Life Sciences 248 (2020) 117456

Contents lists available at ScienceDirect

Life Sciences
journal homepage: www.elsevier.com/locate/lifescie

Mechanism of berberine in treating Helicobacter pylori induced chronic T

atrophic gastritis through IRF8-IFN-γ signaling axis suppressing
Tao Yanga, Ruilin Wangb, Jianzhong Zhangc, Chunmei Baod, Juling Zhangd, Ruisheng Lie,
Xing Chenf, Shihua Wuf, Jianxia Wenf, Shizhang Weig, Haotian Lig, Huadan Caig,
⁎ ⁎⁎
Xiangdong Yangh, , Yanling Zhaog,
a
College of Clinical Medicine, Chengdu University of Traditional Chinese Medicine, No. 37, 12 Bridge Road, Chengdu 610075, PR China
b
Integrative Medical Center, The Fifth Medical Center of PLA General Hospital, Beijing 100039, PR China
c
Center of Disease Control and Prevention, National Institute for Communicable Disease Control and Prevention, Beijing 100039, PR China
d
Division of Clinical Microbiology, The Fifth Medical Center of PLA General Hospital, Beijing 100039, PR China
e
Research Center for Clinical and Translational Medicine, The Fifth Medical Center of PLA General Hospital, Beijing 100039, PR China
f
College of Pharmacy, Chengdu University of Traditional Chinese Medicine, Chengdu 611137, PR China
g
Department of Pharmacy, The Fifth Medical Center of PLA General Hospital, Beijing 100039, PR China
h
Colorectal and Anal Surgery, Chengdu Anorectal Hospital, No 152 Daqiang East Street, Taisheng South Road, Chengdu 610075, PR China

A R T I C LE I N FO A B S T R A C T

Keywords: Aims: In this study, we will investigate the therapeutic effects of berberine (BBR) in Helicobacter pylori (H. pylori)
Chronic atrophic gastritis induced chronic atrophic gastritis (CAG). Furthermore, potential mechanisms of BBR in regulating IRF8-IFN-γ
Helicobacter pylori signaling axis will also be investigated.
Berberine Materials and methods: H. pylori were utilized to establish CAG model of rats. Therapeutic effects of BBR on
IRF8
serum supernatant indices, and histopathology of stomach were analyzed in vivo. Moreover, GES-1 cells were
IFN-γ
infected by H. pylori, and intervened with BBR in vitro. Cell viability, morphology, proliferation, and quanti-
tative analysis were detected by high-content screening (HCS) imaging assay. To further investigate the potential
mechanisms of BBR, relative mRNA, immunohistochemistry and protein expression in IRF8-IFN-γ signaling axis
were measured.
Key findings: Results showed serum supernatant indices including IL-17, CXCL1, and CXCL9 were downregulated
by BBR intervention, while, G-17 increased significantly. Histological injuries of gastric mucosa induced by H.
pylori also were alleviated. Moreover, cell viability and morphology changes of GES-1 cells were improved by
BBR intervention. In addition, proinflammatory genes and IRF8-IFN-γ signaling axis related genes, including
Ifit3, Upp1, USP18, Nlrc5, were suppressed by BBR administration in vitro and in vivo. The proteins expression
related to IRF8-IFN-γ signaling axis, including Ifit3, IRF1 and Ifit1 were downregulated by BBR intervention.

Significance system. Abdominal pain, bloating, abdominal discomfort, loss of ap-

Berberine possesses therapeutic effects on CAG induced by H. pylori
via chronic inflammation inhibition. The anti-inflammatory properties
of BBR tightly related to suppression of IRF8-IFN-γ signaling axis, which
is crucial in Th1 cell-dominant inflammatory response.
1. Introduction
Chronic atrophic gastritis (CAG) is a prevailing disease in digestive
petite and secondary anemia, weight loss are classical symptoms of
CAG. The pathological features of CAG are characterized by chronic
inflammatory processes of gastric mucosa, altered mucosal atrophy and
intestinal metaplasia (especially incomplete colonization) [1]. CAG
have served as the main stages of precancerous lesion of gastric cancer
(PLGC) and may evolve into irreversible tumorigenesis [2]. Up to now,
the mechanisms of CAG have not been fully investigated. However,
there exist a lot of evidence declare Helicobacter pylori (H. pylori) is the
leading risk factor of CAG [3–6]. H. pylori is a kind of Gram-negative

⁎
Corresponding author.
⁎⁎
Correspondence to: Y. Zhao, Department of Pharmacy, The Fifth Medical Center of PLA General Hospital, No 100 West Fourth Ring Middle Road, Beijing 100039,
PR China.
E-mail addresses: y-xd@vip.163.com (X. Yang), zhaoyl2855@126.com (Y. Zhao).

https://doi.org/10.1016/j.lfs.2020.117456
Received 11 January 2020; Received in revised form 15 February 2020; Accepted 19 February 2020
Available online 22 February 2020
0024-3205/ © 2020 Published by Elsevier Inc.
T. Yang, et al.
anaerobic bacterium and has been defined as I class of carcinogenic
factors [7]. More than 50% of the world's population is infected with H.
pylori [8]. The urease apoenzyme encoded by ureA and ureB of H. pylori
is capable of employing acid acclimation, combating gastric acidity,
allowing gastric colonization [9,10]. Colonization of H. pylori in hu-
mans stomach mucosa could induce various inflammatory processes,
including innate and adaptive mucosal inflammation [11,12]. H. pylori
infection in stomach mucosa has been recognized as the primary cause
of many stomach diseases, including chronic gastritis, peptic ulcers,
lymphoma of mucosa-associated lymphoid tissue (MALT lymphoma)
and gastric adenocarcinoma [13].
It has been reported that Interferon regulatory factor 8 (IRF8) in
stomach tissues when H. pylori infection became increased expression,
and Interferon-gamma (IFN-γ) acted as major regulator of IRF8 in H.
pylori induced inflammatory process [14]. IRF8 is a transcription factors
that is induced by interferons (IFNs) in a wide range of cell types [15].
IRF8 plays essential roles in cellular differentiation and function
[16,17]. Developing lymphoid and myeloid cells express stable IRF8.
When binding to a partner molecule or specific DNA sequences, all
activities of IRF8 are activated and asserts its transcriptional regulatory
activity strongly [18]. Previous studies have illustrated interferon (IFN)
is one of the strongest inducers of IRF8 transcription. IFN-c-activated
factor (GAF), is the resultant dimer of IFN, could bind to the IFN-c
activated site (GAS) and then upregulate IRF8 [19,20]. IFN-γ is a kind
of T helper cell 1 (Th1) cytokines, may promote the release of proin-
flammatory cytokines, augmenting inflammation and apoptosis in-
duced by H. pylori [21]. IFN-γ plays double-dimension adjustment role
in the induction of suppressive Th1-like Treg cells [22]. During mi-
croorganism infection, IFN-γ promotes T-box transcription factor (T-
bet) expressing Treg cells, which restrain type I responses [23]. In
contrast, continuous exposure of IFN-γ can destabilize suppressive Th1-
like Treg cells [24]. IRF8 is highly expressed by Treg cells and mainly
controls type I immune responses [25]. During this immune response
process, IRF8 get increased in a way similar to T-bet and chemokine (C-
X-C motif) receptor 3 (CXCR3) [25]. On the contrary, decreased IRF8
level will cause aberrantly high expression of T helper cell 2 (Th2) [IL-
4, IL-5, IL-13, et al] and T helper cell 17 (Th17) [IL-21, et al] cytokines
in Treg cells, which leads to Treg cells losing suppressive function [26].
Thus, there may exist feedback interaction between IRF8 and IFN-γ
when infection happens. Higher expression of IRF8 or IFN-γ may fa-
cilitate chronic infection.
H. pylori eradication could benefit millions of people all over the
world and inhibit the development of CAG and PLGC. However, due to
issues of soaring antibiotic resistance and changing epidemiology of H.
pylori infection, treatment failure and high rates of recrudescence are
universal. New approaches and strategies are needed for effective
management. Fortunately, Traditional Chinese medicine (TCM) may
contribute to H. pylori eradication and successful treatment of CAG.
Berberine (BBR), a natural isoquinoline alkaloid from various tradi-
tional Chinese medicine herbs, such as Rhizoma coptidis, Cortex phello-
dendri, has been widely applied in clinical treatment for many cen-
turies. Over the past decades, many studies have revealed BBR and its
derivatives possess high activity against both inflammation and cancer
in the digestive system [27,28]. Meanwhile, there are increasing reports
elucidated BBR holds great potential to treat chronic gastritis induced
by H. pylori infection in stomach mucosa [29,30]. Nevertheless, po-
tential mechanisms by which BBR exerts inhibitory effect on H. pylori
infection is not yet completely clarified. The potential mechanisms of
BBR in IRF8-IFN-γ signaling axis was shown in Fig. 1.
In this study, we will investigate the therapeutic effects of BBR in H.
pylori induced CAG. Furthermore, we also explore potential mechan-
isms of BBR in regulating IRF8-IFN-γ signaling axis, contributing to
better understanding the protection roles of BBR mechanisms.
2
Life Sciences 248 (2020) 117456
2. Materials and methods
2.1. Ethics statement
This study was conducted strictly in accordance with the Guidelines
for the Care and Use of Laboratory Animals of the Ministry of Science
and Technology of China. All breeding and experiments were under-
taken with review and approval from the Animal Ethical and
Experimental Committee of the Fifth Medical Center of PLA General
Hospital (Approval ID: IACUC-2018-010).
2.2. Berberine preparation
Standards of BBR (purity ≥98%, Cat. No. CHB181028) was pur-
chased from Chroma Biotechnology Co. Ltd. (Chengdu, China). BBR
was dissolved in dimethyl sulfoxide (DMSO) and diluted to corre-
sponding concentration when applied for human gastric epithelial cell
(GES-1). Then, BBR (purity ≥95%, Cat. No. CHB180606) was dissolved
in sodium chloride injection (NS 0.9%) and diluted to corresponding
concentration when applied to SD rats.
2.3. Rats and infection
A model using H. pylori-infected rats with chronic gastritis was
previously described [31]. Specific pathogen free (SPF) male Sprague-
Dawley rats (180 ± 20 g) were purchased from Beijing Sibeifu Animal
Breeding Center (Permission No. SCXK-(jing) 2016–0002). All rats were
negative for pathogenic bacteria including Helicobacter spp and para-
sites. Rats were maintained under SPF conditions (temperature:
25 ± 0.5 °C, humidity: 55 ± 5%, 12 h:12 h light-dark cycle) in a
shelter sustained facility and provided with sterile food and water. In-
fection of rats with the H. pylori strain (isolated from the stomach tissue
of a male CAG patient (No. ZCDC111001), kindly provided by Prof.
Jianzhong Zhang, National Institute for Communicable Disease Control
and Prevention, Beijing, China). H. pylori were grown in Campylobacter
agar base (Oxoid, UK) containing 1% H. pylori selective supplement
(Oxoid, UK) and 3% fetal bovine serum, cultured at 37 °C under mi-
croaerophilic conditions (10% CO2, 5% O2, 85% N2). After culture for
4 days, live bacteria were collected and adjusted to 108 colony forming
units (CFU)/mL. Briefly, rats were inoculated with an oral dose of
1.5 × 108 CFU/ml H. pylori at day 1, 3, 5 and 7. At 8 weeks following
infection, stomach tissues were processed for rapid urease test, his-
tology and tissue culture for enumeration of H. pylori. Infection status
and H. pylori-induced chronic atrophic gastritis in rats were confirmed.
After infection verified, rats were randomly assigned to three different
groups, including H. pylori infection group, BBR with low-dose (14 mg/
kg/d) and high-dose group (28 mg/kg/d), respectively.
2.4. Cells infection and cell viability evaluation
Human gastric epithelial cells (GES-1) line were purchased from
FuHeng Cell Center (Shanghai, China). The adherence of H. pylori
(multiplicity of infection [MOI] of 10:1, 20:1, 50:1 and 100:1) to GES-1
for 24 h. The relative number of H. pylori was examined using a Synergy
H1 Hybrid Reader (Biotech, USA). The optical density (OD) at 600 nm
was set to count colony forming units of H. pylori (1
OD600nm = 1.5 × 108 colony forming units/ml). The viability of GES-1
after infection and processed by BBR, 10% (vol/vol) cell counting kit-8
(CCK-8; Lot. PG658, Dojindo, Tokyo, Japan) was added into cells and
incubated for 15 min at 37 °C. Absorbance was measured at 450 nm.
Cell viability was calculated as cell viability (%) = 100 × (OD treat-
ment/OD control).
2.5. Morphological identification and quantitative statistics
Morphological identification and quantitative statistics of GES-1
T. Yang, et al.
cells were examined by a High-Content System array scan (Thermo
Scientific, Massachusetts, USA), which was utilized by Wen, et al. [32]
before. Fluorescent dyes, including Hoechst 33342 (H3570, Invitrogen),
aiming to mark nuclear area, Calcein AM (C3099, Invitrogen) to spot
cytoplasm, and ethidium homodimer-1 (EthD-1) (L3224, Invitrogen) to
detect nucleic acids, were employed to identify morphology of GES-1
cells. The cell health profiling assay module was selected in the HCS
system, the parameters and forma setting were reported previously by
O'Brien, et al. [33] and wave length in different channels were set to
collect fluorescent images. Configure acquisition parameters, including
objective (10×), camera configuration (×1) and acquisition camera
mode (1104 × 1104, 2 × 2 binning), were employed. Ultimately, the
Array Scan XTI system was utilized to quantify the mean fluorescence
intensity of GES-1 cells by software algorithm.
2.6. Histopathological examination
Stomach tissue samples were fixed and preserved in 10% neutral
buffered formalin solution, cleared in xylene, embedded in paraffin,
and cut into 5 μm thick slices by using a microtome. Stomach tissue
sections were stained with hematoxylin-eosin (HE). Histopathological
determination of the stomach mucosa injury was conducted by photo-
graphy with light microscopy and 200×, 400× magnification was used
in the microscopy analysis.
2.7. Measurement of specific serum biomarkers
The Synergy H1 Hybrid Reader (Biotech, USA) was employed to
measure serum biochemical indices, including gastrin-17 (G-17), in-
terleukin-17 (IL-17), chemokines 1 (CXCL1), chemokines 9 (CXCL9).
The enzyme-linked immunosorbent assay (ELISA) kits of G-17 and IL-17
were purchased from MLBIO biotechnology Co., Ltd. (Shanghai, China).
CXCL1 and CXCL9 kits were purchased from JYMBIO biotechnology
Co., Ltd. (Wuhan, China). All assays were performed rigorously ac-
cording to the manufacturer's instructions.
2.8. Immunohistochemistry (IHC)
Paraffin sections of stomach tissues were stained with a polyclonal
3
Life Sciences 248 (2020) 117456
Fig. 1. Potential mechanisms of BBR in
IRF8-IFN-γ signaling axis. means sti-
mulation, means inhibition.
anti-IRF8 Ab (Cat No.: 18977-1-AP, Proteintech, 1:100) and anti-IFN-γ
Ab (Cat No.: NBP2-66900, Novusbio, 1:100) were utilized. Light mi-
croscopy (Olympus, Japan) at 200×, 400× magnification was applied
to photograph images.
2.9. Real-time quantitative PCR for mRNA expressions in stomach tissues
Microarray analysis was done using RNA extracts from frozen sto-
mach tissues of infected and control rats or cells. TRIzol reagent (Nordic
Bioscience, Beijing, China) were applied and converted into cDNA by
reverse transcription kit (Promega, Madison, USA) according to man-
ufacturer's protocol. The primers sequences of IRF8, IFN-γ, Ifit3, Upp-1,
USP-18, Nlrc5, NF-κB and TNF-α were listed in Table 1. Quantitative
Real-time PCR for these mRNA was performed and analyzed using
cDNA and SYBR Green PCR Master Mix (Nordic Bioscience, Beijing,
China). RT-PCR was performed on a 7500 fast real-time PCR system
(Applied Biosystems, Foster City, CA, USA). 7500 software (Applied
Biosystems for 7500 and 7500 Fast Real-Time PCR Products, version
2.0.5) was used to present results and export data. The relative amounts
of mRNA were determined based on 2−ΔΔCt calculations with β-actin as
a controlling reference.
2.10. Western blotting analysis for protein expression
Stomach tissues were homogenized with ice-cold RIPA lysis buffer
(tissues to buffer ratio, 1: 10, w/v) supplemented with a protease in-
hibitor cocktail. The homogenates were centrifuged at 4 °C for 10 min
at 10,000g, and the supernatants were stored at −20 °C. Bicinchoninic
acid (BCA) protein assay kit (Solarbio, Beijing, China) was used to
measure the protein concentration. Proteins (50 mg) were boiled with
SDS sample buffer, separated by SDS-PAGE (25 min, 80 V; 50 min,
120 V), and then electrophoretic ally transferred onto PVDF membranes
(Millipore, MA, USA; 200 mA, 2 h). Tris-buffered saline (TBS) with 5%
non-fat dry milk (NFDM) was applied to seal PVDF membranes. Next,
these membranes were incubated overnight at 4 °C with rabbit anti-
IRF8 Ab (Proteintech, Cat No.: 18977-1-AP, dilution: 1:1000), rabbit
anti-IFN gamma Ab (Novusbio, Cat No.: NBP2-66900, dilution: 1:500),
rabbit anti-Ifit3 Ab (BIOSS, Cat No.: bs-15515R, dilution: 1:500), rabbit
anti-Ifit1 Ab (Proteintech, Cat No.: 23247-1-AP, dilution: 1:500), rabbit
T. Yang, et al. Life Sciences 248 (2020) 117456

Table 1
Primers sequences of real-time PCR analyses for mRNA expression.
Genes Forward Reverse

SD rats
IRF8 AGAGCCGCCTGCCTGATAGC TGCCCGCTTCCTCCACCATC
IFN-γ ACAACCCACAGATCCAGCACAAAG GCTTCCTTAGGCTAGATTCTGGTGAC
Ifit3 ACAGCTTGGTCATGTGCCGTTAC TCTTCTCTCACTCTTGTCAGCCTCTC
Upp1 ATCATCCGCATTGGCACTTCAGG GTTTCGAGTCACCCGCTTTCCC
USP18 TGCTGCTCATCTCTTCCTTACAATCTG TCCTGCTGCTCTCTGCTCCAC
Nlrc5 CACCTTGCCACCAACCTCACG GCCAACTCAGCAGCCATCTCATC
β-Actin CACTATCGGCAATGAGCGGTTCC ACTGTGTTGGCATAGAGGTCTTTACG

GES-1
IRF8 CAGCCACTTGGAAGACGAGGTTAC ACTTCATTCACGCAGCCAGCAG
IFN-γ AGTGATGGCTGAACTGTCGC ACTGGGATGCTCTTCGACCT
USP18 CCACCTCATGCGATTCTCCATCAG GCTCCTCAGCATCACAAGACTCTC
Upp1 CGGTGCTGTCTGTCAGTCATGG ACCAGAAGTGCCAATGCGGATG
NF-κB GACATGGTGGTCGGCTTCGC CGCCTCTGTCATTCGTGCTTCC
TNF-α CCAATGGCGTGGAGCTGAGAG TCTGGTAGGAGACGGCGATGC
β-Actin AGGAAGGACCTGTATGCCAACA GCGCGGTGATCTCTTTCTG

Fig. 2. Disease performance of chronic atrophic gastritis in rats. (A) Weight of rats (n = 6), data were shown as mean ± SD, ##P < .01 versus control group; (B)
Morphology of rats stomach; (C) Rapid urease test of stomach tissues. Ctrl, control group.

Fig. 3. Effect of BBR on cell viability of

GES-1 cells. (A) Cell viability of GES-1 cells
in different concentrations of BBR (10
μΜ–100 μΜ); (B) Cell viability of GES-1
cells in different MOI of H. pylori
(10:1–100:1); (C) Cell viability of GES-1
cells in the intervention of BBR. ##P < .01
versus control group, ⁎⁎P < .01 versus H.
pylori group. Results were expressed as
percentages of the control group. Data were
shown as mean ± SD. BBR, berberine; Ctrl,
control group; MOI, multiplicity of infec-
tion.

4
T. Yang, et al. Life Sciences 248 (2020) 117456

(caption on next page)

5
T. Yang, et al. Life Sciences 248 (2020) 117456

Fig. 4. Morphological identification and quantitative analysis of HCS imaging assay for GES-1 cells. Intensity of fluorescence staining reflected the survival cells
(green fluorescence) and dead cells (red fluorescence), Scale bar = 50 μm. (A) Valid cell counts of HCS analysis for GES-1 cells (% of control). (B) Survival cell counts
of GES-1 cells (MEAN_TargetAvgIntenCh2). (C) Dead cell counts of GES-1 cells (MEAN_TargetAvgIntenCh3). N·S, none-significant, ##P < .01 versus control group.
⁎
P < .05 versus H. pylori infection group. ⁎⁎P < .01 versus H. pylori infection group. The results are expressed as percentages of control group. Data were shown as
mean ± SD. Ctrl, control group; BBR, berberine. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this
article.)

Fig. 5. Expression of proinflammatory genes in GES-1 with H. pylori infection. All data are presented as mean ± SD. ∗∗P < .01 versus control group; Ctrl, control
group; IRF8, interferon regulatory factor 8; IFN-γ, interferon-gamma; NF-κB, nuclear factor-κ-gene binding; TNF-α, tumor necrosis factor-α.

anti-IRF1 Ab (BIOSS, Cat No.: bsm-52114R, dilution: 1:1000) and anti-
β-actin monoclonal antibody (BIOSS, Cat No.: bs-0061R, dilution:
1:3000), respectively. Then, membranes were washed five times for
5 min each with TBS-0.1% Tween 20 (TBST) and incubated with HRP-
conjugated secondary antibody (goat anti-mouse IgG (H + L)) (ZSGB-
BIO, Cat No.: ZB-2301, dilution, 1:25000) for 1 h at room temperature
on a shaker. Western blotting detection system (Quantity One, Bio-Rad
Laboratories, USA) was applied to obtain images. Quantification of
bands was performed by densitometric analysis through Bio-Rad
Quantity One. The β-actin was set as a loading control.
2.11. Statistics analysis
3. Results
3.1. Disease performance of chronic atrophic gastritis in H. pylori-induced
rats
Eight weeks after H. pylori infection, the rats infected with H. pylori
exhibited CAG symptoms, such as loss of appetite, diarrhea and weight
loss (Fig. 2A). The surface of the gastric mucosa was rough and pale, the
stomach wrinkles are disordered microvascular exposure under the
mucosa, many bleeding points were seen directly by visual inspection
(Fig. 2B). The rapid urease test of stomach tissues (from body of sto-
mach and pyloric antrum) was positive (Fig. 2C). Those changes are
similar to those populations who have CAG caused by H. pylori in clinic.

All data were presented as mean ± standard deviation (SD) and

analyzed with the SPSS software program (version 17.0; SPSS Inc.,
Chicago, IL, USA). Data were presented using one-way analysis of
variance (ANOVA) followed by Bonferroni method. P < .05 was
considered statistically significant and P < .01 was highly significant.
GraphPad Prism software for Windows (version 6.02; Inc., San Diego,
USA) were utilized for visible presentation of all results.
3.2. Cell viability
CCK-8 kit was utilized to determine cell viability of GES-1. The
optimum concentrations of BBR for protecting GES-1 cells against H.
pylori-induced injury were explored firstly. The concentrations of BBR
were set as 0, 10, 20, 30, 40, 50 and 100 μM. The results showed that
BBR with the concentrations of 100 μM could significantly inhibit the
cell viability (52.31 ± 5.74) compared with the control groups
(100 ± 17.93) (P < .01). Meanwhile, cell viability of GES-1 with
50 μM concentrations of BBR was lower than 90% (66.33 ± 4.35).
When given at 40 μM concentrations of BBR, cell viability of GES-1 was
higher than 90% (94.91 ± 7.92). Accordingly, 40 μM of BBR showed a

6
T. Yang, et al. Life Sciences 248 (2020) 117456

Fig. 6. Effects of BBR on serum supernatant indices of CAG rats (n = 6). Data were shown as mean ± SD. ##P < .01 versus control group; ∗∗P < .01 versus H.
pylori group; Ctrl, control group; L, low-dose group; H, high-dose group. G-17, gastrin-17; IL-17, interleukin-17; CXCL1, chemokines 1; CXCL9, chemokines 9.

Fig. 7. Effects of BBR on stomach histological changes at low dose and high dose. Representative photomicrographs and summary data for HE staining of stomach
histological changes were represented. Red arrows indicated neutrophil infiltration. Ctrl, control group; L, low-dose group; H, high-dose group. (For interpretation of
the references to colour in this figure legend, the reader is referred to the web version of this article.)

7
T. Yang, et al.
Fig. 8. Effects of BBR on the IRF8-IFN-γ signaling axis mRNA expressions in vitro with H. pylori infection. All data are presented as mean ± SD. ##P < .01 versus
control group; ∗P < .05 versus H. pylori infection group; ∗∗P < .01 versus H. pylori infection group. Ctrl, control group; Combination, AX-024 + BBR 40 μM; IRF8,
interferon regulatory factor 8; IFN-γ, interferon-gamma; USP18, ubiquitin specific peptidase 18; Upp1, uridine phosphorylase 1.
relatively protective effect and was used to investigate the protective
effect of BBR on GES-1 injury induced by H. pylori (Fig. 3A). Then, the
adherence of H. pylori (multiplicity of infection [MOI] of 10:1, 20:1,
50:1 and 100:1) to GES-1 co-cultivated for 24 h. There were lot of dead
GES-1 cells through observation of naked eyes directly when infected
with MOI 100:1, and the cell viability (39.81 ± 8.06) was decreased
significantly compared with the control groups (100 ± 12.91). Cell
viability of GES-1 with MOI 50:1 was about (50.03 ± 7.95). Conse-
quently, MOI 50:1 was chosen in this study for subsequent experiment
(Fig. 3B). Next, BBR with the concentrations of 40 μM and 20 μM with
MOI 50:1 were cultivated together for 24 h. Results demonstrated cell
viability of GES-1 was increased in 40 μM (83.44 ± 7.46) and 20 μM
BBR group (75.47 ± 9.31) compared with the H. pylori infection group
(Fig. 3C). Overall, all results revealed BBR was capable of protecting
GES-1 from H. pylori infection.
3.3. Morphological identification and quantitative statistics of GES-1 cells
In order to identify the effects of BBR on cell morphological influ-
ence, high-content survival cell imaging assays were utilized to quali-
tatively and quantitatively assay cell counts, morphology and cell via-
bility. As displayed in Fig. 4, GES-1 cells in the control group presented
Hoechst and Calcein, AM fluorescence in the nuclear area and cyto-
plasm homogeneously. However, morphological changes of GES-1 cells
in H. pylori infection group were remarkable, the nucleus tinted by
Hoechst 33342 were featured with malformations, deeper staining and
coarse-grained. The cytoplasm stained by Calcein, AM was character-
ized with bright spots (green fluorescence) and fractured cytoskeleton.
Dead cells stained by EthD-1 with red fluorescence increased phe-
nomenally. On the contrary, intervened by BBR with 20 μM and 40 μM,
the morphological changes of GES-1 cells were slight, no matter in
8
Life Sciences 248 (2020) 117456
nuclear area and cytoplasm. The intensity of green fluorescence (sur-
vival cell staining) was significantly increased and the red fluorescence
(dead cell staining) was significantly decreased. In terms of quantitative
statistics, GES-1 cell counts were significantly decreased after infected
with H. pylori for 24 h. Compared with H. pylori infection group, the
reduction rate of cell counts in BBR group declined remarkably. Results
were shown in Fig. 4 (A–C). All data suggested that BBR may sig-
nificantly keep GES-1 from H. pylori infection and reduce injury.
3.4. Expression of proinflammatory genes in GES-1 with H. pylori infection
An ocean of studies reported expression of proinflammatory genes
increased when H. pylori infection. In this paper, expression of proin-
flammatory genes were probed in GES-1 when H. pylori infection. The
expression of proinflammatory genes encoding IRF-8, IFN-γ, NF-κB and
TNF-α were tested with MOI of 10:1, 20:1, 50:1 and 100:1. As described
previously, there was multitude of floating GES-1 cells when infected
with MOI 100:1 for 24 h. As a result, proinflammatory genes expression
dramatically upregulated with MOI of 10:1, 20:1, 50:1 and 100:1 for
24 h compared with H. pylori uninfected group. Obviously, the highest-
level expression of proinflammatory genes (almost higher than 2-fold
increasing) when infected with MOI 50:1 in GES-1 cells. Accordingly,
MOI 50:1 was selected in this study for following exploration. Results
were shown in Fig. 5.
3.5. Detection of biomarkers in serum
To clarify the activities of several specific markers of H. pylori-in-
duced CAG rats, the serum supernatant levels of gastrin-17 (G-17), in-
terleukin-17 (IL-17), CXCL1, and CXCL9 were estimated. As showed in
Fig. 6, IL-17, CXCL1, and CXCL9 increased markedly in H. pylori-
T. Yang, et al.
Fig. 9. Effects of BBR on the IRF8-IFN-γ signaling axis mRNA expressions in vivo with H. pylori infection (n = 6). All data are presented as mean ± SD. ##P < .01
versus control group; ∗P < .05 versus H. pylori infection group; ∗∗P < .01 versus H. pylori infection group. Ctrl, control group; IRF8, interferon regulatory factor 8;
IFN-γ, interferon-gamma; Ifit3, interferon induced protein with tetratricopeptide repeats 3; Upp1, uridine phosphorylase 1; USP18, ubiquitin specific peptidase 18;
Nlrc5, NLR family CARD domain containing 5.
induced CAG group compared to control group. On the contrary, G-17
decreased distinctly in H. pylori infection group compared with non-
infection group. In the administration of BBR group (14 mg/kg and
28 mg/kg), IL-17, CXCL1, and CXCL9 significantly reduced, and the
high dosage of compatibility group (28 mg/kg) had lower level of IL-17,
CXCL1, and CXCL9 compared with group with low dosage and H. pylori
infection group. Conversely, the high dosage of compatibility group
maintained a higher level of G-17 compared with group with low do-
sage and H. pylori infection group. Altogether, these results in vivo
imply that the activities of several specific markers, including IL-17,
CXCL1, and CXCL9, might get suppressed by BBR intervention.
Nevertheless, G-17 raised significantly following administration of BBR
when H. pylori infection.
3.6. Histological examination of gastric mucosa
Histological features of gastric mucosa were the direct evidence for
the therapeutic effect of BBR against CAG infected by H. pylori. In the
current study, hematoxylin-eosin (HE) staining was performed to
evaluate morphological features, which were induced by inflammation
accumulation in stomach tissues. Rats in the control group showed
normal morphology, signed with tightly and orderly gastric glandular
and parietal cells. In the H. pylori infected group, pathologic changes of
rats are characteristic with atrophy and irregular arrangement of gastric
glandular, infiltrated with large amounts of lymphocytes and plasma
cells, and loss of parietal cells. Conversely, those changes in BBR groups
were more slightly than in H. pylori infected group in terms of the
gastric glandular and membranes of parietal cells. Administration of
BBR at high dose (28 mg/kg) exhibited lower infiltration of in-
flammatory cell and other histological injuries noticeably. Results were
presented in Fig. 7.
9
Life Sciences 248 (2020) 117456
3.7. Berberine suppressed IRF8-IFN-γ signaling axis when H. pylori
infection in vitro
Previous genome-wide analysis of IRF8 target genes by employing
ChIP-seq and RNA-seq demonstrated USP18 and Upp1 were relevant
downstream genes [14]. The role of BBR in IRF8-IFN-γ signaling axis in
GES-1 infected by H. pylori (MOI 50:1) was further investigated in this
examine. Selective inhibitor of IFN-γ (AX-024, MedChem Express,
Shanghai, China, 10 ng/ml) was applied to black the expression of IFN-
γ. As seen in Fig. 8, the expression of IFN-γ was significantly suppressed
by exposure to AX-024 in the presence of H. pylori. Additionally, we
observed that proinflammatory genes including NF-κB and TNF-α were
decreased significantly with AX-024 blocking. Furthermore, IRF8 and
its downstream genes (USP18, Upp1) also were suppressed significantly
by AX-024 inhabitation. Accordingly, these findings suggested that IFN-
γ could induce IRF8 expression in GES-1 cells. Intervened by 40 μM BBR
subsequently, the expression of NF-κB, TNF-α, IFN-γ, IRF8, USP18, and
Upp1 also decreased significantly compared with H. pylori infected
group. Next, AX-024 plus BBR (combination group) was utilized to treat
GES-1 cells with H. pylori infection, data showed all proinflammatory
genes mentioned above were suppressed obviously. Together, these
findings suggested that BBR could suppress IRF8-IFN-γ signaling axis
and expression of proinflammatory genes, protect GES-1 cells from in-
fection induced by H. pylori.
3.8. Berberine attenuated IRF8-IFN-γ signaling axis when H. pylori
infection in vivo
We then evaluated the effects of BBR on expression of IRF8 and its
downstream genes in the gastric mucosa of H. pylori-infected rats by
qRT-PCR firstly. Results were presented in Fig. 9. Evidently, the ex-
pression of IFN-γ, IRF8 and its related downstream genes including
T. Yang, et al.
Fig. 10. Effects of BBR on immunohistochemical analysis with low dose and high dose. Representative photomicrographs and summary data for IHC staining of
stomach histological changes were represented. Red arrows indicated positive expression. IHC, immunohistochemistry; Ctrl, control group; L, low-dose group; H,
high-dose group. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Ifit3, Upp1, USP18, Nlrc5 were increased significantly in H. pylori-in-
fected rats compared with the normal rats. Administration of BBR at
high dose (28 mg/kg) expressed lower level of IFN-γ, IRF8 and its
downstream genes noticeably compared with the H. pylori-infected
group and low dose (14 mg/kg) group. Consequently, those results
mentioned above revealed that BBR could down-regulate genes ex-
pression bound to IRF8-IFN-γ signaling axis and hold anti-inflammatory
properties in H. pylori-infected gastric tissues.
3.9. Berberine inhibited protein expression in IRF8-IFN-γ signaling axis
when H. pylori infection
We demonstrated previously that the mRNA levels of IFN-γ, IRF8
and its controlled downstream genes including Ifit3, Upp1, USP18,
Nlrc5 were significantly decreased following intervention of BBR.
Immediately after, the protein expression related to IRF8-IFN-γ sig-
naling axis were measured. As reported by Yan M, et al. previously
[14], genes increased most in H. pylori-infected gastric tissues was Ifit3
(4.7 fold change), followed by IRF1 (2.1 fold change) and Ifit1 (2.2 fold
change). All those genes were found to be direct targets of IRF8 and the
expressions were IRF8-dependent fashion. Consistent with the findings
of mRNA, immunohistochemical analyses revealed that non-infected
stomach tissues expressed low levels of IRF8 as evidenced by barely
positive staining of IRF8 in nucleated glandular cells. However, H. py-
lori infected tissues embraced a robust increase of IRF8. Correspond-
ingly, H. pylori infected tissues hold higher level of IFN-γ compared
with non-infected tissues. Interfered by BBR, the expression of IRF8 and
IFN-γ decreased significantly. Administration of BBR at high dosage
(28 mg/kg) exhibited slight infiltration of IRF8 and IFN-γ observably
compared with the H. pylori-infected tissues and low dosage tissues.
Results were presented in Fig. 10.
10
Life Sciences 248 (2020) 117456
Subsequently, the protein expressions of IFN-γ, IRF8, Ifit3, IRF1 and
Ifit1 in stomach tissues were estimated by western blotting analysis. As
shown in Fig. 11, IFN-γ, IRF8, Ifit3, IRF1 and Ifit1 expressed at a re-
latively high level in H. pylori-infected group compared with control
group. However, BBR given at a high dosage could significantly inhibit
the expression of IFN-γ, IRF8 and its associated downstream proteins
including Ifit3, IRF1 and Ifit1. Remarkably, the expressions of these
proteins were exceedingly significant differences in low-dose group and
high-dose group. Findings from western blotting analysis provided
stronger convincement that BBR is able to treat H. pylori induced CAG
through restraining IRF8-IFN-γ signaling axis.
4. Discussion
In the current research, findings revealed that berberine could
suppress the IRF8-IFN-γ signaling axis to exhibit anti-inflammatory
properties in H. pylori-induced chronic atrophic gastritis (CAG). It could
attenuate the inflammatory response by suppressing the production of
pro-Th1 cytokines via inhibiting IFN-γ expression, which is involved in
the anti-inflammatory role of BBR in CAG with H. pylori infection. Our
works pave a theoretical cornerstone for exploring the pharmacological
effects of berberine in the treatment of CAG induced by H. pylori.
> 50% of the world's population is infected with H. pylori [8]. H.
pylori can colony in the gastric mucosa for decades and trigger vigorous
host innate and adaptive immune responses [34]. Chronic inflammation
process in stomach mucosa is the principally pathological changes of
CAG with H. pylori infection [35]. When inflammations or injury come,
immune response of T-cell and B-cell was activated in order to clear
bacteria, including H. pylori, either contributing to mucosa damage in
inflammation process. Furthermore, neutrophil and macrophages re-
cruitment also got triggered in early stage in controlling tissue
T. Yang, et al. Life Sciences 248 (2020) 117456

Fig. 11. Proteins expression in IRF8-IFN-γ signaling axis estimated by western blotting analysis. (A) Western blotting images of IFN-γ, IRF8, Ifit3, IRF1 and Ifit1. (B)
Relative IFN-γ protein level in stomach. (C) Relative IRF8 protein level in stomach. (D) Relative Ifit3 protein level in stomach. (E) Relative IRF1 protein level in
stomach. (F) Relative Ifit1 protein level in stomach. All data are presented as the mean ± SD. Results were from three independent experiments. #P < .05 versus
control group; ##P < .01 versus control group; ⁎P < .05 versus H. pylori infection group; ⁎⁎P < .01 versus H. pylori infection group. Ctrl, control group; L, low-dose
group; H, high-dose group. IRF8, interferon regulatory factor 8; IFN-γ, interferon-gamma; Ifit3, interferon induced protein with tetratricopeptide repeats 3; IRF1,
interferon regulatory factor 1; Ifit1, interferon induced protein with tetratricopeptide repeats 1.

infections or injury [36]. Previous study has demonstrated that H. pylori promotes the differentiation of monocytes into granulocytes [38]. IRF8
infection mainly induced Th1 cell-dominant immune response in gastric also acts as a key controller of differentiation and function in dendritic
inflammation [37]. Interferon regulatory factor 8 (IRF8), a transcrip- cell, establishing host defense and innate immunity [39]. It is uni-
tion factors, plays a vital role in the differentiation of myeloid cells and versally known that interferon (IFN) is one of the strongest inducers of

11
T. Yang, et al.
IRF8 transcription. IFN-γ is a kind of Th1 cytokines and produced by
activated T lymphocytes (T cells) and natural killer (NK) cells. It may
promote the release of proinflammatory cytokines, augmenting in-
flammation and apoptosis induced by H. pylori [21]. During micro-
organism infection, IFN-γ promotes T-bet expressing Treg cells, which
restrain type I responses [23]. At the same time, IRF8 is highly ex-
pressed by Treg cells and mainly controls type I immune responses
[25]. Earlier study has illustrated that expression of IFN-γ was IRF8-
dependent in H. pylori-infected GECs cells, meanwhile, expression of
IRF8 was induced by IFN-γ in GSM06 cells via a time-dependent
manner. Briefly, IFN-γ upregulates IRF8 expression, which, in turn,
promotes IFN-γ production [14]. IFN-γ-intermediated immunity in the
infection of early phase is expected to be exaggerated through this
positive feedback loop between IRF8 and IFN-γ [40].
In this current examination, the feedback interaction between IRF8
and IFN-γ is verified one more time in vitro and in vivo. This regulatory
circuit may boost inflammatory responses in gastric mucosa to promote
bacterial clearance. Consequently, it is potential that stimulation of
IRF8 and IFN-γ may facilitate the process of chronic infection and in-
crease the likelihood of malignant transformation induced by H. pylori.
In this study, the expression of proinflammatory genes, including NF-
κB, TNF-α, IFN-γ, IRF8, USP18, and Upp1 were probed in GES-1 cells
when H. pylori infection. We found the expression of all proin-
flammatory genes, such as NF-κB, TNF-α, was activated in H. pylori
infected GES-1 cells. Furthermore, genes in IRF8-IFN-γ signaling axis
also got increased when H. pylori infection. Next, the genes related to
IRF8-IFN-γ regulatory circuit were quested in the gastric mucosa of H.
pylori-infected rats. Accordingly, the expression of IFN-γ, IRF8 and
IRF8-bound genes including Ifit3, Upp1, USP18, Nlrc5 were increased
significantly in H. pylori-infected gastric mucosa. We also revealed the
protein expression in IRF8-IFN-γ signaling axis got escalated in H. py-
lori-infected gastric mucosa. There is no denying that IRF8-IFN-γ sig-
naling axis exerts pivotal effects in chronic inflammation process in-
duced by H. pylori.
Berberine (BBR) is a natural isoquinoline alkaloid from various
traditional Chinese medicine herbs, such as Rhizoma coptidis, Cortex
phellodendri, has been widely applied in clinical treatment for many
centuries. Over the past decades, many studies have revealed BBR and
its derivatives possess high activity against both inflammations and
cancers in the digestive system, and with utterly slight side effects and
resistance in clinical application [27,30]. In this work, we explored the
pharmacological effects of BBR in the treatment of H. pylori-induced
CAG. The mechanism of BBR in treating H. pylori-infected CAG were
also explored by analyzing the interaction between IRF8 and IFN-γ
response. In our findings, we observed that BBR was capable of pro-
tecting GES-1 from H. pylori infection. Cell viability, morphological
identification of GES-1 cells was ameliorated directly following BBR
administration. The pathologic changes of gastric mucosa, including
arrangement of gastric glandular, infiltration of lymphocytes and
plasma cells and loss of parietal cells, also were better than in H. pylori
infected tissues. Several specific markers in serum, such as IL-17,
CXCL1, and CXCL9, significantly reduced after intervened by BBR.
Conversely, G-17 raised significantly following administration of BBR
when H. pylori infection. We speculated that with H. pylori clearance
intervened by BBR, the secretory function of gland cells (G cells) re-
turned to normal action and levels. In terms of mechanism of BBR in
treating H. pylori-infected CAG, the proinflammatory genes, encoding
NF-κB, TNF-α, IFN-γ, IRF8 and its downstream genes were either de-
creased significantly followed by AX-024, a selective inhibitor of IFN-γ,
or downregulated by BBR intervention in GES-1 cells. These data sup-
port the role of BBR as an anti-inflammatory agent in GES-1 cells injury
induced by H. pylori. We also demonstrated the expression of IFN-γ,
IRF8 and its related downstream genes including Ifit3, Upp1, USP18,
Nlrc5 were suppressed significantly in H. pylori-infected gastric mucosa.
Meanwhile, we revealed the protein expression in IRF8-IFN-γ signaling
axis were downregulated after exposure to BBR. Taken together, these
12
Life Sciences 248 (2020) 117456
results suggested that BBR which could block the course of IRF8-IFN-γ
signaling axis to H. pylori-infected procession in vivo and in vitro. The
therapeutic effects of BBR associated intimately to Th1 cell-dominant
immune responses in gastric inflammation, and changed the adaptive
immunity responses to H. pylori by converting CD4+ T cells into Th1
differentiation.
5. Conclusions
All in all, conclusions from this study suggest that berberine pos-
sesses therapeutic effects on H. pylori-induced chronic atrophic gastritis,
supporting the role of BBR as an anti-inflammatory agent in CAG in-
duced by H. pylori. The anti-inflammatory property of BBR tightly re-
lated to suppression of IRF8-IFN-γ signaling axis, which is crucial in
Th1 cell-dominant inflammatory response. The findings from this re-
search pave a theoretical cornerstone for investigating the pharmaco-
logical effects of berberine in human CAG induced by H. pylori.
Author contributions
Tao Yang, Xiangdong Yang and Yanling Zhao conceived the project
and wrote the manuscript. Tao Yang performed main part of the ex-
periments, with contributions from Ruilin Wang, Chunmei Bao, Juling
Zhang and Ruisheng Li. Jianzhong Zhang provided us with Helicobacter
pylori. Xing Chen, Shihua Wu, Jianxia Wen performed and analyzed the
high content analysis and real-time quantitative PCR experiments data.
Haotian Li, Shizhang Wei and Huadan Cai contributed to the data
collection and analysis. Xiangdong Yang and Yanling Zhao participated
in the project design as well as manuscript draft preparation and revi-
sion. All authors read and approved the final manuscript.
Declaration of competing interest
All authors of this manuscript state that they do not have any
conflict of interests, and there is nothing to disclose.
Acknowledgments
This research was financially supported by the National Key
Research and Development Program (No.2018YFC1704500).
References
[1] D. Campana, D. Ravizza, P. Ferolla, et al., Risk factors of type 1 gastric neu-
roendocrine neoplasia in patients with chronic atrophic gastritis. A retrospective,
multicentre study, Endocrine. 56 (3) (2017) 633–638, https://doi.org/10.1007/
s12020-016-1099-y.
[2] H. Song, I.G. Ekheden, Z. Zheng, et al., Incidence of gastric cancer among patients
with gastric precancerous lesions: observational cohort study in a low risk Western
population, BMJ. 351 (2015) h3867, https://doi.org/10.1136/bmj.h3867.
[3] B.N. Parsons, U.Z. Ijaz, R. D’Amore, et al., Comparison of the human gastric mi-
crobiota in hypochlorhydric states arising as a result of Helicobacter pylori-induced
atrophic gastritis, autoimmune atrophic gastritis and proton pump inhibitor use,
PLoS Pathog. 13 (11) (2017) e1006653, , https://doi.org/10.1371/journal.ppat.
[4] K. Fagan-Garcia, J. Geary, H.J. Chang, et al., Burden of disease from Helicobacter
pylori infection in western Canadian Arctic communities, BMC Public Health 19 (1)
(2019) 730, https://doi.org/10.1186/s12889-019-7065-x.
[5] L. Gao, M.N. Weck, A. Michel, et al., Association between chronic atrophic gastritis
and serum antibodies to 15 Helicobacter pylori proteins measured by multiplex
serology, Cancer Res. 69 (7) (2009) 2973–2980, https://doi.org/10.1158/0008-
5472.
[6] X. Gao, Y. Zhang, H. Brenner, Associations of Helicobacter pylori infection and
chronic atrophic gastritis with accelerated epigenetic ageing in older adults, Br. J.
Cancer 117 (8) (2017) 1211–1214, https://doi.org/10.1038/bjc.2017.314.
[7] M. Hatakeyama, Helicobacter pylori CagA and gastric cancer: a paradigm for hit-
and-run carcinogenesis, Cell Host Microbe 15 (3) (2014) 306–316, https://doi.org/
10.1016/j.chom.2014.02.008.
[8] J.K.Y. Hooi, W.Y. Lai, W.K. Ng, et al., Global prevalence of helicobacter pylori in-
fection: systematic review and meta-analysis, Gastroenterology. 153 (2) (2017)
420–429, https://doi.org/10.1053/j.gastro.2017.04.022.
[9] D.R. Scott, E.A. Marcus, D.L. Weeks, et al., Mechanisms of acid resistance due to the
urease system of Helicobacter pylori, Gastroenterology. 123 (1) (2002) 187–195,
T. Yang, et al.
https://doi.org/10.1053/gast.2002.34218.
[10] E.A. Marcus, G. Sachs, D.R. Scott, The role of ExbD in periplasmic pH homeostasis
in Helicobacter pylori, Helicobacter. 18 (5) (2013) 363–372, https://doi.org/10.
1111/hel.12055.
[11] Y. Zhuang, P. Cheng, X.F. Liu, et al., A pro-inflammatory role for Th22 cells in
Helicobacter pylori-associated gastritis, Gut. 64 (9) (2015) 1368–1378, https://doi.
org/10.1136/gutjnl-2014-307020.
[12] M. Howlett, H.V. Chalinor, J.N. Buzzelli, et al., IL-11 is a parietal cell cytokine that
induces atrophic gastritis, Gut. 61 (10) (2012) 1398–1409, https://doi.org/10.
1136/gutjnl-2011-300539.
[13] D.B. Polk, R.M. Peek Jr., Helicobacter pylori: gastric cancer and beyond, Nat. Rev.
Cancer 10 (6) (2010) 403–414, https://doi.org/10.1038/nrc2857.
[14] M. Yan, H. Wang, J. Sun, et al., Cutting edge: expression of IRF8 in gastric epithelial
cells confers protective innate immunity against Helicobacter pylori infection, J.
Immunol. 196 (5) (2016) 1999–2003, https://doi.org/10.4049/jimmunol.1500766.
[15] T. Taniguchi, K. Ogasawara, A. Takaoka, et al., IRF family of transcription factors as
regulators of host defense, Annu. Rev. Immunol. 19 (2001) 623–655, https://doi.
org/10.1146/annurev.immunol.19.1.623.
[16] H. Wang, H.C. Morse 3rd., IRF8 regulates myeloid and B lymphoid lineage di-
versification, Immunol. Res. 43 (1–3) (2009) 109–117, https://doi.org/10.1007/
s12026-008-8055-8.
[17] R. Lu, Interferon regulatory factor 4 and 8 in B-cell development, Trends Immunol.
29 (10) (2008) 487–492, https://doi.org/10.1016/j.it.2008.07.006.
[18] P. Tailor, T. Tamura, H.C. Morse 3rdet al., The BXH2 mutation in IRF8 differentially
impairs dendritic cell subset development in the mouse, Blood. 111 (4) (2008)
1942–1945, https://doi.org/10.1182/blood-2007-07-100750.
[19] N. Nelson, Y. Kanno, C. Hong, et al., Expression of IFN regulatory factor family
proteins in lymphocytes. Induction of Stat-1 and IFN consensus sequence binding
protein expression by T cell activation, J. Immunol. 156 (10) (1996) 3711–3720.
[20] K. Takahashi, T. Sugiyama, S. Tokoro, et al., Inhibition of interferon-gamma-in-
duced nitric oxide production by 10-hydroxy-trans-2-decenoic acid through in-
hibition of interferon regulatory factor-8 induction, Cell. Immunol. 273 (1) (2012)
73–78, https://doi.org/10.1016/j.cellimm.2011.11.004.
[21] C.A. Figueiredo, C.R. Marques, S. Costa Rdos, et al., Cytokines, cytokine gene
polymorphisms and helicobacter pylori infection: friend or foe? World J.
Gastroenterol. 20 (18) (2014) 5235–5243, https://doi.org/10.3748/wjg.v20.i18.
5235.
[22] A.O.H. Hall, D.P. Beiting, C. Tato, et al., The cytokines interleukin 27 and inter-
feron-γ promote distinct Treg cell populations required to limit infection-induced
pathology, Immunity. 37 (3) (2012) 511–523, https://doi.org/10.1016/j.immuni.
2012.06.014.
[23] M.A. Koch, G. Tucker-Heard, N.R. Perdue, et al., The transcription factor T-bet
controls regulatory T cell homeostasis and function during type 1 inflammation,
Nat. Immunol. 10 (6) (2009) 595–602, https://doi.org/10.1038/ni.1731.
[24] L.F. Lu, M.P. Boldin, A. Chaudhry, et al., Function of miR-146a in controlling Treg
cell-mediated regulation of Th1 responses, Cell 142 (6) (2010) 914–929, https://
doi.org/10.1016/j.cell.2010.08.012.
[25] W. Lee, H.S. Kim, S.Y. Baek, et al., Transcription factor IRF8 controls Th1-like
regulatory T-cell function, Cell Mol Immunol. 13 (6) (2016) 785–794, https://doi.
org/10.1038/cmi.2015.72.
[26] R. Lin, J. Nie, J. Ren, et al., USP4 interacts and positively regulates IRF8 function
13
Life Sciences 248 (2020) 117456
via K48-linked deubiquitination in regulatory T cells, FEBS Lett. 591 (12) (2017)
1677–1686, https://doi.org/10.1002/1873-3468.12668.
[27] K. Zou, Z. Li, Y. Zhang, et al., Advances in the study of berberine and its derivatives:
a focus on anti-inflammatory and anti-tumor effects in the digestive system, Acta
Pharmacol. Sin. 38 (2) (2017) 157–167, https://doi.org/10.1038/aps.2016.125.
[28] Q. Hu, L. Li, X. Zou, et al., Berberine attenuated proliferation, invasion and mi-
gration by targeting the AMPK/HNF4alpha/WNT5A pathway in gastric carcinoma,
Front. Pharmacol. 9 (2018) 1150, https://doi.org/10.3389/fphar.2018.01150.
[29] Y.H. Lin, J.H. Lin, S.C. Chou, et al., Berberine-loaded targeted nanoparticles as
specific Helicobacter pylori eradication therapy: in vitro and in vivo study,
Nanomedicine. 10 (1) (2015) 57–71, https://doi.org/10.2217/nnm.14.76.
[30] X. Wu, X. Li, Z. Dang, et al., Berberine demonstrates anti-inflammatory properties in
Helicobacter pylori-infected mice with chronic gastritis by attenuating the Th17
response triggered by the B cell-activating factor, J. Cell. Biochem. 119 (7) (2018)
5373–5381, https://doi.org/10.1002/jcb.26681.
[31] D. Werawatganon, Simple animal model of Helicobacter pylori infection, World J.
Gastroenterol. 20 (21) (2014) 6420–6424, https://doi.org/10.3748/wjg.v20.i21.
6420.
[32] J. Wen, J. Wang, P. Li, et al., Protective effects of higenamine combined with [6]-
gingerol against doxorubicin-induced mitochondrial dysfunction and toxicity in
H9c2 cells and potential mechanisms, Biomed. Pharmacother. 115 (2019) 108936,
https://doi.org/10.1016/j.biopha.2019.108881.
[33] P.J. O’Brien, W. Irwin, D. Diaz, et al., High concordance of drug-induced human
hepatotoxicity with in vitro cytotoxicity measured in a novel cell-based model using
high content screening, Arch. Toxicol. 80 (9) (2006) 580–604, https://doi.org/10.
1007/s00204-006-0091-3.
[34] A. Razavi, N. Bagheri, F. Azadegan-Dehkordi, M. Shirzad, G. Rahimian, Rafieian-
Kopaei M, et al, Comparative Immune Response in Children and Adults with H.
Pylori Infection. J Immunol Res. 2015 (2015) 315957, https://doi.org/10.1155/
2015/315957.
[35] J. Zhang, H. Wang, Morroniside protects against chronic atrophic gastritis in rat via
inhibiting inflammation and apoptosis, Am. J. Transl. Res. 11 (9) (2019)
6016–6023.
[36] K. De Filippo, A. Dudeck, M. Hasenberg, et al., Mast cell and macrophage chemo-
kines CXCL1/CXCL2 control the early stage of neutrophil recruitment during tissue
inflammation, Blood. 121 (24) (2013) 4930–4937, https://doi.org/10.1182/blood-
2013-02-486217.
[37] K.A. Eaton, M. Mefford, T. Thevenot, The role of T cell subsets and cytokines in the
pathogenesis of Helicobacter pylori gastritis in mice, J. Immunol. 166 (12) (2001)
7456–7461, https://doi.org/10.4049/jimmunol.166.12.7456.
[38] T. Tamura, T. Nagamura-Inoue, Z. Shmeltzer, et al., ICSBP directs bipotential
myeloid progenitor cells to differentiate into mature macrophages, Immunity. 13
(2) (2000) 155–165, https://doi.org/10.1016/s1074-7613(00)00016-9.
[39] D.-M. Shin, C.-H. Lee, H.C. Morse 3rd., IRF8 governs expression of genes involved in
innate and adaptive immunity in human and mouse germinal center B cells, PLoS
One 6 (11) (2011) e27384, , https://doi.org/10.1371/journal.pone.0027384.
[40] J.F. Marquis, O. Kapoustina, D. Langlais, et al., Interferon regulatory factor 8 reg-
ulates pathways for antigen presentation in myeloid cells and during tuberculosis,
PLoS Genet. 7 (6) (2011) e1002097, , https://doi.org/10.1371/journal.pgen.
1002097.