Fish & Shellfish Immunology 37 (2014) 108e114

Contents lists available at ScienceDirect

Fish & Shellfish Immunology

journal homepage: www.elsevier.com/locate/fsi

Full length article

Passive protective effect of chicken egg yolk immunoglobulins against

experimental Vibrio anguillarum infection in ayu (Plecoglossus altivelis)
Chang-Hong Li, Xin-Jiang Lu, Deng-Feng Li, Jiong Chen*
Laboratory of Biochemistry and Molecular Biology, School of Marine Sciences, Ningbo University, Ningbo 315211, China

a r t i c l e i n f o a b s t r a c t

Article history: Oral administration of chicken egg yolk immunoglobulins (IgY) has attracted much attention as a means
Received 19 November 2013 for controlling infectious diseases caused by microorganisms. This study evaluated the protective effect
Received in revised form of IgY against Vibrio anguillarum infection in ayu, Plecoglossus altivelis. IgY was isolated from egg yolks
21 January 2014
laid by hens initially immunized with formalin-inactivated V. anguillarum. Lower mortality of ayu was
Accepted 21 January 2014
Available online 29 January 2014
observed in groups treated with anti-V. anguillarum IgY (aVIgY), compared with those treated with saline
or with nonspecific IgY (nspIgY). All fish in saline-treated groups died within seven days after bacterial
inoculation. The bacterial load in blood, liver, and spleen was significantly lower in fish treated with
Keywords:
Bacterial burden
aVIgY than in fish treated with nspIgY. aVIgY treatment significantly reduced tumor necrosis factor-a
Cytokine gene expression (PaTNF-a), interleukin-1b (PaIL-1b), transforming growth factor-b (PaTGF-b), and leukocyte cell-derived
Macrophage phagocytosis chemotaxin-2 (PaLECT2) transcript levels in the head kidney, spleen, and liver of ayu challenged by
Plecoglossus altivelis V. anguillarum, compared with nspIgY treatment. The phagocytic activity of macrophages for
Yolk immunoglobulin V. anguillarum in the presence of specific IgY was significantly higher than that seen for nonspecific IgY.
These results suggest that passive immunization by oral intubation with pathogen-specific IgY may
provide a valuable treatment for V. anguillarum infection in ayu.
Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction Chicken egg yolk immunoglobulin (IgY) is the major circulating

Ayu (sweetfish), Plecoglossus altivelis, the sole member of the
Osmeriformes family Plecoglossidae, is an important cultured
freshwater fish in Japan, China, and Korea. Bacterial diseases have
been a major cause of losses in the ayu culture industry in Asian
countries, with Vibrio anguillarum identified as one of the most
harmful pathogens [1e3]. Over the last ten years, ayu culture has
rapidly increased in China, and diseases caused by V. anguillarum
pose a serious threat [3].
Antibiotics have been used extensively for treatment of bacterial
infections in aquatic animals for many years. However, antibiotic
overuse contributes to the growing number of bacterial species that
are becoming resistant to antibacterial medications, which is a
concern worldwide. In order to reduce the risk of overuse of anti-
biotics, a number of alternative measures have been explored and
applied in animal culture, including the use of antimicrobial pep-
tides [4,5], application of probiotics [6,7], immunostimulation [8e
10], vaccination [11,12], and administration of chicken egg yolk
immunoglobulins (IgY) [13,14].
* Corresponding author. Tel.: þ86 574 87609571; fax: þ86 574 87600167.
E-mail addresses: jchen1975@163.com, chenjiong@nbu.edu.cn (J. Chen).
antibody found in chickens, but it is also actively transported to
the egg in a manner similar to the placental transfer of IgG in
mammals [15]. As a passive, inexpensive, and easily produced
antibody, IgY has attracted much attention and is recognized to be
efficient in both therapy and prevention of various diseases [16].
IgY is environmentally friendly and elicits no side effects, disease
resistance, or toxic residues [17]. Studies have successfully eluci-
dated the protective effect of specific IgYs against a variety of
microbial pathogens in mammals. For example, specific chicken
egg IgYs have been used in mastitic cows against Escherichia coli
and Staphylococcus aureus [18,19]. In aquaculture, chicken egg IgYs
have also been used in rainbow trout (Oncorhynchus mykiss)
against Yersinia ruckeri and V. anguillarum [20,21], in shrimp
crayfish (Procambius clarkiaii) and (Penaeus chinensis) against
WSSV [13,22], and in small abalone (Haliotis diversicolor super-
texta) against Vibrio alginolyticus [14]. The IgY administered in
these studies showed effective protection in a dose-dependent
fashion against infection. However, further research is needed to
better understand the mechanisms by which IgY confers protec-
tion [23].
In the present study, the effect of anti-V. anguillarum IgY on the
mortality, bacterial burden, and tissue cytokine gene expression in
ayu challenged by V. anguillarum was determined. The phagocytic

1050-4648/$ e see front matter Ó 2014 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.fsi.2014.01.018
 C.-H. Li et al. / Fish & Shellfish Immunology 37 (2014) 108e114 109

activity of macrophages for V. anguillarum in the presence of spe- 2.5. Survival

cific IgY was also evaluated.
2. Materials and methods
2.1. Preparation of antigen
V. anguillarum strain ayu-H080701 isolated from diseased ayu
[3] was used in this study. Overnight cultures of V. anguillarum were
separated by centrifugation, washed, and suspended in sterile sa-
line (0.9 w/v NaCl) at a density of 108 CFU/ml. Formaldehyde was
added at a final concentration of 0.5% (v/v), and the suspension was
incubated at approximately 37  C for 24 h. Cells were washed twice
with sterile saline to remove the formaldehyde and resuspended in
sterile saline. Complete killing of the V. anguillarum suspensions
was confirmed by culture. Bacterial suspensions were stored at
approximately 4  C before use.
2.2. Development of anti-V. anguillarum antibodies in chickens
The 50% lethal dose (LD50) of V. anguillarum ayu-H080701 was
determined to be about 5.4  105 CFU/kg of fish in this study. Two
concentrations (100 mg/kg or 200 mg/kg) of aVIgY or nspIgY were
orally intubated to ayu that were injected intraperitoneally (ip),
simultaneously with 1.2  104 CFU V. anguillarum per fish. Another
group of ayu without IgY treatment was injected ip with
V. anguillarum. Morbidity was monitored for 8 days after challenge,
and the results were recorded every 24 h.
In order to determine the time course of aVIgY, 4 mg aVIgY were
orally intubated to ayu before or after bacterial challenge. For this,
two groups of ayu were injected ip with 1.2  104 CFU
V. anguillarum per fish at either 7 or 14 d after aVIgY treatment. Two
additional groups of ayu were orally intubated with 4 mg aVIgY per
fish at either 1 or 2 d post-injection. Another group of ayu was
injected ip with V. anguillarum without IgY treatment. Morbidity
was monitored for 8 days after challenge, and the results were
recorded every 24 h.

All of the experiments were performed according to Experi- 2.6. Bacterial burden assay
mental Animal Management Law of China and approved by An-
imal Ethics Committee of Ningbo University. A group of Hyline aVIgY or nspIgY at 200 mg/kg was orally intubated to ayu that
White laying hens, 24 weeks old, were kept for immunization were injected ip simultaneously with V. anguillarum. A bacterial
and egg production in the Central Animal Facility of Ningbo burden assay was performed as previously described [24]. Briefly,
University. Antigen suspensions comprising formalin-killed the blood, liver, spleen, and head kidney were harvested aseptically
V. anguillarum were diluted to 108 CFU/ml in sterile 0.9% (w/v) from ayu at 24 h post-infection (hpi). Each liver, spleen, or head
NaCl. Hens were injected intramuscularly in breast muscle with kidney was homogenized in 1 ml of sterile PBS (pH7.2). Homoge-
0.5 ml of antigen suspension mixed with an equal volume of nates and blood were serially diluted in sterile PBS (pH7.2) and
complete Freund’s adjuvant for the first immunization. After plated onto separate LuriaeBertani agar plates. After incubation for
initial immunization, two additional booster injections each 18 h at 28  C, bacterial colonies in the plates were counted sepa-
consisting of 0.25 ml of antigen suspension mixed with an equal rately for each sample. Liver, spleen, and head kidney samples were
volume of incomplete Freund’s adjuvant were given on days 10 normalized to organ weight, and blood samples were normalized to
and 20. Eggs were then collected daily from the immunized blood volume.
hens and control hens from the same flock and stored at 4  C
until use. 2.7. Alteration of cytokine mRNA expression related to IgY
administration
2.3. Isolation and purification of IgY
Either aVIgY or nspIgY at 200 mg/kg was orally intubated to ayu
that were injected ip simultaneously with 1.2  104 CFU
IgY isolation procedures were carried out by salt precipitation
V. anguillarum per fish. Two additional groups of ayu were injected
(ammonium sulphate in solid form) followed by centrifugation
ip with either 1.2  104 CFU V. anguillarum or the same volume of
and dialysis [23]. Briefly, the egg yolk was separated from the
the saline per fish, without IgY treatment. Liver, kidney, and spleen
white, mixed with nine volumes of sterile water, and frozen
were collected aseptically at 12 hpi, frozen in liquid nitrogen, and
at 20  C overnight. The mixture was then thawed, centrifuged at
stored at 70  C until use.
2500 g (4  C, 45 min) and the pellet was discarded. Supernatant
Changes of PaTNF-a, PaIL-1b, PaTGF-b, and PaLECT2 mRNA
was clarified by filtration through a 0.4-mm filter before adding
expression in ayu liver, kidney, and spleens were determined by
ammonium sulphate (up to 40 percent). After 18 h at 4  C, the
real-time quantitative PCR (RT-qPCR) as previously described [25].
solution was centrifuged at 5000 g (4  C, 45 min), and the su-
Specific primers were designed according to the sequences of
pernatant was discarded. The pellet was resuspended with PBS
PaTNF-a, PaIL-1b, PaTGF-b, and PaLECT2 (Table 1). As an internal
and dialyzed against PBS. Anti-V. anguillarum IgY (aVIgY) was
extracted from the immunized eggs, while nonspecific IgY
(nspIgY) was extracted from the control. The purity of IgY was Table 1
investigated by sodium dodecyl sulfate polyacrylamide gel elec- Oligonucleotide primers used in this work.
trophoresis (SDS-PAGE) under reducing conditions by using a 5% Primer Gene Accession Nucleotide Amplification
stacking gel and a 12% resolving gel. The gel was stained with number sequence (50 / 30 ) of length
Coomassie brilliant blue R-250 staining solution (Bio-Rad Labo-
PaTNF-aF TNF-a JP740414 ACATGGGAGCTGTGTTCCTC 115 bp
ratories, Hercules, CA, USA). PaTNF-aR GCAAACACACCGAAAAAGGT
PaIL-1bF IL-1b HF543937 TACCGGTTGGTACATCAGCA 104 bp
PaIL-1bR TGACGGTAAAGTTGGTGCAA
2.4. Fish
PaTGF-bF TGF-b JP742920 CTGGAATGCCGAGAACAAAT 101 bp
PaTGF-bR GATCCAGAACCTGAGGGACA
Healthy juvenile ayu weighing 20e25 g each were obtained PaLECT2F LECT2 FM253748 CAGTCTGGTCCTTGCAGAGC 440 bp
from pathogen-free stocks and maintained in stock tanks supplied PaLECT2R ACTTGGTGGGGTCAGACTTG
with filtered water at 20e22  C. Fish were fed a diet of commercial pActin2F b-actin AB020884 TCGTGCGTGACATCAAGGAG 231 bp
pActin2R CGCACTTCATGATGCTGTTG
fish food.
110 C.-H. Li et al. / Fish & Shellfish Immunology 37 (2014) 108e114
control, primers pActin2F and pActin2R were used to amplify a 231-
bp fragment of the housekeeping b-actin mRNA [26,27]. One ml of
each reverse transcription reaction served as a template for the
25 ml RT-qPCR reaction using SYBR premix Ex Taq (Perfect Real
Time) (TaKaRa). RT-qPCR was performed using the RT-Cycler(tm)
Realtime Fluorescence Quantitative PCR (CapitalBio, Beijing,
China) with an initial denaturation step at 95  C for 5 min, followed
by amplification of the target cDNA (35 cycles of denaturation at
95  C for 30 s, annealing at 58  C for 30 s, and extension at 72  C for
30 s). The mRNA expression of the PaTNF-a, PaIL-1b, PaTGF-b, and
PaLECT2 genes was normalized against b-actin expression.
2.8. Phagocytic assay of macrophages
Head kidney-derived macrophages of ayu were isolated and
cultured according to previous reports [26]. Briefly, head kidneys
were aseptically extracted, collected, and meshed in RPMI 1640
(Invitrogen, Shanghai, China) supplemented with 2% fetal bovine
serum (FBS) (Invitrogen), penicillin (100 U ml1), streptomycin
(100 mg ml1), and heparin (20 U ml1). After centrifugation, cells
were collected from the interphase, washed, and dissolved in
RPMI 1640 supplemented with 0.1% FBS and antibiotics. Cells
were then seeded into 35-mm well plates at a density of
2  107 cells well1 and allowed to adhere overnight at 24  C
with 5% CO2. Non-adherent cells were washed off after overnight
incubation. The medium was changed to complete medium (4%
ayu serum, 6% FBS, 100 U ml1 penicillin, 100 mg ml1 strepto-
mycin), and cells were left in the incubator under the same
conditions.
Before infection, the medium was changed to antibiotic-free
medium and cells were incubated for another 12 h. Macro-
phages were treated with aVIgY or nspIgY (at a final concentra-
tion of 1 mg/ml), and infected with FITC-labeled V. anguillarum at
a multiplicity of infection (MOI) of 10. Cells were harvested at
30 min post-infection. The engulfed bacteria were examined by
fluorescence microscopy (600  magnification; Nikon Eclipse Ti-
U, Tokyo, Japan). The mean fluorescence intensity (MFI) of bac-
teria engulfed by cells among nspIgY- and aVIgY-treated groups
Fig. 1. SDS-PAGE patterns of antibody (IgY) purified from egg yolk: (lane M) protein
molecular weight standard (kDa); (lane 1) nonspecific IgY (nspIgY). (lane 2) anti-
V. anguillarum IgY (aVIgY). Heavy (H) and light (L) chains are indicated.
was analyzed by the NIH ImageJ program, and at least 400
macrophages were counted for each independent assay. The re-
sults are expressed as the percent MFI of the control and are
shown as the mean  SEM of a typical example from at least
three independent experiments.
2.9. Statistical analysis
Results are presented as mean  SEM. All data were subjected to
one-way or repeated-measures analysis of variance (ANOVA) with
SPSS (version 13.0, Chicago, IL, USA), followed by the least signifi-
cant difference (LSD) post-hoc test to compare individual groups.
The KaplaneMeier method was used to analyze survival. Differ-
ences were considered statistically significant at a probability
(P) < 0.05.
3. Result
3.1. Isolation and purification of IgY
In this study, aVIgY was successfully elicited by immunizing
hens with formalin-inactivated whole V. anguillarum antigen
emulsified in Freund’s adjuvant. IgY isolation were carried out by
ammonium sulphate precipitation followed by centrifugation and
dialysis. The purity of IgY was investigated by SDS-PAGE. Under
reducing conditions, the purified aVIgY migrated as heavy and light
chains of 66 and 26 kDa, respectively (Fig. 1, lane 1). The electro-
phoretic patterns were in accordance with nspIgY (Fig. 1, lane 2).
3.2. Effect of IgY on the survival of V. anguillarum-infected ayu
Two concentrations of IgY (aVIgY or nspIgY) were orally
intubated to ayu that were injected ip simultaneously with
V. anguillarum, resulting in dramatic differences in fish survival
(Fig. 2a). The fish without IgY treatment all died by day 8. The
fish treated with 100 mg/kg or 200 mg/kg aVIgY could achieve
survival rates of approximately 50% and 80% at day 8, respec-
tively. However, the survival rates of fish treated with 100 mg/kg
or 200 mg/kg nspIgY were only 10% and 15% at day 8, respec-
tively. Based on the results obtained from the above experiment,
pre-treatment or post-treatment with IgY at a dose of 200 mg/kg
was used to detect the effect of aVIgY on the survival of ayu upon
V. anguillarum infection. The fish without IgY treatment all died
by day 8. The fish treated with 200 mg/kg aVIgY 7 or 14 d before
bacterial infection achieved survival rates of 64% and 5% at day 8,
respectively. The survival rates of fish treated with 200 mg/kg
aVIgY 1 or 2 d after bacterial infection were 55% and 9% at day 8,
respectively.
3.3. Effect of IgY on bacterial burden in V. anguillarum-infected ayu
A bacterial burden assay was performed by the plate count
method. The number of colony forming units (CFU) per mg of tissue
or per 50 ml of blood is shown in Fig. 3. The bacterial burden in
blood from the aVIgY-treated group was 3.0  103 CFU per 50 ml,
while that from the nspIgY-treated group was 5.6  104 CFU per
50 ml. The bacterial burden in liver from the aVIgY-treated group
was 0.82  103 CFU per mg, while that from the nspIgY-treated
group was 5.2  103 CFU per mg. The bacterial burden of spleen
from the aVIgY-treated group was 0.81  103 CFU per mg, while that
from the nspIgY-treated group was 3.9  103 CFU per mg. The
bacterial burden of head kidney from the aVIgY-treated group was
0.17  103 CFU per mg, while that from the nspIgY-treated group
was 1.14  103 CFU per mg.
 C.-H. Li et al. / Fish & Shellfish Immunology 37 (2014) 108e114
Fig. 2. IgY improves survival in V. anguillarum-infected ayu. (a) Survival in V. anguil-
larum-infected ayu orally intubated with 100 or 200 mg/kg aVIgY, or 100 or 200 mg/kg
nspIgY simultaneously. (b) Survival in ayu orally intubated with 200 mg/kg aVIgY 7 or
14 d before, or 1 or 2 d after V. anguillarum infection. An additional group of ayu
without IgY treatment was injected ip with V. anguillarum. *: P < 0.05, **: P < 0.01
versus the nspIgY-treated group (n ¼ 4).
3.4. Effect of IgY on cytokine mRNA expression in V. anguillarum-
infected ayu
RT-qPCR was performed to analyze PaTNF-a, PaIL-1b, PaTGF-b,
and PaLECT2 transcripts in head kidney, spleen, and liver from
nspIgY- or aVIgY-treated ayu that were injected ip simultaneously
with V. anguillarum. V. anguillarum infection resulted in signifi-
cantly increased transcripts of PaIL-1b (head kidney: 65.4-fold;
spleen: 121.94-fold; liver: 3.93-fold), PaTNF-a (head kidney: 3.09-
fold; spleen: 6.15-fold; liver: 2.82-fold), PaTGF-b (head kidney:
7.72-fold; spleen: 2.63-fold; liver: 8.64-fold) and PaLECT2 (head
kidney: 33.28-fold; spleen: 1.72-fold; liver: 13.44-fold) when
compared to that of saline-injected fish (Fig. 4). For the
V. anguillarum-infected groups, the cytokine mRNA expression
111
Fig. 3. Bacterial burden in blood, liver, spleen and head kidney of V. anguillarum-
infected ayu orally intubated with 200 mg/kg aVIgY or nspIgY simultaneously. Data for
tissue and blood are presented as CFU per mg of tissue or per 50 mL of blood,
respectively. Horizontal bars indicate means. *: P < 0.05, **: P < 0.01 versus the nspIgY-
treated group (n ¼ 4).
levels of the nspIgY-treated group showed no obvious differences
when compared to those without the IgY treatment, but were
higher than those in fish of the aVIgY-treated group (Fig. 4).
Compared to the nspIgY-treated group, the most significant
changes were observed in spleen PaIL-1b (decreased 12.5-fold) and
PaTNF-a (decreased 4.44-fold), liver PaTGF-b (decreased 2.26-fold),
and head kidney PaLECT2 (decreased 2.54-fold).
3.5. Effect of IgY on macrophage phagocytosis
Head kidney-derived macrophages of ayu were isolated and
used to assess the effect of IgY in the phagocytosis of FITC-labeled
V. anguillarum by fluorescence microscopy observation. The re-
sults showed that the phagocytic percent of macrophages from the
aVIgY-treated group was higher than that from the nspIgY-treated
group (increased 1.41-fold) (P < 0.05) (Fig. 5).
4. Discussion
As a passive, inexpensive, and easily produced antibody, avian
IgY has attracted much attention and has been recognized as an
efficient prophylactic, therapeutic, and food preservation agent
[13,14,28,29]. The advantages of using IgY have also been described
in aquatic animals [30e32]. In this study, chicken egg yolk anti-
bodies against V. anguillarum were produced, and the protective
112 C.-H. Li et al. / Fish & Shellfish Immunology 37 (2014) 108e114
Fig. 4. IgY alters the mRNA expression of PaTNF-a, PaIL-1b, PaTGF-b, and PaLECT2 in head kidney, spleen, and liver. Either 200 mg/kg aVIgY or nspIgY were orally intubated to ayu
that were injected ip simultaneously with 1.2  104 CFU V. anguillarum per fish. Two additional groups of ayu without IgY treatment were injected ip with either 1.2  104 CFU
V. anguillarum or the same volume of saline. Error bars indicate SEM. Relative expression of PaIL-1b, PaTNF-a, PaTGF-b, and PaLECT2 mRNA was normalized against b-actin. *:
P < 0.05, **: P < 0.01 versus the saline-treated group or the nspIgY-treated group (n ¼ 4).
effects in ayu upon bacterial infection were investigated. Vaccina-
tion has proved to be effective in ayu against V. anguillarum, and the
survival rate for fish with V. anguillarum vaccine increases from
64.2% to 92.4% compared with the nonvaccinated fish [33]. In our
investigation, the survival rate increased by 65% after 200 mg/kg
aVIgY treatment. Hence, both vaccination and IgY usage are effec-
tive against V. anguillarum infection. Since the approval of aquatic
vaccine is very difficult in China, the usage of IgY in the anti-
microbial infection should be strongly recommended in aquacul-
ture. Furthermore, the survival rate increased by 55% in ayu treated
with 200 mg/kg aVIgY 1 d after bacterial infection. Our results
suggest that IgY may treat V. anguillarum infection, while vaccina-
tion only can prevent but not treat infection.
Specific IgYs have been proven effective in promoting disease
resistance in some aquatic animals. For example, pre-ip injection of
specific IgY was effective against an immersion challenge with
Y. ruckeri or V. anguillarum in rainbow trout [20,21], and pre-
Fig. 5. Phagocytic percent of the head kidney-derived macrophages against
V. anguillarum treated by IgY. The head kidney-derived macrophages were incubated
with FITC-labeled V. anguillarum at a MOI of 10 for 30 min with aVIgY or nspIgY at
1 mg/ml. Histogram represents the percent mean fluorescence intensity (MFI) of
bacteria engulfed by cells. Error bars indicate SEM. Scale bar, 10 mm *: P < 0.05, versus
the nspIgY-treated group (n ¼ 4).
feeding a diet with anti-WSSV IgY significantly reduced the cu-
mulative mortality of WSSV-infected black tiger shrimp (Penaeus
monodon) [34]. Additionally, pre-feeding a sheet diet with anti-
V. alginolyticus IgY significantly increased the survival of
V. alginolyticus-infected abalone (Haliotis diversicolor supertexta)
[14]. A recent study reported that immersion with anti-Aeromonas
hydrophila IgY at 0.5 g L1 exhibited a therapeutic effect against ip
injection with 108 cfu/mL of A. hydrophila in crucian carp (Carassius
auratus Gibelio) [32]. In the present study, aVIgY-treated fish that
were injected ip simultaneously with V. anguillarum exhibited the
highest survival rate (80%), and the group orally intubated with
aVIgY 7 d before or 1 d after bacterial infection also exhibited a
higher rate of survival (64% and 55%, respectively). Results suggest
that the administration of specific IgY is an attractive approach for
establishing protective immunity against this bacterial pathogen,
however, the time of treatment is important for effective protec-
tion. Although fish can produce antibody themselves, IgY usage in
fish seems to be effective against bacterial infection, providing an
alternative method to control bacterial disease in aquaculture.
Previous studies have shown that specific IgY exhibits bacteri-
cidal and bacteriostatic activities by opsonization of the bacteria for
macrophage phagocytosis, or to influence the growth of bacteria
[18,31,32,35e37]. Oral administration of specific IgYs could signif-
icantly reduce the total bacterial count in mice feces [31]. In Japa-
nese eel (Anguilla japonica), oral administration of specific IgYs was
reported to reduce the bacterial number in the intestine [35]. In
ingibel carp (C. auratus Gibelio), administration of specific IgYs by ip
injection reduced the number of A. hydrophila in kidney samples of
dead fish [38]. The present study showed that oral administration
of aVIgY could significantly decrease the bacterial burden in ayu
immune tissues, which is consistent with previous reports. There
are also reports showing that specific IgY can enhance the phago-
cytic activity of macrophages [18,36]. Immunoelectron microscopic
observation revealed that the binding of specific IgY to the bacterial
surface could result in structural alteration of the bacterial surface,
 C.-H. Li et al. / Fish & Shellfish Immunology 37 (2014) 108e114
which may promote phagocytosis of the bacteria cells [18,39]. In
the present study, aVIgY treatment could significantly increase the
phagocytic activity of macrophages to V. anguillarum in vitro when
compared to nspIgY treatment, suggesting that specific IgY at least
could reduce bacterial burden by promoting the phagocytosis of
macrophages.
Inflammation is mediated by a variety of soluble factors,
including a group of secreted polypeptides known as cytokines.
Several cytokines play key roles in mediating acute inflammatory
reactions, such as IL-1b, TNF-a, TGF-b, and LECT2. IL-1b plays a
crucial role as a prototypical pro-inflammatory cytokine in immune
responses and has been shown to increase cytokine production,
phagocytosis, and bacterial killing in macrophages [40,41]. TNF-a is
a well-known pro-inflammatory cytokine with multiple biological
functions via affecting the growth, differentiation, survival and
physiological activity of a variety of different cells [42]. TGF-b is a
pleiotropic cytokine that predominantly exerts inhibitory functions
in the immune system [42]. LECT2 is a newly identified cytokine
involved in the macrophage-mediated immune response [25,27]. In
fish, the expression of those genes had been shown to be closely
related to vibriosis [27,40e42]. Thus, we selected them as the
cytokine markers for studying the effect of aVIgY on immune
response to V. anguillarum infection in ayu. Until the present, effects
of IgY on cytokine mRNA expression in animal tissues were rarely
reported. The current study showed that mRNA expression of these
cytokines in fish immune tissues increased significantly in the
V. anguillarum-infected group compared with the saline-treated
group. Oral intubation of nspIgY had no effect on mRNA expres-
sion of these cytokines in V. anguillarum-infected ayu, while oral
intubation of aVIgY inhibited mRNA expression of all cytokines
tested with the exception of liver LECT2. It was recently reported
that LECT2 did not suppress early inflammation but rather
improved protective immune response in septic mice [25], and it is
produced mainly by the liver [43]. This may explain why LECT2
transcripts in liver were not significantly associated with aVIgY
treatment at 12 hpi in this study. These results suggest that specific
IgY may play a role in suppression of the inflammatory response via
inhibition of vigorous expression of inflammatory cytokines, which
may contribute beneficial effects in fish bacterial infection.
In conclusion, feeding specific anti-V. anguillarum IgY to ayu
either before or after ip injection produced marginal reductions in
mortality. aVIgY administration led to a reduction of bacterial
number and inflammatory cytokine expression in fish tissues, and
enhanced the phagocytic activity of macrophages against
V. anguillarum in vitro. The mechanism of the protective effect of
specific IgY in bacterial infection is likely based on its bactericidal
(or bacteriostatic) effects on a certain pathogen and a potential role
in the regulation of the fish immune system. Thus, specific IgY
immunization should be a safe, cost-effective, and easily imple-
mented technique to control bacterial infections in aquaculture.
Acknowledgments
The project was supported by the Program for the National
Natural Science Foundation of China (31372555), Zhejiang Provin-
cial Natural Science Foundation of China (LZ13C190001,
LQ13C190002), Zhejiang Marine Biotechnology Innovation Team
(ZMBIT) (2010R50029-16), the Program for the Natural Science
Foundation of Ningbo City (2013A610166) and the KC Wong Magna
Fund in Ningbo University.
References
[1] Muroga K, Egusa S. Vibrio anguillarum from an endemic disease of ayu in Lake
Hamana. Bull Jap Soc Sci Fish 1967;33:636e40.
113
[2] Muroga K, Egusa S. Vibriosis of Ayu: a review. J Fac Appl Biol Sci Hiroshima
Univ 1988;27:1e17.
[3] Li CH, Chen J, Shi YH, Li MY. Characterization of Listonella anguillarum as the
aetiological agent of vibriosis occurred in cultured ayu (Plecoglossus altivelis)
in Ninghai country, China. Acta Micriobiol Sin 2009;49:931e7.
[4] Jia X, Patrzykat A, Devlin RH, Ackerman PA, Iwama GK, Hancock REW. Anti-
microbial peptides protect coho salmon from Vibrio anguillarum infections.
Appl Environ Microbiol 2000;66:1928e32.
[5] Fernandes JM, Kemp GD, Smith VJ. Isolation and characterisation of onco-
rhyncin II, a histone H1-derived antimicrobial peptide from skin secretions of
rainbow trout, Oncorhynchus mykiss. Dev Comp Immunol 2004;28:127e38.
[6] Lazado CC, Caipang CM, Brinchmann MF, Kiron V. In vitro adherence of two
candidate probiotics from Atlantic cod and their interference with the adhe-
sion of two pathogenic bacteria. Vet Microbiol 2011;148:252e9.
[7] Touraki M, Karamanlidou G, Karavida P, Chrysi K. Evaluation of the probiotics
Bacillus subtilis and Lactobacillus plantarum bioencapsulated in Artemia nauplii
against vibriosis in European sea bass larvae (Dicentrarchus labrax, L.). World J
Microbiol Biotechnol 2012;28:2425e33.
[8] Skjermo J, Bergh Ø. High-M alginate immunostimulation of Atlantic halibut
(Hippoglossus hippoglossus L.) larvae using Artemia for delivery increases
resistance against vibriosis. Aquaculture 2004;238:107e13.
[9] Huttenhuis HB, Ribeiro AS, Bowden TJ, Van Bavel C, Taverne-Thiele AJ,
Rombout JH. The effect of oral immuno-stimulation in juvenile carp (Cyprinus
carpio L.). Fish Shellfish Immunol 2006;21:261e71.
[10] Liu Y, Oshima S, Kawai K. Glyceraldehyde-3-phosphate dehydrogenase of
Edwardsiella tarda has protective antigenicity against Vibrio anguillarum in
Japanese flounder. Dis Aqua Org 2007;75:217e20.
[11] Rajesh Kumar S, Ishaq Ahmed VP, Parameswaran V, Sudhakaran R, Sarath
Babu V, Sahul Hameed AS. Potential use of chitosan nanoparticles for oral
delivery of DNA vaccine in Asian sea bass (Lates calcarifer) to protect from
Vibrio (Listonella) anguillarum. Fish Shellfish Immunol 2008;25:47e56.
[12] Yu LP, Hu YH, Sun BG, Sun L. C312M: an attenuated Vibrio anguillarum strain
that induces immunoprotection as an oral and immersion vaccine. Dis Aquat
Organ 2012;102:33e42.
[13] Lu Y, Liu J, Jin L, Li X, Zhen Y, Xue H. Passive immunization of crayfish (Pro-
cambius clarkiaii) with chicken egg yolk immunoglobulin (IgY) against white
spot syndrome virus (WSSV). Appl Biochem Biotechnol 2009;159:750e8.
[14] Wu CJ, Wang H, Chan YL, Li TL. Passive immune-protection of small abalone
against Vibrio alginolyticus infection by anti-Vibrio IgY-encapsulated feed. Fish
Shellfish Immunol 2011;30:1042e8.
[15] de Paula VS, da Silva ADS, de Vasconcelos GALBM, Iff ET, Monteiro Silva ME,
Kappel LA, et al. Applied biotechnology for production of immunoglobulin Y
specific to hepatitis A virus. J Virol Methods 2011;171:102e6.
[16] Jensenius JC, Andersen I, Hau J, Crone M, Koch C. Eggs: conveniently packaged an-
tibodies. Methods for purification of yolk IgG. J Immunol Methods 1981;46:63e8.
[17] Coleman M. Using egg antibodies to treat diseases. In: Sim JS, Nakai S, Guenter W,
editors. Egg nutrition and biotechnology. UK: CABI Publishing Inc; 1999.
[18] Zhen YH, Jin LJ, Guo J, Li XY, Lu YN, Chen J, et al. Characterization of specific
egg yolk immunoglobulin (IgY) against mastitis-causing Escherichia coli. Vet
Microbiol 2008;130:126e33.
[19] Zhen YH, Jin LJ, Li XY, Guo J, Li Z, Zhang BJ, et al. Efficacy of specific egg yolk
immunoglobulin (IgY) to bovine mastitis caused by Staphylococcus aureus. Vet
Microbiol 2009;133:317e22.
[20] Lee SB, Mine Y, Stevenson RM. Effects of hen egg yolk immunoglobulin in
passive protection of rainbow trout against Yersinia ruckeri. J Agric Food Chem
2000;48:110e5.
[21] Arasteh N, Aminirissehei AH, Yousif AN, Albright LJ, Durance TD. Passive
immunization of rainbow trout (Oncorhynchus mykiss) with chicken egg yolk
immunoglobulins (IgY). Aquaculture 2004;231:23e36.
[22] Kim DK, Jang IK, Seo HC, Shin SO, Yang SY, Kim JW. Shrimp protected from
WSSV disease by treatment with egg yolk antibodies (IgY) against a truncated
fusion protein derived from WSSV. Aquaculture 2004;237:21e30.
[23] Amaral JA, Tino De Franco M, Carneiro-Sampaio MM, Carbonare SB. Anti-
enteropathogenic Escherichia coli immunoglobulin Y isolated from eggs laid
by immunised Leghorn chickens. Res Vet Sci 2002;72:229e34.
[24] Soto E, Endris RG, Hawke JP. In vitro and in vivo efficacy of florfenicol for
treatment of Francisella asiatica infection in tilapia. Antimicrob Agents Ch
2010;54:4664e70.
[25] Lu XJ, Chen J, Yu CH, Shi YH, He YQ, Zhang RC, et al. LECT2 protects mice
against bacterial sepsis by activating macrophages via the CD209a receptor.
J Exp Med 2013;210:5e13.
[26] He YQ, Chen J, Lu XJ, Shi YH. Characterization of P2X7R and its function in the
macrophages of ayu, Plecoglossus altivelis. PLoS One 2013;8:e57505.
[27] Lu XJ, Hang XY, Yin L, He YQ, Chen J, Shi YH, et al. Sequencing of the first ayu
(Plecoglossus altivelis) macrophage transcriptome and microarray develop-
ment for investigation the effect of LECT2 on macrophages. Fish Shellfish
Immunol 2013;34:497e504.
[28] Sui J, Cao L, Lin H. Antibacterial activity of egg yolk antibody (IgY) against
Listeria monocytogenes and preliminary evaluation of its potential for food
preservation. J Sci Food Agric 2011;91:1946e50.
[29] Xu Y, Lin H, Sui J, Cao L. Effects of specific egg yolk antibody (IgY) on the
quality and shelf life of refrigerated Paralichthys olivaceus. J Sci Food Agric
2012;92:1267e72.
[30] Dias da Silva W, Tambourgi DV. IgY: a promising antibody for use in immunodi-
agnostic and in immunotherapy. Vet Immunol Immunopathol 2010;135:173e80.
114 C.-H. Li et al. / Fish & Shellfish Immunology 37 (2014) 108e114
[31] Neema K, Mtenga AB, Shim WB, Chung DH. The in vitro and in vivo efficacy of
hen IgY against Vibrio parahaemolyticus and Vibrio vulnificus. J Microbiol
Biotechnol 2012;22:1423e31.
[32] Jin L, Li X, Zou D, Li S, Song W, Xu Y. Protection of crucian carp (Carassius
auratus Gibelio) against septicaemia caused by Aeromonas hydrophila using
specific egg yolk immunoglobulins. Aquac Res 2013;44:928e36.
[33] Kawai K, Yamamoto S, Kusuda R. Plankton-mediated oral delivery of Vibrio
anguillarum vaccine to juvenile ayu Plecoglossus altivelis. Bull Jpn Soc Sci Fish
1989;55:35e40.
[34] Kumaran T, Michaelbabu M, Selvaraj T, Albindhas S, Citarasu T. Production of
anti WSSV IgY Edible antibody using Herbal Immunoadjuvant Asparagus
racemosus and its Immunological influence against WSSV infection in Penaeus
monodon. J Aquacult Feed Sci Nut 2010;2:1e5.
[35] Gutierrez MA, Miyazaki T, Hatta H, Kim M. Protective properties of egg yolk IgY
containing anti-Edwardsiella tarda antibody against paracolo disease in the
Japanese eel, Anguilla japonica Temminck & Schlegel. J Fish Dis 1993;16:113e22.
[36] Barnes AC, Guyot C, Hansen BG, Horn MT, Ellis AE. Antibody increases
phagocytosis and killing of Lactococcus garvieae by rainbow trout (Onco-
rhynchus mykiss, L.) macrophages. Fish Shellfish Immunol 2002;12:181e96.
[37] Mahdavi AH, Rahmani HR, Nili N, Samie AH, Soleimanian-Zad S. Chicken egg
yolk antibody (IgY) powder against Escherichia coli 078:K80. J Anim Vet Adv
2010;9:366e73.
[38] Li XL, Shuai JB, Fang WH. Protection of Carassius auratus Gibelio against
infection by Aeromonas hydrophila using specific immunoglobulins from hen
egg yolk. J Zhejiang Univ Sci B 2006;7:922e8.
[39] Sunwoo HH, Lee EN, Gujral N, Suresh MR. Growth inhibition of Escherichia coli
987P by neutralizing IgY antibodies. Open Immunol J 2010;3:1e8.
[40] Secombes CJ, Wang T, Bird S. The interleukins of fish. Dev Comp Immunol
2011;35:1336e45.
[41] Lu XJ, Chen J, He YQ, Shi YH. Molecular characterization of an IL-1b gene from
ayu, Plecoglossus altivelis. Fish Shellfish Immunol 2013;34:1253e9.
[42] Zhu LY, Nie L, Zhu G, Xiang LX, Shao JZ. Advances in research of fish immune-
relevant genes: a comparative overview of innate and adaptive immunity in
teleosts. Dev Comp Immunol 2013;39:39e62.
[43] Yamagoe S, Mizuno S, Suzuki K. Molecular cloning of human and bovine
LECT2 having a neutrophil chemotactic activity and its specific expression in
the liver. BBA-Gene Struct Expr 1998;1396:105e13.