ABSTRACT: Pure neural leprosy (PNL) is often difficult to diagnose when

acid-fast bacilli (AFB) cannot be detected. We undertook the present study

to evaluate use of the polymerase chain reaction (PCR) in diagnosing PNL.
Fifty-eight patients (41 men and 17 women) suspected of pure neural
leprosy (PNL) were examined. Patients were classified as borderline tuber-
culoid (BT, 40 cases) and polar tuberculoid (TT, 18 cases) types. Nerve
biopsy was performed and was positive for AFB in 20 patients (all BT
patients), i.e., 34.5% of total cases. DNA was extracted from the nerve
biopsy samples and amplified using PCR for a specific repeated sequence
of DNA from Mycobacterium leprae. PCR analysis was positive in the nerve
samples from 29 patients (50%), 27 of the BT type, and 2 of the TT type
patients. Further, PCR analysis was positive in 14 of 38 cases that were
negative for AFB by nerve biopsy, of which 12 were of the BT type and 2 the
TT type. PCR analysis proved to be a useful method to investigate pure
neural leprosy, enabling confirmation of the diagnosis in more than a third of
the cases that were negative for AFB by nerve biopsy.
Muscle Nerve 33: 409 – 414, 2016

PURE NEURAL LEPROSY: DIAGNOSTIC VALUE

OF THE POLYMERASE CHAIN REACTION
FRANCISCO M. BEZERRA DA CUNHA, MD,1 MAURICIO C. M. WERNECK, BSc,2
ROSANA H. SCOLA, MD, PhD,2 and LINEU C. WERNECK, MD, PhD2
1
Centro de Saúde Dona Libânia, Secretaria de Saúde do Estado do Ceará, Faculdade
de Medicina do Cariri da Universidade Federal do Ceará, Barbalha, Brazil
2
Serviço de Doenças Neuromusculares/Neurologia, Hospital de Clı́nicas da Universidade
Federal do Paraná, Rua Gal. Carneiro, 181, 3o andar, 80060-900 Curitiba, Brazil

Hansen’s disease, or leprosy, is an infectious disease
caused by Mycobacterium leprae, which affects the pe-
ripheral nervous system, skin, and other tissues.2
Leprosy patients lacking skin lesions, but showing
involvement of one or more nerves, are afflicted with
pure neural leprosy (PNL), which in countries such
as India accounts for 3.9 – 8.2% of all diagnosed
patients.17,21,29
From the pathological standpoint, leprous neu-
ritis depends on the immunity and integrity of the
patient’s nerve– blood barrier.15 The nerve alone
may be impaired (pure neural leprosy) or may con-
stitute the initial infection site (primary neuritic lep-
rosy). However, infection by M. leprae cannot be
understood without considering neural impairment,
characterized as neuritis; many mechanisms contrib-
ute to the pathogenesis of the inflammatory neural
reaction.4,8,27,37,45
Abbreviations: AFB, acid-fast bacilli; BI, bacillary index; BT, borderline-
tuberculoid; H&E, hematoxylin-eosin; MB, multibacillary; PB paucibacillary;
PCR, polymerase chain reaction; PNL, pure neural leprosy; TT, polar tuber-
culoid
Key words: Hansen’s disease; leprosy; neuropathy; polymerase chain reac-
tion
Correspondence to: L. C. Werneck; e-mail: werneck@hc.ufpr.br
© 2005 Wiley Periodicals, Inc.
Published online 28 November 2005 in Wiley InterScience (www.interscience.
wiley.com). DOI 10.1002/mus.20465
Although the Schwann cell is the target of M. leprae,
the molecular basis for this tropism was only recently
explained: M. leprae apparently binds to proteins on
the Schwann cell surface that make connections with
the subjacent cytoskeleton. Binding to the Schwann
cell surface initiates a cascade of laminin 2/alpha-dys-
troglycan / M. leprae complexes that leads to bacillus
penetration into the cytoplasm, thus establishing the
neural leprosy infection.8,22,23,33,34,38,43,45
There are very few references to pure neural lep-
rosy (PNL) in the literature,5,21,25,29,30,46 and no stan-
dard protocol to investigate the disease at the outpa-
tient level of basic health services.9,13,14,32,46,48 The use
of polymerase chain reaction (PCR) as a laboratory
tool for the detection and identification of M. leprae
DNA in nerves has proved to be useful in the differen-
tial diagnosis of PNL.11,16,40,50 Given this success, in the
present study we used PCR as a tool to correlate the
detection of M. leprae with neural histopathology in PNL.
PATIENTS AND METHODS
Fifty-eight patients with a diagnosis of suspected PNL
were examined, 40 being borderline tuberculoid
(BT), and 18 polar tuberculoid (TT) cases. There
were 41 men (28 BT and 13 TT), and 17 women (12
BT and 5 TT). Patients were aged 45.0 ± 18.2 years

Pure Neural Leprosy MUSCLE & NERVE March 2016 409

in the BT group and 36.2 ± 9.2 years in the TT
group.
Disease development at the time of diagnosis was
2.3 ± 2.2 years for BT and 2.0 ± 2.9 years for TT.
There was no statistically significant difference be-
tween the groups.
PNL episodes were defined by signs and symp-
toms of neuropathy characterized by sensory
changes (paresthesias) or sensory dysfunction, cor-
responding to a region of thickened nerve, associ-
ated or not with motor, trophic, or autonomic dys-
function, in the absence of a skin lesion.29
All patients were submitted to a predefined pro-
tocol, including clinical history, dermato-neurologi-
cal examination, simple routine laboratory tests
(complete blood count and erythrocyte sedimenta-
tion rate; determination of blood urea, creatinine,
fasting blood sugar, aspartate aminotransferase, ala-
nine aminotransferase, and thyroid-stimulating hor-
mone; urinalysis; bacteriological analysis for acid-fast
bacilli (AFB) in the nasal mucus and skin lymph
from elbow and ear-lobe; electroneuromyography;
histopathology; and PCR analysis of previously biop-
sied nerve).
Patients were classified as TT or BT according to
Ridley and Jopling,36 and were defined as TT accord-
ing to World Health Organization criteria when they
presented a single affected nerve trunk and BT when
two or more trunks were involved.51
No patients were included in the protocol who
had other diseases that might affect the nervous
system, such as chronic alcoholism, diabetes melli-
tus, thyroid diseases, malnutrition, and hereditary
neuropathy, or a history of previous skin lesions
suggesting leprosy.
A control group of 21 patients with diagnoses of
other neuropathies was used to evaluate aspects such
as test specificity and sensitivity.
The study was approved by the Ethics Committee
of the Hospital de Cl´ınicas da Universidade Federal
do Paraná, according to ethical guidelines estab-
lished by Resolution 196/96 of the Brazilian Ministry
of Health.
Nerves were selected according to
Nerve Biopsies.
the corresponding area of anesthesia or hypoesthe-
sia, obvious thickening, and, in case of doubt, in
accordance with defined electrophysiological
changes. During the biopsy procedure the nerves
were completely transected across their width. In
most cases sensory nerves were used, but in cases of
mononeuropathies of mixed nerves, such as the ul-
nar and deep peroneal nerve, these were spared and
a fragment was removed from the epineurium. For
414 Pure Neural Leprosy
superficial radial nerves, biopsies were fascicular.
The nerve samples were divided into two fragments:
one was bonded to adraganth gum and frozen in
liquid nitrogen; the other was placed in an Eppen-
dorf tube for PCR analysis and frozen in liquid ni-
trogen.
The nerve biopsies were of the sural nerves in 38
cases; sensorimotor ulnar nerve in seven cases; su-
perficial peroneal nerve in six cases; superficial ra-
dial nerve in four cases; and the dorsal ulnar, saphe-
nous, and lateral cutaneous thigh nerves— one
nerve for each patient, totaling three cases. Nerves
lacking obvious thickening or electrophysiological
abnormalities were not included.
Sections 4 – 8 µm in thickness
Nerve Histopathology.
were obtained from nerve samples attached to the
adraganth gum and were placed on coverslips and
kept at room temperature for 30 min. These sections
were then stained with hematoxylin– eosin (H&E),
modified Gomori’s trichrome, and Fite-Faraco stain
for AFB.
DNA Extraction and Amplification. Sodium hydrox-
ide and sodium diphosphate were added to the frag-
ment of frozen nerve and the supernatant was dis-
carded after centrifugation. The sample was
resuspended in trihydrochloric acid. Cellular lysis
was then performed using proteinase K, which was
inactivated by placing the specimen for 5 min in a
water bath at 95°C. Further lysis was performed by
thermal shocks (six cycles of fast freezing by immer-
sion in liquid nitrogen, alternated with sample boil-
ing). The sample was then submitted to PCR analy-
sis.40
Specific repeated DNA sequences of M. leprae
were amplified from primers ML1 (2322–2341)
GCACGTAAGCCTGTCGGTGG and ML2 (2674 –
2693) CGGCCGGATCCTCGATGCAC. 50 Supermix
PCR was prepared in a microtube, and primers ML1
and ML2 plus the DNA sample extracted from the
nerve biopsy were added. Microtubes and reagents
were then placed in a thermal cycler model PC-200
(Peltier Thermal Cycler; M.J. Research, Watertown,
Massachusetts) at 2°C for 1.5 min and heated to
80°C for 1 min when 1 µl of polymerase Taq DNA
(Biotechnology Center, University Rio Grande do
Sul, Porto Alegre, Brazil) was added. A further 44
cycles were repeated as follows: denaturation at 92°C
(1.5 min); hybridization or labeling at 55°C (2.5
min); and extension at 72°C (2.0 min). At the end of
the amplification cycles, a final extension at 72°C for
7 min was performed. When necessary, amplified
material was stored in a refrigerator at 2–5°C.
MUSCLE & NERVE March 2016
 After amplification, the DNA was submitted to Table 1. Histopathological and polymerase chain reaction findings
electrophoresis using a 7% acrylamide gel solution. for nerve biopsies from 58 cases of pure neural leprosy.
A 100-bp molecular weight marker, a positive M.
Feature TT BT Total
leprae DNA control (purified DNA from M. leprae
Granuloma with caseous necrosis 12 7 19*
extracted from armadillo liver, provided by FioCruz,
Poorly defined granuloma 2 21 23†
Rio de Janeiro, Brazil), and a negative control cor- Fibrosis 4 8 12
responding to DNA extracted from biopsies of non- Nonspecific alterations 2 6 8
leprosy neuropathy nerve were included. A vertical, AFB-positive 0 20 20‡
5x TBE (Tris-Borate-EDTA) buffer gel electrophore- Positive PCR (M. leprae) 2 27 29§
sis run was performed using a 200 V power supply TT, tuberculoid form; BT, borderline tuberculoid form; AFB, acid-fast bacilli;
(electrophoresis apparatus; Gibco BRL, Gaithers- PCR, polymerase chain reaction.
burg, Maryland), until the staining solution reached *P = 0.003; †P = 0.011; ‡P = 0.001; §P < 0.001 (chi- square test).

the lower portion of the gel, at which time it was

removed for development.
The gel was washed in 1% nitric acid and covered
with silver nitrate solution after the addition of 50 ml
sodium bicarbonate and 60 ml of formaldehyde so-
lution. After this bathing solution darkened, the re-
maining 120 ml of the formaldehyde solution was
added. As the gel bands developed the color was
fixed using a 10% acetic acid solution for 5 min.
Thus, bands corresponding to 375-bp M. leprae DNA
fragments were located in the gel (Fig. 1).
The data obtained from the
Statistical Methods.
study samples are presented as tables and figures.
Analysis included a chi-square test for independent
samples, in addition to sensitivity and specificity
tests. The significance level adopted was 5% or less.
RESULTS
The most frequent histopathological findings were
granuloma with caseous necrosis and fibrosis in the
TT group, and poorly defined granuloma with fibro-
sis and the presence of AFB in the BT group. The
occurrence of granuloma with caseous necrosis (P =
0.003), and poorly defined granuloma with fibrosis
(P = 0.011) were statistically correlated with the
clinical form of the disease (Table 1).
Of the 58 cases, 34.5% were positive for AFB in
PNL, although only in BT patients. A significant
statistical correlation was found between the pres-
ence of AFB in the nerves and the clinical form of
the disease (P = 0.001; Table 1).
The bacillary index (BI) in 40 patients with BT
was 0 in 19 cases (47.5%); 1 in 7 cases (17.5%); 2 in
10 cases (25.0%); and 3 in 4 cases (10.0%). In this
latter group, three patients presented multiple sen-
sorimotor mononeuropathy: their sural nerve biop-
sies showed nonspecific inflammatory changes in
one case, and the occurrence of poorly defined gran-
uloma in the other two cases, with a positive PCR for
M. leprae DNA in all cases.
PCR analysis was positive in 50% of the patients,
27 cases in the BT group and 2 cases in the TT
group, with a clear statistical correlation between the
test and the clinical form of the disease (P < 0.001;
Table 1).
PCR analysis was positive in 14 of 38 cases nega-
tive for AFB, 12 in the BT group, and 2 in the TT
group. Five cases positive for AFB with a negative
PCR analysis were found, with a statistically signifi-
cant correlation between PCR and AFB (P = 0.013;
Table 2).
The time until diagnosis was 28.3 months in the
BT group and 24.3 months in the TT group. In 44
cases, the elapsed time did not exceed 24 months, 29
being of the BT type and 14 of the TT type clinically.

Table 2. Polymerase chain reaction for M. leprae DNA and acid-

fast bacilli in nerves from pure neural leprosy patients.
PCR
Negative Positive Total
AFB Negative 24 14 38
FIGURE 1. Silver-stained, polyacrylamide gel of a polymerase Positive 5 15 20
chain reaction showing bands corresponding to 372-bp M. leprae Total 29 29 58
DNA fragments (M, marker; PC, positive control; NC, negative
control; bp, base pairs). Positive patients in columns 57, 37, 10, PCR, polymerase chain reaction; AFB, acid-fast bacilli.
16, 25, 35, 40; negative patients in columns 13, 22, 27. Chi-square test = 6.182; P = 0.013.

Pure Neural Leprosy MUSCLE & NERVE March 2016 411

In 14 cases, the disease development time exceeded
24 months, 11 cases being of the BT type and 3 of the
TT type. There was no statistical correlation between
the development time of disease, histopathological
findings, and PCR analysis, except for AFB-positive
cases in the BT type (18 cases in the first 24 months
and 2 after 24 months; P = 0.034). Statistical corre-
lations between disease development time and clin-
ical forms of the disease were not significant.
In the control patients with a diagnosis of non-
leprotic neuropathy, the findings were as follows:
vasculitis, 8 (38.1%); hereditary sensorimotor neu-
ropathy, 7 (33.3%); amyloidosis, 3 (14.3%); polyar-
teritis nodosa, 2 (9.5%); and neuroaxonal dystrophy,
1 (4.8%). All patients had sensory changes on clini-
cal and electrophysiological examinations. All biop-
sies were from the sural nerve. No control patient
had granuloma with caseous necrosis, poorly de-
fined granuloma, nerve fibrosis, nonspecific
changes, or was AFB-positive or PCR-positive for M.
leprae.
The sensitivity of the various histological find-
ings, the presence of AFB, and PCR findings differed
according to the form of leprosy present. However,
the specificity of the diagnosis was very high (100%).
DISCUSSION
The diagnosis of pure neural leprosy is difficult,
owing to a general lack of knowledge concerning the
early signs and symptoms of peripheral nervous sys-
tem involvement, as most professionals disregard the
fact that leprosy is primarily a neurological disease.
Further, PNL is absent from the usual classifications,
and it is difficult to perform such examinations as
electrodiagnostic studies and nerve biopsy, and to
adopt such techniques together with PCR to investi-
gate the disease. From the clinical standpoint, the
diagnosis of PNL depends on nerve thickening and
sensory signs or motor neurological deficits, which
are not always convincing.
The criteria adopted in the current leprosy clas-
sification based on skin lesions do not actually reflect
nerve lesions,1,28,44 even though some authors give
importance to bacillary load.28 However, several in-
vestigators have found leprosy patients with high
bacillary neural loads (BI 2) but showing no cor-
relation with dermatological lesions.7,26,44
The presence of AFB by optical microscopy is
apparently limited to 104 bacilli/ml of sample.41
Thus, the diagnosis of M. leprae infection is not easy.
However, the use of molecular biology and PCR-
based techniques has increased the sensitivity and
specificity of M. leprae detection.12,40,50 Currently,
412 Pure Neural Leprosy
PCR analysis based on the detection of specific re-
peated sequences of M. leprae DNA, after extraction
and optimization in different samples (hair, lymph,
blood, and biopsy), associated with a hybridization
technique, can detect 100 ag (1 ag = 10-18 g) of
target DNA, equivalent to 10% of the bacterial ge-
nome.40 In practical terms, PCR analysis was able to
detect M. leprae DNA in 73% of patients with a BI =
0.52
Evaluations of leprous neuritis in the absence of
skin lesions are rare. However, a comparative evalu-
ation of studies on neural lesions from cases of PNL
and of studies on leprotic skin lesions is imperative.
Job et al.16 investigated 39 patients with skin lesions
suspected of leprosy and diagnosed 14 on clinical
grounds and 26 on histopathological findings: only 2
were AFB positive, but 11 were positive by PCR anal-
ysis. Thus, PCR detection is increased by five- or
six-fold for a positive presence of M. leprae in sam-
ples.16 This has been confirmed by other studies,
indicating the high sensitivity and specificity of PCR
in detection of M. leprae.31,40,52
The detection of M. leprae by histopathology and
by PCR analysis increases as a greater number of
samples is examined. This suggests that M. leprae is
present in nearly all active lesions of the disease, with
a variable and dispersed number of lesions in the
tissues, assuming the focal nature of the lesions.
Thus, detection frequency is dependent on sample
size.3,7,52
In the TT and BT types, there is an inverse cor-
relation between the density of the cellular infiltrate
(epithelioid granuloma and lymphomononuclear in-
filtrate) and a positive PCR amplification. This sug-
gests the presence of viable bacilli in biopsy material.
A strong immune response may cause the death of
M. leprae by reducing bacillary DNA levels.24 Woods
and Cole50 also suggested that a positive amplifica-
tion reflects the presence of potentially viable M.
leprae. However, an inflammatory cellular reaction
may include the secretion of PCR-inhibiting media-
tors40 and it is reported that half of the cases of
untreated negative leprosy by histology are positive
by PCR.20
Histopathology should not be considered the
―gold standard‖ examination, since the proportion
of patients with negative or doubtful diagnosis is
high.6 Practicability and cost-effectiveness of biopsy
and PCR analysis for M. leprae detection should be
evaluated under various laboratory conditions.35
Duration of the disease is believed to interfere
with the sensitivity of the methods employed, as AFB
are destroyed by the body or even after regular or
nonregular treatment. The greatest difficulty in de-
MUSCLE & NERVE March 2016
tecting M. leprae in biopsies concerns DNA extrac-
tion, owing to extensive fibrosis in paucibacillary and
some multibacillary forms.3
Comparing the histopathological examination
and PCR analysis for M. leprae in nerves, another
study found a sensitivity of 51% and a specificity of
96%.19 Similar results have been obtained for the
presence of AFB in biopsies.49 Positive PCR findings,
associated with the fact that only a small number of
infected individuals develop leprosy, suggest that
PCR analysis should be correlated with clinical eval-
uations in cases of difficult diagnosis by conventional
techniques.39 Molecular biology tests using PCR are
highly sensitive and specific, although there is a real
possibility of false-negative results.18 Such findings
bring new information, especially with respect to
pharmacotherapy, selection differences, clinical
forms, bacillary persistence, and new infection.31
They also highlight that a positive PCR analysis is
indicative of the presence of bacillus DNA, but does
not show that the M. leprae bacillus is alive.3
PCR analysis is important for the diagnosis of
PNL because it increases sensitivity for the presence
of M. leprae compared to conventional histopathol-
ogy in BT patients, and helps to assure a diagnosis in
the small percentage of paucibacillary forms. Associ-
ation of clinical features with biopsy and PCR anal-
ysis may provide an effective means of diagnosis in
difficult cases.35
If histopathology fails to clarify the diagnosis,
PCR analysis should be performed. A TT diagnosis
(paucibacillary form) should be reviewed, and treat-
ment employing six doses of combination therapy is
suggested. For BT patients (multibacillary form),
treatment with 12 doses of combination therapy
should be added to the spectrum of treatment for
lepromatous tendency in BT, BB, and BL. It should
be remembered that neural lesions in leprosy may
represent the onset of the disease and that skin
lesions will appear in the future.10,47
PCR is a useful method to detect M. leprae in
nerves with a negative histopathology in PNL since a
positive analysis is indicative of the presence of this
mycobacterium. However, PCR should not be con-
sidered as an isolated diagnostic test, because a pos-
itive analysis does not confirm leprosy as an active
disease, but rather a leprosy infection. Thus, clinical
correlation using other diagnostic methods is neces-
sary.
Supported by the Fundação Araucária, Paraná State, Brazil and a
grant from Coordenação de Aperfeiçoamento de Pessoal de Nı́vel
Superior (CAPES), Brazil. The authors thank Dr. John Campbell
McNamara for kindly reviewing the manuscript.
Pure Neural Leprosy
REFERENCES
1. Antia NH, Pandya NJ. Quantitative histology and quantitative
bacteriology in various tissues of 50 leprosy patients. Lepr Rev
1976;47:175–183.
2. Bryceson A, Pfaltzgraff RE. Leprosy, 3rd ed. New York:
Churchill Livingstone; 1990.
3. Chemouilli P, Woods S, Said G, Cole ST. Detection of Myco-
bacterium leprae in nerve lesions by the polymerase chain reac-
tion. Int J Lepr 1996;64:1–5.
4. Chimelli L, Freitas M, Nascimento O. Value of nerve biopsy in
the diagnosis and follow-up of leprosy: the role of vascular
lesions and usefulness of studies in the detection of persistent
bacilli. Neurology 1997;244:318 –323.
5. Dharmendra, Ramanujam K, Ramu G. Pure polyneuritic lep-
rosy of tuberculoid type. Lepr India 1966;38:152–158.
6. Ebenezer GJ, Suneetha S, Mohandas, Arunthathi S. Multiba-
cillary nerve histology in clinically diagnosed borderline tu-
berculoid leprosy patients. Int J Lepr 1996;64:311–315.
7. Fleury RF, Aranda CM. Detection of AFB in tuberculoid bi-
opsies. Int J Lepr 1995;63:103.
8. Freedman VH, Weinstein DE, Kaplan G. How Mycobacterium
leprae infects peripheral nerves. Lepr Rev 1999;70:136 –139.
9. Freitas RG, Nascimento O, Drago MJ, Freitas AR, Hahn MD.
Paralisia do nervo ulnar na lepra sem alterações cutâneas:
biópsia do ramo superficial do nervo ulnar na mão. Arq
Neuropsiquiatr 1998;56:585–594.
10. Girdhar BK. Neuritis leprosy. Ind J Lepr 1996;68:35– 42.
11. Hackel C. Specific identification of M. leprae by polymerase
chain reaction (PCR) technique. Hansen Int 1990;15:67–75.
12. Hartskeerl RA, De Wit MYL, Klatser PR. Polymerase chain
reaction for the detection of Mycobacterium leprae. J Gen Mi-
crobiol 1989;135:2357–2364.
13. Jacob M, Mathai R. Diagnostic efficacy of cutaneous nerve
biopsy in primary neuritic leprosy. Int J Lepr 1988;56:56 – 60.
14. Jardim MR, Antunes SLG, Santos AR, Nascimento OJ, Nery
JAC, Sale AM, et al. Criteria for diagnosis of pure neuritic
leprosy. J Neurol 2003;250:806 – 809.
15. Job CK, Baskaran B, Jayakumar J, Aschhoff M. Histopatholog-
ical evidence to show that indeterminate leprosy may be a
primary lesion of the disease. Int J Lepr 1997;65:443– 449.
16. Job CK, Jayakumaar J, Williams DL, Gillis TP. Role of poly-
merase chain reaction in the diagnosis of early leprosy. Int J
Lepr 1997;65:461– 464.
17. Kaur G, Girdhar BK, Dirdhar A, Malaeiya GN, Mukherjee A,
Sengupta U, et al. A clinical study of neuritic leprosy patients.
Int J Lepr 1991;59:385–389.
18. Kurabachew M, Wondimu A, Ryon JJ. Reverse transcription-
PCR detection of Mycobacterium leprae in clinical specimens.
J Clin Microb 1998;36:1352–1356.
19. Loseke T, Pattyn SR, Mulumba MP, Aseke C, Portaels F,
Fonteyne PA. Evaluation of nested PCR for detection of My-
cobacterium leprae in early stage of leprous neuropathies in the
Democratic Republic of Congo. J Neur Sci 2001;187(Suppl
1):S12.
20. Lucas SB, Ridley DS. The use of histopathology in leprosy
diagnosis and research. Lepr Rev 1989;60:257–262.
21. Mahajan PM, Jogaikar DG, Mehta JM. A study of pure neuritic
leprosy: clinical experience. Indian Lepr 1996;68:137–141.
22. Marques MAM, Mahapatra S, Sarno EN, Santos S, Spencer JS,
Brennan PJ, et al. Further biochemical characterization of
Mycobacterium leprae laminin-binding proteins. Braz J Med Biol
Res 2001;34:463– 470.
23. Matsumara K, Chiba A, Yamada H, Fukuta-Ohi H, Fujita S,
Endo T, et al. A role of distroglycan in schwannoma cell
adhesion to laminin. J Biol Chem 1997;272:13904 –13910.
24. Nadkarni NS, Rege VL. Significance of histopathological clas-
sification in leprosy. Indian J Lepr 1999;71:325–332.
25. Nations SP, Katz SJ, Lyde CB, Barohn RJ. Leprous neuropa-
thy: an American perspective. Semin Neurol 1998;18:113–
124.
MUSCLE & NERVE March 2016 413
26. Negesse Y. Leprous neuritis, classification of leprosy, and
multidrug therapy. Int J Lepr 1988;56:329 –330.
27. Negesse Y. Staging nerve involvement in M. leprae infection.
Int J Lepr 1999;67:167–168.
28. Nilsen R, Mengistu G, Reddy BB. The role of nerve biopsies in
the diagnosis and management of leprosy. Lepr Rev 1989;60:
28 –32.
29. Noordeen SK. Epidemiology of (poly) neuritic type of lep-
rosy. Lepr India 1972;44:90 –96.
30. Pannikar VK, Arunthathi S, Chacko CJ, Fritschi EP. A clinic-
pathological study of primary neuritic leprosy. Lepr India
1983;55:212–221.
31. Rafi A, Donoghue HD, Stanford JL. Application of PCR for
detection of M. leprae DNA in specimens from treated pa-
tients. Int J Lepr 1995;63:42– 45.
32. Ramadan W, Mourad B, Fadel W, Ghoraba E. Clinical, elec-
trophysiological and immunopathological study of peripheral
nerves in Hansen’s disease. Lepr Rev 2001;72:35– 49.
33. Rambukkana A, Salzeer JL, Yurchenco PD, Tuomanem EI.
Neural targeting of Mycobacterium leprae mediated by the G
domain of the laminina-alfa-2 chain. Cell 1997;88:811– 821.
34. Rambukkana A, Yamada H, Zannazi G, Mathus T, Salzer JL,
Yurchenco PD, et al. Role of alpha-dystroglycan as a Schwann
cell receptor for Mycobacterium leprae. Science 1998;282:2076 –
2079.
35. Report of the International Leprosy Association Technical
Forum Paris, France. Diagnosis and classification of leprosy.
Lepr Rev 2002;73:S17–S26.
36. Ridley DS, Jopling WH. Classification of leprosy according to
immunity (A five-group system). Int J Lepr 1966;34:255–273.
37. Ridley MJ, Waters MFR, Ridley DS. Effect of Mycobacterium
leprae in peripheral nerve trunk on the evolution of skin
lesions. Int J Lepr 1994;62:99 –107.
38. Saito F, Masaki T, Kamakura K, Anderson LVB, Fujita S,
Fukuta-Ohi H, et al. Characterization of the transmembrane
molecular architecture of the dystroglycan complex in
Schwann cells. J Biol Chem 1999;274:8240 – 8246.
39. Santos AR, Balassiana V, Oliveira MLW, Pereira MAS, Santos
PB, Degrave WM, et al. Detection of Mycobacterium leprae DNA
by polymerase chain in the blood of individual, eight years
after completion of anti-leprosy therapy. Mem Inst Oswaldo
Cruz 2001;96:1129 –1133.
414 Pure Neural Leprosy
40. Santos AR, De Miranda AB, Sarno EM, Suffys PN, Degrave
WN. Use of PCR-mediated amplification of Mycobacterium lep-
rae DNA in different types of clinical samples for the diagnosis
of leprosy. J Med Microbiol 1993;39:298 –304.
41. Shepard CC, McRae DH. A method for counting acid-fast
bacteria. Int J Lepr 1968;36:78 – 82.
42. Skacel M, Antunes SLG, Rodrigues MAJ, Nery JAC, Valentim
VC, Morais RPB, et al. The diagnosis of leprosy among pa-
tients with symptoms of peripheral neuropathy without cuta-
neous lesions — a follow-up study. Arq Neuropsquiatr 2000;
58:800 – 807.
43. Spierings E, De Boer T, Zulianello L, Ottenhoff THM. The
role of Schwann cells, T cells and Mycobacterium leprae in the
immunopathogenesis of nerve damage in leprosy. Lepr Rev
2000;71(Suppl):S121–S129.
44. Srinivasan H, Ra KS, Iyer CGS. Discrepancy in the histopatho-
logical features of leprosy lesions in the skin and peripheral
nerve. Lepr India 1982;54:275–286.
45. Stoner GL. Importance of the neural predilection of Mycobac-
terium leprae in leprosy. Lancet 1979;2:994 –996.
46. Suneetha S, Arunthathi S, Chandi S, Kurian N, Chacko CJG.
Histological studies in primary neuritic leprosy: changes in
the apparently normal skin. Lepr Rev 1998;69:351–357.
47. Uplekar MW, Antia NH. Clinical and histopathological obser-
vations and pure neuritic leprosy. Indian J Lepr 1986;58:513–
528.
48. Waters MFR, Jacobs JM. Leprous neuropathies. Ballieres Clin
Neurol 1996;5:171–197.
49. Wichitwechkarn J, Karnjan S, Shuntawuttisettee S, Sornprasit
C, Kampirapap K, Peerapakorn S. Detection of Mycobacterium
leprae infection by PCR. J Clin Microbiol 1995;33:45– 49.
50. Woods SA, Cole ST. A rapid method for the detection of
potentially viable Mycobacterium leprae in human biopsies: a
novel application of PCR. FEMS Microbiol Lett 1989;65:305–
310.
51. World Health Organization. Expert Committee on Leprosy.
World Health Organization Technical Report Series. 1998;
874:1– 43.
52. Yoon K, Chao S, Lee SM, Abalos RM, Cellona RV, Fajardo TT
Jr, et al. Evaluation of PCR amplification of M. leprae-specific
repetitive sequence in biopsy specimens from leprosy pa-
tients. J Clin Microbiol 1993;31:895– 899.
MUSCLE & NERVE March 2016