| |

Received: 20 November 2018    Revised: 15 May 2019    Accepted: 31 May 2019

DOI: 10.1111/jocd.13055

ORIGINAL CONTRIBUTION

Interaction between low‐level laser therapy and Guarana

(Paullinia cupana) extract induces antioxidant, anti‐
inflammatory, and anti‐apoptotic effects and promotes
proliferation in dermal fibroblasts

Daíse Raquel Maldaner1,2 | Neida Luiza Pellenz1 | Fernanda Barbisan3,4  |

Verônica Farina Azzolin3,4 | Moisés Henrique Mastella1 | Cibele Ferreira Teixeira1 |
Thiago Duarte1 | Ednea A. Maia‐Ribeiro5 | Ivana Beatrice Mânica da Cruz1,3,4 |
Marta Maria Medeiros Frescura Duarte1,2

1
Postgraduate Program of
Pharmacology, Federal University of Santa Abstract
Maria, Santa Maria, Rio Grande do Sul, Brazil Background: Low‐level laser therapy (LLLT) has several clinical applications; however,
2
Lutheran University of Brazil, Santa Maria,
its benefits are not universal. Therefore, combination therapy with LLLT and extracts
Rio Grande do Sul, Brazil
3
Postgraduate Program of
from the guarana (Paullinia cupana) plant may improve its effectiveness as guarana
Gerontology, Federal University of Santa extracts exhibit anti‐aging properties.
Maria, Santa Maria, Rio Grande do Sul, Brazil
4
Objectives: To evaluate the antioxidant, anti‐inflammatory, anti‐apoptotic, and pro‐
Biogenomic Laboratory, Federal University
of Santa Maria, Santa Maria, Rio Grande do liferative effects of combined LLLT and guarana extract therapy on human dermal
Sul, Brazil fibroblasts.
5
University of the State of Amazonas/
Methods: Human dermal fibroblasts (HFF‐1) were cultured and initially exposed to
Open University of the Third Age, Manaus,
Amazonas, Brazil several concentrations (1, 3, 5, 10, 30 µg/mL) of guarana extract. The experimental
concentration of guarana extract was selected by analyzing cytokine levels, DNA
Correspondence
Fernanda Barbisan, Biogenomic Laboratory, oxidation, and apoptotic markers in LLLT‐exposed (4 J/cm2) and LLLT‐unexposed fi‐
Federal University of Santa Maria, Santa
broblast cultures. After 72 hours, the cells were analyzed using spectrophotometric,
Maria, Rio Grande do Sul, Brazil.
Email: fernandabarbisan@gmail.com fluorimetric, immunological, and gene expression (qRT‐PCR) assays. Flow cytometry
was used to evaluate the effect of each treatment on cell cycle.
Funding information
Conselho Nacional de Desenvolvimento Results: Fibroblasts treated with guarana (5 µg/mL) exhibited anti‐inflammatory and
Científico e Tecnológico
anti‐apoptotic properties been used in complementary protocols. Combined guarana
and LLLT treatment significantly decreased protein carbonylation, lipoperoxidation,
and DNA oxidation, downregulated the mRNA and protein expression of pro‐inflam‐
matory molecules, and upregulated IL‐10 gene and protein expression. Guarana plus
LLLT also decreased the levels of caspases 1, 3, and 8, increased the percentage of
S‐phase cells, and decreased FGF‐1 and KGF‐1 levels. Some of these changes were
also observed after treatment with guarana or LLLT alone.
Conclusions: Our results suggest that concomitant treatment with guarana and LLLT
may promote fibroblast biostimulation and thus is clinically relevant.

Maldaner and Pellenz have contributed equally to produce the present study.

J Cosmet Dermatol. 2019;00:1–9. © 2019 Wiley Periodicals, Inc. |  1

wileyonlinelibrary.com/journal/jocd  
 |
2       MALDANER et al.
KEYWORDS
aging, Amazonian fruit, fibroblast, laser, skin
1 |  I NTRO D U C TI O N
Multiple skin conditions are treated with nonpharmacological proce‐
dures, such as low‐level laser therapy (LLLT). LLLT uses nonthermal
lasers to excite endogenous chromophores, resulting in photophysi‐
cal and photochemical biological events.1
Clinical applications of LLLT involve wound healing, tissue repair,
the prevention of tissue death, treatment of chronic joint disorders
and inflammation, edema relief, analgesia, and the treatment of neu‐
rological disorders.1 On the skin, LLLT has beneficial effects on wrin‐
kles, acne scars, and hypertrophic scars. It enhances the healing of
burns and reduces UV damage, an effect observed both as treatment
post‐UV exposure, and as a prophylactic measure. Dermatological
studies have also described that in pigmentary disorders such as vit‐
iligo; LLLT can improve pigmentation by stimulating melanocyte pro‐
liferation and reduce depigmentation by inhibiting autoimmunity. 2
As LLLT is also used as a skin biostimulator, some authors believe
that this procedure may also decelerate fibroblast aging.3 A recent
in vitro study by Maldaner et al,4 in fibroblasts treated with reactive
oxygen species (ROS), LLLT exhibited protective and proliferative
properties, by partially or totally reverting the negative effects trig‐
gered by H2O2 exposure.
Therefore, the effect of LLLT on fibroblast may be potential‐
ized by the interaction with antioxidant compounds and extracts.
Guarana (Paullinia cupana) has a chemical matrix rich in caffeine‐cat‐
echin molecules. Traditionally, persons from Amazonian indigenous
communities have consumed the toasted seeds of guarana as an en‐
ergetic beverage, since pre‐Colombian times.5
Previous in vitro studies suggest that guarana may modulate dif‐
ferent inflammatory states and anti‐aging processes. An investiga‐
tion performed by Krewer et al6 evaluated the effects of guarana
on the modulation of cytokines using a translational study involv‐
ing in vitro and in vivo models. In vitro analysis of peripheral blood
mononuclear cells (PBMCs) showed that guarana exerted similar
anti‐inflammatory effects as resveratrol, decreasing interleukin‐1β
(IL‐1β), IL‐6, and, interferon‐gamma (IFN‐γ) levels, and increasing
IL‐10 levels compared with those of the control group. Results from
a randomized, placebo‐controlled study that included 14 healthy
volunteers treated with guarana powder for 14  days confirmed its
anti‐inflammatory effect. A complementary study by Machado et al7
investigated the effects of guarana on senescent adipocyte‐mesen‐
chymal cells (ASCs) obtained from cells of human lipoaspirates. In
these cells, guarana was able to increase cellular proliferation and
decrease several oxidative stress indicators, reverting the initial se‐
nescence processes in ASCs.
Therefore, we tested the potential in vitro effect of combined
LLLT and guarana extract treatment on the modulation of cellular
oxidation, inflammation, and apoptosis in dermal fibroblasts.
2 | M E TH O DS
2.1 | Cell culture conditions and general
experimental design
The in vitro experiments were performed using HFF‐1 human dermal
fibroblasts (ATCC® SCRC‐1041™), a commercially available cell line
produced by the American Type Culture Collection (ATCC‐USA), and
obtained from the Rio de Janeiro Cell Bank. The cell line was main‐
tained in the growth medium DMEM supplemented with 15% fetal
bovine serum (FBS), antibiotics (1% penicillin/streptomycin), and an
antifungal (1% amphotericin B), at a temperature of 37℃, 5% CO2,
and 95% humidity.
Initially, the effects of guarana were analyzed using fibroblasts
(1  ×  105 fibroblasts) cultured in 96‐well plates. Inflammation and
apoptosis were evaluated at different concentrations of guarana (1,
3, 5, 10, and 30 µg/mL) and cultured for 72 hours. A guarana curve
concentration was generated based on previous studies performed
by Krewer et al6 and Cadoná et al8 The levels of the following pro‐in‐
flammatory cytokines were measured in culture supernatants: IL‐1β,
IL‐6, and tumor necrosis factor alpha (TNF‐α). The levels of IL‐10,
an anti‐inflammatory cytokine, were also quantified in cell cultures.
DNA oxidation was measured through the quantification of 8‐hy‐
droxy‐2'‐deoxyguanosine (8‐OHdG) levels. Apoptotic induction was
evaluated by quantification of caspases 1, 3, and 8 levels.
The lowest concentration of guarana that concomitantly re‐
sulted in anti‐inflammatory effects, and did not induce oxidation to
DNA and caspase induction, was selected to perform subsequent
experiments to evaluate the interaction between guarana and LLLT
on dermal fibroblasts. In a parallel experiment, fibroblasts cultured
for 7 hours were analyzed for the following: (a) markers of oxida‐
tive metabolism: ROS, protein carbonylation, lipoperoxidation, and
DNA oxidation determined by 8‐OHdG levels; (b) markers of inflam‐
mation: cytokines (IL‐1β, IL‐6, TNF‐α, and IL‐10) protein and gene
modulation (evaluated after 24  hours); (c) markers of apoptosis:
caspases (1, 3, and 8) protein and gene modulation; and (d) changes
in cell proliferation: cell cycle analysis evaluated by flow cytometry
and by quantification of two cell signaling growth factors: fibroblast
growth factor (FGF‐1) and keratinocyte growth factor (KGF‐1).
2.2 | Guarana extract preparation and chemical
characterization
This study is part of a project previously authorized by the Brazilian
Environmental Ministry to assess the components of genetic pat‐
rimony in the national territory (no.010547/2013‐4) according to
Brazilian legislation (no. 2186‐16). The guarana extract used in all ex‐
periments was produced using raw guarana powder obtained from
MALDANER et al.
EMBRAPA Western Amazon Co, a nonprofit governmental organiza‐
tion located in Maués, Amazon, Brazil.
The guarana powder was used to produce a hydroalcoholic ex‐
tract as described by Bittencourt et al9 Briefly, the extract was pro‐
duced using a 70:30 alcohol to water ratio, in 100 mL of extraction
fluid prepared at a concentration of 300 mg/mL. After 24 hours of
extraction, the solution was centrifuged at 1408 g for 10 minutes,
and the supernatant was isolated and filtered through Whatman No.
1 paper. Ethanol was removed from the extract using a rotary evap‐
orator at reduced pressure, 25°C at 115  rpm, and the extract was
lyophilized by freeze‐drying (Enterprise II LT 1000; Terroni).
Bioactive molecules were measured by chromatographic analysis
and detected at a UV absorbance of 272 nm on an HPLC system con‐
sisting of a Shimadzu Prominence LC‐20 A, LC‐20AT quaternary pump,
SIL 20 auto sampler A, DGU‐20A5 on‐line degasser, CBM‐20 A integra‐
tor, and SPD‐20 V DAD detector following the protocol of Andrews et
10
al A 150 mm 4.6 mm i.d. ODS‐3 column (Phenomenex Prodigy ODS‐3
100 A, 5‐lm particle size) was used for the separation. Working stan‐
dards were prepared using serial dilutions of the stock solution (mL) in
mobile phase. The least concentrated standard had a limit of detection
of 0.005% based on a 1 g sample diluted in 100 mL (LOD = 0.05 mg/g).
The HPLC conditions were as follows: flow rate, 1  mL/min; mobile
phase A, 0.1% H3PO4 in water; and mobile phase B, 100% acetonitrile.
The chromatographic system was calibrated with at least a five points
9,11
standard curve for each set of samples analyzed. Standards were
generated after every fourth sample and were reproducible with an R
value for the calibration curve or 0.9999 or greater. The main bioactive
compounds of guarana were determined to be caffeine = 12.40 mg/g,
theobromine = 6.433 mg/g, and total catechins = 4.128 mg/g.
For in vitro experiments, the lyophilized extract of guarana was di‐
luted in distilled water at a concentration of 200 mg/mL. The mixture
was boiled for 7 minutes, centrifuged (352 g, 15 minutes), and filtered.
The solution was sterilized by filtration (0.22 μm filter) before different
concentrations were used to supplement the culture medium.
2.3 | LLLT exposure conditions
Fibroblast cells were laser‐irradiated until 2  hours after cell to be
guarana exposed using an Endophoton LLT 0107 KLD® (Biosystems
Electronic Equipment Ltda—Brazilian Industry). Cells not exposed to
guarana were also irradiated as a laser control group. A laser 660 nm
was used as the irradiation source with 35  mW output power and
16 Hz frequency in punctual continuous wave mode. The delivered
2
dose was 4 J/cm with an exposure time of 14 seconds, as this dose
promotes anti‐aging as previously described by Maldaner et al4 The
irradiation process was achieved at room temperature (18‐25°C).
All treatments were conducted with a 35 mm distance between the
laser and area of irradiation.
2.4 | Inflammatory markers
The protein levels of cytokines secreted into cell culture super‐
natants were quantified. Protein expression of pro‐inflammatory
|
      3
cytokines (IL‐1β, IL‐6, TNF‐α) and IL‐10, an anti‐inflammatory cy‐
tokine produced by macrophages, were analyzed by ELISA using
Quantikine Human Kits (R&D Systems), according to the manufac‐
turer's instructions and following previously described methods by
Jung et al12 The sensitivity and range of detection for each cytokine
were as follows: IL‐1β (1  pg/mL, 3.1‐300  pg/mL); IL‐6 (0.7  pg/mL,
3.1‐300  pg/mL); TNF‐α (5.5  pg/mL, 15.6‐1000  pg/mL); and IL‐10
(3.9 pg/mL, 7.8‐500 pg/mL).
2.5 | Oxidative metabolism markers
Guarana is known to have antioxidant properties; therefore, markers
of oxidative metabolism were quantified in fibroblasts previously HP
exposed or unexposed. Nitric oxide (NO) and superoxide anion (SA)
production were spectrophotometrically analyzed by methods de‐
scribed by Choi et al13 and Morabito et al,14 respectively. Both assays
were analyzed at a wavelength of 550 nm. The level of ROS in the
supernatant of fibroblast cultures was quantified by dichlorofluores‐
cein acetate fluorimetric assay (DCFDA) and read at an excitation
of 488 nm and an emission of 525 nm.15 The levels of carbonylation
protein were determined by the Levine method with the absorbance
read at 370 nm,16 and lipoperoxidation was quantified by the forma‐
tion of thiobarbituric acid reactive substances (TBARS) and read at
532 nm.17
DNA oxidation was determined by 8‐OHdG levels and the pro‐
duction of antioxidant enzymes (superoxide dismutase [SOD], cata‐
lase [CAT], and glutathione peroxidase [GPX]) quantified using were
analyzed by ELISA using Quantikine Human Kits (R&D Systems),
according to the manufacturer's instructions according to the man‐
ufacturer's instructions, as previously described. The sensitivity
and range of detection of each marker were as follows: 8‐OHdG
(0.9‐57  pg/mL), SOD (0.1‐209  U/L), CAT (3.12‐200  U/L), and GPX
(15.6‐1000 U/L).
2.6 | Caspases and cytokines gene
expression analysis
Gene expression of apoptotic and inflammatory markers was deter‐
mined by quantitative reverse transcription PCR (qRT‐PCR) using a
Rotor‐Gene Q 5plex HRM System (QIAGEN Biotechnology). Total
RNA was extracted from each sample using TRIzol (Invitrogen Life
Technologies). Expression of most genes was quantified, as de‐
scribed previously by Barbisan et al18 For reverse transcription, RNA
was added to the samples and reversed transcribed under the fol‐
lowing conditions (1 for 30 seconds, and a melt curve of 60‐90°C,
with 0.5°C increments, for 5  seconds). For each sample, qRT‐PCR
was performed in triplicate after DNase treatment (Invitrogen Life
Technologies) for 5 minutes at 37°C and heated at 65°C for 10 min‐
utes. cDNA was synthesized using 1  µL iScript cDNA and 4  µL of
Mix iScript (Bio‐Rad Laboratories) under the following reaction con‐
ditions: 5°C for 10 minutes, 25°C for 5 minutes, 85°C for 5 minutes,
and 5°C for 60  minutes. The qRT‐PCR conditions were as follows:
95°C for 3 minutes, 40 cycles of 95°C for 10 seconds and 60°C for
 |
4       MALDANER et al.
30  seconds, and a melt curve of 60‐90°C, with 0.5°C increments,
for 5  seconds. For each sample, qRT‐PCR was performed in tripli‐
cate using 1  µM of each primer, 1000  ng/µL cDNA, RNase‐free
water, and 2× QuantiFast SYBR Green PCR Master Mix (QIAGEN
Biotechnology) in a 20‐µL reaction mixture. Beta‐actin (β‐actin) was
the housekeeping gene used to normalize the expression of all sam‐
ples tested. Relative expression was quantified using comparative
cytosine‐thymine (CT) and is expressed as a fold change compared
with that in control cells.
The specific primer pairs of cytokines and caspases and GenBank
number used were as follows: IL‐1β (Gene ID 3553) Forward
GCGGCATCCAGCTACGAAT and Reverse ACCGCATCTTCCTCAGCTT
GT; IL‐6 (Gene ID 3569) Forward TACCCCCAGGAGAAGATTCCA
and Reverse CCGTCGAGGATGTACCGAATT; TNF‐α (Gene ID 7124)
Forward AGTGACAAGCCTGTAGCCC and Reverse GCAATGATCCCA
AAGTAGACC; IL‐10 (Gene ID 3586) Forward GTGATGCCCC
AAGCTGAGA and Reverse TGCTCTTG TTTTCACAGGGAAGA; CASP‐1
(Gene ID 834) Forward CGCACACGTCTTGCTCTCAT and Reverse TACG
CTGTACCCCAGATTTTGTAG; CASP‐3 (Gene ID 863) ForwardTTTGAGC
CTGAGCAGAGACATG and Reverse TACCAGTGCGTATGGAGAAAT
GG; and CASP‐8 (Gene ID 841) Forward AAGGAGCTGCTCTTCCGAATT
and Reverse CCCTGCCTGGTGTCTGAAGT.
2.7 | Cellular proliferation analysis
The effect of guarana on cellular proliferation was evaluated by
quantifying the cells in different phases of the cell cycle (G0/G1,
S, and G2/mitosis phases) by flow cytometry using a previously
described protocol by Azzolin et al19 Briefly, treated samples were
incubated with 500 μL of a propidium iodide (PI) PBS solution and
incubated for 40 minutes at 37°C, as PI is able to intercalate into the
base pairs of DNA to determine different cell cycle phases. After
an incubation period, the cells were trypsinized, washed with PBS,
resuspended in 70% ethanol, and stored at −20°C overnight. The
cells were centrifuged and washed once with PBS and resuspended
in 500 μL PI solution. This procedure was repeated washing the cells
with 1  mL PBS. Finally, cells were centrifuged and resuspended in
500 μL PBS for flow cytometry analysis.
In addition to the analysis of the cell cycle, two important growth
factors were quantified. Fibroblast growth factor (FGF‐1) strongly
stimulates fibroblast and keratinocytes proliferation, 20 and kerati‐
nocyte growth factor (KGF‐1), also known as FGF‐7, has broad mi‐
togenic and cell survival properties. 21 Quantification of these two
markers was performed by immunoassay using Human FGF1 ELISA
Kit and Human KGF ELISA Kit (Abcam Company).
The sensitivity and range of detection of FGF‐1 and KGF‐1 were
0.78‐50 ng/mL and 25‐1600 ng/mL, respectively.
2.8 | Statistical analysis
Data were analyzed using GraphPad Prism software, version 7.0
(2017). The data were obtained from independent triplicate treat‐
ments, with five repetitions of each test. All data were transformed
into percentages relative to the negative control group and pre‐
sented as media  ±  standard deviation (SD) to perform statistical
comparisons. The upper and lower values of 2‐SD range were con‐
sidered outliers and excluded from the analysis, because generally
these outliers generate relative SD >10% suggesting experimental
imprecision. This previous data normalization is a procedure broadly
used for in vitro analysis allowing comparisons of data obtained from
experiments performed on different days as preconized in OECD
guidance document on Good In Vitro Methods Practices.22 The
effect of guarana at different concentrations on cells was statisti‐
cally compared by one‐way analysis of variance (ANOVA), followed
by Tukey's post hoc test, whereas the interaction between guarana
and LLLT was compared by two‐way ANOVA followed by post hoc
Bonferroni test. Results with a P ≤ 0.05 are considered statistically
significant.
3 | R E S U LT S
The effect of guarana on fibroblasts was first analyzed to determine
the test concentration of guarana that has an effect on inflamma‐
tion and oxidation after 72  hours in culture. Guarana at a 5  µg/
mL concentration did not induce the production of pro‐inflamma‐
tory cytokines and significantly increased IL‐10 levels (Figure 1A‐B).
However, the higher concentrations of guarana induced a pro‐in‐
flammatory response in fibroblast cells. Moreover, fibroblasts ex‐
posed to guarana (5  µg/mL) did not elevate the caspases or DNA
oxidation relative to control groups (Figure 1C‐D).
The effect of guarana at a concentration of 5 µg/mL was subse‐
quently used to analyze the inflammation and apoptosis induced in
response to combined treatment with guarana and LLLT.
Changes in the markers of oxidation in response to guarana treat‐
ment plus LLLT exposure were analyzed in fibroblasts (Figure 2A‐E).
Guarana supplementation significantly decreased ROS, lipoperoxida‐
tion, and DNA oxidation relative to control cells. However, guarana
induced a slight but significant increase in protein carbonylation com‐
pared with that in the control group. On the contrary, LLLT exposure
alone induced a significant increase in ROS, protein carbonylation, and
lipoperoxidation levels, and lowered DNA oxidation. The combination
of guarana treatment and LLLT exposure reduced protein carbonyla‐
tion, lipoperoxidation, and DNA oxidation levels. However, ROS levels
did not reduce in the presence of guarana plus LLLT exposure.
Antioxidant enzymes were also compared among treatments
(Figure 2E). The total levels of SOD increased significantly when fi‐
broblasts were exposed to all treatments. CAT levels increased sig‐
nificantly when cells were exposed to guarana only and with guarana
plus LLLT. GPX enzyme increased significantly in cells treated with
guarana only, and in LLLT‐only treated cells, however, the GPX was
lower with LLLT treatment than with guarana treatment. Guarana
plus LLLT also resulted in an increase in GPX relative to levels de‐
tected in control groups.
The effect of combined guarana plus LLLT therapy on the pro‐
tein and gene expression of cytokines was analyzed (Figure 3A).
MALDANER et al. |
      5

F I G U R E 1   Effect of different concentrations of guarana on fibroblast after 72 hours, on inflammatory (A), anti‐inflammatory (B),
apoptotic (C), and markers of DNA oxidation (D). Data were analyzed using one‐way analysis of variance (ANOVA), followed by the Tukey
post hoc test. The different letters (A, B, C, and D) represent statistical differences between treatment groups at P < 0.05

Pro‐inflammatory cytokine production decreased in response to all
treatments, with a concomitant downregulation of their gene ex‐
pression. However, IL‐1β production was significantly accentuated
in fibroblasts exposed to LLLT alone. All other treatments increased
IL‐10 protein levels triggering an overexpression of the gene. IL‐10
gene modulation was higher in fibroblasts treated with LLLT alone,
and guarana plus LLLT, relative to guarana‐only treated cells.
Caspases gens and protein levels in fibroblasts were differentially
expressed in response to guarana and LLLT exposure (Figure 3B).
In general, all treatments significantly decreased CASP 1, CASP 3,
and CASP 8 protein. CASP 1 gene was downregulated by LLLT and
guarana plus LLLT treatment. The CASP 3 gene was downregulated
by all treatments, whereas CASP 8 was downregulated by guarana
alone, and in guarana plus LLLT‐exposed fibroblasts.
The effect of guarana plus LLLT on fibroblast proliferation after
72 hours was evaluated by cell cycle analysis using flow cytometry. In
addition, the FGF‐1 and KGF‐1 cellular signaling growth factors were
analyzed (Figure 4). From Figure 4A and 4B, guarana treatment signifi‐
cantly decreased the number of cells in the S phase compared with
that of the control group. However, the inverse was observed with
LLLT treatment, as a significant increase in the frequency of S‐phase
cells was observed. These results were significantly accentuated in
fibroblasts concomitantly treated with guarana plus LLLT. All treat‐
ments increased FGF‐1 and KFG‐1 levels compared with those in con‐
trol groups (Figure 4C). However, in cells treated with guarana plus LLLT,
the levels of FGF‐1 were significantly higher than all other treatments.
Conversely, KGF‐1 levels were significantly higher in cells treated with
guarana alone than in those subjected to all other treatments.
4 | D I S CU S S I O N
In this study, we determined whether the interaction between
LLLT and guarana extract is beneficial to dermal fibroblasts.
Initially, we observed no effect on inflammation and apoptosis in
fibroblasts treated with <10 µg/mL of guarana. However, 5 µg/mL
of guarana triggered an increase in the anti‐inflammatory cytokine
IL‐10, and thus, this concentration was used in subsequent ex‐
periments. Taken together, we determined that guarana plus LLLT
triggered antioxidant, anti‐inflammatory, anti‐apoptotic, and pro‐
liferative effects on dermal fibroblasts. However, some of these
benefits were also observed in fibroblasts treated with guarana
or exposed to LLLT alone. We will now discuss in more detail the
main results obtained.
 |
6       MALDANER et al.
Our results confirmed the anti‐inflammatory properties of guarana
6
previously described by Krewer et al However, our results were ob‐
tained from dermal fibroblasts exposed to concentrations of guarana
≤10 µg/mL. Dermal fibroblasts are known to secrete cytokines when
4,23-25
exposed to pollutants or pro‐senescent agents. Therefore, gua‐
rana (5 µg/mL) was used in our experiments with and without LLLT.
Laser stimulation including LLLT is a procedure widely used in many
clinical applications, as it is not known to cause iatrogenic malignancies.1,26
However, its beneficial effect is not universal and dependents on in vitro
and in vivo treatment conditions. We used 4  J/cm2 of LLLT exposure
F I G U R E 2   Effect of guarana and
low‐level laser therapy (LLLT) on oxidative
stress. (A) Levels of reactive oxygen
species (ROS); (B) carbonylation of
proteins; (C) lipoperoxidation (D) DNA
oxidation, and (E) level of antioxidant
enzymes, superoxide dismutase (SOD),
catalase (CAT), and glutathione peroxidase
(GPX). Statistical analysis was performed
using two‐way analysis of variance
followed by the Bonferroni post hoc
test. The different letters (A, B, and C)
represent statistical differences between
treatment groups at P < 0.05
based on results previously described by Maldaner et al4 using the same
dermal fibroblast line (HFF‐1). This dose of LLLT was able to improve the
levels of the anti‐inflammatory cytokine IL‐10, in cultures concomitantly
exposed to 50 µM H2O2, an accelerator of cellular senescence.4
Guarana treatment plus LLLT exposure triggered an increase in
the total ROS produced by fibroblasts compared with that of the
control. Conversely, this interaction lowered protein carbonylation
and decreased lipoperoxidation in LLLT‐exposed fibroblasts.
There is growing evidence that a low to moderate increase in ROS
production may have a positive effect on many cellular processes,
MALDANER et al.       7 |
F I G U R E 3   Effect of guarana and
low‐level laser therapy (LLLT) on protein
and gene expression in fibroblasts. (A)
Protein levels and (B) gene expression
levels of cytokines: IL‐1β, IL‐6, TNF‐α
(pro‐inflammatory), and IL‐10 (anti‐
inflammatory). (C) Protein levels and
(D) gene expression of caspases 1, 3,
and 8. Treatments were statistically
analyzed by two‐way ANOVA followed
by Tukey post hoc test. Different letters
depict concentrations with significant
differences (P < 0.05). Gene expression of
each cytokine and caspase is represented
by colored squares and were determined
relative to the untreated control group to
determine the relative mRNA expression.
The expression of β‐actin was used as an
internal control (housekeeping gene)

including the stimulation of cellular proliferation. For example, hy‐
drogen peroxide is considered a ROS molecule involved in several
cellular metabolic pathways, since at low concentrations is able to
act as a second messenger. In this way, ROS metabolic response,
such as hydrogen peroxide can modulate differentially proliferation,
27
survival, and death. In fact, previous studies have reported that
LLLT‐induced ROS stimulates fibroblast proliferation and DNA syn‐
thesis in cultured normal human keratinocytes, fibroblasts, osteo‐
blasts, mesenchymal and cardiac stem cells, and endothelial cells.1
We found an increase in the number of fibroblasts in the S phase,
and increased FGF‐1, suggesting that a possible elevation in ROS
production triggered by guarana plus LLLT had no negative effects.
This hypothesis is corroborated by the decrease in the markers
of carbonylation, lipoperoxidation, and DNA oxidation in fibroblasts
exposed to guarana plus LLLT. Furthermore, all treatments have
some effect on the modulation of antioxidant enzymes. However,
it is important to note that cells treated with guarana or LLLT alone
also had decreased DNA oxidation, confirming independent geno‐
protective effects of both treatments as previously described.4,7
The modulation of inflammatory markers expressed by fibro‐
blasts was evaluated. The protein and gene expression of pro‐in‐
flammatory cytokines decreased in both independent guarana and
LLLT treatments, and guarana plus LLLT exposure. In addition, all
treatments were able to upregulate the anti‐inflammatory cytokine
 |
8       MALDANER et al.

F I G U R E 4   Effect of guarana and low‐level laser therapy (LLLT) on the cell cycle of fibroblasts determined by flow cytometry after 72‐h
exposure. (A) Representative graphic of cell phases: (G0/G1 = gap 1; S = synthesis; G2/M = gap 2 and mitosis). (B) Percentage (%) of cells in
the control at each stage (G0/G1 = gap 1; S = synthesis; G2/M = gap 2 and mitosis) of the cell cycle. (C) Protein levels of FGF‐1 and KGF‐1.
Analyzed using two‐way analysis of variance (ANOVA), followed by the Tukey post hoc test. The different letters (A, B, C, and D) represent
statistical differences between treatment groups at P < 0.05

IL‐10. These results may be relevant to IL‐10. This anti‐inflammatory
cytokine has been identified as a candidate for scar‐improving ther‐
apy based on preclinical studies. Shi et al28 showed that when human
dermal fibroblasts were stimulated with TGF‐β1 and subsequently
treated with IL‐10 this cytokine exhibited inhibitory effects on the
excessive deposition of extracellular matrix components and fibro‐
blast‐to‐myofibroblast transition, suggesting that IL‐10 has the po‐
tential to prevent and reduce skin scarring. As a result, recent studies
have used gene modulation of IL‐10 in fibroblast to study important
components of plant extracts with potential wound healing effects.29
All treatments were able to decrease the levels of all three
caspase molecules that participate in intrinsic and extrinsic apopto‐
sis in cells. During skin aging, oxidative stress can cause DNA dam‐
age‐inducing apoptosis in cells such as fibroblasts. Previous studies
have described the potential anti‐apoptotic effects of LLLT in dif‐
ferent types of cells.30,31 The anti‐apoptotic effect of catechin, a
component of the guarana chemical matrix, on fibroblasts has been
described in the literature.32 It is likely that this reduction in apop‐
tosis regulates the genoprotective effect observed in fibroblasts
exposed to guarana.
Importantly, the interaction between guarana and LLLT in fibro‐
blasts affected the cell cycle and modulated FGF‐1 levels. This is evi‐
dence of a potential benefit of combining guarana and LLLT therapy.
FGF‐1 is considered a powerful mitogen that triggers the stimulation
of DNA synthesis and proliferation of a large number of cell types,
including fibroblasts. 20 However, to the best of our knowledge, this
is the first study describing FGF‐1 modulation by guarana extract.
Although all treatments significantly increased KGF‐1, the effect was
relatively slight, and this result could be considered positive. KGF‐1 is
a key signaling molecule in fibroblast and keratinocyte cells; however,
in some conditions, such as fibrotic disorders KGF‐1 is overexpressed
in the tissue.21 Therefore, high levels of KGF‐1 may not be desirable.
5 | CO N C LU S I O N
In conclusion, despite the methodological constraints associated with
in vitro studies; together, our results suggest that the independent
and combinational use of guarana and LLLT exhibit antioxidant, anti‐
inflammatory, anti‐apoptotic, and proliferative effects on fibroblasts.
MALDANER et al.
ORCID
Fernanda Barbisan  https://orcid.org/0000-0002-2960-7047
REFERENCES
1. Migliario M, Sabbatini M, Mortellaro C, Renò F. Near infrared
low‐level laser therapy and cell proliferation: the emerging role
of redox sensitive signal transduction pathways. J Biophotonics.
2018;11:e201800025.
2. Avci P, Gupta A, Sadasivam M, et al. Low‐level laser (light) therapy
(LLLT) in skin: stimulating, healing, restoring. Semin Cutan Med Surg.
2013;32:41‐52.
3. Zachary CB. Facial rejuvenation: 40th anniversary review. Semin
Cutan Med Surg. 2016;35:122‐124.
4. Maldaner DR, Azzolin VF, Barbisan F, et al. In vitro effect of low‐level
laser therapy on the proliferative, apoptosis modulation, and oxi‐in‐
flammatory markers of premature‐senescent hydrogen peroxide‐in‐
duced dermal fibroblasts. Lasers Med Sci. 2019. https​://doi/10.1007/
s10103-019-02728-1 [Epub ahead of print].
5. Schimpl FC, Silva JF, Gonçalves J, Mazzafera P. Guarana: revisit‐
ing a highly caffeinated plant from the Amazon. J Ethnopharmacol.
2013;150:14‐31.
6. Krewer CC, Suleiman L, Duarte M, et al. Guaraná, a supplement
rich in caffeine and catechin, modulates cytokines: evidence
from human in vitro and in vivo protocols. Eur Food Res Technol.
2014;239:49‐57.
7. Machado AK, Cadoná FC, Azzolin VF, et al. Guaraná (Paullinia cu-
pana) improves the proliferation and oxidative metabolism of se‐
nescent adipocyte stem cells derived from human lipoaspirates.
Food Res Int. 2015;67:426‐433.
8. Cadoná FC, Machado AK, Azzolin VF, et al. Guaraná a caffeine‐
rich food increases oxaliplatin sensitivity of colorectal HT‐29 cells
by apoptosis pathway modulation. Anticancer Agents Med Chem.
2016;16:1055‐1065.
9. Bittencourt LS, Machado DC, Machado MM, et al. The protec‐
tive effects of guaraná extract (Paullinia cupana) on fibroblast
NIH‐3T3 cells exposed to sodium nitroprusside. Food Chem Toxicol.
2013;53:119‐125.
10. Andrews KW, Schweitzer A, Zhao C, et al. The caffeine contents of
dietary supplements commonly purchased in the US: analysis of 53
products with caffeine‐containing ingredients. Anal Bioanal Chem.
2007;389:231‐239.
11. Belliardo F, Martelli A, Valle MG. HPLC determination of caffeine
and theophylline in Paullinia cupana Kunth (Guarana) and Cola spp.
samples. Z Lebensm Unters Forsch. 1985;180:398‐401.
12. da Cruz Jung IE, Machado AK, da Cruz IBM, et al. Haloperidol and
Risperidone at high concentrations activate an in vitro inflamma‐
tory response of RAW 264.7 macrophage cells by induction of
apoptosis and modification of cytokine levels. Psychopharmacology.
2016;233:1715‐1723.
13. Choi WS, Shin PG, Lee JH, Kim GD. The regulatory effect of veratric
acid on NO production in LPS‐stimulated RAW264.7 macrophage
cells. Cell Immunol. 2012;280:164‐170.
14. Morabito C, Rovetta F, Bizzarri M, Mazzoleni G, Fanò G, Mariggiò
MA. Modulation of redox status and calcium handling by extremely
low frequency electromagnetic fields in C2C12 muscle cells: a real‐
time, single‐cell approach. Free Radic Biol Med. 2010;48:579‐589.
15. Halliwell B, Whiteman M. Measuring reactive species and oxidative
damage in vivo and in cell culture: how should you do it and what do
the results mean? Br J Pharmacol. 2004;142:231‐255.
16. Levine RL, Williams JA, Stadtman ER, Shacter E. Carbonyl assays for
determination of oxidatively modified proteins. Methods Enzymol.
1994;233:346‐357.
|
      9
17. Jentzsch AM, Bachmann H, Fürst P, Biesalski HK. Improved anal‐
ysis of malondialdehyde in human body fluids. Free Radic Biol Med.
1996;20:251‐256.
18. Barbisan F, Azzolin VF, Teixeira CF, et al. Xanthine‐catechin mixture
enhances lithium‐induced anti‐inflammatory response in activated
macrophages in vitro. BioMed Res Int. 2017;2017:4151594.
19. Azzolin VF, Cadoná FC, Machado AK, et al. Superoxide‐hydrogen
peroxide imbalance interferes with colorectal cancer cells viability,
proliferation and oxaliplatin response. Toxicol In Vitro. 2016;32:8‐15.
20. Żerańska J, Pasikowska M, Szczepanik B, et al. A study of the ac‐
tivity and effectiveness of recombinant fibroblast growth fac‐
tor (Q40P/S47I/H93G rFGF‐1) in anti‐aging treatment. Postepy
Dermatol Alergol. 2016;33:28‐36.
21. Canady J, Arndt S, Karrer S, Bosserhoff AK. Increased KGF expres‐
sion promotes fibroblast activation in a double paracrine manner
resulting in cutaneous fibrosis. J Invest Dermatol. 2013;133:647‐657.
22. OECD (2018), Guidance document on good in vitro method practices
(GIVIMP), OECD series on testing and assessment, no. 286, OECD
publishing, Paris. https​://doi.org/10.1787/97892​64304​796-en
23. Lee DC, Choi H, Oh J‐M, et al. The effect of urban particulate mat‐
ter on cultured human nasal fibroblasts. Int Forum Allergy Rhinol.
2018;8:993‐1000.
24. Shirato K, Koda T, Takanari J, et al. Anti‐inflammatory effect of
ETAS®50 by inhibiting nuclear factor‐κB p65 nuclear import in ul‐
traviolet‐B‐irradiated normal human dermal fibroblasts. Evid Based
Complement Alternat Med. 2018;2018:5072986.
25. Kitahiro Y, Koike A, Sonoki A, Muto M, Ozaki K, Shibano M.
Anti‐inflammatory activities of Ophiopogonis Radix on hydrogen
peroxide‐induced cellular senescence of normal human dermal fi‐
broblasts. J Nat Med. 2018;72:905‐914.
26. Bayat M, Virdi A, Jalalifirouzkouhi R, Rezaei F. Comparison of ef‐
fects of LLLT and LIPUS on fracture healing in animal models and
patients: a systematic review. Prog Biophys Mol Biol. 2018;132:3‐22.
27. Di Marzo N, Chisci E, Giovannoni R. The role of hydrogen peroxide
in redox‐dependent signaling: homeostatic and pathological re‐
sponses in mammalian cells. Cells. 2018;7:E156.
28. Shi J‐H, Guan H, Shi S, et al. Protection against TGF‐β1‐induced
fibrosis effects of IL‐10 on dermal fibroblasts and its potential
therapeutics for the reduction of skin scarring. Arch Dermatol Res.
2013;305:341‐352.
29. Czemplik M, Korzun‐Chłopicka U, Szatkowski M, Działo M, Szopa J,
Kulma A. Optimization of phenolic compounds extraction from flax
shives and their effect on human fibroblasts. Evid Based Complement
Alternat Med. 2017;2017:3526392.
3 0. Yin K, Zhu R, Wang S, Zhao RC. Low‐level laser effect on prolifera‐
tion, migration, and antiapoptosis of mesenchymal stem cells. Stem
Cells Dev. 2017;26:762‐775.
31. Chu YH, Chen SY, Hsieh YL, Teng YH, Cheng YJ. Low‐level laser
therapy prevents endothelial cells from TNF‐α/cycloheximide‐in‐
duced apoptosis. Lasers Med Sci. 2018;33:279‐286.
32. Tanigawa T, Kanazawa S, Ichibori R, et al. (+)‐Catechin protects
dermal fibroblasts against oxidative stress‐induced apoptosis. BMC
Complement Altern Med. 2014;14:133.
How to cite this article: Maldaner DR, Pellenz NL, Barbisan F,
et al. Interaction between low‐level laser therapy and
Guarana (Paullinia cupana) extract induces antioxidant, anti‐
inflammatory, and anti‐apoptotic effects and promotes
proliferation in dermal fibroblasts. J Cosmet Dermatol.
2019;00:1–9. https​://doi.org/10.1111/jocd.13055​