphysiological doses result in its
gene expression (Fig. 6k) following a six week intervention. downregulation indicating an activation of the endocrine feedback-loop
system [67,68]. Here we show that a dose of 5 mg⋅kg BW−1⋅day−1
results in an activation of this negative feedback loop (Fig. 6) indicated
Table 1
Overview of regulation of mRNA levels after 6 weeks of the specified inter- by the observed downregulation of AR mRNA by MD. Interactions be-
vention program compared to control group. ↑/↓: slight changes; ↑↑/↓↓: tween IGF-1 expression and AR activity have been demonstrated
changes; ↑↑↑/↓↓↓: strong changes; = : no changes. [69,70]. Here we show that MD treatment 48 h after the last bout of
exercise results in a decrease of AR expression of and an increase of IGF-
Gene Exercise Metandienone Metandienone + Exercise
1 (Fig. 6l), again an indication for the activation of the endocrine
Activin Receptor IIB ↓ = = feedback. Furthermore, MD treatment results in an increased expression
Androgen Receptor = ↓↓ ↓ of MyoD mRNA (Fig. 6k) and protein expression (Fig. 7). MyoD is a key
embryonal Myosin Heavy ↓↓ ↑↑↑ ↓ regulator in the differentiation of myogenic precursor cells. In agree-
Chain
Follistatin = ↑ =
ment with our observation it has been shown to be upregulated in re-
IGF-1 = ↑ = sponse to AAS application [71]. Interestingly here, the upregulation of
Interleukin 6 ↓↓ = ↓↓ both, IGF-1 and MyoD, in response to AAS is antagonized by exercise.
Interleukin 10 = = = Previous publications suggest that in rodents, AAS act rather re-
MyoD = ↑ =
generative than promyogenic [72]. This hypothesis is further supported
Myogenin = = =
Myostatin = ↑↑ = by the results presented in this study, namely by the detected upregu-
Pax7 = = = lation of embryonal Myosin Heavy Chain mRNA expression (Fig. 6m).
Smad3 ↓ ↓ ↓ This gene was previously reported to be transiently upregulated during
Smad7 = = ↓ regeneration in skeletal muscle of rat [73]. Furthermore, while the
Tumor Necrosis Factor α = = ↓
triggering of an endocrine feedback loop might explain gene expression
response to application of metandienone, the absence of regulation of
experimental design it clearly responds on the molecular level, as de- master promyogenic signals and factors in response to mechanical
monstrated by gene expression data (summarized in Table 1). In ske- loading come as a surprise and might require further investigation.
letal muscle, the transforming growth factor beta (TGF-β) superfamily Taken together, our data suggests distinct molecular mechanism
regulates its homeostasis by modulating myogenesis and protein break- involved in the adaptation of the skeletal muscle to AAS and exercise.
down [15,16]. Myostatin for example is a suppressor of myogenesis and The used dosage of MD did neither result in skeletal muscle hyper-
satellite cell activity [56,57], whereas follistatin acts as an inhibitor of trophy nor in liver-toxic effects. However, induction of regeneration
myostatin. Here we show that treatment with MD results in an upre- (embryonal Myosin Heavy Chain), MyoD expression and endocrine
gulation of myostatin gene expression (Fig. 6a). This upregulation is negative feedback was triggered (Androgen Receptor). Moreover we
accompanied by a downregulation of Smad3, a factor responsible for demonstrate that visceral fat and bone responds to ASS and exercise
the downstream propagation of the inhibitory signal of Myostatin [58] with higher sensitivity than skeletal muscle. This apparent plasticity of
(see Fig. 6d). In previous studies from our lab, a downregulation of adipose and bone tissue rather than skeletal muscle could indicate a
myostatin after short-time administration of metandieone could be potentially superior future role of fat rather than muscle related para-
observed in young adult rats [24]. However, in line with results pre- meters to detect and AAS abuse in a biologic passport strategy in pro-
sented here, chronic administration of AAS has been shown to increase fessional athletes.
Myostatin expression [50]. Dalbo et al. conclude that the upregulation
of Myostatin in response to long-term ASS treatment is compensated by 4. Material and methods
the downregulation of Smad3. This is the same regulatory pattern that
we report in this study (Fig. 6d). While Dalbo et al. report no significant 4.1. Animals, diet and experimental design
changes in follistatin gene expression in our study this gene is affected
30 adult male Wistar rats (Janvier Laboratories, Le Genest-Saint-

50
S.M. Reitzner, et al. Journal of Steroid Biochemistry and Molecular Biology 190 (2019) 44–53

Isle, France) were subjected to a six week intervention program con-
sisting of exercise interventions and/or injection of anabolic steroids.
Exercise consisted of two to four training sessions, in total 20 min a day
on a steep-angle treadmill at an incline of 25° with a progressively in-
creasing velocity (see Fig. 1). Injection of the anabolic steroid me-
tandienone (17b-hydroxy-17a-methylandrosta,-1,4-dien-3-one; see
Fig. 2) was administered daily throughout the six weeks at a dosage of 5
mg⋅kg BW−1 dissolved in 20% ethanol/peanut oil (Sigma-Aldrich),
control groups were injected with ethanol/peanut oil only. The animals
were separated equally by body weight and assessed running motiva-
tion into two intervention groups (metandienone, exercise +
metandienone) and two control groups (control, exercise). Animals
were kept at 22 °C room temperature, air humidity of 50–80 % and a
12 h day-night-cycle. Throughout the experiment the rats were fed an
isoflavone-depleted diet (phytoestrogen free; 4 mg ISO aglycone
equivalent⋅kg−1 diet; Ssniff, Soest, Germany) All animal handling and
experimental conditions were carried out according to the “Institutional
Animal Care and Use Committee guidelines,” regulated by the german
federal law for animal welfare and were approved by LANUV, permis-
sion number 84.02.04.2013.A239.
4.2. Tissue preparation
Body weight was determined before rats were decapitated and
heart, liver, prostate, seminal vesicle, testis, tibia, Mm. gastrocnemius
and soleus and visceral fat pad dissected and snap frozen in liquid ni-
trogen. Visceral fat pad was formol fixated, muscles were conserved in
mounting medium. Tissues were stored at −80 °C.
4.3. RNA analysis
RNA from M. gastrocnemius was homogenized using a bead mill
and extracted using TRIzol according to standard protocol (Life
Technologies). RNA was quality assessed and quantified and pooled
into four treatment-based pools. cDNA synthesis was performed with
1 μg of pooled RNA each using the QuantiTect Reverse Transcription Kit
(Quiagen). Real-time PCR was performed in triples using a Stratagene
MX3005 P thermocycler (Agilent Technologies) with a Taq DNA
Polymerase Recombinant Kit (Life Technologies) and SYBR Green.
Validated and optimized primers were self-designed and assessed using
Primer3 and synthesized by Invitrogen (Life Technologies), they have
partially been published previously [24,74–76] (see Table 2). As a
housekeeping gene, cyclophilin was used.
4.4. Protein extraction and western blot
Total protein was extracted in lysis buffer under permanent liquid
nitrogen cooling using mortar and pestle and a Polytron PT1200E
homogenizer (Fisher Scientific) and centrifuged at 8000 g for 20 min.
Supernatant was quantified using the DC Protein Assay Kit (Bio-Rad)
and pooled equally for each group. 25 μg of protein each was loaded on
a Nu-PAGE 4%–12% Bis-Tris Midi Gel and blotted on nitrocellulose
membrane using the Trans-Blot Turbo System (Bio-Rad). Gels were
stained using Coomassie blue, membranes were stained using Ponceau
S. Primary antibody used was MyoD (D7F2, Developmental Studies
Hybridoma Bank, University of Iowa). Secondary antibody (Goat anti-
mouse IgG cross-adsorbed HRP conjugate; G-21040, Thermo Fisher
Scientific) was coupled with horseradish peroxidase for visualization
and measured with ImageQuant LAS-4000 (GE Healthcare). Protein
data was analyzed by densiometric measurement using ImageJ (NIH,
v1.46d).
4.5. Histological methods
The formol fixated visceral fat pad was cut on a microtome and
stained with hematoxylin and eosin. M. gastrocnemius frozen in
mounting medium was cut on a microtome. ATPase was stained for
with the classic histochemical ATPase staining protocol. Slides were
analyzed with the Axiovert 200 M microscope (Zeiss) and ImageJ (NIH,
v1.46d).
4.6. Statistics
For analysis of real-time PCR and western blot, gene and protein
expression was normalized using the ΔΔCt-Method [77]. Gene expres-
sion was statistically analyzed using one-way ANOVA and the Newman-
Keuls multiple comparison post hoc test. Physiological parameters and
histological results were statistically calculated with Mann-Whitney-U
test. Cross-sectional area of muscle fiber types was analyzed by one-way
ANOVA. Intervention effect on fiber type distribution was analyzed
using two-way ANOVA. Differences were considered significant at
p < 0.05. Statistics were calculated using GraphPad Prism v7.03 and
IBM SPSS v24.
Conflict of interest
The authors declare no conflict of interests.
Acknowledgements
The authors would like to thank Ute Laudenbach-Leschowsky for
her support during conduction of the animal experiment. This project
was partially funded by the World Anti-Doping Agency (WADA), [grant
number Di-12C12PD] .

Table 2
Used primers, their sequences and sources.
Amplicon name Forward Primer Sequence Reverse Primer Sequence Published in

ActRIIB CACAAGAAGATGAGGCCCAC GCTTAGATGCTGGACTCTTTA self-made

AR CTCACCAAGCTCCTGGATTC GGTGGGTTTGGGTATTAGGG Hanft 2012
Cyc GGATTCATGTGCCAGGGTGG CACATGCTTGCCATCCAGCC Matsakas et al. 2005
Follistatin AGGGAAAGTGTATCAAAGCAAAGTC AACCTTGAAATCCCATAGGCATT Mosler et al. 2012
IGF-1 CCGCTGAAGCCTACAAAGTC TGTTTTGCAGGTTGCTCAAG Weigt et al. 2012
IL-6 TGGAGTTCCGTTTCTACCTG TTTCATATTGCCAGTTCTTCG self-made
IL-10 CCTGCTCTTACTGGCTGGAG TCCAGCTGGTCCTTCTTTTG self-made
MHCe AGAGTCTGTGAAGGGCCTGA CTAGCTCATGCTGGGCTTTC Velders et al. 2012
MyoD GGAGACATCCTCAAGCGATGC AGCACCTGGTAAATCGGATTG Velders et al. 2012
Myogenin CCAGTGAATGCAACTCCCAC GCAGACAATCTCAGTTGGGC self-made
Myostatin TAACCTTCCCAGGACCAGGA CACTCTCCAGAGCAGTAATT Mosler et al. 2012
Pax7 AGCCGAGTGCTCAGAATCAA TCCTCTCGAAAGCCTTCTCC Velders et al. 2012
Smad3 CTCCTAGCTCAGTCTGTCAACC ATTCAGGTGTAGCTCGATCCAG self-made
Smad7 CAACCCCCATCACCTTAGTCGA CTTGCTCCTCACTTTCTGTACCA Mosler et al. 2012
TNFα TGGCCCAGACCCTCACACTC CTCCTGGTATGAAATGGCAAATC Velders et al. 2012

51
S.M. Reitzner, et al.
References
[1] K.D. Fitch, Androgenic-anabolic steroids and the Olympic games, Asian J. Androl.
10 (2008) 384–390, https://doi.org/10.1111/j.1745-7262.2008.00377.x.
[2] J.L. Dotson, R.T. Brown, The history of the development of anabolic-androgenic
steroids, Pediatr. Clin. North Am. 54 (2007) 761–769, https://doi.org/10.1016/j.
pcl.2007.04.003.
[3] I. Mazzoni, O. Barroso, O. Rabin, The list of prohibited substances and methods in
sport: structure and review process by the world anti-doping agency, J. Anal.
Toxicol. 35 (2011) 608–612, https://doi.org/10.1093/anatox/35.9.608.
[4] J.M. Hoberman, C.E. Yesalis, The history of synthetic testosterone, Sci. Am. (1995)
76–81, https://doi.org/10.1038/scientificamerican0295-76.
[5] M. Sheffield-Moore, R.J. Urban, S.E. Wolf, J. Jiang, D.H. Catlin, D.N. Herndon,
R.R. Wolfe, A.A. Ferrando, Short-term oxandrolone administration stimulates net
muscle protein synthesis in young men, J. Clin. Endocrinol. Metab. 84 (1999)
2705–2711, https://doi.org/10.1210/jc.84.8.2705.
[6] S. Bhasin, T.W. Storer, N. Berman, C. Callegari, B. Clevenger, J. Phillips,
T.J. Bunnell, R. Tricker, A. Shirazi, R. Casaburi, The effects of supraphysiologic
doses of testosterone on muscle size and strength in normal men, N. Engl. J. Med.
335 (1996) 1–7, https://doi.org/10.1056/NEJM199607043350101.
[7] J. Tan, D.R. Joseph, V.E. Quarmby, D.B. Lubahn, M. Sar, F.S. French, E.M. Wilson,
The rat androgen receptor: primary structure, autoregulation of its messenger ri-
bonucleic acid, and immunocytochemical localization of the receptor protein, Mol.
Endocrinol. 2 (1988) 1276–1285, https://doi.org/10.1210/mend-2-12-1276.
[8] E.T. Keller, W.B. Ershler, C. Chang, The androgen receptor: a mediator of diverse
responses, Front. Biosci. 1 (1996) d59–71, https://doi.org/10.2741/a116.
[9] F. Kadi, P. Bonnerud, A. Eriksson, L.E. Thornell, The expression of androgen re-
ceptors in human neck and limb muscles: effects of training and self-administration
of androgenic-anabolic steroids, Histochem. Cell Biol. 113 (2000) 25–29, https://
doi.org/10.1007/s004180050003.
[10] K. Svechnikov, L. Landreh, J. Weisser, G. Izzo, E. Colón, I. Svechnikov, O. Söder,
Origin, development and regulation of human leydig cells, Horm. Res. Paediatr. 73
(2010) 93–101, https://doi.org/10.1159/000277141.
[11] W. Rosner, R.J. Auchus, R. Azziz, P.M. Sluss, H. Raff, Position statement: utility,
limitations, and pitfalls in measuring testosterone: an endocrine society position
statement, J. Clin. Endocrinol. Metab. 92 (2007) 405–413, https://doi.org/10.
1210/jc.2006-1864.
[12] E.M. Wilson, Androgen receptor structure and function, in: H.L. Henry,
A.W. Norman (Eds.), Encycl. Horm. Academic Press, New York, 2003, pp. 103–110,
, https://doi.org/10.1016/B0-12-341103-3/00016-4.
[13] A. Ferry, M. Schuh, A. Parlakian, T. Mgrditchian, N. Valnaud, P. Joanne, G. Butler-
Browne, O. Agbulut, D. Metzger, Myofiber androgen receptor promotes maximal
mechanical overload-induced muscle hypertrophy and fiber type transition in male
mice, Endocrinology 155 (2014) 4739–4748, https://doi.org/10.1210/en.2014-
1195.
[14] T. Tamaki, Y. Uchiyama, Y. Okada, K. Tono, M. Nitta, A. Hoshi, A. Akatsuka,
Anabolic-androgenic steroid does not enhance compensatory muscle hypertrophy
but significantly diminish muscle damages in the rat surgical ablation model,
Histochem. Cell Biol. 132 (2009) 71–81, https://doi.org/10.1007/s00418-009-
0584-2.
[15] L.R. Rodino-Klapac, A.M. Haidet, J. Kota, C. Handy, B.K. Kaspar, J.R. Mendell,
Inhibition of myostatin with emphasis on follistatin as a therapy for muscle disease,
Muscle Nerve 39 (2009) 283–296, https://doi.org/10.1002/mus.21244.
[16] H.D. Kollias, J.C. Mcdermott, Transforming growth factor-B and myostatin sig-
naling in skeletal muscle, J. Appl. Physiol. 104 (2008) 579–587, https://doi.org/10.
1152/japplphysiol.01091.2007.
[17] M.A. Febbraio, B.K. Pedersen, Muscle-derived interleukin-6: mechanisms for acti-
vation and possible biological roles, FASEB J. 16 (2002) 1335–1347, https://doi.
org/10.1096/fj.01-0876rev.
[18] M. Buckingham, P.W.J. Rigby, Gene regulatory networks and transcriptional me-
chanisms that control myogenesis, Dev. Cell 28 (2014) 225–238, https://doi.org/
10.1016/j.devcel.2013.12.020.
[19] L.S. Perry, Robert, M.A. Rudnicki, Molecular mechanisms regulating myogenic
determination and differentiation, Front. Biosci. 5 (2000) d750–767, https://doi.
org/10.2741/Perry.
[20] S. Schiaffino, C. Mammucari, Regulation of skeletal muscle growth by the IGF1-
Akt/PKB pathway: insights from genetic models, Skelet. Muscle 1 (2011) 1–14,
https://doi.org/10.1186/2044-5040-1-4.
[21] S.B.P. Chargé, M.A. Rudnicki, Cellular and molecular regulation of muscle re-
generation, Physiol. Rev. 84 (2004) 209–238, https://doi.org/10.1152/physrev.
00019.2003.
[22] M.S. Bahrke, C.E. Yesalis, Abuse of anabolic androgenic steroids and related sub-
stances in sport and exercise, Curr. Opin. Pharmacol. 4 (2004) 614–620, https://
doi.org/10.1016/j.coph.2004.05.006.
[23] W. Pitsch, “The science of doping” revisited: fallacies of the current anti-doping
regime, Eur. J. Sport Sci. 9 (2009) 87–95, https://doi.org/10.1080/
17461390802702309.
[24] S. Mosler, C. Pankratz, A. Seyfried, M. Piechotta, P. Diel, The anabolic steroid
methandienone targets the hypothalamic-pituitary- testicular axis and myostatin
signaling in a rat training model, Arch. Toxicol. 86 (2012) 109–119, https://doi.
org/10.1007/s00204-011-0740-z.
[25] A.F. Aguiar, I.J. Vechetti-Júnior, R.W. Alves De Souza, E.P. Castan, R.C. Milanezi-
Aguiar, C.R. Padovani, R.F. Carvalho, M.D.P. Silva, Myogenin, MyoD and IGF-I
regulate muscle mass but not fiber-type conversion during resistance training in
rats, Int. J. Sports Med. 34 (2013) 293–301, https://doi.org/10.1055/s-0032-
52
Journal of Steroid Biochemistry and Molecular Biology 190 (2019) 44–53
1321895.
[26] T. Tamaki, S. Uchiyama, S. Nakano, A weight-lifting exercise model for inducing
hypertrophy in the hindlimb muscles of rats, Med. Sci. Sport. Exerc. 24 (1992)
881–886, https://doi.org/10.1249/00005768-199208000-00009.
[27] N. Zoth, C. Weigt, S. Zengin, O. Selder, N. Selke, M. Kalicinski, M. Piechotta, P. Diel,
Metabolic effects of estrogen substitution in combination with targeted exercise
training on the therapy of obesity in ovariectomized Wistar rats, J. Steroid Biochem.
Mol. Biol. 130 (2012) 64–72, https://doi.org/10.1016/j.jsbmb.2012.01.004.
[28] A.L. Goldberg, J.D. Etlinger, D.F. Goldspink, C. Jablecki, Mechanism of work-in-
duced hypertrophy of skeletal muscle, Med. Sci. Sports 7 (1975) 185–198, https://
doi.org/10.1249/00005768-197500740-00003.
[29] B.J. Schoenfeld, Potential mechanisms for a role of metabolic stress in hypertrophic
adaptations to resistance training, Sport. Med. 43 (2013) 179–194, https://doi.org/
10.1007/s40279-013-0017-1.
[30] S.C. Kandarian, J.C. Young, E.E. Gomez, Adaptation in synergistic muscles to Soleus
and plantaris muscle removal in the rat hindlimb, Life Sci. 51 (1992) 1691–1698,
https://doi.org/10.15680/IJIRSET.2016.0509175.
[31] A.T. Kicman, Pharmacology of anabolic steroids, Br. J. Pharmacol. 154 (2008)
502–521, https://doi.org/10.1038/bjp.2008.165.
[32] R.C. Hickson, W.W. Heusner, W.D. Van Huss, D.E. Jackson, D.A. Anderson,
D.A. Jones, A.T. Psaledas, Effects of dianabol and high-intensity sprint training on
body composition of rats, Med. Sci. Sports Exerc. 8 (1976) 191–195, https://doi.
org/10.1249/00005768-197600830-00011.
[33] D. Bitran, R.J. Hilvers, C.A. Frye, M.S. Erskine, Chronic anaboblic-androgenic
steroid treatment affects brain GABAa receptor-gated chloride ion transport, Life
Sci. 58 (1996) 573–583, https://doi.org/10.1016/0024-3205(95)02326-7.
[34] J. Hengevoss, M. Piechotta, D. Müller, F. Hanft, M.K. Parr, W. Schänzer, P. Diel,
Combined effects of androgen anabolic steroids and physical activity on the hy-
pothalamic-pituitary-gonadal axis, J. Steroid Biochem. Mol. Biol. 150 (2015)
86–96, https://doi.org/10.1016/j.jsbmb.2015.03.003.
[35] R. Gragera, A. Saborido, F. Molano, L. Jimenez, E. Muniz, A. Megias, Ultrastructural
changes induced by anabolic steroids in liver of trained rats, Histol. Histopathol. 8
(1993) 449–455.
[36] F. de A.C. Seara, R.A.Q. Barbosa, D.F. de Oliveira, D.L.S. Gran da Silva,
A.B. Carvalho, A.C. Freitas Ferreira, J.H. Matheus Nascimento, E.L. Olivares,
Administration of anabolic steroid during adolescence induces long-term cardiac
hypertrophy and increases susceptibility to ischemia/reperfusion injury in adult
Wistar rats, J. Steroid Biochem. Mol. Biol. 171 (2017) 34–42, https://doi.org/10.
1016/j.jsbmb.2017.01.012.
[37] A. Zebrowska, E. Sadowska-Krepa, S. Jagsz, B. Klapcinska, J. Langforst, Cardiac
hypertrophy and IGF-1 response to testosterone propionate treatment in trained
male rats, Open Life Sci. 12 (2017) 120–127, https://doi.org/10.1515/biol-2017-
0014.
[38] V. Simões Tanasov, W. Krause Neto, L. Gonçalves, L. Beatriz Mesiano Maifrino,
R. Rodrigues de Sousa, E. Florencio Gama, Use of anabolic steroid altered the liver
morphology of rats, Int. J. Morphol. 32 (2014) 756–760, https://doi.org/10.4067/
S0717-95022014000300002.
[39] M. Niedfeldt, Anabolic steroid effect on the liver, Curr Sport Med Rep. 17 (2018)
97–102, https://doi.org/10.1249/JSR.0000000000000467.
[40] E.A. Marques, J. Mota, J. Carvalho, Exercise effects on bone mineral density in older
adults: a meta-analysis of randomized controlled trials, Age (Omaha). 34 (2012)
1493–1515, https://doi.org/10.1007/s11357-011-9311-8.
[41] M.M. Chen, J.K. Yeh, J.F. Aloia, J.M. Tierney, S. Sprintz, Effect of treadmill exercise
on tibial cortical bone in aged female rats: a histomorphometry and dual energy X-
ray absorptiometry study, Bone 15 (1994) 313–319, https://doi.org/10.1016/
8756-3282(94)90294-1.
[42] J. Chahal, R. Lee, J. Luo, Loading dose of physical activity is related to muscle
strength and bone density in middle-aged women, Bone 67 (2014) 41–45, https://
doi.org/10.1016/j.bone.2014.06.029.
[43] J.K. Yeh, J.F. Aloia, J.M. Tierney, S. Sprintz, Effect of treadmill exercise on vertebral
and tibial bone mineral content and bone mineral density in the aged adult rat:
determined by dual energy X-Ray absorptiometry, Calcif. Tissue Int. 52 (1993)
234–238, https://doi.org/10.1007/bf00298725.
[44] O. Rönning, E. Mäkinen, K. Lahtinen, E. Raijola, Effect of nandrolone phenylpro-
pionate on the bone of young rats, Endocrinology. 75 (1964) 477–482, https://doi.
org/10.1210/endo-75-4-477.
[45] K.B. Wiancko, K.E. Kowalewski, Strength of callus in fractured humerus of rat
treated with anti-anabolic and anabolic compounds, Acta Endocrinol. (Copenh). 36
(1961) 310–318, https://doi.org/10.1530/acta.0.0360310.
[46] A. Clerico, M. Ferdeghini, C. Palombo, R. Leoncini, M.G. Del Chicca, G. Sardano,
G. Mariani, Effect of anabolic treatment on the serum levels of gonadotropins,
testosterone, prolactin, thyroid hormones and myoglobin of male athletes under
physical training, J. Nucl. Med. Allied Sci. 25 (1981) 79–88.
[47] M. Alén, M. Reinlä, R. Vihko, Response of serum hormones to androgen adminis-
tration in power athletes, Med. Sci. Sports Exerc. 17 (1985), https://doi.org/10.
1249/00005768-198506000-00009.
[48] J. Torres-Calleja, M. González-Unzaga, R. DeCelis-Carrillo, L. Calzada-Sánchez,
N. Pedrón, Effect of androgenic anabolic steroids on sperm quality and serum
hormone levels in adult male bodybuilders, Life Sci. 68 (2001) 1769–1774, https://
doi.org/10.1016/S0024-3205(01)00972-9.
[49] S.T. Soukup, D.R. Müller, A. Kurrat, P. Diel, S.E. Kulling, Influence of testosterone
on phase II metabolism and availability of soy isoflavones in male Wistar rats, Arch.
Toxicol. 91 (2017) 1649–1661, https://doi.org/10.1007/s00204-016-1853-1.
[50] V.J. Dalbo, M.D. Roberts, C.B. Mobley, C. Ballmann, W.C. Kephart, C.D. Fox,
V.A. Santucci, C.F. Conover, L.A. Beggs, A. Balaez, F.J. Hoerr, J.F. Yarrow,
S.E. Borst, D.T. Beck, Testosterone and trenbolone enanthate increase mature
S.M. Reitzner, et al.
myostatin protein expression despite increasing skeletal muscle hypertrophy and
satellite cell number in rodent muscle, Andrologia 49 (2017) 1–11, https://doi.org/
10.1111/and.12622.
[51] Z. Soffe, H.G. Radley-Crabb, C. Mcmahon, M.D. Grounds, T. Shavlakadze, Effects of
loaded voluntary wheel exercise on performance and muscle hypertrophy in young
and old male C57B1/6J mice, Scand. J. Med. Sci. Sport 26 (2016) 172–188, https://
doi.org/10.1111/sms.12416.
[52] K. Kobayashi, R. Ogasawara, A. Tsutaki, K. Lee, E. Ochi, K. Nakazato, Genetic strain-
dependent protein metabolism and muscle hypertrophy under chronic isometric
training in rat gastrocnemius muscle, Physiol. Res. 61 (2012) 527–535.
[53] K. Fontana, G.E.R. Campos, R.S. Staron, M.A. da Cruz-Höfling, Effects of anabolic
steroids and high-intensity aerobic exercise on skeletal muscle of transgenic mice,
PLoS One 8 (2013) 1–8, https://doi.org/10.1371/journal.pone.0080909.
[54] I. Coll-Risco, V.A. Aparicio, E. Nebot, D. Camiletti-moirón, R. Martínez,
G. Kapravelou, M. López-jurado, M. Jesús, P. Aranda, V.A. Aparicio, E. Nebot,
D. Camiletti-moirón, R. Martínez, G. Kapravelou, M. López-jurado, J.M. Porres,
P. Aranda, Effects of interval aerobic training combined with strength exercise on
body composition, glycaemic and lipid profile and aerobic capacity of obese rats, J.
Sports Sci. 34 (2016) 1452–1460, https://doi.org/10.1080/02640414.2015.
1119296.
[55] K.S.C. Gollisch, J. Brandauer, N. Jessen, T. Toyoda, A. Nayer, M.F. Hirshman,
L.J. Goodyear, Effects of exercise training on subcutaneous and visceral adipose
tissue in normal- and high-fat diet-fed rats, Am. J. Physiol. Endocrinol. Metab. 297
(2009) 495–504, https://doi.org/10.1152/ajpendo.90424.2008.
[56] C. McFarlane, A. Hennebry, M. Thomas, E. Plummer, N. Ling, M. Sharma,
R. Kambadur, Myostatin signals through Pax7 to regulate satellite cell self-renewal,
Exp. Cell Res. 314 (2008) 317–329, https://doi.org/10.1016/j.yexcr.2007.09.012.
[57] W.E. Taylor, S. Bhasin, J. Artaza, F. Byhower, D.H. Willard, F.C. Kull, N. Gonzalez-
cadavid, A.J. Physiol, R. Integr, C. Physiol, S. Lokireddy, V. Mouly, G. Butler-
browne, P.D. Gluckman, R. Kambadur, C. Mcfarlane, E.R. Price, U. Bauchinger,
D.M. Zajac, D.J. Cerasale, J.T. Mcfarlan, R. Gerson, S.R. Mcwilliams,
C.G. Guglielmo, L.A. Garcia, K.K. King, M.G. Ferrini, K.C. Norris, J.N. Artaza,
M. Azam, E. Wayne, Myostatin inhibits cell proliferation and protein synthesis in C2
C12 muscle cells, Am. J. Physiol. Endocrinol. Metab. 280 (2001) 221–228, https://
doi.org/10.1152/ajpendo.2001.280.2.e221.
[58] X. Zhu, S. Topouzis, L.F. Liang, R.L. Stotish, Myostatin signaling through Smad2,
Smad3 and Smad4 is regulated by the inhibitory Smad7 by a negative feedback
mechanism, Cytokine 26 (2004) 262–272, https://doi.org/10.1016/j.cyto.2004.03.
007.
[59] C.A. Dinarello, Proinflammatory cytokines, Chest 118 (2000) 503–508, https://doi.
org/10.1378/chest.118.2.503.
[60] S.M. Opal, V.A. DePalo, Anti-inflammatory cytokines, Chest 117 (2000)
1162–1172, https://doi.org/10.1378/chest.117.4.1162.
[61] A. Steensberg, M.A. Febbraio, T. Osada, P. Schjerling, G. Van Hall, B. Saltin,
B.K. Pedersen, Interleukin-6 production in contracting human skeletal muscle is
influenced by pre-exercise muscle glycogen content, J. Physiol. 537 (2001)
633–639, https://doi.org/10.1111/j.1469-7793.2001.00633.x.
[62] J.M.L. Stouthard, R.P.J. Oude Elferink, H.P. Sauerwein, Interleukin-6 enhances
glucose transport in 3T3-L1 adipocytes, Biochem. Biophys. Res. Commun. 220
(1996) 241–245, https://doi.org/10.1006/bbrc.1996.0389.
53
Journal of Steroid Biochemistry and Molecular Biology 190 (2019) 44–53
[63] S.I. Ikeda, Y. Tamura, S. Kakehi, H. Sanada, R. Kawamori, H. Watada, Exercise-
induced increase in IL-6 level enhances GLUT4 expression and insulin sensitivity in
mouse skeletal muscle, Biochem. Biophys. Res. Commun. 473 (2016) 947–952,
https://doi.org/10.1016/j.bbrc.2016.03.159.
[64] J.M. Youd, S. Rattigan, M.G. Clark, Acute impairment of insulin-mediated capillary
recruitment and glucose uptake rat skeletal muscle vivo by TNF-α, Diabetes 49
(2000) 1904–1909, https://doi.org/10.2337/diabetes.49.11.1904.
[65] G.S. Hotamisligil, The role of TNFalpha and TNF receptors in obesity and insulin
resistance, J. Intern. Med. 245 (1999) 621–625, https://doi.org/10.1046/j.1365-
2796.1999.00490.x.
[66] T.S. Kostic, N.J. Stojkov, M.M. Bjelic, A.I. Mihajlovic, M.M. Janjic, S.A. Andric,
Pharmacological doses of testosterone upregulated androgen receptor and 3-beta-
hydroxysteroid dehydrogenase/delta-5-delta-4 isomerase and impaired leydig cells
steroidogenesis in adult rats, Toxicol. Sci. 121 (2011) 397–407, https://doi.org/10.
1093/toxsci/kfr063.
[67] M. Lin, J. Rajfer, R.S. Swerdloff, N.F. González-Cadavid, Testosterone down-reg-
ulates the levels of androgen receptor mRNA in smooth muscle cells from the rat
corpora cavernosa via Aromatization to estrogens, J. Steroid Biochem. Mol. Biol. 45
(1993) 333–343, https://doi.org/10.1016/0960-0760(93)90002-e.
[68] V.E. Quarmby, W.G. Yarbrough, D.B. Lubahn, F.S. French, E.M. Wilson, Autologous
down-regulation of androgen receptor messenger ribonucleic acid, Mol. Endocrinol.
4 (1990) 22–28, https://doi.org/10.1210/mend-4-1-22.
[69] H.J. Kim, W.J. Lee, Insulin-like growth factor-I induces androgen receptor activa-
tion in differentiating C2C12 skeletal muscle cells, Mol. Cells 28 (2009) 189–194,
https://doi.org/10.1007/s10059-009-0118-8.
[70] W.J. Lee, Insulin-like growth factor-I-induced androgen receptor activation is
mediated by the PI3K/Akt pathway in C2C12 skeletal muscle cells, Mol. Cells 28
(2009) 495–499, https://doi.org/10.1007/s10059-009-0142-8.
[71] X.H. Liu, R. De Gasperi, W.A. Bauman, C.P. Cardozo, Nandrolone-induced nuclear
accumulation of MyoD protein is mediated by Numb, a Notch inhibitor, in C2C12
myoblasts, Physiol. Rep. 6 (2018) 1–8, https://doi.org/10.14814/phy2.13520.
[72] G.S. Lynch, J.D. Schertzer, J.G. Ryall, Anabolic agents for improving muscle re-
generation and function after injury, Clin. Exp. Pharmacol. Physiol. (2008)
852–858, https://doi.org/10.1111/j.1440-1681.2008.04955.x.
[73] S. Sartore, L. Gorza, S. Schiaffino, Fetal myosin heavy chains in regenerating
muscle, Nature 298 (1982) 294–296, https://doi.org/10.1038/298294a0.
[74] A. Matsakas, A. Friedel, T. Hertrampf, P. Diel, Short-term endurance training results
in a muscle-specific decrease of myostatin mRNA content in the rat, Acta Physiol.
Scand. 183 (2005) 299–307, https://doi.org/10.1111/j.1365-201X.2005.01406.x.
[75] M. Velders, B. Schleipen, K.H. Fritzemeier, O. Zierau, P. Diel, Selective estrogen
receptor-beta activation stimulates skeletal muscle growth and regeneration, FASEB
J. 26 (2012) 1909–1920, https://doi.org/10.1096/fj.11-194779.
[76] C. Weigt, T. Hertrampf, N. Zoth, K.H. Fritzemeier, P. Diel, Impact of estradiol, ER
subtype specific agonists and genistein on energy homeostasis in a rat model of
nutrition induced obesity, Mol. Cell. Endocrinol. 351 (2012) 227–238, https://doi.
org/10.1016/j.mce.2011.12.013.
[77] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-
time quantitative PCR and the 2-ΔΔCT method, Methods 25 (2001) 402–408,
https://doi.org/10.1006/meth.2001.1262.