Journal of the Saudi Society of Agricultural Sciences 19 (2020) 521–527

Contents lists available at ScienceDirect

Journal of the Saudi Society of Agricultural Sciences

journal homepage: www.sciencedirect.com

Full length article

The impact of onion-garlic mixture to control of Rhynchophorus

ferrugineus in Saudi Arabia
Laila Ali M. Al-Shuraym a, Lamya Ahmed Al-Keridis a, Abeer Ali Al-Dakhil b, Wedad Saeed Al-Qahtani a,⇑
a
Department of Biology, College of Sciences, Princess Nourah Bint Abdulrahman University, 11474 Riyadh, Saudi Arabia
b
Department of Biology, College of Science, Taibah University, Al-Madinah 41477, Saudi Arabia

a r t i c l e i n f o a b s t r a c t

Article history: Natural pesticide has been used to fight infestations by red palm weevils is the central cause of the dev-
Received 5 June 2020 astation of date palms. This study focuses on controlling Rhynchophorus ferrugineus inhabiting date palms
Revised 10 August 2020 via using natural pesticide created by mixing of onion and garlic extracts without adverse effects dam-
Accepted 7 September 2020
aging palm trees in Saudi Arabia. Moreover, the laboratory analysis in this study evaluated the efficacy
Available online 1 October 2020
and restorative use of onion-garlic mixture for the protection of date palm trees in Saudi Arabia.
This research project aims at examining the value of an onion-garlic mix derived from, onion and garlic
Keywords:
plants. The mixture was assessed by the factors of performance bioassays, larval mortality, fecundity/
Rhynchophorus ferrugineus
Saudi Arabia
sterility, total larval and pupal duration cycle as well as expression of detoxification genes.
Natural biopesticide The results indicate that concentration-mortality were defined in vitro for an onion-garlic mixture uti-
Detoxification genes lized throughout 24-hour interval in relation to newly prepared eighth-instar larvae and pupae. Three
concentrations a mixture based on onion and garlic (especially 30, 40 and 50 mg/ml) tended to demon-
strate enormous toxicity rates in relation to red palm weevil larvae and its pupa. With processing of larval
stage, LC50 and LC90 values for a mixture based on onion and garlic were 37 and 52 mg/ml, respectively
after 24 h of onion-garlic mixture application. Additionally, the pupal phase was assessed with the
onion-garlic mixture and the values of LC50 and LC90 were recorded as 44 and 56 mg/ml, respectively.
Female fecundity of Rhynchophorus ferrugineus was essentially decreased, while sterility rate was ele-
vated through use of a mixture in relation to middle aged eighth-instar larvae and pupal phases. The
results also extended the time of the larval phase. The mixture’s bioactive effect was observed by selec-
tively decreasing gene expressions of Esterase, Glutathione S transferase (GST) and Cytochrome P450.
The findings have been optimistic enough to show that the mixture based on onion and garlic extracts
is quite efficient against Rhynchophorus ferrugineus and can be a helpful and safer option against infesta-
tions instead of toxic chemical pesticides.
Ó 2020 The Authors. Production and hosting by Elsevier B.V. on behalf of King Saud University. This is an
open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

1. Introduction
Phoenix dactylifera L. (Arecales: Arecaceae) or simply date palm
tree remains to be a relevant strategic socioeconomic crop around
the world. Formally, date cultivars are viewed as accessible source
⇑ Corresponding author.
E-mail addresses: aroob6@hotmail.com (L.A.M. Al-Shuraym), lamya.a.k@hotmail.
com (L.A. Al-Keridis), adakhail@taibahu.edu.sa (A. Ali Al-Dakhil), walqahtani@
nauss.edu.sa (W.S. Al-Qahtani).
Peer review under responsibility of King Saud University.
Production and hosting by Elsevier
of food and energy and can be utilized for various industrial pur-
poses (Qadir et al., 2020). Date palm trees are a valuable natural
resource in Saudi Arabia and thus they are planted across the
whole country (Jonoobi et al., 2019). However, these trees are often
infested with multiple insect pests. With infestation onset, target
insects provoke step-by-step progressive damage to the tree, caus-
ing weight loss, nutritional loss, organoleptic loss, and generally
poor quality of grains (Alwahshi et al., 2019; Osuji, 1985). Red palm
weevil (RPW), Rhynchophorus ferrugineus (Olivier) (Coleoptera:
Curculionidae) is considered the most insidious and dangerous
wood pest type which vastly damages date palm trees. The insect
is broadly spread across the globe by occupying and infesting palm
orchards and fruit gardens. It is presented in regions of Southern
Asia, India, UAE, Saudi Arabia, Iran, Egypt, Palestine and Jordan.
RPW usually attacks trees in the amount of almost 40 palm species

https://doi.org/10.1016/j.jssas.2020.09.005
1658-077X/Ó 2020 The Authors. Production and hosting by Elsevier B.V. on behalf of King Saud University.
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Laila Ali M. Al-Shuraym, Lamya Ahmed Al-Keridis, A. Ali Al-Dakhil et al.
(Osuji, 1985), including date palms in Saudi Arabia. Its spread
around the Arabian Peninsula has started rapidly since 1985 (Al-
Dosary et al., 2016). Adult females of R. ferrugineus are attracted
by trees’ volatile aroma which serves as a signal to lay eggs. As a
result, damaging larva occupy the trees. Larvae penetrate the palm
tissue provoking huge inner damage that is usually complicated to
identify at the early phase of infestation (Yuezhong et al., 2009).
The Food and Agriculture Organization (FAO) marks R. ferrugineus
as a category-1 pest affecting date palms in the region of the Mid-
dle East (Abou-Zaid and Arnason, 2002; Faleiro, 2006). Increased
fertility, issues of early identification, large scales of young planta-
tions to control, and poor quarantine measures to assure protec-
tion of non-affected plants have dramatically contributed to the
quick distribution of RPW in numerous date palm farms
(Alhudaib et al., 2009).
Due to unsafe and damaging effects of existing insecticides and
ongoing economic loss provoked by the selected pest (Qadir et al.,
2020; Jonoobi et al., 2019; Osuji, 1985; Abou-Zaid and Arnason,
2002), alternative methods to ensure efficient, safe and affordable
control of infestation have been actively studied. One of the
promising directions is to prepare the natural pesticides from plant
extracts to control the infestations with minimal harm to the palm
trees.
Plants such as garlic (Allium sativum) and onion (Allium cepa)
have been reported in their ability to insects’ repulse. The best
example is the Cole crops that grown next to onion and garlic with
less prone to attacks of insect pests. Onion and garlic plants were
released aromas from the leaves and excretions also from the roots.
Their aromas and excretions discouraged attacks of insects and are
therefore considered as plants of insect repellent (Debra and
Misheck, 2014). Both Garlic (Allium sativum) and onion (Allium
cepa) are quite prevalent food products broadly used in different
world cultures (Debra and Misheck, 2014). The essential bioactive
organic component, allicin, represents the edible bulb developed
by a plant from the lily family (Livak and Schmittgen, 2001). In
the present study, it was hypothesized that onion and garlic mix-
ture also have significant insecticidal activity against Red palm
weevil (RPW).
The current study aimed at examining the specific natural
biopesticide composed of onion and garlic extracts to cope with
RPW attacking date palm trees via two certain tests: (1) Laboratory
bioassay for monitoring the efficacy of onion-garlic mixture in
terms of mortality of RPW larva, (2) Effect of onion-garlic mixture
on expression of detoxification genes Glutathione S transferase
(GST), Cytochrome P450, and Esterase in the RPW larvae using
molecular tools (real-time PCR), and (3) Effect of onion-garlic mix-
ture on fecundity and sterility rate in female RPW.
2. Material and methods
2.1. Insects collection
The current study represents field experiments that were con-
ducted on several breeding locations of RWP at Riyadh. The field
research for this project did not implicate the regular permission
usually required at this site to complete an official research. The
population sample of Red palm weevil (RPW) was taken naturally
and directly from infested palm trees planted in the outskirts of
Riyadh, Saudi Arabia (Fig. 1). At the night, 10 red palm weevil
(RPW) adults for each experiment (male and female) and 10 con-
trols (untreated) were collected. Afterwards, the samples were
transformed into a culture supported under controlled terms in
the laboratory growth chamber at 30 ± 1 °C, 75% ± 5% relative
humidity (RH) and 12:12 photoperiods. Red palm weevil (RPW)
522
Journal of the Saudi Society of Agricultural Sciences 19 (2020) 521–527
Fig. 1. The palm tree’s decay was infested by RPW in the stem, Riyad, Saudi Arabia.
A close-up view of the area was destroyed because of infestation by adults RPW
with their larvae which dug the palm’s stem via its mouth (marked by blue circle).
adults were fed using sugarcane stems for feeding as described
in (Carson, 1987).
2.2. Preparing the onion-garlic mixture
Fresh bulbs of both onion and garlic were successfully gathered
from Saudi farm at Qassim, Saudi Arabia. They were cleaned,
peeled, and chopped into minor pieces were grounded with a help
of the electric blender. The plant’s porridge was placed into sterile
containers.
In next step, watery extracts were produced by soaking and
absorbing 200 g for each of onion and garlic into 200 ml water.
The raw concentrate was then centrifuged for 15 min at
3000 rpm and 4℃. The watery plant extract was then lyophilized
with a help of vacuum freeze-dryer (Model FDF 0350, Korea).
The extracts prepared were marked as the 100% mixture. In this
mix, 50% dilutions were prepared using water. Final dilutions were
blended with a homogenizer to enhance their homogeneity.
2.3. Restorative method
In vitro testing of bio-insecticidal activity was fulfilled through
five separate concentrations 10, 20, 30, 40 and 50 mg/ml for 24 h.
Meanwhile, 25 middle age (eighth instar) RPW larvae and pupa/-
concentrations were fed with the help of specially synthesized
diet along 24 h within perforated plastic bowls. Sugarcane stem
pieces were used as artificial feeding in plastic containers with dif-
ferent concentrations of onion-garlic mixture, a relative humidity
of 70 ± 5%, 12:12 photoperiods, and kept at 26 ± 2 °C ambient tem-
perature (El-Zoghby and Abdel-Hameid, 2018). The process was
repeated five times, with each repetition set incorporating one
control.
2.4. Bioassays and larval mortality
Bioassays were completed on the eighth stage of larval and
pupa development of RPW implementing all five composures. To
evaluate the efficiency and value of the concentrations selected
on the mortality rate, 25 eighth-instar larvae and pupae were put
in 250 ml plastic test tube holding different composures of the
mixture based on onion and garlic. The processing was repeated
for five times. Each repetition set incorporated one control. Every
testing unit was supported within the growth chamber at specific
conditions, namely 30 ± 1◦C, 75% ± 5% RH. The mortality rate was
measured by utilizing the following formula (1) for the 24-hour
interval of post-feeding.
Laila Ali M. Al-Shuraym, Lamya Ahmed Al-Keridis, A. Ali Al-Dakhil et al.
Corrected mortalityð%Þ ¼
%mortality in treated  % mortality in control
100  % mortality in control
Abbott formula for infestation or live individual, where N
(insect population).
The total and fixed larval mortality data was angularly reshaped
for further data homogenization. Homogenized total mortality data
was then evaluated by reiterated ANOVA measures at various time
intervals utilizing the Fisher’s LSD test (Corzo-Martínez et al.,
2007). Probit analysis method was then completed to define the
lethal concentration (LD50) of the mixture representing 50% of lar-
val mortality of RPW.
2.5. Fecundity and sterility
The fecundity and fertility tests have been performed by select-
ing equal amount of RPW males and females emerged from the
control and processing sets of each composition. The mating of
species was arranged in the cages of (25  25  25) cm, separately
for each concentration and composure. Species were fed for 24 h
without external treatment. Afterwards, their eggs were taken
and measured in detail. The fecundity rate was measured by the
amount of eggs laid in the meshed cages, which were divided by
the number of females selected for mating. Importantly, the deaths
of the adult insects during the test were also taken into consider-
ation. The Sterility Indices from tests were calculated using the fol-
lowing formula (2) developed in the study by Saxena et al. (Al-
Snafi, 2013):
N of eggs of females ðtreatedÞ  Fecundity
SI ¼ 100 
N of eggs of females ðcontrolÞ  Fecundity
* Percentage of hatch represent (Fecundity)
2.6. Total larval and pupal duration
To properly analyze the development factors of RPW, a selected
solution of the concentrated onion-garlic mixture (10, 20, 30, 40
and 50 mg/ml) for 24 h was prepared and utilized. A considered
amount of eggs was prepared to hatch. The whole larval interval
(measured in days) has been computed covering periods from
hatching to pupation. Moreover, the pupa was put in a separate
container covered by a transparent net, keeping the adult species
in isolation. The pupal growth (measured in days) was computed
covering the periods from the pupal molt to the full development
of imago.
2.7. RNA isolation and cDNA synthesis
The eighth-instar RPW larvae’s whole-gut portion taken from
the alimentary canal was utilized to define the expression samples
and patterns of cytochrome P450, glutathione S-transferase, as well
as esterase. Five copies of samples were prepared and divided by
five separate larval gut portions (within treated and control
groups). In terms of completing the dissection in saline, the mid-
gut sample of each selected larva was successfully ground in liquid
nitrogen to ensure complete RNA extraction with a help of
RNeasyÒ Universal Mini Kit (Qiagen Cat No 73404) according to
the manufacturer’s proposing standards and recommendations.
Total RNA of each sample was extracted and subsequently used
for cDNA preparation using cost saving kit (Clontech Cat #
6110A). The first strand cDNA engineered for each response was
kept at  20 ◦C.
Journal of the Saudi Society of Agricultural Sciences 19 (2020) 521–527
2.8. Effect of onion-garlic mixture on the mRNA expression of
ð1Þ detoxification genes
The detoxification genes were Glutathione S transferase (GST) F:
50 -ATAGCCAACCACCACTGTCG-30 and R: 50 -
CGTTCCTCTTGCCGCTAGTT-30 with accession number KR902496;
Esterase F: 50 -ACCTACAAGAATCCGACGCC-30 and R: 50 -
ACTCCGAAACTTTGGGCCAT-30 with accession number KT748822;
Cytochrome P450 F: 50 TGGAGAAACACCCGCAAGAA-30 and R: 50 -C
GGCGATTTTGCCTACCAAG-30 with accession number KT748789;
and b-Actin F: 50 -AAAGGTTCCGTTGCCCTGAA-30 and R: 50 -
TGGCGTACAAGTCCTTCCTG 30 with accession number
KM438516, created using NCBI, have been bought from Macrogen
Company, South Korea. b-Actin was utilized as an integrated con-
trol. Quite diverse expressions of GST, Esterase, and Cytochrome
P450 utilizing SYBRÒ Premix Ex TaqTM II kit (TaKaRa Clontech,
France) in CFX96 Touch TM (Bio-Rad, UK) following the manufac-
turer’s recommendations and via qRT-PCR.
Quantitative values derived from every testing unit were finally
contrasted with of the ones from the control using the relative fold
expression derived by converting the received values and out-
comes into absolute values by applying 2  DDCt (Livak and
Schmittgen, 2001). Significantly, each relative gene expression
was set to 1 in relation to the reference housekeeping gene in
untreated (control) sample.
2.9. Statistical evaluation
Statistical evaluations were conducted with a help of SigmaStat
software version 3.5 (Systat Software, San Jose, CA, USA). Varia-
ð2Þ tions and changes in mortality rates of feeding based the diet
selected for the various experimental concentrations and the
numerical gene expressions. Therefore, the recorded numerical
values for each gene were contracted with the values of controls
and transformed into absolute values as relative fold expressions
by using 2-DDCt. All the values were indicated as mean ± SEM. P val-
ues < 0.05 were considered as statistically important and valid.
3. Results
3.1. Insecticidal activity of an onion-garlic mixture
Table 1 demonstrates that insecticidal activity concentration–
response ratio was defined for an onion-garlic mixture utilized
for 24-hour interval in relation to newly prepared eighth-instar
larvae and pupae.
The mortality rates have been marked as elevated for 8th instar
(Table 1) and toward pupa formation phase (Table 2). Concerning
eighth-instar stage, the mortality percentages were recorded
according to the tested concentration and resulted in: 10 mg/ml =
36.25%; 20 mg/ml = 40.87%; 30 mg/ml = 44.31%; 40 mg/ml = 63.56
% and 50 mg/ml = 91.31% of mortality rate (Table 1). By including
probit analysis, the LC50 was computed as 37.3 mg/ml (95%
CI = 36.23 – 38.34 mg/ml; n = 75; Slope = 2.59 ± 0.876), the LC90
was computed as 52.3 mg/ml concentration and resulted in
95.12% of mortality rate.
For the pupal stage, the mortality percentages were also
recorded according to the tested concentration: 10 mg/ml = 33.84
%; 20 mg/ml = 38.17%; 30 mg/ml = 42.31%; 40 mg/ml = 48.27% and
50 mg/ml = 87.56% of mortality rate (Table 2). In terms of using pro-
bit analysis, the LC50 reached 44.5 mg/ml (95% CI = 42.56 – 46.48 mg/
ml/l; n = 75; Slope = 1.82 ± 0.635), LC90 was scored as 56.5 mg/ml
concentration and resulted in 93.11% of mortality rate.
523
Laila Ali M. Al-Shuraym, Lamya Ahmed Al-Keridis, A. Ali Al-Dakhil et al. Journal of the Saudi Society of Agricultural Sciences 19 (2020) 521–527

Table 1
Insecticidal activity of aqueous plant mixture: Larval mortality (%) (mean ± SEM) of Rhynchophorus ferrugineus at 24 h after exposure to aqueous plant mixture.

Concentration (mg/ml) Mortality (%) LC50 95%Confidancelimits LC90 (mg/ml) Slope ± S.E. Chi2
(mg/ml) (mg/ml) (n = 75)

Lower Upper
0 0
10 36.25 ± 1.215
20 40.87 ± 0.562
30 44.31 ± 0.813 37.3 36.23 38.34 52.3 2.59 ± 0.876 0.796
40 63.56 ± 0.477 after
50 91.31 ± 0.391 24 h

Table 2
Insecticidal action of different concentrations of aqueous onion-garlic mixture at 24 h after expsoure against newly ecdysed pupae of Rhynchophorus ferrugineus.

Concentration (mg/ml) Mortality (%) LC50 95%Confidancelimits LC90 (mg/ml) Slope ± S.E. Chi2
(mg/ml) (mg/ml) (n = 75)

Lower Upper
0 0
10 33.84 ± 0.872
20 38.17 ± 1.047
30 42.31 ± 0.628 44.5 42.56 46.48 56.5 1.82 ± 0.635 0.266
40 48.27 ± 0.501 after
50 87.56 ± 0.694 24 h

3.2. Effect on Fecundity, sterility and growth

Fecundity rates have also been dramatically declined after 24 h

of the application of the onion-garlic mixture. In (Fig. 2a), the
fecundity rates showed significant decreased in adults when they
were eighth-instar larvae and treated with onion-garlic mixture
as following: 10 mg/ml = 89.73% (p < 0.05), 20 mg/ml = 70.21%
(p < 0.01) and the highest three concentrations: 30 mg/ml = 51.26
%, 40 mg/ml = 30.41% and 50 mg/ml 1.02% (p < 0.001). On another
hand, the fecundity rates were significantly decreased in adults
when they were pupa stage and treated with all the tested concen-
trations of onion-garlic mixture except (10 mg/ml = 95.73%) was Fig. 3. Sterility Indices of Rhynchophorus ferrugineus female species 24 h post-
not significant. Therefore, the significant reduction was only feeding of eighth instars (a) and pupae phases (b) with the onion-garlic mixture.
observed in 20 mg/ml = 79.21% (p < 0.01) and also the highest three Data following by ***P < 0.001, **P < 0.01, *P < 0.05 are essentially different from
concentrations: 30 mg/ml = 61.19%, 40 mg/ml = 54.14% and 50 mg/ control, n = 25.
ml = 0.89% (p < 0.001) as shown in (Fig. 2, b) (see Fig. 3.).

Fig. 2. Fecundity of Rhynchophorus ferrugineus female species 24 h post-feeding (a) in eighth-instars and (b) in pupae phases with the onion-garlic mixture. Data following by
***P < 0.001, **P < 0.01, *P < 0.05 are essentially different from control, n = 25.

524
Laila Ali M. Al-Shuraym, Lamya Ahmed Al-Keridis, A. Ali Al-Dakhil et al. Journal of the Saudi Society of Agricultural Sciences 19 (2020) 521–527

Fig. 4. Expression level of detoxification genes in R. ferruginous larva fed over artificial diet mixed with different concentrations of onion-garlic mixture, P450 (a), GST (b) and
Esterase (c) in the whole-gut of Rhynchophorus ferruginous eighth-instar larvae using qRT-PCR. The recorded numerical values for each gene were contracted with the values of
controls and transformed into absolute values as relative fold expressions by using 2-DDCt. Data following by ***P < 0.001, **P < 0.01, *P < 0.05 are essentially different from
control, n = 25.

Sterility indices of adult species have been remarkably elevated
in terms of utilizing the onion-garlic mixture. Sterility indices were
significantly increased in female species when they were eighth-
instar larvae and treated with onion-garlic mixture as following:
10 mg/ml = 35.42%, 20 mg/ml = 47.38%, 30 mg/ml = 52.67%,
40 mg/ml = 84.93% and 50 mg/ml 91.89% (p < 0.001), (Fig. 4a). In
addition, sterility indices recorded significant increased in female
species when they were pupa and treated with onion-garlic
mixture as following: 10 mg/ml = 30.58%, 20 mg/ml = 40.69%,
30 mg/ml = 49.43%, 40 mg/ml = 74.12% and 50 mg/ml 83.55%
(p < 0.001), (Fig. 4, b). The mixture based on onion and garlic
hugely affected the female species’ fecundity, making only a lim-
ited number of adults to survive.
The duration time of 8th larval instar to 9th larval instar as well
as the pupal stages showed significant (p < 0.001) delayed in
growth and extended in duration time after 24 h of treatment with
Table 3
Effect of the onion-garlic mixture towards newly ecdysed eighth-instar larvae of
Rhynchophorus ferrugineus on the development time.
the tested concentrations of onion-garlic mixture except 10 mg/ml
concentration (Table 3).
3.3. Regulation of detoxification genes of Red palm weevils in response
to onion-garlic mixture
3.3.1. Cytochrome P450 gene expression of Red palm weevil larvae
The numerical expression of Cytochrome P450 indicated of
essential variations. Larvae nourished on a specifically prepared
diet filled with the onion-garlic mixture dramatically decreased
the expression of detoxification gene expression of Cytochrome
P450 at the concentrations (i.e.10, 20 and 30 mg/ml) of the onion-
garlic mixture with high and significant scores (p < 0.05) in com-
parison to the untreated larvae (control) and other concentrations.
The onion-garlic mixture composures prepared for the experiment
(40 and 50 mg/ml) significantly (p < 0.01) reduced expression of
Cytochrome P450 gene at diverse stages referring to the concentra-
tions examined (Fig. 4a).

Concentration (mg/l) After 24 h post-feeding duration (days) Mean ± SE 3.3.2. Glutathione S-Transferase gene expression of Red palm weevil
8th
larval instar to 9th
larval instar Pupal stage
larvae
Of all available concentrations of the mixture, (10 and 20 ug/ml)
0 8.73 ± 1.95 23.24 ± 1.15
10 8.92 ± 1.24 23.69 ± 1.60
significantly decreased GST expression (p < 0.05) in RPW larvae. Syn-
20 9.45 ± 2.03 24.92 ± 1.14 thesized diet filled with high portions of the developed mixture (30,
30 11.42 ± 1.86 25.37 ± 0.78 40 and 50 mg/ml) leading to significant (p < 0.01) reduced expres-
40 14.57 ± 0.91 25.89 ± 0.96 sions of GST at various stages contrasted to the low composures
50 16.34 ± 1.78 26.60 ± 1.69
(10 and 20 mg/ml) of the mixture and untreated larvae (Fig. 4b).
525
Laila Ali M. Al-Shuraym, Lamya Ahmed Al-Keridis, A. Ali Al-Dakhil et al.
3.3.3. Esterase gene expression of Red palm weevil larvae
Furthermore, the concentrations of the mixture (10, 20, 30, 40
and 50 ug/ml) were recorded highly significant (p < 0.01)
decreased Esterase gene expression of RPW larvae in contrast to
the untreated RPW larvae samples (Fig. 4c).
4. Discussion
Empirically, the current research has shown that the use of an
onion-garlic mixture significantly influenced the growth and mor-
tality of RPW in Saudi Arabia. The experiments have revealed that
the onion-garlic mixture is greatly efficient in the role of insecticide.
The toxicity shown by onion-garlic mixture in present study is
likely due to the bio-active sulfur present in garlic, specifically
when garlic is collapsing or being cut. According to the previous
study, garlic contains specific various compositions such as; Alline
(provokes strong garlic aroma), Alline (without aroma), ajoene (nat-
ural disulfide), diallyl sulfide (DAS), diallyl disulfide (DADS), diallyl
trisulfide (DAT), S-allylcysteine (SAC), organosulfur concentrations,
and allyl sulfur concentrations (Carson, 1987; Kovarovič et al.,
2019).
The current study reveals that the extracts of onion-garlic were
toxic to RPW. The mortality of RWP was concentration dependent
of onion-garlic mixture, thus supporting previous findings on the
toxicity effect originated from these elements in the experimental
mixture and hence becoming strong against pest insects.
Nourishing of the eighth-instar RPW larvae via selected diet
filled with various concentrations of onion-garlic mix ensured
observable increase in mortality after 24 h mainly for the three
prepared concentrations, such as 20%, 30% and 50%. These results
correlated with findings from other similar thematic studies such
as sterilization effects (Zhou et al., 2016), or direct mortality effects
(Gahukar, 2011).
Prowse et al., (Wahyuni et al., 2019) indicated about the insec-
ticidal activity caused by the Allium sativum and Allium cepa
extracts in two dipteran pests. Researchers highlighted that Allium
sativum and Allium cepa extracts were found efficient to affect all
life phases of two selected insects (Kamenetsky et al., 2015).
It has also been stated in previous studies that the raw or par-
tially cleaned plant extracts are cheaper and more efficient for cop-
ing with RPW as compared to the totally pure extracts (Romeilah
et al., 2010). Both plant extracts were blended to accelerate and
increase the toxicity at the larva and pupa phases of development
(Corzo-Martínez et al., 2007; Bisen and P., & Emerald, M., 2016;
Ahmad et al., 2019). It is worth mentioning that no studies have
been provided information previously about garlic and onion mix-
ture to fight and control RPW. Instead, there are several research
projects where garlic or onion was applied to fight other species
of insects, still demonstrating high toxicity rates on different insect
stages (Romeilah et al., 2010; Gahukar, 2011; Hikal et al., 2017).
Increased larval mortality of RPW was also associated with the syn-
thesized treatment filled with the organic concentrations of the
onion-garlic mixture varied from 30 to 50 mg/ml. Additionally, the
pupal stage was monitored after the processing with the mixture’s
composures varied from 40  50 mg/ml. The vulnerable RPW larvae
did not manage to resist the toxicity of the prepared mixture.
On the other hand, the factors of fertility, sterility, and growth
regulation of insects are the most relevant physiological variables
that are affected by the onion-garlic mixture. Thus, after 24 h after
feeding eighth-instar larvae and pupae by the mixture prepared,
fecundity of insects dropped significantly, and sterility indices ele-
vated. This is rationalized by the fact that the family of Allium Sati-
vum naturally developed strong insecticide-related properties
(Martins et al., 2016; Kovarovič et al., 2019). The processing of
RPW larvae to sub-lethal concentrations of the prepared mixture
of onion-garlic extracts in the laboratory terms extended the larval
526
Journal of the Saudi Society of Agricultural Sciences 19 (2020) 521–527
phase of development (Gahukar, 2011). In the field conditions, pro-
longed phenology of survived larvae, delayed oviposition and
decreased pupal weight usually happen after processing with
neem (Saxena et al., 1993; Kovarovič et al., 2019).
Even though the minimal concentrations of the mixture (10 and
20 ug/ml) slightly (P < 0.05) reduced P450 and GST and gene
expression of RPW larvae while they were markedly (P < 0.01)
reduced the expression of Esterase. In addition, the maximum con-
centrations (30, 40 and 50 mg/ml) significantly (P < 0.01) decreased
the expression of all three genes studied, these results have posi-
tive correlations with mortality outcomes because of the strong
toxicity effect of the selected mixture on RPW populations
(Hussain et al., 2015; Kovarovič et al., 2019), and caused steriliza-
tion effects via increasing sterility indices on the alive RPW adults.
Moreover, onion-garlic mixture affected female fecundity by
decreasing the fecundity rates, thus reducing the percentages of
eggs hatching y (Livak and Schmittgen, 2001).
Concluding all ideas and remarks, these findings are valid
enough to strongly assume that the mixture based on onion and
garlic which is used in 24-hour treatment directly impacts the
expressions of several detoxification genes, which eventually influ-
ences the mortality rates at least LD50 value to the concentration
(37 mg/ml) for the eighth-instar larvae stage as well as (44 mg/ml)
for the pupal stage. In addition, the delayed larval growing period,
extended phenology of survival and prolonged time of larval
instars, decreased fecundity and increased sterility indices of adult
species were found to be the central patterns of the experiment.
Declaration of Competing Interest
The authors declare that they have no known competing finan-
cial interests or personal relationships that could have appeared
to influence the work reported in this paper.
Acknowledgment
This research was funded by the Deanship of Scientific Research
at Princess Nourah Bint Abdulrahman University through the
Fast-track Research Funding Program.
Data Availability
All relevant data are within the paper.
References
Qadir, A., Shakeel, F., Ali, A., Faiyazuddin, M., 2020. Phytotherapeutic potential and
pharmaceutical impact of Phoenix dactylifera (date palm): current research and
prospects. J. Food Sci. Technol. 57 (4), 1191–1204.
Jonoobi, M., Shafie, M., Shirmohammadli, Y., Ashori, A., Hosseinabadi, H.Z.,
Mekonnen, T., 2019. A Review on Date Palm Tree: Properties, Characterization
and Its Potential Applications. J. Renew. Mater. 7 (11), 1055–1075.
Alwahshi, K.J., Saeed, E.E., Sham, A., Alblooshi, A.A., Alblooshi, M.M., El-Tarabily, K.A.,
AbuQamar, S.F., 2019. Molecular identification and disease management of date
palm sudden decline syndrome in the United Arab Emirates. Int. J. Mol. Sci. 20
(4), 923.
Osuji, F., 1985. Outlines of stored products entomology for the tropics. Fourth
Dimension Publishers.
Al-Dosary, N.M., Al-Dobai, S., Faleiro, J.R., 2016. Review on the management of red
palm weevil Rhynchophorus ferrugineus Olivier in date palm Phoenix
dactylifera L Emirates. J. Food Agri., 34–44
Abou-Zaid, M., Arnason, J.T., 2002. Natural Products: Chemistry, Distribution,
Bioactivities and Novel Biotechnological Applications in Forestry. In: In
Proceedings-Plant Growth Regulation Society of America-Annual Meeting, pp.
24–30.
Alhudaib, K., Arocha, Y., Wilson, M., Jones, P., 2009. Molecular identification,
potential vectors, and alternative hosts of the phytoplasma associated with a
lime decline disease in Saudi Arabia. Crop Prot. 28 (1), 13–18.
Faleiro, J.R., 2006. A review of the issues and management of the red palm weevil
Rhynchophorus ferrugineus (Coleoptera: Rhynchophoridae) in coconut and
Laila Ali M. Al-Shuraym, Lamya Ahmed Al-Keridis, A. Ali Al-Dakhil et al.
date palm during the last one hundred years. Int. J. Trop. Insect Sci. 26 (3), 135–
154.
Wahyuni, D., Sari, N.P., Hanjani, D.L., 2019. White Onion (Allium sativum) Extract as
a Vegetable Larvicide in Blowfly (Calliphoridae) Control. KEMAS: Jurnal
Kesehatan Masyarakat 15 (2), 247–256.
Yuezhong, L., Zeng-Rong, Z., Ruiting, J., Lian-Sheng, W., 2009. The red palm weevil,
Rhynchophorus ferrugineus (Coleoptera: Curculionidae), newly reported from
Zhejiang, China and update of geographical distribution. Florida Entomolog. 92
(2), 386–387.
Debra, K.R., Misheck, D., 2014. Onion (Allium cepa) and garlic (Allium sativum) as
pest control intercrops in cabbage-based intercrop systems in Zimbabwe. IOSR
J. Agri. Veterinary Sci. 7 (2), 13–17.
Hussain, A., Rizwan-ul-Haq, M., Al-Ayedh, H., Ahmed, S., Al-Jabr, A.M., 2015. Effect
of Beauveria bassiana infection on the feeding performance and antioxidant
defense of red palm weevil. Rhynchophorus ferrugineus. BioControl 60 (6),
849–859.
El-Zoghby, I.R.M., Abdel-Hameid, N.F., 2018. Rearing of the red palm weevil,
Rhynchophorus ferrugineus (Olivier) on different natural diets. Bio-Pestic. Biol.
Control, 509–518.
Saxena, R.C., Harshan, V., Saxena, A., Sukumaran, P., Sharma, M.C., Kumar, M.L.,
1993. Larvicidal and chemo sterilant activity of Annona squamosa alkaloids
against Anopheles stephensi. J. Amer. Mosq. Control. Assoc. 9, 84–87.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2 DDCT method. Methods 25 (4), 402–408.
Carson, J.F., 1987. Chemistry and biological properties of onions and garlic. Food
Rev. Int. 3 (1–2), 71–103.
Corzo-Martínez, M., Corzo, N., Villamiel, M., 2007. Biological properties of onions
and garlic. Trends Food Sci. Technol. 18 (12), 609–625.
527
Journal of the Saudi Society of Agricultural Sciences 19 (2020) 521–527
Al-Snafi, A.E., 2013. Pharmacological effects of Allium species grown in Iraq. An
overview. Int. J. Pharm. Health Care Res. 1 (4), 132–147.
S Bisen, P., & Emerald, M. (2016). Nutritional and therapeutic potential of garlic and
onion (Allium sp.). Current Nutrition & Food Science, 12(3), 190-199.
Martins, N., Petropoulos, S., Ferreira, I.C., 2016. Chemical composition and bioactive
concentrations of garlic (Allium sativum L.) as affected by pre-and post-harvest
conditions: A review. Food Chem. 211, 41–50.
Ahmad, P., Alvi, S.S., Khan, M.S., 2019. Functioning of Organosulfur Concentrations
from Garlic (Allium sativum Linn) in Targeting Risk Factor-Mediated
Atherosclerosis: A Cross Talk Between Alternative and Modern Medicine. In
Natural Bio-active Concentrations. Springer, Singapore, pp. 561–585.
Kamenetsky, R., Faigenboim, A., Mayer, E., 2015. Integrated transcriptome catalogue
and organ-specific profiling of gene expression in fertile garlic (Allium sativum
L.). Bmc Genomics 16 (1). 12–12.
Kovarovič, J., Bystricka, J., Vollmannova, A., Toth, T., Brindza, J., 2019. Biologically
valuable substances in garlic (Allium sativum L.) A review. J. Central European
Agri. 20 (1), 292–304.
Zhou, F., Zhu, G., Zhao, H., Wang, Z., Xue, M., Li, X., Liu, Y., 2016. Sterilization effects
of adult-targeted baits containing insect growth regulators on Delia Antiqua.
Sci. Rep. 6 (1), 1–9.
Romeilah, R.M., Fayed, S.A., Mahmoud, G.I., 2010. Chemical compositions, antiviral
and antioxidant activities of seven essential oils. J. Appl. Sci. Res. 6 (1), 50–62.
Gahukar, R.T., 2011. Entomophagy and human food security. Int. J. Trop. Insect Sci.
31 (3), 129–144.
Hikal, W.M., Baeshen, R.S., Said-Al Ahl, H.A., 2017. Botanical insecticide as simple
extractives for pest control. Cogent Biol. 3 (1), 1404274.