661375

research-article2016
JFM0010.1177/1098612X16661375Journal of Feline Medicine and SurgeryMukhopadhyay et al

Original Article

Journal of Feline Medicine and Surgery

Molecular characterisation of 1­–7

© The Author(s) 2016
Reprints and permissions:
parvoviruses from domestic cats sagepub.co.uk/journalsPermissions.nav
DOI: 10.1177/1098612X16661375

reveals emergence of newer jfms.com

This paper was handled and processed

variants in India by the European Editorial Office (ISFM)

for publication in JFMS

Hirak K Mukhopadhyay1, Mangadevi Nookala1,

Nobal RK Thangamani1, Amsaveni Sivaprakasam1,
Prabhakar X Antony1, Jacob Thanislass2,
Mouttou V Srinivas1 and Raghavan M Pillai1

Abstract
Objectives  The present study was undertaken to characterise the viral polypeptide 2 (VP2) gene of parvovirus from
domestic cats in India.
Methods  The faecal samples from diarrhoeic/healthy domestic cats were collected from different geographical
regions of India for screening by PCR assay followed by sequence analysis of the VP2 gene.
Results  Canine parvovirus (CPV)/feline panleukopenia virus (FPV) infections were found in 12 samples (11.3%) of
106 faecal samples tested. Two new CPV-2a (297Ala and Asn426) and three FPV strains were identified by VP2
gene analysis. Several unique and existing amino acid mutations were found suggesting continuous evolution and
emergence of newer variants. The phylogenetic analysis of the CPV sequences revealed that the two new CPV-
2a strains from Mumbai (MC8) and Puducherry (P15) were clustered together in a single clade but had evolved
independently and were ancestrally related to Chinese CPV-2a isolates. The FPV sequences (T-C-6 and T-C-1) from
Thrissur, Kerala, formed a different clade (FPV clade) and were closely related to each other and had an ancestral
relationship with an FPV isolate from the USA. Another FPV isolate from Goa (GC1) was positioned in the same
clade but had evolved independently.
Conclusions and relevance  Detection of CPV in both diarrhoeic/healthy cats and the occurrence of FPV infection in
a vaccinated cat provide new insights into parvovirus infections in cats in India.

Accepted: 2 July 2016

Introduction
Feline panleukopenia virus (FPV) and canine parvovirus
(CPV) infections are highly contagious and serious
enteric diseases of cats and dogs, respectively, with high
fatality rates. They are members of the genus
Protoparvovirus of the family Parvoviridae, which also
includes mink enteritis virus. Canine parvovirus caused
by CPV-2 is considered a canine-specific variant of the
FPV that emerged as a novel pathogen in the late 1970s
as a consequence of an interspecies jump from other car-
nivores to dogs and spread rapidly worldwide.1
antigenic strains differ from CPV-2a at only one position
(VP2 residue 426), they are now considered to be vari-
ants of CPV-2a rather than distinct subtypes, as are all of
the CPVs circulating worldwide today.3 During the early
1990s in German CPV isolates, an additional amino acid
difference was observed in CPV-2a and CPV-2b at amino
1Department of Veterinary Microbiology, Rajiv Gandhi Institute of
Veterinary Education and Research, Puducherry, India
2Department of Veterinary Biochemistry, Rajiv Gandhi Institute of

However, by the end of 1980, CPV-2 was completely
replaced globally in dogs by a genetic and antigenic vari-
ant termed CPV-2a.2 Subsequently, the VP2 residue 426
changed from Asn to Asp and then from Asp to Glu in
the so-called CPV-2b and CPV-2c antigenic variant
strains, respectively. However, as the CPV-2b and CPV-2c
Veterinary Education and Research, Puducherry, India
Corresponding author:
Hirak Kumar Mukhopadhyay MVSc, PhD, Department of
Veterinary Microbiology, Rajiv Gandhi Institute of Veterinary
Education and Research, Puducherry 605 009, India
Email: mhirak@rediffmail.com

Downloaded from jfm.sagepub.com at CORNELL UNIV on August 26, 2016

2 Journal of Feline Medicine and Surgery 
Table 1  Details showing the number of samples collected from different states of India (2011–2014) and the results
Sample State/union territory Place
1 Maharashtra Mumbai
2 West Bengal Kolkata
3 Madhya Pradesh Jabalpur
4 Kerala Thrissur
5 Union Territory of Puducherry Puducherry
  Karaikal
  Auroville
6 Goa Caranzalem
7 Tamil Nadu Chennai
  Coimbatore
8 Andhra Pradesh Tirupati
  Visakhapatnam
9 Karnataka Bengaluru
Total
acid position 297 (Ser to Ala) and the mutants were des-
ignated ‘new CPV-2a/2b’.4 CPV and FPV are two closely
related viruses, causing disease in their respective hosts,
but new variants of CPVs have acquired the feline host
range, allowing them to infect both cats and dogs,
whereas the original CPV-2 does not replicate in cats.5
FPV, the prototype parvovirus of carnivores is a highly
contagious sickness occurring in cats, characterised by
severe leukopenia, gastroenteritis, reproductive disorders
and nervous signs. Cats are also susceptible to the new
variants of canine parvovirus (CPV-2a, CPV-2b and
CPV-2c). As a consequence of the host range shift of CPV-2
from dogs to cats and wild felids, there are several reports
of detection of CPV-2a/2b5,6 and CPV-2c infection in cats,7–9
but FPV remains the more prevalent species of parvovirus
causing disease in cats.10 In contrast, in some Asian coun-
tries, large numbers of CPV isolates were detected in
domestic and wild cats.7 A recent study frequently isolated
CPVs from apparently healthy cats, suggesting the role of
CPVs in causing subclinical or very mild disease in this
species.11 Multiple infections could increase the chance of
establishing persistent infection in feline hosts emphasis-
ing the epidemiological role of cats as reservoirs. Feline
hosts could also act as the source of new variants of parvo-
viruses, emerging in the field, as they are susceptible to
both new variants of CPVs and FPV.
Realising the importance of cats as a potential source
of genetic diversity for parvoviruses, and as there is
absolutely no such study in India on detection and char-
acterisation of parvoviruses in domestic cats, the parvo-
virus (CPV/FPV) strains detected in diarrhoeic/healthy
domestic cats from different states of India were ana-
lysed in the present study. The molecular characterisa-
tion and sequence diversity and phylogeny were also
evaluated on the viral polypeptide 2 (VP2) capsid gene.
Downloaded from jfm.sagepub.com at CORNELL UNIV on August 26, 2016
Clinical samples Positive by PCR
15 5
2 1
3 1
13 2
25 1
2 –
10 –
3 2
10 –
9 –
2 –
2 –
10 –
106 12 (11.3%)
Materials and methods
Clinical samples and laboratory processing
A total of 106 faecal samples/rectal swabs were collected
between 2011 and 2014 from both CPV/FPV suspected
and also apparently healthy cats of different age groups
from different states of India, as detailed in Table 1. The
faecal samples/rectal swabs collected were emulsified in
1 ml 0.1 M phosphate-buffered saline of pH 7.4, stored at
4ºC and transported to the laboratory, maintaining cold
chain during transport. The emulsions were centrifuged
at 9300 g for 15 mins at 4ºC and the supernatant was
passed through a 0.45 μm membrane filter (Millipore).
The filtrate was collected and stored at −40ºC until fur-
ther use.
PCR
The template DNA for the PCR assay was prepared fol-
lowing the procedure described earlier.12 Total nucleic
acid from all the clinical specimens was extracted by the
boiling lysis method by boiling at 96ºC for 10 mins fol-
lowed by chilling immediately in crushed ice. Following
high-speed centrifugation, the supernatants were diluted
at 1:10 in nuclease-free water (NFW) to reduce residual
inhibitors of DNA polymerase activity.13 The extracted
template DNA was stored at −40ºC until further use and
was screened for the presence of CPV/FPV using the
Hfor/Hrev primer pair listed in Table 2, which amplifies a
630 base pair (bp) fragment of the VP2 gene encoding
capsid protein.14 The DNA prepared from CPV-2 vaccine
strain (Strain C154; Intervet India)/CPV-2b vaccine
strain (Fort Dodge Animal Health) maintained in the
Department of Veterinary Microbiology, Rajiv Gandhi
Institute of Veterinary Education and Research,
Puducherry, India was used as positive control in the
PCR assay.
Mukhopadhyay et al 3

Table 2  Oligonucleotide primer sequences used for screening the samples and viral polypeptide 2 gene analysis

Primer Position* Sequence 5’–3’ Amplicon Reference

size (bp)

Screening primers Hfor 3556–3575 CAGGTGATGAATTTGCTACA 630 Buonavoglia et al14

  Hrev 4166–4185 CATTTGGATAAACTGGTGGT  
Sequencing primers CPV2655-F 2655–2675 CCAGATCATCCATCAACATCA 837 Decaro et al15
  CPV3511-R 3489–3511 TGAACATCATCTGGATCTGTACC  
  CPV3381-F 3381–3400 CCATGGAAACCAACCATACC 717 Decaro et al15
  CPV4116-R 4093–4116 AGTTAATTCCTGTTTTACCTCCAA  
  CPV2b-F 4043–4062 CTTTAACCTTCCTGTAACAG 427 Pereira et al16
  CPV2b-R 4449–4470 CATAGTTAAATTGGTTATCTAC  
  555for 4003–4022 CAGGAAGATATCCAGAAGGA 583 Buonavoglia et al14
  555rev 4561–4585 GGTGCTAGTTGATATGTAATAAACA  
*The primer positions are based on CPV-2 GenBank accession number M38245

The PCR amplification of the VP2 capsid protein gene
was carried out using 100 ng template DNA, 5 µl 10×
PCR buffer, 2 mM MgCl2, 1 µl 10 mM deoxynucleotide
triphosphates, 10 µM forward and reverse primers, 2 U
Taq DNA Polymerase (New England Bio Labs) and the
volume was made up to 50 µl with NFW. PCR amplifica-
tion consisted of initial denaturation at 95ºC for 5 mins
followed by 35 cycles of denaturation at 95ºC for 30 s,
annealing at 55ºC for 30 s and extension at 70ºC for 1
min, followed by a final extension at 70ºC for 10 mins.
The PCR-amplified products were resolved on 1.5% aga-
rose gel in Tris acetate EDTA buffer and visualised under
an ultraviolet transilluminator (Syngene).
Virus isolation
Virus isolation was carried out as per the procedure rec-
ommended.17 Eight PCR-positive samples from cats rep-
resenting the diverse geographical locations of India
were randomly selected and subjected to isolation of
virus in an A-72 cell line maintained in RPMI-1640 media
(Sigma-Aldrich). The clinical samples were filtered and
used for virus isolation in the A-72 cell line. The infected
monolayers were harvested on day 3 postinoculation
(with or without a cytopathic effect [CPE]) by three cycles
of alternative freezing, thawing and clarified at 6000 g for
15 mins in a refrigerated centrifuge. The supernatants
were stored at −40ºC until further use. The presence of
virus in the cell culture fluids at the third passage level
was confirmed by PCR assay using the Hfor/Hrev primer
pair.
Genotyping of parvovirus samples/isolates
Three randomly selected PCR-positive (Hfor/Hrev) clini-
cal samples and two cell culture isolates representing
different geographical areas of India were subjected
to another four individual PCR assays using four sets
of overlapping sequencing primer pairs listed in
Table 2,14,15,16 following the same protocol as detailed
earlier. The PCR-amplified products were excised from
the gel and extracted using a Qiagen Gel Extraction Kit.
The four overlapping PCR products of the VP2 gene (for
each sample/isolate) were sequenced for both strands of
DNA (5’–3’ and 3’–5’) and aligned to determine their
nucleotide/amino acid variations in the VP2 gene. The
sequencing was carried out using automated DNA
sequencer (Applied Biosystems) at Eurofins Genomics
(Bengaluru, India). The sequence chromatogram was
visualised in BioEdit version 7.0.5 analysis software (Isis
Therapeutics). A nucleotide basic local alignment search
tool (BLAST) analysis was performed with the obtained
sequences using the NCBI nucleotide database (http://
blast.ncbi.nlm.nih.gov/Blast.cgi) to confirm the genus
specificity to CPV/FPV. VP2 gene sequences of FPV,
CPV-2, CPV-2a, CPV-2b and CPV-2c from different parts
of the world were retrieved from the NCBI nucleotide
database and multiple sequence alignment was per-
formed using the Clustal W algorithm in MEGA5.18 The
VP2 genes of five complete/partial aligned sequences
under this study were submitted to Genbank for allot-
ment of accession numbers.
Phylogenetic analysis
The parvovirus sequences obtained in this study and the
17 parvovirus reference sequences retrieved from
GenBank were aligned and evolutionary history was
inferred by employing the maximum likelihood method
based on the Tamura 3-parameter model implemented
in MEGA5.18,19 The branch lengths were measured in
terms of the number of substitutions per site. Bootstrap
test (1000 replicates) was undertaken to evaluate the
confidence level of branching in the phylogenetic tree.
Results
PCR
Of the total 106 faecal samples collected from CPV/FPV
suspected diarrhoeic/healthy cats of different states and

Downloaded from jfm.sagepub.com at CORNELL UNIV on August 26, 2016

4 Journal of Feline Medicine and Surgery 

Table 3  Details of the cats found positive for parvovirus

Sample Place Breed Sex Age (months) Vaccination Clinical signs, if any
P15 Puducherry Non-descript Female 6 No Diarrhoeic, died later
T-C-1 Thrisoor Non-descript Female 8 No Diarrhoeic, died later
T-C-6 Thrisoor Non-descript Male 7 No Diarrhoeic, died later
MC8 Mumbai Non-descript Female 3 No Healthy
MC9 Mumbai Non-descript Female 7 No Healthy
MC11 Mumbai Non-descript Male 10 No Healthy
MC12 Mumbai Persian Male 8 No Diarrhoeic
MC13 Mumbai Non-descript Female 8 No Diarrhoeic
CC1 Kolkata Non-descript Male 14 No Diarrhoeic
JC1 Jabalpur Non-descript Male 7 No Healthy
GC1 Goa Non-descript Female 24 Yes Bloody diarrhoea, died later
GC2 Goa Non-descript Male 18 Yes Bloody diarrhoea, died later

various zones of India from 2011 to 2014, 12 samples Phylogenetic analysis

(11.3%) were found positive for parvoviruses by PCR
assay using Hfor/Hrev primers (Table 3), by yielding a
specific product size of 630 bp.
Virus isolation
In A-72 cell culture a mild cytopathic effect in the form of
rounding, increased granularity and detached cells
could be seen 3–4 days postinfection for two cat samples
at the third passage level. The cryolysates were also con-
firmed as positive for parvovirus by PCR. The virus in
the remaining six samples failed to grow in A-72 cell line.
Sequencing and BLAST analysis
Upon BLAST analysis, the specificity of the sequences of
full-length/partial VP2 gene of parvoviruses amplified
from faecal samples/cryolysates of five cats represent-
ing diverse geographical regions of India was found to
be maximally identical (99–100%) with VP2 gene
sequences of CPV/FPV strains available in GenBank.
The sequences of two cell culture isolates namely MC8
(Mumbai) and P15 (Puducherry) had maximum identity
(99%) with the new CPV-2a strain KM457141 (Uruguay)
and HQ883267 (China). However, the virus sequence
from the GC1 (Goa) sample had maximum identity
(99%) with FPV strain EU98686 (Italy), whereas the
sequences from the T-C-1 and T-C-6 (Thrissur) samples
had maximum identity (99%) with FPV strain D78584
(Japan). Therefore, sequencing results revealed detection
of two new CPV-2a strains and three FPV strains.
Nucleotide sequence accession numbers and
mutations
GenBank accession numbers JX459572, KF772942,
KP090138, KP090139 and KT444622 were obtained
(Table 3). Additionally, 16 non-synonymous (Table 4) and 11
synonymous (supplementary material Table S1) mutations
were also noticed in the CPV/FPV sequences under study.
The phylogenetic analysis of the CPV sequences
obtained from cats revealed that the two new CPV-2a
strains from Mumbai (MC8) and Puducherry (P15) were
clustered together in a single clade with Chinese and
Uruguayan CPV-2a isolates but had evolved indepen-
dently. The FPV sequences (T-C-6 and T-C-1) from
Thrissur, Kerala, formed a different clade (FPV clade)
and were closely related to each other and ancestrally
originated from reference FPV strain (M38246) from the
USA. Another FPV isolate from Goa (GC1) was posi-
tioned in the same clade at a distance along with the
Korean FPV strain but appeared to have evolved inde-
pendently as several non-synonymous and synony-
mous mutations were noticed in it. A commercial FPV
vaccine strain was also clustered at a distance within the
same FPV clade (Figure 1).
Discussion
The present study confirmed the presence of both CPV
and FPV infections among the cat population in India.
Of the 106 faecal samples screened in this study from
various states of India, 12 (11.3%) samples (including
four samples from apparently healthy cats) were found
positive by PCR assay. Battilani et  al analysed faecal
samples from 24 cats with a clinical diagnosis of parvo-
virus infection and found that 22 viral strains were FPV,
whereas two strains were intermediate between CPV
and FPV.10 In a recent study, two CPV-2a (Ser297Ala)
strains were identified out of 16 samples collected from
cats (12.5%) in China.20 The report of CPV/FPV infection
among cats in India is scarce. There is absolutely no
report of CPV infection in cats in India and in a recent
study in the city of Chennai, India, 60 diarrhoeic cat sam-
ples were tested and 17 samples (28.3%) were detected
as positive for FPV by PCR assay.21 Therefore, the pre-
sent study is the first comprehensive report of detection
and characterisation of parvovirus infection among

Downloaded from jfm.sagepub.com at CORNELL UNIV on August 26, 2016

Mukhopadhyay et al 5

New CPV-2a
New CPV-2a
Table 4  Non-synonymous mutations at various amino acid residues of the VP2 protein of feline panleukopenia virus (FPV)/canine parvovirus (CPV) obtained from

CPV/FPV
strain

FPV
FPV
FPV
(Asn→
A→C
(565)
4479

His)

C
–
–
–
–
(Asn→
A→C
(564)
4476

His)

C
–
–
–
–
(Met→
A→G
(551)
4437

Val)

G
–
–
–
–
(Ala→
G→A
(514)
4326

Thr)

–
–
–
–
(Thr→
A→G
(440)
4104

Ala)

G
G

–
–
–
A→G

(Thr→ (Ile→
(401)
3987

Val)

–
–
–
–
C→A
(388)
3949

Asn)

A
–
–
–
–
(Ala→
G→C
(359)
3861

Pro)

Figure 1  Maximum likelihood tree depicting phylogenetic

C

–
–
–
–

relationship among parvovirus isolates. Canine parvoviruses

3756–3757

(CPV)/feline panleukopenia viruses (FPV) sequenced in this

(Tyr→Ile)
TA→AT

study are shown with solid triangles, vaccine with solid circle
(324)

and the bootstrap values are shown next to the branches in

AT
AT

–
–
–

the phylogenetic tree

(Phe→
(267)
3586

T→A

Tyr)

domestic (both diarrhoeic and apparently healthy) cat

A
A

–
–
–

populations from different geographical regions of India

(Gly→
G→A
(224)
3457

Glu)

based on complete/partial VP2 gene analysis.

A

*
*
*

A similar CPE pattern by parvovirus in the A-72 cell

(Ser→
G→C
(179)
3322

line was also noticed by several researchers.14,15,22 Both

Thr)

C
–

*
*
*

the cryolysates found positive by PCR assay were identi-

(Arg→

fied later as CPVs (MC8 and P15) and not FPVs by

A→G
3027

Gly)
(81)

sequencing. Probably, FPVs require more passages to

G
–

*
*
*

become adapted to a canine-origin A-72 cell line. FPVs

GGT→CAG
2814–2816

(Gly→Gln)

were passaged in the A-72 cell line 15 times, to observe

the characteristic CPE.21
CAG
(10)

The present finding of the presence of CPV in the fae-

–

*
*
*

cal samples of healthy (MC8) as well as diarrhoeic (P15)

2012
2012
2014
2011
2014
Year

cats indicates the important role the cats play in acting as

reservoirs and transmitting the infection to dogs. A simi-
Thrisoor, Kerala
Thrisoor, Kerala

lar result was also observed in other research.11 All three

Maharashtra
Puducherry
collection

FPV strains were detected from diarrhoeic cats. The cats

Mumbai,
Place of
positions (VP2 amino acid residue)

from Goa alone (GC1 and GC2) were vaccinated with a

Goa

commercial trivalent FPV vaccine. None of the other cats

in the present study were vaccinated with either CPV or
Accession

KP090139
KP090138

KT444622
KF772942
JX459572
CPV genome nucleotide

number

FPV vaccines.
The mutation at amino acid change Tyr324Ile was
and their mutation

noticed in the two CPV-2a strains (MC8 and P15). Similar

Isolate and

*Not sequenced

codon changes at amino acid positions 324 were also

reported in the CPVs isolated from dogs in several coun-
strain

T-C-1
T-C-6
MC8

GC1
P15
cats

tries.22–27 Residue 324 was prone to strong positive

 

Downloaded from jfm.sagepub.com at CORNELL UNIV on August 26, 2016

6 Journal of Feline Medicine and Surgery 
selection in all carnivorous CPV isolates.28 This residue
was adjacent to residue 323, responsible for canine trans-
ferrin receptor binding, and together with residue 93,
determined the canine host range. Therefore, mutation
at amino acid residue 324 is likely to have an impact on
the parvovirus host range.29 Interestingly, the frequency
of CPV strains carrying mutations at the 324Ile residue
had increased enormously and had reached a high prev-
alence among Chinese and Indian CPVs isolated from
dogs.22–23,25,26 However, to date, this mutation has never
been reported from any CPV strains isolated from cats.
In fact, the presence of the mutation at amino acid posi-
tion 324 (TyrIle) in CPVs also isolated from cats in this
study provides new insights into the theory of involve-
ment of amino acid position 324 as a canine host range
mutation.
The next variation was observed in the amino acid
residue Thr440Ala in both the sequences (MC8 and P15).
Amino acid residue 440 is important because it is located
at the top of the three-fold spike (GH loop) of the VP2
protein on the surface of the capsid, the main antigenic
site of the virus.30,31 A similar codon change at nucleotide
position 4104 (AG) was also reported in earlier studies
in CPVs isolated from dogs,15,24,25,32,33 and also in CPVs
isolated from cats.8 Therefore, this mutation is likely to
change the antigenicity of this CPV strain isolated from
the cat.
Interestingly, three unique amino acid changes –
Gly10Gln, Gly224Glu and Ala514Thr – were noticed in
the MC8 sequence. These mutations have not been
reported by earlier research and are unique to the CPV
strain obtained from cats in the present study. Although
the functional impact of these mutations was yet to be
ascertained, the present study indicated active evolution
of this CPV-2a strain of cat origin.
The FPV sequence (GC1) showed four amino acid
changes – Arg81Gly, Ser179Thr, Ala359Pro and Ile401Val.
Two of these non-synonymous mutations were detected
in the GH loop of the VP2 protein (267–498 residues
located between βG and βH strands), exposed on the
surface of capsid, and greatest variability was seen in
this antigenic region. Six synonymous mutations were
also noticed in this FPV sequence. This FPV sequence
was obtained from a cat from Goa that was vaccinated
with a commercial trivalent FPV vaccine. The presence
of many non-synonymous and synonymous mutations
in this FPV strain would have contributed to antigenic
variation, resulting in vaccine failure. Three amino acid
mutations – Met551Val, Asn564His and Asn565His –
were observed in another FPV sequence (T-C-6), while
the other FPV sequence T-C-1 showed only one mutation
Thr388Asn. These mutations are all unique to our strains
and have not been reported so far from any FPV isolates.
The amino acid at position 564 is a differentiating amino
Downloaded from jfm.sagepub.com at CORNELL UNIV on August 26, 2016
acid between FPV (Asn/AAT) and CPV (Ser/AGT)
strains. Interestingly, two consecutive unique mutations
in one of the FPV strains (T-C-6) at amino acid positions
564 (His/CAT) and 565 (His/CAT) have been reported
in this study. This FPV strain (T-C-6) needs to be studied
further in relation to its pathogenicity and antigenicity.
Therefore, the presence of unique and certain existing
non-synonymous mutations in the CPV/FPV strains in
India indicate that the CPV/FPV strains are under con-
stant selection pressure and are constantly mutating,
leading to the evolution of newer CPV/FPV types/vari-
ants among the Indian cat population.
Therefore, as per the present study, mutations and the
positive selection of the mutants was found to be the
major mechanism of emergence and evolution of CPV/
FPVs in India. No cat is vaccinated against CPV in India
and very few cats are vaccinated with FPV vaccine. In
our study, except for the cats from Goa which were vac-
cinated with a commercial trivalent FPV vaccine, no cat
was vaccinated against CPV/FPV vaccines.
Conclusions
The present study provides new and valuable insight
into the evolutionary dynamics of parvovirus infections
in cats in India, although further studies involving
greater sample size and wider geographical regions are
required for complete understanding of the problem.
The presence of CPVs in both healthy and diarrhoeic cats
emphasises the possible role of cats as a source of infec-
tion to dogs. As cats in India were found to be suscepti-
ble to both CPV and FPV infections, the role of cats as the
source of new variants of parvovirus needs to be further
explored. Furthermore, the presence of FPV infection
into the domestic cat population raises serious concern
on the urgent need of educating the owners about the
importance of FPV vaccination. The cats from Goa suc-
cumbing to FPV infection in spite of vaccination raises
serious concerns. Intensifying surveillance of parvovirus
infections in cats in India is required.
Supplementary material Table to show synonymous
mutations at various amino acid residues of the VP2 protein
of FPV/CPV obtained from cat.
Acknowledgements  We thank Dean Rajiv Gandhi, Insti-
tute of Veterinary Education and Research, Puducherry, India,
for providing the necessary funds and facilities to carry out this
study.
Conflicts of interest  The authors declared no potential con-
flicts of interest with respect to the research, authorship, and/
or publication of this article.
Funding  This project was funded by a grant received from
DBT, Government of India (BT/PR14677/ADV/57/111/2010).
Mukhopadhyay et al 7
References
1 Appel MJ, Scott FW and Carmichael LE. Isolation and immu-
nization studies of a canine parvo-like virus from dogs with
haemorrhagic enteritis. Vet Rec 1979; 105: 156–159.
2 Parrish CR, Aquadro CF and Carmichael LE. Canine host
range and a specific epitope map along with variant
sequences in the capsid protein gene of canine parvovirus
and related feline, mink, and raccoon parvoviruses. Virol-
ogy 1988; 166: 293–307.
3 Organtini LJ, Allison AB, Lukk T, et  al. Global displace-
ment of canine parvovirus by a host-adapted variant:
structural comparison between pandemic viruses with
distinct host ranges. J Virol 2015; 89: 9–12.
4 Martella V, Cavalli A, Decaro N, et al. Immunogenicity of
an intranasal administered modified live canine parvovi-
rus type 2b vaccine in pups with maternally derived anti-
bodies. Clin Diagn Lab Immunol 2005; 12: 1243–1245.
5 Clegg SR, Coyne KP, Dawson S, et al. Canine parvovirus in
asymptomatic feline carriers. Vet Microbiol 2012; 157: 78–85.
6 Decaro N and Buonavoglia C. Canine parvovirus – a
review of epidemiological and diagnostic aspects, with
emphasis on type 2c. Vet Microbiol 2012; 155: 1–12.
7 Ikeda Y, Mochizuki M, Naito R, et  al. Predominance of
canine parvovirus CPV in unvaccinated cat populations
and emergence of new antigenic types of CPVs in cats.
Virology 2000; 278: 13–19.
8 Battilani M, Bassani M, Forti D, et al. Analysis of the evolu-
tion of feline parvovirus (FPV). Vet Res Commun 2006; 30:
223–226.
9 Decaro N, Buonavoglia D, Desario C, et  al. Characteriza-
tion of canine parvovirus strains isolated from cats with
feline panleukopenia. Res Vet Sci 2010; 89: 275–278.
10 Battilani M, Balboni A, Ustulin M, et al. Genetic complexity
and multiple infections with more parvovirus species in
naturally infected cats. Vet Res 2011; 42: 43.
11 Battilani M, Balboni A, Ustulin M, et al. Co-infection with
feline and canine parvovirus in a cat. Vet Ital 2013; 49:
127–129.
12 Mukhopadhyay HK, Amsaveni S, Matta SL, et  al. Devel-
opment and evaluation of loop-mediated isothermal ther-
mal amplification for rapid and sensitive detection of
canine parvovirus DNA directly in faecal specimens. Lett
Appl Microbiol 2012; 55: 202–209.
13 Decaro N, Elia G, Desario C, et al. A minor groove binder
probe real-time PCR assay for discrimination between
type 2-based vaccines and field strains of canine parvovi-
rus. J Virol Methods 2006; 136: 65–70.
14 Buonavoglia C, Martella A, Pratella M, et al. Evidence for
evolution of canine parvovirus type-2 in Italy. J Gen Virol
2001; 82: 3021–3025.
15 Decaro N, Desario C, Lucente MS, et al. Specific identifica-
tion of feline panleukopenia virus and its rapid differ-
entiation from canine parvoviruses using minor groove
binder probes. J Virol Methods 2008; 147: 67–71.
16 Pereira CA, Monezi TA, Mehnert DU, et al. Molecular char-
acterization of canine parvovirus in Brazil by polymerase
chain reaction assay. Vet Microbiol 2000; 75: 127–133.
Downloaded from jfm.sagepub.com at CORNELL UNIV on August 26, 2016
17 Hirayama K, Kano R, Kanai TH, et al. VP2 gene of a canine
parvovirus isolate from stool of a puppy. J Vet Med Sci
2005; 67: 139–143.
18 Tamura K, Peterson D, Peterson N, et al. MEGA5: molecu-
lar evolutionary genetics using maximum likelihood,
evolutionary distance, and maximum parsimony meth-
ods. Mol Biol Evol 2011; 28: 2731–2739.
19 Felsenstein J. Confidence limits on phylogenies: an
approach using the bootstrap. Evolution 1985; 39: 783–791.
20 Jing W, Xin-tao G, Shao-hua H, et al. Molecular epidemio-
logical and phylogenetic analysis of canine parvovirus in
domestic dogs and cats in Beijing, 2010–2013. J Vet Med Sci
2015; 77: 1305–1310.
21 Parthiban M, Aarthi KS, Balagangatharathilagar M, et  al.
Evidence of feline panleukopenia infection in cats in
India. Virus Dis 2014; 25: 497–499.
22 Mukhopadhayay HK, Matta SL, Amsaveni S, et al. Phylo-
genetic analysis of canine parvovirus partial VP2 gene in
India. Virus Genes 2014; 48: 89–95.
23 Zhang R, Yang S, Zhang W, et al. Phylogenetic analysis of
the VP2 gene of canine parvoviruses circulating in China.
Virus Genes 2010; 40: 397–402.
24 Dogonyaro BB, Bosman AM, Sibeko KP, et  al. Genetic
analysis of the VP2 gene of canine parvovirus strains
from Africa. Vet Microbiol 2013; 165: 460–465.
25 Srinivas VMV, Mukhopadhyay HK, Thanislass J, et  al.
Molecular epidemiology of canine parvovirus in South-
ern India. Vet World 2013; 6: 744–749.
26 Mittal M, Chakravarti S, Mohapatra JK, et al. Molecular
typing of canine parvovirus strains circulating from
2008 to 2012 in an organized kennel in India reveals the
possibility of vaccination failure. Infect Genet Evol 2014;
23: 1–6.
27 Csagola A, Varga S, Lorincz M, et al. Analysis of the full
length VP2 protein of canine parvoviruses circulating in
Hungary. Arch Virol 2014; 159: 2441–2444.
28 Horiuchi M, Goto H, Ishiguro N, et al. Mapping of deter-
minants of the host range of canine cells in the genome
of canine parvovirus/mink enteritis virus chimeric virus.
J Gen Virol 1994; 75: 1319–1328.
29 Hueffer K, Parker JS, Weichert WS, et al. The natural host
range shift and subsequent evolution of canine parvo-
virus resulted from virus-specific binding to the canine
transferrin receptor. J Virol 2003; 77: 1718–1726.
30 Battilani M, Ciulli S, Tisato E, et  al. Genetic analysis of
canine parvovirus isolates (CPV-2) from dogs in Italy.
Virus Res 2002; 83: 149–157.
31 Tsao J, Chapman MS, Agbandje M, et al. The three dimen-
sional structure of canine parvovirus and its functional
implications. Science 2008; 251: 1456–1464.
32 Castro TX, Costa EM, Leite JP, et al. Partial VP2 sequenc-
ing of canine parvovirus (CPV) strains circulating in the
state of Rio de Janerio, Brazil: detection of the new variant
CPV-2c. Braz J Microbiol 2010; 41: 1093–1098.
33 Bajehson DB. Molecular characterization of canine par-
vovirus strains from domestic dogs in South Africa and
Nigeria. Thesis, University of Pretoria, 2010.