Clinical Gastroenterology and Hepatology 2020;-:-–-

Low-Fat, High-Fiber Diet Reduces Markers of Inflammation

and Dysbiosis and Improves Quality of Life in Patients With
Ulcerative Colitis
Julia Fritsch,*,‡ Luis Garces,* Maria A. Quintero,* Judith Pignac-Kobinger,*
Ana M. Santander,* Irina Fernández,* Yuguang J. Ban,§ Deukwoo Kwon,§,k
Matthew C. Phillips,* Karina Knight,* Qingqing Mao,¶ Rebeca Santaolalla,*
Xi S. Chen,§,k Mukil Maruthamuthu,* Norma Solis,* Oriana M. Damas,*
David H. Kerman,* Amar R. Deshpande,* John E. Lewis,# Chi Chen,¶ and
Maria T. Abreu*,‡

*Division of Gastroenterology, Department of Medicine, ‡Department of Microbiology and Immunology, §Sylvester

Comprehensive Cancer Center, kDivision of Biostatistics, Department of Public Health Sciences, #Department of Psychiatry
and Behavioral Sciences, University of Miami–Leonard Miller School of Medicine, Miami, Florida; ¶Department of Food Science
and Nutrition, University of Minnesota, St Paul, Minnesota

BACKGROUND & AIMS: A high-fat diet has been associated with an increased risk of ulcerative colitis (UC). We studied the
effects of a low-fat, high-fiber diet (LFD) vs an improved standard American diet (iSAD, included
higher quantities of fruits, vegetables, and fiber than a typical SAD). We collected data on quality of
life, markers of inflammation, and fecal markers of intestinal dysbiosis in patients with UC.

METHODS: We analyzed data from a parallel-group, cross-over study of 17 patients with UC in remission or
with mild disease (with a flare within the past 18 mo), from February 25, 2015, through
September 11, 2018. Participants were assigned randomly to 2 groups and received a LFD (10%
of calories from fat) or an iSAD (35%–40% of calories from fat) for the first 4-week period,
followed by a 2-week washout period, and then switched to the other diet for 4 weeks. All diets
were catered and delivered to patients’ homes, and each participant served as her or his own
control. Serum and stool samples were collected at baseline and week 4 of each diet and
analyzed for markers of inflammation. We performed 16s ribosomal RNA sequencing and
untargeted and targeted metabolomic analyses on stool samples. The primary outcome was
quality of life, which was measured by the short inflammatory bowel disease (IBD) question-
naire at baseline and week 4 of the diets. Secondary outcomes included changes in the
Short-Form 36 health survey, partial Mayo score, markers of inflammation, microbiome and
metabolome analysis, and adherence to the diet.

RESULTS: Participants’ baseline diets were unhealthier than either study diet. All patients remained in
remission throughout the study period. Compared with baseline, the iSAD and LFD each
increased quality of life, based on the short IBD questionnaire and Short-Form 36 health survey
scores (baseline short IBD questionnaire score, 4.98; iSAD, 5.55; LFD, 5.77; baseline vs iSAD,
P [ .02; baseline vs LFD, P [ .001). Serum amyloid A decreased significantly from 7.99 mg/L at
baseline to 4.50 mg/L after LFD (P [ .02), but did not decrease significantly compared with
iSAD (7.20 mg/L; iSAD vs LFD, P [ .07). The serum level of C-reactive protein decreased
numerically from 3.23 mg/L at baseline to 2.51 mg/L after LFD (P [ .07). The relative abun-
dance of Actinobacteria in fecal samples decreased from 13.69% at baseline to 7.82% after LFD
(P [ .017), whereas the relative abundance of Bacteroidetes increased from 14.6% at baseline
to 24.02% on LFD (P [ .015). The relative abundance of Faecalibacterium prausnitzii was
higher after 4 weeks on the LFD (7.20%) compared with iSAD (5.37%; P [ .04). Fecal levels of
acetate (an anti-inflammatory metabolite) increased from a relative abundance of 40.37 at

Abbreviations used in this paper: CRP, C-reactive protein; IBD, inflam-
matory bowel disease; IL, interleukin; iSAD, improved standard American
diet; LFD, low-fat, high-fiber diet; PC, principal component; QoL, quality of
life; SAA, serum amyloid A; SF-36, Short Form-36 Health Survey; SIBDQ,
short inflammatory bowel disease questionnaire; UC, ulcerative colitis.
© 2020 by the AGA Institute. Published by Elsevier, Inc. This is an open
access article under the CC BY-NC-ND license (http://creativecommons.
org/licenses/by-nc-nd/4.0/).
1542-3565
https://doi.org/10.1016/j.cgh.2020.05.026
2 Fritsch et al Clinical Gastroenterology and Hepatology Vol. -, No. -

baseline to 42.52 on the iSAD and 53.98 on the LFD (baseline vs LFD, P [ .05; iSAD vs LFD, P [
.09). The fecal level of tryptophan decreased from a relative abundance of 1.33 at baseline to
1.08 on the iSAD (P [ .43), but increased to a relative abundance of 2.27 on the LFD (baseline vs
LFD, P [ .04; iSAD vs LFD, P [ .08); fecal levels of lauric acid decreased after LFD (baseline,
203.4; iSAD, 381.4; LFD, 29.91; baseline vs LFD, P [ .04; iSAD vs LFD, P [ .02).

CONCLUSIONS: In a cross-over study of patients with UC in remission, we found that a catered LFD or iSAD were
each well tolerated and increased quality of life. However, the LFD decreased markers of
inflammation and reduced intestinal dysbiosis in fecal samples. Dietary interventions therefore
might benefit patients with UC in remission. ClinicalTrials.gov no: NCT04147598.

Keywords: Western Diet; Lifestyle Adjustment; Microbiota; Metabolites.

he incidence of ulcerative colitis (UC) is increasing Methods

T in the United States. The current treatment regi-
mens rely on mesalamines, which are safe but expensive,
and immunosuppression, which may lead to an increased
risk for infection and hematologic malignancies. As a
result, many patients want nonpharmacologic ap-
proaches for managing their disease. An estimated 80%
to 89% of patients want their physicians to provide di-
etary advice.1
Epidemiologic studies have found that a high-fat diet
and animal meat are associated with an increased risk of
UC.2,3 A systematic review found that individuals with
the highest consumption of total fat had an increased risk
of Crohn’s disease and UC.2 Similarly, a prospective
longitudinal study found that consumption of foods with
certain fatty acids such as myristic acid was associated
with a higher risk of flaring in UC patients.3 Our group
has published that Hispanic immigrants developing in-
flammatory bowel disease (IBD) are more likely to eat a
standard American diet, characterized by high levels of
sugar and low amounts of fruits and vegetables,
compared with Hispanics who do not have IBD.4,5 These
studies suggest that diet contributes to the development
of IBD.
Diet interventions have been tried in patients with UC
with mixed results. Fish oil supplementation was not
found to be effective in patients with UC in a large
placebo-controlled study.6 Association studies have
found that consumption of vegetables, fruits, fish, and
dietary fiber decreases the risk of Crohn’s disease, but
not UC.7,8 Thus far, diet studies have not yielded mean-
ingful, actionable results for patients with UC who want
to enhance their quality of life (QoL) and minimize flares.
To test if the fat content affected clinical and
biochemical parameters in UC, we embarked on a
comprehensive, exploratory study of a low-fat, high-fiber
diet (LFD) vs an improved standard American diet (iSAD,
which included higher quantities of fruits, vegetables,
and fiber than a typical SAD). The primary aim was to
test whether a LFD would improve QoL. The design of
the study was novel in that patients served as her or his
own control and the diets were catered. We believe this
diet intervention fills a void in understanding how diet
can be used as an adjunct in the treatment of UC.
Study Design
The full details of the clinical trial are described in the
Supplementary materials. Recruitment occurred between
February 25, 2015, and September 11, 2018. This was a
parallel-group, cross-over study of two 4-week periods,
with each participant serving as her or his own control.
Patients with a disease history of at least 3 months, a
confirmed UC diagnosis by colonoscopy within 2 years
before randomization, and a moderate to low partial Mayo
score (<7) with a flare within the past 18 months3 were
eligible for the study. Participants were randomized into 2
groups (n ¼ 18) and received a catered LFD or iSAD
intervention for the first 4-week period, followed by a 2-
week washout period, and then switched to the alternate
diet for 4 weeks (Supplementary Figure 1A and 2A). The
caterer prepared and delivered customized meals for both
interventions (Supplementary materials for sample
menus). To maintain a stable weight, diet calories were
tailored to each participant’s expenditures via the
Harris–Benedict equation. However, patients lost an
average of 2 kg and decreased their body mass index and fat
mass without increasing their physical activity
(Supplementary Figure 3). The iSAD had 35% to 40% of
calories from fat, 10% to 11% from saturated fat, and 25%
to 29% from unsaturated fat with an omega 6:3 fatty acid
ratio of 20 to 30:1. The LFD had 10% of calories from fat, 1%
to 5% from saturated fat, and 5% to 9% from unsaturated
fat with an omega 6:3 ratio of approximately 3:1 or lower.
The study was performed at the Crohn’s and Colitis Center
at the University of Miami and was approved by the Uni-
versity of Miami Institutional Review Board (protocol
20130716). All study participants provided their written
informed consent before participating in the study.
All authors had access to the analyzed data and
approved the final manuscript before submission.
Primary and Secondary End Points
The primary outcome was QoL, as measured by the
short IBD questionnaire (SIBDQ). The secondary
- 2020 Manipulating Dietary Fat in UC 3

outcomes included changes in the Short Form-36 Health

Survey (SF-36), partial Mayo score, inflammatory
markers, microbiome, and metabolome, as well as adher-
ence to a catered diet, which are described in the
Supplementary materials.
Results
What You Need to Know
Background
A high-fat diet has been associated with an increased
risk of ulcerative colitis (UC), but it is not clear what
effect a high-fat vs low-fat diet has on patients with
UC in remission.

Demographics of the Study Population Findings

A cross-over study of patients with UC in remission
Overall, 38 participants with a mean age of 42 years found that a catered low-fat, high-fiber diet or an
enrolled in the study, and 18 patients completed all study improved standard American diet (with higher
requirements. The average body mass index was 27 amounts of fruits, vegetables, and fiber) both were
(Table 1), which is similar to average Americans.9 Consis- well tolerated and increased quality of life. However,
tent with clinical remission, most patients (12 of 18) had a the low-fat, high-fiber diet decreased markers of
normal number of stools with no blood, a fecal calprotectin inflammation and reduced intestinal dysbiosis in
level of 88.7 mg/g, and a partial Mayo score of 1.4. One third fecal samples.
of the patients were currently using biologics, and those not Implications for patient care
using biologics were on mesalamines (n ¼ 10) or on no Dietary interventions therefore might benefit pa-
medication (n ¼ 2). Half of the patients had pancolitis. One tients with UC in remission.
patient completed the diets but was excluded from analysis
because the participant discontinued habitual marijuana
use and thus had not kept medications stable. Table 1. Baseline Demographics and Characteristics of
Enrolled Participants
Catered Diet Interventions Differed in Completed Enrolled
Macronutrients and Micronutrients From patients patients
Patients’ Baseline Diets Characteristics (n ¼ 18) (n ¼ 38)

Sex, n (%)
UC patients in remission have a very heterogeneous diet.
Male 7 (39) 14 (36.8)
At baseline, there was a wide range of macronutrient intake Female 11 (61) 24 (63.1)
(Figure 1A, Supplementary Table 1), with the percentage of Ethnicity, n (%)
calories from fat varying from 23.3% to 45.9%. The ratio of Hispanic 14 (78) 25 (65.7)
omega 6 to 3 was always higher than the recommended 3:1 Non-Hispanic 4 (22) 13 (34.2)
Race, n (%)
ratio, consistent with the Western diet pattern
White 17 (94) 36 (94.5)
(Supplementary Figure 4E). Patients consumed approxi- African American 1 (6) 2 (5.2)
mately half of the US Department of Agriculture recom- Age at baseline, y, median 41.7 (33.1–47.3) 40.9 (30.6–49.0)
mended fiber intake (Figure 1E), with only 1 daily serving of (Q1–Q3)
fruits and vegetables (Supplementary Figure 4I). During the Age at UC diagnosis, y, 33.0 (22.3–39.8) 33.2 (23.0–41.0)
median (Q1–Q3)
washout period, patients had similar macronutrients
Duration of UC, y, median 8.7 (4.0–13.5) 7.2 (3.9–8.7)
compared with their baseline (Supplementary Figure 4, (Q1–Q3)
Supplementary Tables 1 and 2). These data suggest that UC Location of UC, n (%)
patients’ baseline diets are similar to a typical standard Pancolitis 9 (50.0) 19 (50.0)
American diet and not the recommended US Department of Left-sided 7 (38.9) 11 (28.9)
Proctosigmoiditis 2 (11.1) 8 (21.1)
Agriculture diet.
BMI, median (Q1–Q3) 27.4 (23.2–30.0) 26.14 (19.5–38)
To represent patients’ baseline diet vs the study diets, we Nonsmokers, n (%) 9 (50.0) 25 (65.8)
used a heat map to show the top 32 macronutrients and Ex-smokers, n (%) 8 (44.4) 11 (28.9)
micronutrients that were reported by both the Automated Smokers, n (%) 1 (5.6) 2 (5.3)
Self-Administered 24-hour dietary recall and Nutrihand Level of education, n (%)
Less than high school 1 (5.6) 1 (2.6)
(http://www.nutrihand.com) (Figure 1A). After adjusting for
High school 5 (27.8) 8 (21.1)
calories, the heatmap revealed a clear separation between the College 10 (55.6) 24 (63.2)
3 diets. To determine the source of variability in an unbiased Graduate school 1 (5.6) 1 (2.6)
manner, we used a bioinformatics approach to reduce the Other 1 (5.6) 3 (7.9)
nutrients into 5 principal components (PCs), which together Medications, n (%)
Previous use of 17 (94.4) 34 (89.5)
explained 81% of the total variation. The principal compo-
mesalamines
nent analysis biplot shows that PC1 separated the LFD from Previous use of biologics 7 (38.9) 18 (47.4)
baseline and the iSAD, capturing 36% of the variability
(Figure 1B). PC2 further distinguished the iSAD from baseline
4 Fritsch et al Clinical Gastroenterology and Hepatology Vol. -, No. -

Table 1. Continued which mainly was refined sugar because their daily fruit
consumption was less than 1 serving (Supplementary
Completed Enrolled
Figure 4K). Both catered diets had significantly more fiber
patients patients
Characteristics (n ¼ 18) (n ¼ 38) (Figure 1E) and servings of fruits and vegetables compared
with baseline (Supplementary Figure 4I). These data sug-
Previous use of 4 (22.2) 14 (36.8) gest that both catered diets were healthier with higher fiber,
immunomodulators more fruits and vegetables, and lower refined sugar levels
Previous use of steroids 14 (77.8) 25 (65.8)
compared with patients’ baseline diets.
Current use of 4 (22.2) 10 (26.3)
immunomodulators
Current use of 10 (55.6) 20 (52.6) A Low-Fat, High-Fiber Diet and an Improved
mesalamines
Current use of biologics 6 (33.3) 17 (44.7) Standard American Diet Increased Quality of Life
Current use of steroids 0 1 (2.6)
Partial Mayo (minimum, 1.41 (0.0–5.0) Approximately half of the patients (8 of 17) had an initial
maximum) partial Mayo score of 0, which remained unchanged
Stool frequency, n (%)
throughout the study. The remaining 9 patients had a low
Normal number of stools 12 (66.7) 22 (57.9)
for this patient partial Mayo score of 2.7 at baseline; marginal improvements
1–2 stools more than 2 (11.1) 8 (21.1) were seen with both the LFD and iSAD (Figure 2A). Patients
normal were more than 85% adherent to both diets (Supplementary
3–4 stools more than 2 (11.1) 5 (13.2) Figure 5). Both the LFD and iSAD improved QoL significantly
normal
as measured by the SIBDQ compared with baseline (baseline
5 stools than normal 2 (11.1) 3 (7.8)
Rectal bleeding, n (%) vs iSAD, P ¼ .02; baseline vs LFD, P ¼ .001) (Figure 2B;
No blood seen 12 (66.7) 28 (73.7) Supplementary Tables 3 and 4). QoL during the LFD also was
Streaks of blood with 6 (33.3) 8 (21.1) significantly higher than with the iSAD (P ¼ .04). Both diets
stools less than half significantly improved role limitations owing to physical
the time
(baseline vs iSAD, P ¼ .04; baseline vs LFD, P ¼ .002) and
Obvious blood with 0 2 (5.3)
stools most of the emotional health (baseline vs iSAD, P ¼ .01; baseline vs LFD,
time P ¼ .004), social functioning (baseline vs iSAD, P ¼ .01;
Blood alone passes 0 0 baseline vs LFD, P ¼ .03), bodily pain (baseline vs iSAD, P ¼
Laboratory, median (Q1– .05; baseline vs LFD, P ¼ .007), and general health (baseline
Q3)
vs iSAD, P ¼ .04; baseline vs LFD, P ¼ .03) as measured by the
Hemoglobin level, g/dL 13.67 (12.85–14.75) 13.56 (12.9–14.48)
Albumin level, g/dL 4.39 (4.3–4.6) 4.32 (4.28–4.5) SF-36 (Figure 2C). These data show that both diets are well
Fecal calprotectin level, 88.7 (9.1–153.1) N/A tolerated and improve QoL, even in patients largely in
mg/g, median (Q1–Q3) remission.
CRP level, mg/L, median 3.23 (0.43–4.3) N/A We next examined subclinical markers of inflamma-
(Q1–Q3)
tion. Fecal calprotectin and C-reactive protein (CRP) were
SIBDQ, median (Q1–Q3) 4.98 (4.1–6.0) N/A
low at baseline and after the iSAD, but decreased further
after LFD, although not significantly (Figure 2D and E).
BMI, body mass index; CRP, C-reactive protein; Q, quartile; sIBDQ, short in- Importantly, neither diet increased serum levels of in-
flammatory bowel disease questionnaire; UC, ulcerative colitis.
flammatory cytokines (interleukin [IL]6, tumor necrosis
and accounted for 18% of variability (Figure 1B), suggesting factor ⍺, IL1b, and interferon g) (Supplementary Table 3)
that baseline and the iSAD are more similar to each other or biochemical markers of inflammation (Figure 2E and
compared with the LFD. This unsupervised clustering accu- F). After a LFD, patients had a significant decrease in
rately separated baseline, LFD, and iSAD. serum amyloid A (SAA), a marker of mucosal inflamma-
We next wanted to determine which nutrients accoun- tion, compared with baseline, and numerically lower than
ted for the differences. PC1 showed that the LFD had a high with the iSAD (baseline vs LFD, P ¼ .02; iSAD vs LFD, P ¼
amount of fiber, omega 3, magnesium, iron, and vitamins .07) (Figure 2F). These data provide preliminary evidence
with a low amount of fat compared with the other 2 diets that a LFD may have anti-inflammatory effects compared
(Figure 1C). As intended, a LFD had significantly lower total with patients’ baseline diets and that even a high-fat diet
fat (Figure 1D), including saturated and unsaturated fat when combined with increased fruits and vegetables is
(Supplementary Figure 4A and B), and a lower omega 6:3 not harmful in the short term.
ratio (Supplementary Figure 4E) compared with the other
diets. The LFD also had significantly more fiber compared Low-Fat High-Fiber Diets and Improved
with baseline and the iSAD (Figure 1E). PC2, which segre- Standard American Diets Impact Microbial
gated baseline from iSAD, showed that the iSAD had more Composition
arachidonic acid and less sugar compared with baseline
(Figure 1C). Indeed, patients at baseline consumed signifi- Stool was analyzed by 16S ribosomal RNA
cantly more sugar compared with the iSAD (Figure 1F), sequencing. There was a trend toward increased a
- 2020 Manipulating Dietary Fat in UC 5

Figure 1. Dietary components that distinguish the diet interventions, a low-fat, high-fiber diet (LFD) and improved standard
American diet (iSAD), from baseline diets. (A) Heatmap of 32 nutrients. (B) Principal component analysis (PCA) of diet and (C)
diet variables. (D–F) The top 3 macronutrients that distinguish each of the PCs and diets. ***P < .001. contrib, contribution.
6 Fritsch et al Clinical Gastroenterology and Hepatology Vol. -, No. -

Figure 2. Effect of dietary interventions on clinical symptoms and quality of life. (A) Partial Mayo score was used to determine
disease activity. (B) Quality of life was measured using short inflammatory bowel disease (IBD) questionnaire and (C) the Short
Form-36 Health Survey (SF-36). (D) Intestinal inflammation was measured using fecal calprotectin level. (E) Systemic
inflammation was measured using C-reactive protein level and (F) serum amyloid A level. *P < .05 and **P < .01. iSAD,
improved standard American diet; LFD, low-fat, high-fiber diet.

diversity as measured by Faith’s phylogenetic diversity
after a LFD (baseline, 7.89; iSAD, 8.74; LFD, 9.59; base-
line vs iSAD, P ¼ .15; baseline vs LFD, P ¼ .13)
(Figure 3A; Supplementary Table 5). After accounting for
patient heterogeneity, we observed a significant shift in
microbial composition as measured by b diversity be-
tween the LFD and baseline (P ¼ .05) (Supplementary
Table 6). b diversity was not significantly different be-
tween baseline and the iSAD, or between the iSAD and
LFD (Supplementary Table 6). Of note, there were
several variables that were associated with changes in
the microbiota composition, including SIBDQ, CRP, IL6,
IL1b, and 32 dietary components (P ¼ .001, P ¼ .007,
P ¼ .02, P ¼ .05, respectively) (Supplementary Table 7).
We identified significant microbial changes at different
taxonomy levels when comparing the LFD with baseline
(Figure 3B, Supplementary Figure 6A), with a significant
increase in Bacteroidetes (baseline, 14.6%; iSAD, 21.7%;
LFD, 24.02%; baseline vs LFD, P ¼ .015) and a significant
decrease in Actinobacteria (baseline, 13.69%; iSAD,
9.98%; LFD, 7.82%; baseline vs LFD, P ¼ .017)
(Figure 3C and D). Although modest, we saw some
changes at the family and genus levels when comparing
baseline with the iSAD (Figure 3B, Supplementary
Figure 6B). After a LFD, Faecalibacterium prausnitzii
significantly increased compared with iSAD (iSAD,
5.37%; LFD, 7.20%; iSAD vs LFD, P ¼ .04) (Figure 3E).
Prevotella increased significantly after a LFD compared
with baseline (baseline, 0.36%; iSAD, 0.40%; LFD, 0.69%;
baseline vs LFD, P ¼ .0007), with only a marginal in-
crease compared with iSAD (P ¼ .08) (Figure 3F). These
microbial changes suggest an anti-inflammatory shift in
the microbiota after a LFD.
Metabolome Changes Occur With Diet
Intervention
Physiological effects of the microbiota may be medi-
ated by microbe or dietary-derived metabolites.10 We
performed untargeted and targeted metabolomics on
stool and observed a separation between each of the
diets (Figure 4A); several metabolites contributed to this
separation. Although the LFD had significantly higher
amounts of fiber, only 1 short-chain fatty acid, acetate,
increased significantly compared with baseline, and
increased marginally compared with the iSAD (baseline,
40.37; iSAD, 42.52; LFD, 53.98; baseline vs LFD, P ¼ .05;
- 2020 Manipulating Dietary Fat in UC 7

Figure 3. Microbiome changes after dietary interventions. 16S Ribosomal RNA sequencing was used to determine micro-
biome composition. (A) a diversity (Faith’s phylogenetic diversity). (B) Histogram of the linear discriminant analysis (LDA) score
showing significant taxa between baseline and the low-fat, high-fiber diet (LFD) (top panel) and between baseline and an
improved standard American diet (iSAD) (bottom panel). (C–F) Relative abundance of Bacteroidetes (C), Actinobacteria (D), F
prausnitzii (E), and Prevotella (F) (n ¼ 17). *P < .05 and ***P < .001.
8 Fritsch et al Clinical Gastroenterology and Hepatology Vol. -, No. -

Figure 4. Metabolome changes after dietary interventions. Untargeted and targeted metabolomics were performed on stool
samples. (A) Partial least-squares discriminant analysis showing metabolite separation between baseline and the low-fat, high-
fiber diet (LFD), baseline and an improved standard American diet (iSAD), and between an iSAD and the LFD in untargeted
metabolites. (B) Relative abundance of short-chain fatty acids (n ¼ 17). (C–E) Relative abundance of selected targeted me-
tabolites (n ¼ 11). *P < .05.

iSAD vs LFD, P ¼ .09) (Figure 4B). After a LFD, we saw a
decrease in 2 saturated fatty acids implicated in inflam-
mation. Lauric acid decreased significantly compared
with both baseline and the iSAD (baseline, 203.4; iSAD,
381.4; LFD, 29.91; baseline vs LFD, P ¼ .04; iSAD vs LFD,
P ¼ .02) (Figure 4C); and myristic acid was decreased
only marginally compared with the iSAD (iSAD, 157.1;
LFD, 63.47; iSAD vs LFD, P ¼ .08) (Figure 4D). A LFD also
increased tryptophan levels, an essential amino acid that
is reduced in IBD patients (baseline, 1.33; iSAD, 1.08;
LFD, 2.27; baseline vs LFD, P ¼ .04; iSAD vs LFD, P ¼
.076) (Figure 4E).10 A complete list of targeted metabo-
lites can be found in Supplementary Table 5. These data
show that a LFD can result in metabolome changes that
may be anti-inflammatory.
Dietary Components Have a Differential Impact
on Microbiome and Metabolites
We next examined the diet in relation to microbiome
and metabolites. To represent this intricate relationship,
we generated a Circos plot (Figure 5, Supplementary
Tables 8–11). For this analysis we represented the diet
using the 5 PCs described in Figure 1. We found that the
5 diet PCs impacted 35 of 93 microbes at the genus level
- 2020
and 9 of 45 metabolites, suggesting that the diet PCs
impacted the microbiome more than they did the me-
tabolites (Supplementary Tables 8 and 9). After con-
trolling for diet, we found that 86 microbial genera
impacted 39 metabolites and that 43 metabolites
impacted 73 microbes, suggesting a complex inter-
relationship (Supplementary Tables 10 and 11). This
also implies that there is a microbiota–metabolite asso-
ciation that is unlikely to be modulated by diet. Indeed,
the microbiota composition was associated significantly
with acetate and propionate (Supplementary Table 7).
Taken together, the Circos plot shows that diet has a
strong impact on the microbiome and metabolites,
providing insight into the dynamic relationship between
diet, microbiome, and metabolites.
Discussion
Most IBD patients have asked their physician what
they should eat.1 Because of the absence of randomized
controlled data, patients are not given clear guidelines.
Clinical studies and bench research in murine models
suggest that consumption of fat, especially saturated fat, is
associated with more flares or more severe inflammation,
Figure 5. Associations be-
tween diet, microbiome, and
metabolites. Associations are
represented by the connect-
ing arches. An arch that is
indented from the perimeter is
the independent driver, while
the variable that is connected
by this arch and not indented
is the dependent variable. The
thickness of the arches in-
dicates the strength of corre-
lation or the number of
associations. Diet principal
components (PCs) are
described in Figure 1. SCFA,
short-chain fatty acid.
Manipulating Dietary Fat in UC 9
respectively.3 To test the hypothesis that dietary fat could
affect colonic inflammation, we performed a study in pa-
tients with inactive or mild UC wherein each patient
received either a catered LFD or iSAD.
Given the small sample size, the relatively short
length of the intervention, and the fact that we pur-
posely enrolled patients in remission or with only
mildly active disease, we did not intend to see large
clinical effects. Our main finding was that both diets led
to significant improvements in clinical symptoms and
QoL (SIBDQ and SF-36), with trends toward decreasing
CRP compared with baseline. Only the SIBDQ showed a
significant improvement after a LFD compared with
iSAD. At a subclinical level, only the LFD decreased SAA
significantly compared with baseline. We previously
showed that SAA is a useful biomarker for IBD and is
more sensitive than CRP.11 To keep calories stable, the
LFD needed more calories from nonfat sources. As a
result, the changes in other macronutrients also could
explain some of the differences. These data suggest that
even patients in remission could benefit from a
healthier diet.
Just as importantly, neither diet exacerbated symp-
toms, which is notable given the higher fiber in both
catered diets. Baseline diets varied greatly but generally
10 Fritsch et al
were unhealthy with low amounts of fruits and vegeta-
bles and high refined sugar levels compared with the
catered diets. We did not expect to see an improvement
during the use of the iSAD given the high fat content and
meat consumption; however, this improvement could be
attributable to increased fiber intake, an increase in
monounsaturated fatty acid intake as a source of fat, the
decrease in refined sugars, or the placebo effect of being
in a diet study with catered meals. Nevertheless, this
provides reassurance that patients with mild or inactive
UC indeed can consume a diet that is high in fiber and
healthy fats.
Our microbiome data benefited from the cross-over
design of the study because each patient served as her
or his own control. One limitation of studying the micro-
biome is the wide interindividual variation, even when
patients are fed the same foods.12,13 Although we only saw
a trend of increasing a diversity after a LFD, we saw
significant differences in b diversity between baseline and
the LFD. Indeed, Bacteroidetes increased whereas Acti-
nobacteria decreased after a LFD, suggesting an
improvement in dysbiosis.14 A LFD increased F prausnitzii
and Prevotella, which may be beneficial in the context of
IBD.15,16 Prevotella has been associated with a high car-
bohydrate diet, which in part could explain this expansion
in LFD.17 At this stage in our overall knowledge of IBD and
the microbiome, there is not a specific marker that can be
used to define an improvement in dysbiosis.16,18
Microbial-derived metabolites regulate immune ho-
meostasis. Interestingly, baseline and iSAD had increased
lauric acid, which is a saturated fatty acid implicated as
an agonist for Toll-like receptor 4.19 We have published
that Toll-like receptor 4 signaling increases colitis and
colitis cancer risk.20 After an iSAD, patients also had
increased myristic acid levels, which has been associated
with increased UC flares.3 Two other important metab-
olites implicated in the pathogenesis of IBD are short-
chain fatty acids and tryptophan.10 Acetate, which was
increased after a LFD, is a byproduct of bacterial
fermentation of fiber and mediates improved intestinal
epithelial barrier function and inflammatory responses
by binding to G-protein–coupled receptors.21 Consistent
with increased acetate, a LFD increased Bacteroidetes,
which contain the main producers of acetate,10 and the
microbiota composition also was associated significantly
with acetate. The microbiota metabolize tryptophan into
indole metabolites that act as ligands for the aryl hy-
drocarbon receptor, which exerts protective, anti-
inflammatory effects via IL22.10 It has been shown that
IBD patients have decreased microbial metabolism of
tryptophan.10 Interestingly, after a LFD, patients had a
significant increase in tryptophan compared with base-
line, and a marginal increase compared with iSAD. These
metabolites may be playing a role in modifying symp-
toms and inflammation.
Clinical Gastroenterology and Hepatology Vol. -, No. -
Our study had several limitations. The small size,
length of the intervention, and enrolling patients with
minimal symptoms made it difficult to draw overarching
conclusions about the efficacy of these diets. Neverthe-
less, the diets were well tolerated. We did not perform
endoscopies or biopsy the mucosa, but patients had no
increase in fecal calprotectin level, CRP level, or partial
Mayo scores. We have shown that catering is a feasible
way to perform a diet intervention study with high
adherence. In the future, one could use national-level
caterers to widen the reach of the intervention. Ironi-
cally, catering a diet for a patient with IBD for a year
costs between $19,000 and $21,000 per patient. The cost
of a patient on a biologic such as ustekinumab is
approximately $130,752 to $261,504.
Patients demand better information on diet. In their
absence, patients often find fad diets with little to no data
on efficacy. We believe that our study fills a gap method-
ologically and experimentally. Our results show the
feasibility of catering as a means to control diet in the
outpatient setting. Future studies should address patients
with moderate disease, longer diet interventions, and
strategies to solidify long-term adherence to effective diets
to increase the likelihood of maintaining remission.
Supplementary Material
Note: To access the supplementary material accom-
panying this article, visit the online version of Clinical
Gastroenterology and Hepatology at www.cghjournal.org,
and at https://doi.org/10.1016/j.cgh.2020.05.026.
References
1. Holt DQ, Strauss BJ, Moore GT. Patients with inflammatory
bowel disease and their treating clinicians have different views
regarding diet. J Hum Nutr Diet 2017;30:66–72.
2. Hou JK, Abraham B, El-Serag H. Dietary intake and risk of
developing inflammatory bowel disease: a systematic review of
the literature. Am J Gastroenterol 2011;106:563–573.
3. Barnes EL, Nestor M, Onyewadume L, et al. High dietary intake
of specific fatty acids increases risk of flares in patients with
ulcerative colitis in remission during treatment with amino-
salicylates. Clin Gastroenterol Hepatol 2017;15:1390–1396.e1.
4. Damas OM, Estes D, Avalos D, et al. Hispanics coming to the
US adopt US cultural behaviors and eat less healthy: implica-
tions for development of inflammatory bowel disease. Dig Dis
Sci 2018;63:3058–3066.
5. NHANES Survey. What we eat in America, DHHS-USDA dietary
survey integration. Atlanta, GA: Centers for Disease Control and
Prevention, 2015.
6. Turner D, Steinhart AH, Griffiths AM. Omega 3 fatty acids (fish
oil) for maintenance of remission in ulcerative colitis. Cochrane
Database Syst Rev 2007;3:CD006443.
7. Brotherton CS, Martin CA, Long MD, et al. Avoidance of fiber is
associated with greater risk of Crohn’s disease flare in a 6-
month period. Clin Gastroenterol Hepatol 2016;14:1130–1136.
- 2020
8. Ananthakrishnan AN, Khalili H, Konijeti GG, et al. A prospective
study of long-term intake of dietary fiber and risk of Crohn’s dis-
ease and ulcerative colitis. Gastroenterology 2013;145:970–977.
9. Fryar CD, Kruszon-Moran D, Gu Q, et al. Mean body weight,
height, waist circumference, and body mass index among
adults: United States, 1999-2000 through 2015-2016. Natl
Health Stat Report 2018;122:1–16.
10. Lavelle A, Sokol H. Gut microbiota-derived metabolites as key
actors in inflammatory bowel disease. Nat Rev Gastroenterol
Hepatol 2020;17:223–237.
11. Yarur AJ, Quintero MA, Jain A, et al. Serum amyloid a as a sur-
rogate marker for mucosal and histologic inflammation in patients
with Crohn’s disease. Inflamm Bowel Dis 2017;23:158–164.
12. Wu GD, Chen J, Hoffmann C, et al. Linking long-term dietary
patterns with gut microbial enterotypes. Science 2011;
334:105–108.
13. Johnson AJ, Vangay P, Al-Ghalith GA, et al. Daily sampling re-
veals personalized diet-microbiome associations in humans.
Cell Host Microbe 2019;25:789–802.e5.
14. Matsuoka K, Kanai T. The gut microbiota and inflammatory
bowel disease. Semin Immunopathol 2015;37:47–55.
15. Lloyd-Price J, Arze C, Ananthakrishnan AN, et al. Multi-omics of
the gut microbial ecosystem in inflammatory bowel diseases.
Nature 2019;569:655–662.
16. Fritsch J, Abreu MT. The microbiota and the immune response:
what is the chicken and what is the egg? Gastrointest Endosc
Clin N Am 2019;29:381–393.
17. Hildebrandt MA, Hoffmann C, Sherrill-Mix SA, et al. High-fat diet
determines the composition of the murine gut microbiome inde-
pendently of obesity. Gastroenterology 2009;137:1716–1724.e1–2.
18. Gerasimidis K, Bertz M, Hanske L, et al. Decline in presump-
tively protective gut bacterial species and metabolites are
paradoxically associated with disease improvement in pediatric
Crohn’s disease during enteral nutrition. Inflamm Bowel Dis
2014;20:861–871.
19. Wong SW, Kwon MJ, Choi AM, et al. Fatty acids modulate Toll-like
receptor 4 activation through regulation of receptor dimerization
and recruitment into lipid rafts in a reactive oxygen species-
dependent manner. J Biol Chem 2009;284:27384–27392.
20. Fukata M, Shang L, Santaolalla R, et al. Constitutive activation
of epithelial TLR4 augments inflammatory responses to mucosal
injury and drives colitis-associated tumorigenesis. Inflamm
Bowel Dis 2011;17:1464–1473.
21. Maslowski KM, Vieira AT, Ng A, et al. Regulation of inflammatory
responses by gut microbiota and chemoattractant receptor
GPR43. Nature 2009;461:1282–1286.
Manipulating Dietary Fat in UC 11
Reprint requests
Address requests for reprints to: Maria T. Abreu, MD, University of
Miami–Leonard Miller School of Medicine, 1011 NW 15th Street, D-149,
Gautier Building, Suite 510, Miami, Florida. e-mail: Mabreu1@med.miami.edu;
fax: (305) 243-6125.
Acknowledgments
The authors thank Melissa Kaplan and Joanna Lopez for their guidance in
generating diet plans, and Elisa Karhu for her help in organizing the clinical
tables.
CRediT Authorship Contribtuions
Julia Fritsch (Conceptualization: Lead; Data curation: Lead; Formal anal-
ysis: Lead; Investigation: Lead; Software: Equal; Validation: Equal; Visualiza-
tion: Lead; Writing – original draft: Lead; Writing – review & editing: Lead);
Luis Garces (Data curation: Supporting; Dietitian, recruited patients, ac-
quired patient data and samples: Lead);
Maria A. Quintero (Data curation: Supporting; Project administration: Equal;
Clinical coordinator, recruited patients, acquired patient data and samples:
Lead);
Judith Pignac-Kobinger (Data curation: Supporting; Project administration:
Lead; Writing – review & editing: Supporting);
Ana M. Santander (Investigation: Equal);
Irina Fernández (Investigation: Equal);
Yuguang J. Ban (Software: Equal; Writing – review & editing: Supporting);
Deukwoo Kwon (Formal analysis: Supporting; Statistical analysis: Lead);
Matthew C. Phillips (Conceptualization: Supporting);
Karina Knight (Dietitian: Supporting);
Qingqing Mao (Metabolite analysis: Equal);
Rebeca Santaolalla (Conceptualization: Supporting; Methodology:
Supporting);
Xi S. Chen (Statistical Analysis: Equal);
Mukil Maruthamuthu (Metabolite analysis: Supporting);
Norma Solis (Acquired patient data and samples: Supporting);
Oriana M. Damas (Acquired patient data and samples: Supporting);
David H. Kerman (Resources: Supporting; Acquired patient data and
samples: Supporting);
Amar R. Deshpande (Resources: Supporting; Acquired patient data and
samples: Supporting);
John E. Lewis (Conceptualization: Supporting; Methodology: Supporting;
Validation: Supporting);
Chi Chen (Performed metabolomics and analyzed metabolite data: Lead);
Maria T. Abreu (Conceptualization: Lead; Funding acquisition: Lead;
Methodology: Lead; Resources: Lead; Supervision: Lead; Validation: Lead;
Writing – review & editing: Lead).
Conflicts of interest
This author discloses the following: Maria T. Abreu has served as a scientific
advisory board member for Boehringer Ingelheim Pharmaceuticals, Gilead,
AbbVie, Seres Therapeutics, Shire, and Landos Biopharma, serves as a trainer
or lecturer for Imedex, Focus Medical Communications, and Cornerstones
Health, Inc, has served as a consultant for Ferring Pharmaceuticals, Allergan,
Amgen, Celltrion Healthcare CO, Millennium Pharmaceuticals, Theravance
Biopharma, Inc, and UCB Biopharma SRL, and has funded projects by Pfizer,
Prometheus Laboratories, and Takeda Pharmaceuticals. The remaining au-
thors disclose no conflicts.
Funding
This work was supported by the Crohn’s and Colitis Foundation Broad Medical
Research Program (Litwin IBD Pioneers Initiative; IBD-0389R), the Micky and
Madeleine Arison Family Foundation Crohn’s and Colitis Discovery Laboratory,
and the Martin Kalser Chair (M.T.A.).
11.e1 Fritsch et al
Supplementary Methods
Eligibility Criteria and Exclusion Criteria
Patients did not complete the study for various reasons
including the following: did not like the catered diet, re-
ported side effects (bloating), personal issues (often
traveling for work or pleasure), and extreme weather
(Hurricane Irma). The trial was stopped at the end of the
grant. Male and female participants with UC (ages, 18–70
y) at high risk for flaring (flare within the past 18 mo)1 and
inactive or mild disease were recruited. All treatments for
UC were permitted. Participants with Crohn’s disease,
celiac disease, or a history of colonic dysplasia (except for
adenoma on a prior colonoscopy) or altered anatomy
(colectomy, ileal pouch, or ostomy) were excluded. Pa-
tients on oral mesalamine or sulfasalazine were allowed to
participate as long as they were on a stable dose for at least
2 weeks before screening. Anti–tumor necrosis factors or
immunosuppressants (azathioprine, 6-mercaptopurine,
or methotrexate) at screening were permitted as long as
patients were stable for at least 8 weeks and remained on
the same dose during the treatment period. Patients on
corticosteroids could not exceed more than 20 mg of
prednisone or 9 mg of budesonide daily at the time of
screening. However, intravenous corticosteroids (except
for premedication for anti–tumor necrosis factors) within
2 weeks before screening, during screening, or during the
study period were excluded. If clinically indicated,
tapering of steroids was permitted after 4 weeks of
intervention. Other exclusion criteria included the use of
cyclosporine, mycophenolate mofetil, sirolimus, thalido-
mide. or tacrolimus 2 months before screening; a stool
sample positive for ova, parasites, Clostridium difficile B
toxin, or aerobic pathogens (Aeromonas, Plesiomonas,
Shigella, Yersinia, Campylobacter, and Escherichia coli
species) within 3 months of screening; the use of total
parenteral nutrition at the time of screening and during
the study; the use of antidiarrheal drugs within 2 weeks
before screening; and the use of antibiotics or probiotics 4
weeks before screening. The presence of any of the
following laboratory abnormalities within the past 3
months were excluded, including hemoglobin level less
than 8.0 g/dL and albumin level less than 2.8 g/dL.
Starting new medication for IBD during the trial was not
permitted. Patients also were excluded for the need for
antibiotic use during the study period. Lastly, any other
significant (ie, uncooperative behavior or any condition
that could make the patient potentially nonadherent) or
life-threatening comorbidities in which diet intervention
could have a negative effect (ie, patients with a short life
expectancy or patients with a pacemaker) were
exclusionary.
Diet Assessment
We used 2 methods to record the diets during this
study. The validated Automated Self-Administered 24-
Clinical Gastroenterology and Hepatology Vol. -, No. -
hour dietary recall was used at baseline and at the end
of the washout period. The Automated Self-Administered
24-hour dietary recall is based on the US Department of
Agriculture Automated Multiple-Pass Method, which has
been validated2 to accurately assess the quantity of food
consumed within 24 hours to obtain micronutrients and
macronutrients, as well as mean total energy. Before the
start of the diet intervention (baseline), all participants
were personally provided with in-depth instructions
from a registered dietitian on how to use the Automated
Self-Administered 24-hour dietary recall. For the diet
intervention, all the menus were created by a research
dietitian and entered in a validated web-based food diary
platform called Nutrihand (http://www.nutrihand.com).
This Health Insurance Portability and Accountability
Act–compliant sign-on electronic food diary was used to
record food and assess adherence to the planned diet.
Participants were trained to use this website to record all
the food they ate daily from their menu in Nutrihand. As
part of the study, we implemented specific guidelines
regarding acceptable snacks and substitutions to main-
tain dietary goals. These substitutions were tracked
accordingly in Nutrihand.
Data and Sample Collection
Randomization, which was performed by the dietitian
and clinical coordinator, was a 1:1 allocation ratio
following a combination of blocked and simple
randomization (http://stattrek.com/statistics/random-
number-generator.aspx website). Patients were
assigned to a group based on computer-generated table
of random permutations and were blocked according to
time of enrollment. Each block of patients started the
same diet at the same time. Patients were not told how
the diets differed. Participants completed a comprehen-
sive demographic and medical history questionnaire at
baseline. Study assessments were performed during 5
visits: baseline (visit 1), after diet 1 (visit 2), after
washout (visit 3), and after diet 2 (visit 4). Patients were
instructed to fast before each visit and data collection
was identical for all visits (Supplementary Figure 1B). At
visits 1, 2, and 4, we collected a partial Mayo Score,
SIBDQ, SF-36, International Physical Activity Question-
naire, as well as anthropometric measurements (height,
weight, hip:waist ratio, fat mass, and physical activity) to
make an isocaloric diet customized to each participant’s
energy consumption. For physical activity, we used the
International Physical Activity Questionnaire and pro-
vided each patient with a FitBit (San Francisco, CA) that
they were instructed to wear throughout the duration of
the study. For stool collection, patients were provided
with the EasySampler stool collection kit (Alpco, Salem,
NH). Stool samples were collected within 24 hours of all
scheduled visits and were stored immediately at -4 C
until the samples were transported to the laboratory for
storage at -80 C.
- 2020
Secondary End Points
Disease severity was assessed using a noninvasive 9-
point partial Mayo score, which has been shown to track
clinical response as well as the full Mayo score.3 Serum
samples were used to assess the inflammatory cytokines
IL1b (cat: DY201-05), IL6 (cat: DY206-05), tumor necrosis
factor a (cat: DY210-05), serum amyloid A (cat: DY3019-
05), and interferon g (cat: DY285-05) via enzyme-linked
immunosorbent assay from R&D Systems (Minneapolis,
MN). CRP was analyzed via enzyme-linked immunosor-
bent assay (EK1316; Boster Biological Technology,
Pleasanton, CA) as per the manufacturer’s instructions. To
measure fecal calprotectin level, stool was first aliquoted
using the Bühlmann Calex Cap and then measured using
the Bühlmann fCAL enzyme-linked immunosorbent assay
(Amherst, NH) as per the manufacturer’s instructions. We
calculated adherence to diet by quantifying the partici-
pant’s recorded items and the total number of food
items recommended during the LFD and iSAD diet in-
terventions. The percentage adherence to the diet is the
ratio of items consumed to total items prescribed. We
also analyzed the adherence to the primary macronu-
trient goal of the diet intervention, fat intake. The
adherence to fat is the ratio of the percentage of calories
from fat consumed during the intervention to the per-
centage of calories from fat assigned. Patients who met
or were below their assigned fat intake for the LFD and
met or exceeded their assigned fat intake for iSAD
received an adherence to fat of 100%. We ensured
adherence to the catered diet in various ways. We called
each participant weekly for the following purposes: (1)
to maintain ongoing contact, (2) to help sustain rapport
and interest in the study, and (3) to ascertain well-being
and adherence. The dietitian and clinical coordinator
also monitored if the food was recorded daily and
contacted the patient if it was not completed
(Supplementary Figure 2B).
Microbiome 16S Sequencing
Total bacterial DNA was extracted using the Power-
Soil/fecal DNA Isolation Kit (MoBio Laboratories, Carls-
bad, CA). Samples were sent to the University of
Minnesota (St Paul, MN) Genomic Center for DNA
quantification and 16S sequencing. The 16S-V4 region
was amplified and sequenced using an Illumina MiSeq
(San Diego, CA). The primers used to amplify the 16S-V4
region were as follows: Meta_V4_515F(TCGTCGGCAG
CGTCAGATGTGTATAAGAGACAGGTGCCAGCMGCCGCGGT
AA) and Meta_V4_806R(GTCTCGTGGGCTCGGAGATGT
GTATAAGAGACAGGGACTACHVGGGTWTCTAAT). Poly-
merase chain reactions were performed using KAPAHi-
Fidelity Hot Start Polymerase. After the first
amplification (using Meta_V4_515F and Meta_V4_806R),
the amplified products were diluted 1:100, 5 uL of which
was used for the second round of amplification. Various
Manipulating Dietary Fat in UC 11.e2
different combinations of forward and reverse indexing
primers were used for the second polymerase chain
reaction. Before loading, pooled samples were dena-
tured with NaOH, diluted to 8 pmol/L (Illumina’s HT1
buffer, spiked with 15% PhiX, San Diego, CA), and de-
natured at 96 C for 2 minutes. A MiSeq600 cycle v3 kit
(San Diego, CA) was used to sequence the samples, and
nextera adapter (San Diego, CA) sequences were used
for postrun trimming.
Metabolite Liquid Chromatography–Mass
Spectrometry Analysis
Fecal metabolites were quantified using 4 different
liquid chromatography–mass spectrometry conditions in
both positive and negative nodes. Targeted and untargeted
metabolomics were performed using ultraperformance
liquid chromatography-quadrupole time-of-flight mass
spectrometry system (Waters, Milford, MA) and separated
by a BEH C18 column (Waters). Fecal samples were pre-
pared by mixing with 50% aqueous acetonitrile in a 1:9
(w/v) ratio and then centrifuged at 18,000  g for 10
minutes to obtain fecal extract supernatants. For
detecting metabolites containing amino functional groups
in their structure, the samples were derivatized with
dansyl chloride before the liquid chromatography–
mass spectrometry analysis.4 To detect carboxylic acids,
aldehydes, and ketones, samples were derivatized with
2-hydrazinoquinoline before the liquid chromatography–
mass spectrometry analysis.5 Comprehensive coverage of
the metabolome was achieved using 4 different liquid
chromatography–mass spectrometry conditions to analyze
underivatized metabolites in both positive and negative
modes, as well as 2-hydrazinoquinoline– and dansyl
chloride–derivatized metabolites in positive mode. A 5-mL
aliquot was injected into an ultraperformance liquid
chromatography–quadrupole time-of-flight mass spec-
trometry system (Waters) and separated by a BEH C18
column (Waters) with a gradient of mobile phase ranging
from water to 95% aqueous acetonitrile containing 0.1%
formic acid over a 10-minute run. Capillary voltage and
cone voltage for electrospray ionization were maintained
at 3 kV and 30 V for positive mode detection, respectively.
Source temperature and desolvation temperature were set
at 120 C and 350 C, respectively. Nitrogen was used as
both cone gas (50 L/h) and desolvation gas (600 L/h), and
argon was used as collision gas. For accurate mass mea-
surement, the mass spectrometer was calibrated with so-
dium formate solution (range, 50–1000 m/z) and
monitored by the intermittent injection of the lock mass
leucine enkephalin ([M þ H]þ ¼ 556.2771 m/z) in real
time. Mass chromatograms and mass spectral data were
acquired and processed by MassLynx software (Waters) in
centroided format. Additional structural information was
obtained by tandem mass spectrometry fragmentation
with collision energies ranging from 15 to 40 eV. Individ-
ual metabolite concentrations in fecal samples were
11.e3 Fritsch et al
determined by calculating the ratio between the peak area
of each metabolite and the peak area of the internal
standard, and then fitting it with a standard curve using
QuanLynx software (Waters).
Bioinformatics
The microbiome identification was analyzed using Cos-
mosID pipeline (Rockville, MD), which uses a high-
performance, data-mining, k-mer algorithm that rapidly dis-
ambiguates millions of short sequencing reads into the
discrete genomes engendering the particular sequences. This
pipeline has 2 separable comparators that include a pre-
computation phase that matches a k-mer to a uniquely
identified reference database and a per-sample computation
that statistically scores the entire read to verify the identifi-
cation and to avoid false-positive identifications. For the
precomputation phase, the inputs are microbial genome da-
tabases, and the outputs are phylogeny trees and variable-
length k-mer fingerprints (biomarkers) that uniquely iden-
tify nodes generating branches and leaves of the tree. The
second per-sample computation phase searches hundreds of
millions of short sequence reads or contigs from a draft as-
sembly against fingerprint sets. To exclude false positives, the
results are filtered using a threshold derived from internal
statistical scores that are determined by analyzing a large
number of diverse metagenomes. Linear discriminant anal-
ysis effect size at the genus level (LEfSe, version 1.0, Cam-
bridge, MA) was performed to identify differentially
abundant taxa as biomarkers.6 Taxa were selected with
Wilcoxon rank-sum test (P < .05) and absolute linear
discriminant analysis score (log10) greater than 1.5. In the
cladogram, significantly differential taxa were colored corre-
sponding to the diet groups. For further targeted microbiome
analysis, we used R (vegan package) to perform a permuta-
tional multivariate analysis of variance (PERMANOVA) test
and a Wilcoxon paired t test to analyze the differences in
mean relative abundance between groups.
Diet principal component analysis. For clustering and
principal component analysis of nutrient elements, we
fitted a linear model on each of the elements (stan-
dardized) with total calories as the independent variable
and extracted the residuals as the normalized nutrient
variables. The normalized variables were grouped by
unsupervised hierarchical clustering and analyzed for
PCs using prcomp in R (version 3.6.0, Vienna, Austria).
Diet–microbiota–metabolite relationships. To unravel
the dependence relationships of microbiome and metabolites
on diet, it is necessary to simultaneously consider their
interdependence. We used 2 mixed models: (1) metabolite w
diet PCs þ microbiome þ patient þ sex; and (2) microbiome
w diet PCs þ metabolite þ patient þ sex, where patient was
considered as a random effect. The first model allowed us to
examine the variation of metabolites explained exclusively by
PCs while controlling for microbiome, while the second model
examined the variation of microbiome explained exclusively
by PCs while controlling for metabolites. From these models,
we also can evaluate the microbiota–metabolite relationships
while controlling for diet influence. Before fitting the mixed
Clinical Gastroenterology and Hepatology Vol. -, No. -
model, all the microbiome and metabolite variables were
normalized by inverse normal transformation, followed by
the Shapiro–Wilk normality test to ensure the validity of the
model assumption. We obtained 93 genus-level microbes and
45 metabolites after filtering. Because variation of 1 metab-
olite can be explained by multiple microbes in addition to diet
PCs, the significance of the contribution of diet to the
metabolite was calculated as the least significant one among
all the models with different microbes. The same criteria were
used to consider the significance of the contribution of diet
PCs to microbiome.
Statistical Analysis
We powered the number of patients on a change in
tumor necrosis factor ⍺ level based on data we generated
in an earlier study.7 Based on power calculations, we
needed 12 participants per group to show a difference of
30% in markers of inflammation between the iSAD and
LFD interventions with 90% certainty. We used GraphPad
Prism software (version 8.0, San Diego, CA), SAS (Cary,
NC), and R (version 1.136) for statistics and to generate
graphs. For dietary composition, we used a 1-way analysis
of variance with the Geisser–Greenhouse correction. For
clinical outcomes, we used a paired t test and a mixed
model to take into account a carryover effect, period effect,
and treatment effect (Supplementary Table 3). There was
no carryover or period effect for all primary and secondary
outcomes (Supplementary Table 4). Primary and second-
ary outcome graphs are shown as means  SEM, while all
other graphs are shown as a box and whiskers plot using
the Tukey test. All tests were 2-sided and a P value less
than .05 was considered significant.
Supplementary References
1. Barnes EL, Nestor M, Onyewadume L, et al. High dietary intake of
specific fatty acids increases risk of flares in patients with ulcer-
ative colitis in remission during treatment with aminosalicylates.
Clin Gastroenterol Hepatol 2017;15:1390–1396.e1391.
2. Subar AF, Kirkpatrick SI, Mittl B, et al. The automated self-
administered 24-hour dietary recall (ASA24): a resource for re-
searchers, clinicians, and educators from the National Cancer
Institute. J Acad Nutr Diet 2012;112:1134–1137.
3. Lewis JD, Chuai S, Nessel L, et al. Use of the noninvasive
components of the Mayo score to assess clinical response in
ulcerative colitis. Inflamm Bowel Dis 2008;14:1660–1666.
4. Ma Y, Zhou W, Chen P, et al. Metabolomic evaluation of Sce-
nedesmus sp. as a feed ingredient revealed dose-dependent
effects on redox balance, intermediary and microbial meta-
bolism in a mouse model. Nutrients 2019;11:1971.
5. Lu Y, Yao D, Chen C. 2-hydrazinoquinoline as a derivatization
agent for LC-MS-based metabolomic investigation of diabetic
ketoacidosis. Metabolites 2013;3:993–1010.
6. Segata N, Izard J, Waldron L, et al. Metagenomic biomarker
discovery and explanation. Genome Biol 2011;12:R60.
7. Yarur AJ, Jain A, Sussman DA, et al. The association of tissue
anti-TNF drug levels with serological and endoscopic disease
activity in inflammatory bowel disease: the ATLAS study. Gut
2016;65:249–255.
- 2020 Manipulating Dietary Fat in UC 11.e4

Supplementary
Figure 1. CONSORT flow
diagram.
11.e5 Fritsch et al Clinical Gastroenterology and Hepatology Vol. -, No. -

Supplementary Figure 2. Study design of cross-over intervention. (A) Clinical diet schema of cross-over intervention. (B)
Timeline of clinical trial. Patients came into the clinic 2 weeks before the start of the trial for a medical history examination and 1
week before the start to collect samples. Once the diet intervention started, patients were called on a weekly basis. Patients
came into the clinic at the end of diet 1, at the end of the washout period, and at the end of diet 2. Clinical samples and data
were collected at baseline, end of diet 1, and end of diet 2. ASA24, Automated Self-Administered 24-hour dietary recall; IPAQ,
International Physical Activity Questionnaire; iSAD, improved standard American diet; LFD, low-fat, high-fiber diet; SF-36,
Short Form-36 Health Survey; SIBDQ, short inflammatory bowel disease questionnaire; TNF, tumor necrosis factor; V, visit
- 2020 Manipulating Dietary Fat in UC 11.e6

Supplementary Figure 3. Anthropometric measurements during the study period. (A) Body weight. (B) Body mass index. (C)
Fat mass. (D) Waist to hip ratio. (E) Activity score as measured by the International Physical Activity Questionnaire (IPAQ). An
activity score of less than 600 is considered low activity. An activity score of 600 to 3000 is considered moderate activity. An
activity score of at least 3000 is considered high activity. (F) Average daily steps measured by the FitBit (San Francisco, CA)
that was provided to the patient at the start of the study. *P < .05, **P < .01, and ***P < .001. iSAD, improved standard
American diet; LFD, low-fat, high-fiber diet.
11.e7 Fritsch et al Clinical Gastroenterology and Hepatology Vol. -, No. -

Supplementary Figure 4. Dietary composition of baseline, washout, improved standard American diet (iSAD), and low-fat,
high-fiber diet (LFD) interventions. Daily intake of major macronutrients and dietary components. *P < .05, **P < .01, and
***P < .001. MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid.
- 2020 Manipulating Dietary Fat in UC 11.e8

Supplementary Figure 5. Adherence to catered diets. (A) Adherence to the catered diet items was 86.6% for the improved
standard American diet (iSAD) and 85% for the low-fat, high-fiber diet (LFD). (B) The adherence to fat was 96.6% for the iSAD
and 94.5% for the LFD. (C) Of the items they did not consume, 49% and 54% were fruits and vegetables for the iSAD and LFD,
respectively.
11.e9 Fritsch et al Clinical Gastroenterology and Hepatology Vol. -, No. -

Supplementary Figure 6. Microbiome changes after dietary interventions. 16S ribosomal RNA sequencing was performed on
patient stool samples at baseline, on the improved standard American diet (iSAD), and on the low-fat, high-fiber diet (LFD). (A)
Cladogram showing significant taxa between baseline and the LFD and (B) baseline and the iSAD. (C) Cladogram and his-
togram of linear discriminant analysis score showing significant taxa between the iSAD and LFD. Taxa in red were increased
significantly on the iSAD. The Eubacterium oxidoreducens group was the only taxa increased during the iSAD compared with
the LFD. No significant taxa were increased in the LFD compared with the iSAD using linear discriminant analysis effect size
(LEFse) analysis (n ¼ 17).
- 2020 Manipulating Dietary Fat in UC 11.e10

Supplementary Table 1. Nutrient Intake During Baseline, Washout, iSAD, and LFD

Baseline (n ¼ 17), Washout (n ¼ 17), iSAD (n ¼ 17), LFD (n ¼ 17),

Nutrient median (Q1, Q3) median (Q1, Q3) median (Q1, Q3) median (Q1, Q3)

Daily caloric intake 1873 (1369, 2359) 1635 (1220, 1943) 1764 (1306, 2379) 1646 (1156, 2229)
Daily protein intake, g 80.85 (52.55, 97.85) 79.14 (54.10, 99.45) 102.1 (78.15, 132.1) 104.8 (68.1, 144.7)
Daily protein intake, % of calories 17.13 (13.15, 21.78) 20.19 (16.1, 24.11) 23.27 (22.15, 24.07) 25.4 (23.96, 26.1)
Daily fat intake, g 72.39 (46.6, 88.8) 58.51 (39.95, 77.9) 71.51 (49.25, 101.1) 20.59 (13.9, 28.35)
Daily fat intake, % of calories 33.36 (26, 39.65) 32.02 (27.4, 36) 35.69 (34.35, 38.7) 11.32 (10.75, 11.65)
Daily carbohydrate intake, g 218.2 (167.3, 268) 179.2 (135.4, 204.4) 177.6 (135.1, 222) 263.2 (190, 353.1)
Daily carbohydrate intake, % of calories 48.16 (42.25, 56.5) 44.43 (40.05, 52.36) 40.95 (39.6, 41.87) 63.93 (62.67, 65.89)
Daily sugar intake, g 99.49 (52, 132.5) 61.34 (39.6, 83.65) 41.71 (35.8, 48.95) 62.91 (46.55, 84)
Daily sugar intake, % of calories 22.25 (13.09, 28.72) 15.28 (9.71, 18.79) 9.88 (7.72, 11.33) 15.08 (13.76, 16.52)
Daily fiber intake, g 12.35 (7.3, 15.85) 13.34 (7.85, 19.3) 18.05 (14.6, 23) 25.6 (17.75, 32.5)
Daily cholesterol intake, mg 303.2 (128.8, 358.1) 289.7 (195.8, 355.8) 415.1 (279, 568.9) 153.9 (101.6, 218.2)
Daily saturated fat intake, g 27.17 (13.75, 33.5) 18.52 (13.25, 24.05) 21.81 (15.55, 30.55) 4.02 (2.75, 5.55)
Daily saturated fat intake, % of calories 12.26 (8.29, 14.41) 10.27 (7.95, 13.0) 11.03 (10.88, 11.51) 2.20 (2.00, 2.32)
Daily unsaturated fat intake, g 39.59 (24.35, 44.15) 34.99 (22.0, 46.6) 40.51 (25.65, 58.3) 10.51 (7.1, 14.55)
Daily unsaturated fat intake, % calories 18.45 (13.65, 22.6) 19.02 (16.43, 21.11) 19.97 (18.21, 22.55) 5.76 (5.59, 6.0)
Daily MUFA intake, g 23.77 (13.85, 27.15) 21.75 (14.15, 26.65) 25.82 (17.25, 36.6) 4.91 (3.3, 7.05)
Daily MUFA intake, % of calories 10.77 (7.73, 13.74) 11.95 (10.06, 13.16) 12.81 (12.01, 14.1) 2.68 (2.50, 2.89)
Daily PUFA intake, g 15.84 (9.25, 21.35) 13.24 (7.1, 20.65) 14.68 (8.35, 21.7) 5.59 (3.9, 7.45)
Daily PUFA intake, % of calories 7.68 (5.87, 9.73) 7.07 (5.55, 8.39) 7.16 (6.19, 8.39) 3.08 (2.94, 3.21)
Daily omega 6:3 ratio 15.12:1 (8.0, 19.5) 12.04:1 (9.2, 15.3) 21.2:1 (17.07, 26.37) 2.75:1 (2.0, 3.0)
Daily linoleic acid intake, g 13.81 (7.95, 18.9) 11.31 (5.9, 17.9) 12.24 (6.65, 18.8) 2.69 (1.95, 3.45)
Daily arachidonic acid intake, g 0.14 (0.0, 0.2) 0.16 (0.1, 0.2) 0.18 (0.1, 0.3) 0.08 (0.05, 0.1)
Daily EPA intake, g 0.05 (0, 0) 0.05 (0.0, 0.1) 0.02 (0.0, 0.05) 0.1 (0.1, 0.1)
Daily DPA intake, g 0.01 (0.0, 0.0) 0.04 (0.0, 0.1) 0.01 (0.0, 0.0) 0.05 (0.0, 0.1)
Daily DHA intake, g 0.09 (0.0, 0.1) 0.15 (0.1, 0.25) 0.1 (0.1, 0.1) 0.26 (0.2, 0.3)
Daily calcium intake, mg 1017 (539.7, 1333) 652.8 (458.5, 856.8) 702.6 (560.7, 900.3) 469.9 (313, 618.7)
Daily iron intake, mg 12.38 (7.35, 15.2) 11.13 (9.95, 13.05) 13.17 (9.45, 17.6) 30.96 (10.25, 19.85)
Daily magnesium intake, mg 285.1 (189.5, 372.1) 239.5 (167.8, 295.2) 240.0 (175.9, 317.2) 289.1 (205.1, 374.6)
Daily phosphorus intake, mg 1378 (826.2, 1544) 1118 (858.6, 1357) 991.8 (695.4, 1347) 946.3 (636.9, 1288)
Daily potassium intake, mg 2429 (1504, 3208) 2116 (1405, 2615) 2770 (2109, 3530) 3218 (2306, 4193)
Daily sodium intake, mg 2965 (1668, 3589) 2903 (2010, 3651) 2870 (2103, 3983) 2551 (1707, 3529)
Daily zinc intake, mg 9.58 (6.0, 10.15) 8.65 (6.6, 10.3) 8.84 (6.45, 12.05) 7.14 (4.95, 9.8)
Daily vitamin C, mg 80.65 (26, 116.4) 60.5 (34.45, 74.90) 108.8 (90.75, 124.2) 220.7 (187.7, 274.2)
Daily thiamin intake, mg 1.69 (0.8, 2.5) 1.29 (0.95, 1.55) 1.18 (0.9, 1.55) 1.43 (1.0, 1.85)
Daily riboflavin intake, mg 2.01 (1.2, 2.45) 1.51 (1.1, 1.8) 1.36 (1.0, 1.8) 1.55 (1.0, 2.05)
Daily niacin intake, mg 22.45 (12.70, 25.70) 21.42 (15.4, 25.5) 18.54 (14.15, 25.4) 23.76 (16.65, 31)
Daily vitamin B6 intake, mg 1.99 (1.15, 2.2) 1.7 (0.95, 2.2) 1.61 (1.05, 2.3) 1.99 (1.4, 2.65)
Daily folate intake, mcg 328.6 (176.8, 385) 338.2 (232.4, 416) 335.1 (270, 414.4) 464.7 (329.5 (602.6)
Daily folic acid intake, mcg 133.2 (87.65, 176.1) 150.5 (101.4, 168.3) 69.95 (52.1, 96.8) 109 (83.6, 148.3)
Daily vitamin B12 intake, mcg 3.96 (1.25, 5.0) 4.01 (2.3, 5.5) 3.59 (2.45, 4.85) 2.86 (1.85, 3.95)
Daily vitamin A intake, mcg 572.5 (162.7, 569.6) 441.1 (251.4, 539.4) 696.6 (568.5, 839.5) 1123 (679.2, 1476)
Daily vitamin E intake, mg 5.81 (3.1, 7.65) 6.16 (3.8, 8.9) 7.18 (4.9, 10.35) 4.15 (2.75, 5.2)
Daily intake of fruits, servings 0.67 (0, 1) 0.50 (0, 0.85) 1.56 (1.15, 1.9) 3.53 (2.5, 4.5)
Daily fruits and vegetables, servings 1.12 (0, 1.4) 1.07 (0.55, 1.4) 4.87 (3.75, 5.95) 7.63 (5.8, 9.35)
Daily intake of red meat, servings 3.13 (0, 5.4) 2.17 (0.04, 3.55) 3.23 (2.41, 3.87) 0.57 (0.4, 0.72)

NOTE. Values are shown in average daily nutrient consumption.

DHA, docosahexaenoic acid; DPA, docosapentaenoic acid; EPA, eicosapentaenoic acid; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid; Q,
quartile.
11.e11 Fritsch et al Clinical Gastroenterology and Hepatology Vol. -, No. -

Supplementary Table 2. P Values for Baseline, Washout, iSAD, and LFD Intake of Raw Amounts of Nutrients

P value, baseline vs P value, baseline vs P value, baseline vs P value, iSAD vs

Nutrient iSAD LFD washout LFD

Daily caloric intake .95 .61 .47 .29

Daily protein intake, g .11 .04 .99 .93
Daily protein intake, % of calories .002 <.0001 .17 .0002
Daily fat intake, g .99 .0003 .37 <.0001
Daily fat intake, % of calories .64 <.0001 .87 <.0001
Daily carbohydrate intake, g .18 .32 .21 <.0001
Daily carbohydrate intake, % of .02 <.0001 .35 <.0001
calories
Daily sugar intake, g .003 .11 .03 .0007
Daily sugar intake, % of calories .0004 .06 .03 <.0001
Daily fiber intake, g .009 <.0001 .95 <.0001
Daily cholesterol intake, mg .42 .11 .99 <.0001
Daily saturated fat intake, g .71 .0007 .25 <.0001
Daily saturated fat intake, % of .83 <.0001 .54 <.0001
calories
Daily unsaturated fat intake, g .99 .0003 .83 <.0001
Daily unsaturated fat intake, % .71 <.0001 .99 <.0001
calories
Daily MUFA intake, g .97 .0007 .96 <.0001
Daily MUFA intake, % of calories .11 <.0001 .52 <.0001
Daily PUFA intake, g .96 .0004 .64 <.0001
Daily PUFA intake, % of calories .93 <.0001 .93 <.0001
Daily omega 6:3 ratio .07 .0005 .68 <.0001
Daily linoleic acid intake, g .86 <.0001 .55 <.0001
Daily arachidonic acid intake, g .84 .42 .97 .0003
Daily EPA intake, g .93 .33 .99 .0002
Daily DPA intake, g .97 .11 .33 .02
Daily DHA intake, g .99 .02 .8 <.0001
Daily calcium intake, mg .36 .04 .2 <.0001
Daily iron intake, mg .99 .74 .89 .76
Daily magnesium intake, mg .63 >.99 .46 .02
Daily phosphorus intake, mg .26 .17 .56 .68
Daily potassium intake, mg .66 .04 .58 .04
Daily sodium intake, mg .99 .51 .99 .02
Daily zinc intake, mg .97 .24 .93 .003
Daily vitamin C, mg .43 <.0001 .76 <.0001
Daily thiamin intake, mg .04 .43 .28 .009
Daily riboflavin intake, mg .15 .44 .28 .08
Daily niacin intake, mg .65 .99 .99 .0003
Daily vitamin B6 intake, mg .78 >.99 .86 .002
Daily folate intake, mcg .99 .04 .99 .0004
Daily folic acid intake, mcg .004 .42 .91 .0001
Daily vitamin B12 intake, mcg .99 .64 .99 .002
Daily vitamin A intake, mcg .94 .04 .9 .0004
Daily vitamin E intake, mg .39 .24 .99 <.0001
Daily intake of fruits, servings .02 <.0001 .92 <.0001
Daily fruits and vegetables, servings <.0001 <.0001 .99 .0006
Daily intake of red meat, servings .99 .14 .92 <.0001

DHA, docosahexaenoic acid; DPA, docosapentaenoic acid; EPA, eicosapentaenoic acid; iSAD, improved standard American diet; LFD, low-fat, high-fiber diet;
MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid.
- 2020 Manipulating Dietary Fat in UC 11.e12

Supplementary Table 3. Primary and Secondary Clinical Outcomes

Baseline (n ¼ 17), iSAD (n ¼ 17), LFD (n ¼ 17), BSL vs iSAD, BSL vs LFD, iSAD vs LFD,
median (Q1, Q3) median (Q1, Q3) median (Q1, Q3) P value P value P value

SIBDQ 4.98 (4.1, 6) 5.55 (4.75, 6.25) 5.77 (5, 6.4) .02 .001 .04
Serum amyloid A, mg/L 7.99 (2.61, 13.82) 7.20 (2.04, 10.11) 4.50 (1.31, 8.31) .64 .02 .07
Partial Mayo score 1.41 (0, 2) 0.76 (0, 2) 0.6 (0, 1.5) .06 .08 .63
Partial Mayo score (n ¼ 2.7 (2.0, 4.0) 1.4 (0.5, 2.0) 1.2 (0, 2.5) .06 .08 .65
9)a
Fecal calprotectin, mg/ 88.7 (9.1, 153.1) 124.8 (5.9, 147.4) 66.16 (6.48, 68.0) .38 .35 .19
g
CRP, mg/L 3.23 (0.42, 4.3) 3.05 (0.37, 3.29) 2.51 (0.45, 2.06) .5 .07 .21
TNF⍺, pg/mL 31.19 (0, 30.76) 25.62 (0, 22.28) 30.87 (0, 26.51) .12 .93 .06
IL6, pg/mL 65.65 (0.6, 39.85) 61.02 (0, 56.1) 58.05 (0, 69.2) .56 .44 .34
IL1b, pg/mL 17.6 (0, 12.75) 16.64 (0, 18.1) 16.94 (0, 13.4) .75 .54 .88
IFNg, pg/mL 8.31 (1.66, 8.26) 7.21 (0.59, 10.64) 8.08 (0.54, 11.5) .16 .8 .28
SF-36
Role limitations 66.54 (43.75, 100) 80.89 (65.63, 100) 83.09 (71.88, 100) .04 .002 .55
owing to physical
Role limitations 67.16 (33.33, 100) 83.82 (70.83, 100) 83.82 (75, 100) .01 .004 .99
owing to
emotional
Pain 68.21 (33.75, 90) 78.97 (62.5, 100) 82.65 (72.5, 100) .05 .007 .37
General health 48.53 (27.5, 77.5) 57.65 (32.5, 82.5) 59.12 (37.5, 82.5) .04 .03 .44
Social functioning 69.85 (43.75, 100) 83.09 (75, 100) 84.56 (75, 100) .01 .03 .77
Physical functioning 79.71 (57.5, 100) 86.18 (77.5, 100) 82.35 (70, 100) .18 .55 .05
Energy/fatigue 49.27 (43.75, 56.25) 50.75 (43.78, 56.25) 51.84 (43.78, 56.28) .62 .4 .77
Emotional well-being 60.29 (50, 70) 58.24 (55, 62.5) 59.71 (55, 67.5) .42 .82 .21

BSL, baseline; CRP, C-reactive protein; IFN, interferon; IL, interleukin; iSAD, improved standard American diet; LFD, low-fat, high-fiber diet; Q, quartile; SF-36,
Short Form-36; SIBDQ, short inflammatory bowel disease questionnaire; TNF, tumor necrosis factor.
a
The remaining 9 patients who did not have an initial partial Mayo score of 0, which remained unchanged throughout the study.
11.e13 Fritsch et al Clinical Gastroenterology and Hepatology Vol. -, No. -

Supplementary Table 4. Carry Over Effect for Primary and Secondary Outcomes

Difference between 95% CI of 95% CI of P value for P value for period

means difference lower difference upper carryover effect effect

SIBDQ 0.23 0.03 0.4253 .18 .16

Serum amyloid A, mg/L -2.66 -5.71 0.40 .75 .6
Mayo score -0.13 -0.65 0.40 .51 .62
CRP, mg/L -0.55 -1.46 0.36 .19 .60
Fecal calprotectin, mg/g -58.64 -152.2 34.87 .80 .66
TNF⍺, pg/mL 5.00 -0.39 10.40 .18 .13
IL6, pg/mL -2.89 -9.45 3.67 .62 .78
IL1b, pg/mL 0.26 -4.08 4.6 .29 .74
IFNg, pg/mL 0.83 -0.86 2.53 .15 .49
SF-36
Role limitations owing to 2.21 -5.71 10.13 .14 .97
physical
Role limitations owing to .06 -5.6 5.71 .17 .72
emotional
Pain 3.59 -5.10 12.29 .18 .74
General health 1.53 -2.53 5.59 .40 .62
Social functioning 1.65 -9.28 12.58 .5 .56
Physical functioning -3.85 -7.8 0.09 .14 .78
Energy/fatigue 1.17 -7.10 9.44 .39 .77
Emotional well-being 1.56 -0.74 3.87 .21 .17
Bacteroidetes 2.44 -4.36 9.24 .75 .46
Actinobacteria -2.13 -5.77 1.51 .82 .81
F prausnitzii 1.79 -0.16 3.74 .90 .46
Prevotella 0.30 -0.07 0.66 .47 .46
Alanine 138.7 -146.9 424.3 .62 .72
Asparagine 0.08 -0.10 0.26 .22 .60
Aspartic acid 6.67 -10.74 19.44 .70 .45
Citrulline 2.32 -0.69 5.32 .44 .33
Glutamic acid 50.79 -1.33 102.9 .37 .14
Glutamine .11 -0.37 0.60 .17 .36
Glycine 63.46 -5.24 132.2 .49 .69
Leucine -0.02 -0.07 0.03 .56 .99
Methionine 0.27 -0.1 0.64 .16 .56
Phenylalanine 1.50 -75.21 78.2 .13 .36
Proline 41.17 -20.81 103.2 .41 .98
Serine 8.9 -9.22 27.04 .43 .74
Taurine -5.45 -14.91 4.01 .34 .39
Tyrosine 1.07 -21.65 23.78 .13 .51
Valine -102.1 -326.7 122.5 .33 .18
g-Aminobutyric acid -2.4 -7.44 2.63 .31 .61
Arginine 0.22 -8.09 8.53 .39 .44
Lysine 13.65 -2.95 30.24 .64 .10
Histidine 2.24 -2.06 6.55 .27 .24
Tryptophan 0.62 -0.19 2.64 .91 .54
Ornithine -0.38 -3.76 3.00 .41 .36
CA 50.85 -77.22 178.9 .39 .39
CDCA 66.75 -100.1 233.6 .39 .39
DCA 163 -578.7 904.7 .78 .2
LCA 159 -258.9 576.8 .91 .11
GCA -1.73 -5.5 2.04 .29 .29
GCDCA -3.48 -10.75 3.78 .29 .31
GDCA -0.14 -0.44 0.17 .11 .33
TCA -0.26 -1.08 0.56 .45 .23
TCDCA -0.0002 -0.0005 0.0002 .3 .3
TDCA 0.003 -0.003 0.009 .3 .3
- 2020 Manipulating Dietary Fat in UC 11.e14

Supplementary Table 4. Continued

Difference between 95% CI of 95% CI of P value for P value for period

means difference lower difference upper carryover effect effect

Lauric acid -365.5 -848.6 117.6 .59 .49

Myristic acid -96.6 -209.5 16.28 .89 .53
Eicosatrienoic acid 56.33 -8.54 121.2 .67 .73
3-amino-octanoic acid -15.84 -34.71 3.04 .49 .45
Acetic acid 11.16 -2.58 24.9 .7 .43
Propionic acid 15.31 -10.56 41.17 .54 .46
Butyric acid 27.61 -21.65 76.88 .56 .77
Valeric acid -7.99 -29.10 13.11 .6 .29

CA, cholic acid; CDCA, chenodeoxycholic acid; CRP, C-reactive protein; DCA, deoxycholic acid; GCA, glycocholic acid; GCDCA, glycochenodeoxycholic acid;
GDCA, glycodeoxycholic acid; LCA, lithocholic acid; SF-36, Short Form-36; SIBDQ, short inflammatory bowel disease questionnaire; TCA, taurocholic acid;
TCDCA, taurochenoxycholic acid; TDCA, taurodeoxycholic acid; TNF, tumor necrosis factor.
11.e15 Fritsch et al Clinical Gastroenterology and Hepatology Vol. -, No. -

Supplementary Table 5. Comparison of Microbiome and Metabolites During the Various Interventions

Baseline (n ¼ 11)a, iSAD (n ¼ 11)a, LFD (n ¼ 11)a, BSL vs LFD, BSL vs iSAD, iSAD vs LFD,
means (Q1, Q3) means (Q1, Q3) means (Q1, Q3) P value P value P value

a diversity 7.89 (5.72, 10.40) 8.74 (6.81, 10.34) 9.59 (5.46, 14.08) .13 .15 .78
(n = 17)
Bacteroidetes, 14.6 (4.49, 23.80) 21.7 (7.17, 32.30) 24.02 (14.27, 34.32) .015 .12 .35
% (n = 17)
Actinobacteria, 13.69 (7.38, 14.86) 9.98 (6.14, 11.32) 7.82 (2.79, 11.59) .017 .06 .28
% (n = 17)
F prausnitzii, % 7.38 (1.44, 8.29) 5.37 (1.53, 8.32) 7.20 (1.46, 11.68) .61 .38 .04
(n = 17)
Prevotella, % 0.36 (0.06, 0.22) 0.40 (0.08, 0.34) 0.69 (0.1, 0.62) .0007 .32 .08
(n = 17)
Alanine 916.5 (491.9, 1210) 804.8 (569.9, 990.8) 939.2 (667.4, 1156) .79 .48 .29
Asparagine 0.15 (0.0, 0.34) 0.05 (0.0, 0.01) 0.13 (0.0, 0.16) .82 .29 .30
Aspartic acid 51.32 (34.52, 81.35) 41.85 (24.27, 51.56) 46.67 (30.9, 62.99) .66 .32 .48
Citrulline 3.00 (0.0, 4.5) 3.62 (0.0, 4.94) 5.8 (0.0, 7.89) .41 .78 .13
Glutamic acid 221.2 (148.1, 253.8) 217.4 (101.6, 216.90 271.5 (146.9, 356.8) .43 .93 .053
Glutamine 0.34 (0.0, 0.74) 0.29 (0.0, 0.56) 0.42 (0.0, 0.56) .35 .76 .54
Glycine 193.4 (107.8, 259.4) 162.7 (81.52, 214.6) 225.0 (148.4, 328.6) .22 .43 .057
Leucine 0.03 (0.0, 0.06) 0.04 (0.0 ,0.1) 0.02 (0.0, 0.03) .76 .57 .45
Methionine 0.35 (0.0, 0.63) 0.07 (0.0, 0.0) 0.33 (0.0, 0.56) .88 .099 .13
Phenylalanine 132.1 (58.98, 197.2) 128.1 (86.78, 142.2) 126.6 (97.91, 154.4) .82 .88 .97
Proline 325.7 (127.1, 379.6) 203.0 (71,12, 289.9) 244.3 (139.4, 394.1) .4 .24 .14
Serine 5.98 (0.0, 14.06) 4.23 (0.0, 9.72) 13.39 (0.0, 29.98) .38 .31 .26
Taurine 4.09 (0.0, 0.27) 16.75 (0.0, 1.02) 11.63 (0.0, 0.22) .37 .32 .24
Tyrosine 46.46 (25.16, 43.29) 42.01 (26.1, 48.8) 42.45 (28.6, 54.18) .70 .53 .97
Valine 589.1 (385.2, 782.3) 563.6 (383.2, 746.2) 583 (446.2, 775.0) .94 .77 .82
g-Aminobutyric 1.67 (0.32, 1.22) 2.76 (0.38, 3.36) 2.66 (0.29, 1.04) .56 .39 .97
acid
Arginine 10.96 (0.0, 19.2) 5.12 (0.0, 3.47) 5.06 (0.0, 13.34) .22 .05 .99
Lysine 74.8 (38.58, 102.6) 54.4 (33.38, 70.21) 66.81 (48.51, 72.81) .59 .17 .16
Histidine 1.4 (0.43, 2.36) 0.92 (0.62, 1.05) 2.94 (0.59, 1.53) .34 .32 .32
Tryptophan 1.33 (0.79, 1.65) 1.08 (0.83, 1.42) 2.27 (1.34, 3.26) .04 .43 .076
Ornithine 1.26 (0.46, 1.75) 2.27 (0.51, 1.75) 2.03 (0.58, 1.18) .35 .44 .87
CA 20.55 (17, 26) 0.49 (0.0, 0.64) 56.02 (0, 0.62) .54 <.0001 .34
CDCA 6.12 (0.0, 0.8) 0.001 (0.0, 0.0) 72.81 (0.0, 0.0) .39 .27 .34
DCA 13.68 (0.0, 0.0) 768.1 (465.5, 1068) 890.2 (335.0, 1420) .002 .002 .73
LCA 761.5 (89.09, 1361) 559.5 (215.9, 887.1) 688.6 (278.1, 1231) .7 .24 .54
GCA 577 (178.3, 998.8) 2.25 (0.05, 0.22) 0.69 (0.08, 0.35) .001 .001 .38
GCDCA 0.97 (0.07, 0.19) 4.64 (0.0, 0.04) 1.47 (0.0, 0.008) .38 .35 .35
GDCA 1.84 (0.0, 0.19) 0.21 (0.0, 0.16) 0.08 (0.0, 0.17) .34 .38 .38
TCA 0.22 (0.0, 0.19) 0.39 (0.0, 0.03) 0.17 (0.0, 0.09) .8 .69 .57
TCDCA 0.06 (0.0, 0.02) 0.0001 (0.0, 0.0) 0.0 (0.0, 0.0) .29 .29 .34
TDCA 0.0 (0.0, 0.0) 0.0 (0.0, 0.0) 0.003 (0.0, 0.0) .34 N/A .34
Lauric acid 203.4 (5.68, 203.7) 381.4 (13.82, 642.5) 29.91 (4.31, 27.1) .04 .7 .02
Myristic acid 115 (47.14, 175.3) 157.1 (24.52, 157.1) 63.47 (12.38, 133.4) .23 .53 .08
Eicosatrienoic 171.6 (1.5, 253.9) 34.44 (1.14, 25.62) 89.84 (1.94, 206) .22 .08 .07
acid
Glycine 193.4 (107.8, 259.4) 162.7 (81.52, 214.6) 225 (148.4, 328.6) .22 .43 .06
3-amino- 12.97 (1.73, 25.22) 35.5 (2.59, 61.63) 20.26 (1.63, 22.03) .3 .09 .09
octanooic
acid
Acetate (n ¼ 17) 40.37 (24.13, 53.64) 42.52 (28.66, 63.43) 53.98 (31.5, 75.47) .05 .61 .09
Butyrate 142.6 (79.5, 177) 144.1 (83.48, 191.2) 171.4 (100.5, 226) .21 .90 .24
(n ¼ 17)
Propionate 102.7 (73.08, 123.4) 107.9 (90.04, 130.8) 123.8 (80, 168.5) .13 .52 .20
(n ¼ 17)
Isovaleric acid 55.85 (19.12, 75.93) 56.65 (32, 67.5) 48.01 (20.79, 63.03) .47 .89 .40
(n ¼ 17)

BSL, baseline; CA, cholic acid; CDCA, chenodeoxycholic acid; DCA, deoxycholic acid; GCA, glycocholic acid; GCDCA, glycochenodeoxycholic acid; GDCA,
glycodeoxycholic acid; iSAD, improved standard American diet; LCA, lithocholic acid; LFD, low-fat, high-fiber diet; N/A, not applicable; TCA, taurocholic acid;
TCDCA, taurochenoxycholic acid; TDCA, taurodeoxycholic acid.
a
n = 11 unless otherwise indicated.
- 2020 Manipulating Dietary Fat in UC 11.e16

Supplementary Table 6. Permutational Multivariate Analysis

of Variance of b Diversity

Pairs F model R2 P value

LFD vs baseline 0.715824738 0.020619552 .05

iSAD vs baseline 0.52423958 0.015184681 .40
LFD vs iSAD 0.41937596 0.0121843 .64

iSAD, improved standard American diet; LFD, low-fat, high-fiber diet.

Supplementary Table 7. Association of b Diversity to Study Variables (Permutational Multivariate Analysis of Variance)

Sample Variable F model R2 P value

Stool microbiome Magnesium, mg 2.16 0.04 .0005

Stool microbiome Protein, g 2.17 0.04 .001
Stool microbiome Potassium, mg 2.05 0.04 .001
Stool microbiome Sodium, mg 1.96 0.04 .002
Stool microbiome Calories 2.00 0.04 .002
Stool microbiome Folate, mcg 1.96 0.04 .002
Stool microbiome Riboflavin, mg 1.95 0.04 .004
Stool microbiome Zinc, mg 1.86 0.03 .004
Stool microbiome Iron, mg 1.88 0.03 .005
Stool microbiome Niacin, mg 1.88 0.03 .005
Stool microbiome Phosphorus, mg 1.82 0.03 .01
Stool microbiome Vitamin B6, mg 1.81 0.03 .01
Stool microbiome Carbohydrates, g 1.69 0.03 .01
Stool microbiome Calcium, mg 1.75 0.03 .02
Stool microbiome Thiamin, mg 1.63 0.03 .02
Stool microbiome Folic acid, mcg 1.56 0.03 .02
Stool microbiome Fiber, g 1.51 0.03 .03
Stool microbiome Vitamin E, a tocopherol, mg 1.32 0.02 .09
Stool microbiome Acetate 2.92 0.06 <.0001
Stool microbiome Propionate 2.23 0.05 .002
Stool microbiome SIBDQ 3.25 0.06 .001
Stool microbiome CRP 2.32 0.04 .007
Stool microbiome IL1b 1.71 0.03 .05
Stool microbiome IL6 1.94 0.03 .02
Stool microbiome Vitamin B12, mcg 1.30 0.02 .12
Stool microbiome Vitamin A, RAE, mcg 1.27 0.02 .13
Stool microbiome Cholesterol 1.09 0.02 .29
Stool microbiome Arachidonic acid, g 1.09 0.02 .29
Stool microbiome Saturated fatty acids, g 1.09 0.02 .30
Stool microbiome Fat, g 1.07 0.02 .33
Stool microbiome Sugar, g 0.97 0.02 .48
Stool microbiome Vitamin C, mg 0.97 0.02 .49
Stool microbiome Monounsaturated fatty acids, g 0.94 0.02 .54
Stool microbiome Polyunsaturated fatty acids, g 0.94 0.02 .54
Stool microbiome DPA, g 0.92 0.02 .59
Stool microbiome Linoleic acid, g 0.81 0.02 .80
Stool microbiome EPA, g 0.73 0.01 .90
Stool microbiome DHA, g 0.67 0.01 .95

CRP, C-reactive protein; DHA, docosahexaenoic acid; DPA, docosapentaenoic acid; EPA, eicosapentaenoic acid; IL, interleukin; SIBDQ, short inflammatory bowel
disease questionnaire.
11.e17 Fritsch et al Clinical Gastroenterology and Hepatology Vol. -, No. -

Supplementary Table 8. Correlation of Principal Components to Microbiome

PC ID Microbiome ID PC coefficient P value Phylum

PC1 Peptoclostridium 0.08 .05 Firmicutes

PC1 Rumen 0.061901727 .04 Bacteroidetes
PC1 Sutterella 0.06685958 .001 Proteobacteria
PC1 Mogibacterium -0.074946572 .03 Firmicutes
PC1 Blautia -0.072516101 .03 Bacteria_u_p
PC1 Ruminococcus -0.04930655 .04 Firmicutes
PC1 Lachnospiraceae nd30 0.075998474 .03 Firmicutes
PC1 Atopobiaceae_u_g -0.06084178 .05 Actinobacteria
PC1 [eubacterium] hallii group -0.04583858 .05 Firmicutes
PC1 Bifidobacterium.1 -0.058362006 .03 Actinobacteria
PC1 Microbacterium -0.07613624 .02 Actinobacteria
PC1 Peptostreptococcaceae_u_g -0.060091503 .02 Firmicutes
PC1 Lactobacillus -0.072195643 .04 Firmicutes
PC1 Pseudomonas 0.070547363 .04 Proteobacteria
PC1 Prevotellaceae ucg-0 0.06280752 .03 Bacteroidetes
PC2 Sutterella -0.150108825 .002 Proteobacteria
PC2 Anaerotruncus -0.144018332 .01 Firmicutes
PC3 Adlercreutzia 0.090900686 .02 Actinobacteria
PC3 Lachnospiraceae nc20 0.210532473 .01 Firmicutes
PC3 Ruminiclostridium 5 0.123899713 .03 Firmicutes
PC3 Lachnospira 0.110894885 .02 Firmicutes
PC3 Prevotellaceae ucg-0 0.111975769 .05 Bacteroidetes
PC4 Lactobacillus 0.139350294 .03 Firmicutes
PC5 Lachnospiraceae ucg -0.212478569 .02 Firmicutes
PC5 Sutterella 0.18979764 .001 Proteobacteria
PC5 Alistipes 0.158100809 .004 Bacteroidetes
PC5 Clostridium.3 0.148809797 .02 Firmicutes
PC5 Rikenellaceae_u_g 0.152656884 .02 Bacteroidetes
PC5 Parabacteroides.1 0.147262926 .02 Bacteroidetes

PC, principal component.

Supplementary Table 9. Correlation of Principal Component

to Metabolite

PC PC P
ID Metabolite ID Metabolite category coefficient value

PC2 C16:1 Fatty acid 0.12 .02

PC3 Aspartic acid, mg/ Amino acid -0.173007 .03
g
PC3 Methionine, mg/g Amino acid -0.114736 .03
PC3 Serine, mg/g Amino acid -0.13789 .03
PC4 Glutamine, mg/g Amino acid 0.21649 .001
PC4 Leucine/isoleucine, Amino acid 0.121938 .03
mg/g
PC4 Dopaquinone Untargeted_significant -0.148466 .04

PC, principal component.

- 2020 Manipulating Dietary Fat in UC 11.e18

Supplementary Table 10. Correlation of Microbiota to Metabolite

Metabolite Microbiome P Microbiome

Microbiome ID Metabolite ID category coefficient value phylum

Lactobacillaceae_u_g C18:3 Fatty acid 0.623 .0054 Firmicutes

Rumen C18:3 Fatty acid -0.547 .0049 Bacteroidetes
[Eubacterium] C6:0 Fatty acid 0.346 .0056 Firmicutes
[Eubacterium] C16:0 Fatty acid 0.464 .0030 Firmicutes
[Eubacterium] C18:1 Fatty acid 0.384 .0186 Firmicutes
[Eubacterium] C18:2 Fatty acid 0.515 .0017 Firmicutes
Acetitomaculum C16:1 Fatty acid 0.455 .0007 Firmicutes
Acetitomaculum C18:1 Fatty acid 0.412 .0027 Firmicutes
Acetitomaculum C18:2 Fatty acid 0.521 .0001 Firmicutes
Acetitomaculum C18:3 Fatty acid 0.502 .0001 Firmicutes
Lachnospiraceae, ucg C18:3 Fatty acid 0.328 .0300 Firmicutes
Bifidobacterium C6:0 Fatty acid 0.452 .0106 Actinobacteria
Dialister C4:0 Fatty acid -0.547 .0012 Firmicutes
Dialister C6:0 Fatty acid -0.386 .0037 Firmicutes
Dialister C16:0 Fatty acid -0.545 .0024 Firmicutes
Dialister C18:3 Fatty acid -0.407 .0238 Firmicutes
Turicibacter C8:0 Fatty acid 0.480 .0021 Firmicutes
Prevotella C18:1 Fatty acid -0.764 .0025 Bacteroidetes
Prevotella C18:3 Fatty acid -0.489 .0323 Bacteroidetes
Bacteroidales_u_g C18:3 Fatty acid -0.794 .0000 Bacteroidetes
Alistipes C18:3 Fatty acid -0.673 .0026 Bacteroidetes
Candidatus.5 C6:0 Fatty acid 0.461 .0039 Actinobacteria
Coprococcus C18:3 Fatty acid 0.510 .0098 Bacteria_u_p
Tyzzerella 3 C8:0 Fatty acid 0.626 .0000 Firmicutes
Tyzzerella 3 C18:3 Fatty acid 0.366 .0135 Firmicutes
Blautia C18:3 Fatty acid 0.533 .0003 Bacteria_u_p
Probable genus 10 C18:1 Fatty acid 0.437 .0103 Firmicutes
Probable genus 10 C18:2 Fatty acid 0.483 .0032 Firmicutes
Probable genus 10 C18:3 Fatty acid 0.608 .0003 Firmicutes
Eggerthellaceae_u_g C6:0 Fatty acid 0.413 .0055 Actinobacteria
Eggerthellaceae_u_g C8:0 Fatty acid 0.548 .0018 Actinobacteria
Family xiii_u_g C6:0 Fatty acid 0.594 .0004 Firmicutes
Coprobacillus C6:0 Fatty acid 0.331 .0113 Firmicutes
Subdoligranulum C6:0 Fatty acid 0.419 .0014 Firmicutes
Subdoligranulum C18:3 Fatty acid 0.460 .0059 Firmicutes
[Eubacterium] hallii group C18:3 Fatty acid 0.528 .0016 Firmicutes
Shuttleworthia C18:3 Fatty acid 0.437 .0273 Firmicutes
Dorea C18:3 Fatty acid 0.870 .0002 Firmicutes
Marvinbryantia C18:3 Fatty acid 0.396 .0068 Firmicutes
Clostridium.2 C18:3 Fatty acid -0.344 .0396 Firmicutes
Ruminiclostridium 5 C6:0 Fatty acid -0.408 .0106 Firmicutes
Bifidobacterium.1 C6:0 Fatty acid 0.569 .0013 Actinobacteria
Clostridioides C16:0 Fatty acid 0.521 .0020 Firmicutes
Clostridioides C18:1 Fatty acid 0.587 .0005 Firmicutes
Clostridioides C18:2 Fatty acid 0.666 .0001 Firmicutes
Veillonella.1 C6:0 Fatty acid -0.544 .0016 Firmicutes
Erysipelotrichaceae C4:0 Fatty acid 0.432 .0015 Firmicutes
Erysipelotrichaceae C8:0 Fatty acid 0.556 .0002 Firmicutes
Erysipelotrichaceae C18:3 Fatty acid 0.444 .0399 Firmicutes
Butyrivibrio C8:0 Fatty acid 0.486 .0027 Firmicutes
Butyrivibrio C18:3 Fatty acid 0.314 .0480 Firmicutes
Enorma C6:0 Fatty acid 0.350 .0089 Actinobacteria
Enorma C16:0 Fatty acid 0.554 .0029 Actinobacteria
Lachnospiraceae_u_g C8:0 Fatty acid 0.576 .0032 Firmicutes
Lachnospiraceae_u_g C18:3 Fatty acid 0.705 .0016 Firmicutes
Peptostreptococcaceae_u_g C4:0 Fatty acid 0.631 .0020 Firmicutes
Peptostreptococcaceae_u_g C6:0 Fatty acid 0.742 .0000 Firmicutes
Bacteroides C18:3 Fatty acid -0.391 .0219 Bacteroidetes
Lactobacillus C6:0 Fatty acid 0.483 .0076 Firmicutes
Lachnoclostridium C16:1 Fatty acid 0.697 .0007 Firmicutes
Lachnoclostridium C18:1 Fatty acid 0.503 .0059 Firmicutes
Lachnoclostridium C18:2 Fatty acid 0.695 .0015 Firmicutes
11.e19 Fritsch et al Clinical Gastroenterology and Hepatology Vol. -, No. -

Supplementary Table 10. Continued

Metabolite Microbiome P Microbiome

Microbiome ID Metabolite ID category coefficient value phylum

Lachnoclostridium C18:3 Fatty acid 0.657 .0024 Firmicutes

Peredibacter C16:1 Fatty acid -0.654 .0001 Proteobacteria
Peredibacter C18:1 Fatty acid -0.606 .0009 Proteobacteria
Peredibacter C18:2 Fatty acid -0.674 .0001 Proteobacteria
Blautia.1 C16:1 Fatty acid 0.654 .0002 Firmicutes
Blautia.1 C18:1 Fatty acid 0.596 .0004 Firmicutes
Blautia.1 C18:2 Fatty acid 0.653 .0005 Firmicutes
Blautia.1 C18:3 Fatty acid 0.606 .0012 Firmicutes
Ruminococcus 1 Tryptophan, mg/g Amino acid -0.373 .0495 Firmicutes
Lactobacillaceae_u_g y-amino-n-butyric acid, Amino acid -0.589 .0039 Firmicutes
mg/g
Lactobacillaceae_u_g Lysine, mg/g Amino acid 0.474 .0331 Firmicutes
[Eubacterium] Proline, mg/g Amino acid -0.255 .0328 Firmicutes
Acetitomaculum Taurine, mg/g Amino acid -0.258 .0023 Firmicutes
Acetitomaculum Arginine, mg/g Amino acid 0.324 .0016 Firmicutes
Acetitomaculum Lysine, mg/g Amino acid 0.391 .0015 Firmicutes
Lachnospiraceae ucg Arginine, mg/g Amino acid 0.357 .0039 Firmicutes
[Ruminococcus] gauvreauii group Citrulline, mg/g Amino acid 0.537 .0005 Firmicutes
[Ruminococcus] gauvreauii group Taurine, mg/g Amino acid -0.422 .0070 Firmicutes
[Ruminococcus] gauvreauii group Lysine, mg/g Amino acid 0.459 .0076 Firmicutes
Bifidobacterium Taurine, mg/g Amino acid -0.369 .0066 Actinobacteria
Bifidobacterium Lysine, mg/g Amino acid 0.498 .0194 Actinobacteria
Anaerostipes Alanine, mg/g Amino acid 0.453 .0179 Firmicutes
Anaerostipes Glycine, mg/g Amino acid 0.404 .0403 Firmicutes
Anaerostipes Taurine, mg/g Amino acid -0.463 .0041 Firmicutes
Anaerostipes y-amino-n-butyric acid, Amino acid -0.512 .0030 Firmicutes
mg/g
Anaerostipes Lysine, mg/g Amino acid 0.555 .0297 Firmicutes
Dialister Taurine, mg/g Amino acid 0.343 .0015 Firmicutes
Dialister Lysine, mg/g Amino acid -0.454 .0089 Firmicutes
Christensenellaceae Arginine, mg/g Amino acid -0.311 .0337 Firmicutes
Christensenellaceae Ornithine, mg/g Amino acid -0.319 .0112 Firmicutes
Bacillus Tryptophan, mg/g Amino acid 0.246 .0492 Firmicutes
Turicibacter Arginine, mg/g Amino acid 0.361 .0076 Firmicutes
Turicibacter Lysine, mg/g Amino acid 0.492 .0051 Firmicutes
Bacteroidales_u_g Methionine, mg/g Amino acid -0.315 .0130 Bacteroidetes
Bacteroidales_u_g Phenylalanine, mg/g Amino acid -0.393 .0048 Bacteroidetes
Bacteroidales_u_g Tyrosine, mg/g Amino acid -0.275 .0188 Bacteroidetes
Bacteroidales_u_g Arginine, mg/g Amino acid -0.361 .0087 Bacteroidetes
Enterococcus Glycine, mg/g Amino acid 0.291 .0196 Firmicutes
Enterococcus Tyrosine, mg/g Amino acid 0.217 .0488 Firmicutes
Alistipes Histidine, mg/g Amino acid -0.654 .0092 Bacteroidetes
Candidatus.5 Taurine, mg/g Amino acid -0.340 .0082 Actinobacteria
Candidatus.5 Lysine, mg/g Amino acid 0.513 .0080 Actinobacteria
Coprococcus Taurine, mg/g Amino acid -0.421 .0056 Bacteria_u_p
Mogibacterium Citrulline, mg/g Amino acid 0.621 .0002 Firmicutes
Mogibacterium Glutamic acid, mg/g Amino acid 0.414 .0149 Firmicutes
Mogibacterium Glycine, mg/g Amino acid 0.303 .0308 Firmicutes
Mogibacterium Lysine, mg/g Amino acid 0.422 .0149 Firmicutes
Streptococcus Serine, mg/g Amino acid 0.384 .0099 Firmicutes
Streptococcus Lysine, mg/g Amino acid 0.389 .0193 Firmicutes
Tyzzerella 3 Alanine, mg/g Amino acid 0.277 .0100 Firmicutes
Tyzzerella 3 Glutamic acid, mg/g Amino acid 0.327 .0128 Firmicutes
Tyzzerella 3 Glycine, mg/g Amino acid 0.304 .0063 Firmicutes
Tyzzerella 3 Proline, mg/g Amino acid 0.247 .0298 Firmicutes
Tyzzerella 3 Threonine, mg/g Amino acid 0.321 .0064 Firmicutes
Tyzzerella 3 Tyrosine, mg/g Amino acid 0.225 .0198 Firmicutes
Tyzzerella 3 Arginine, mg/g Amino acid 0.248 .0321 Firmicutes
Tyzzerella 3 Lysine, mg/g Amino acid 0.438 .0015 Firmicutes
Thermoactinomycetaceae_u_g Serine, mg/g Amino acid -0.485 .0226 Firmicutes
Blautia Alanine, mg/g Amino acid 0.251 .0150 Bacteria_u_p
Blautia Aspartic acid, mg/g Amino acid 0.418 .0052 Bacteria_u_p
- 2020 Manipulating Dietary Fat in UC 11.e20

Supplementary Table 10. Continued

Metabolite Microbiome P Microbiome

Microbiome ID Metabolite ID category coefficient value phylum

Blautia Citrulline, mg/g Amino acid 0.465 .0007 Bacteria_u_p

Blautia Glycine, mg/g Amino acid 0.250 .0204 Bacteria_u_p
Blautia Leucine/isoleucine, mg/g Amino acid 0.290 .0070 Bacteria_u_p
Blautia Methionine, mg/g Amino acid 0.231 .0181 Bacteria_u_p
Blautia Phenylalanine, mg/g Amino acid 0.282 .0087 Bacteria_u_p
Blautia Proline, mg/g Amino acid 0.235 .0297 Bacteria_u_p
Blautia Serine, mg/g Amino acid 0.327 .0056 Bacteria_u_p
Blautia Taurine, mg/g Amino acid -0.287 .0021 Bacteria_u_p
Blautia Threonine, mg/g Amino acid 0.347 .0017 Bacteria_u_p
Blautia Tyrosine, mg/g Amino acid 0.243 .0071 Bacteria_u_p
Blautia Arginine, mg/g Amino acid 0.308 .0035 Bacteria_u_p
Blautia Lysine, mg/g Amino acid 0.576 .0000 Bacteria_u_p
Probable genus 10 Taurine, mg/g Amino acid -0.334 .0024 Firmicutes
Probable genus 10 Arginine, mg/g Amino acid 0.362 .0033 Firmicutes
Probable genus 10 Lysine, mg/g Amino acid 0.449 .0032 Firmicutes
Lachnospiraceae nc20 Glutamic acid, mg/g Amino acid 0.378 .0135 Firmicutes
Lachnospiraceae nc20 Arginine, mg/g Amino acid 0.303 .0346 Firmicutes
Lachnospiraceae nd30 Ornithine, mg/g Amino acid -0.420 .0139 Firmicutes
Eggerthellaceae_u_g Taurine, mg/g Amino acid -0.406 .0010 Actinobacteria
Eggerthellaceae_u_g y-amino-n-butyric acid, Amino acid -0.420 .0082 Actinobacteria
mg/g
Eggerthellaceae_u_g Lysine, mg/g Amino acid 0.449 .0253 Actinobacteria
Eisenbergiella y-amino-n-butyric acid, Amino acid 0.601 .0047 Firmicutes
mg/g
Subdoligranulum y-amino-n-butyric acid, Amino acid -0.389 .0082 Firmicutes
mg/g
Subdoligranulum Lysine, mg/g Amino acid 0.575 .0058 Firmicutes
Oribacterium Citrulline, mg/g Amino acid 0.490 .0052 Firmicutes
Oribacterium Glutamic acid, mg/g Amino acid 0.441 .0143 Firmicutes
Oribacterium Lysine, mg/g Amino acid 0.414 .0251 Firmicutes
[Eubacterium] hallii group Lysine, mg/g Amino acid 0.413 .0214 Firmicutes
Thermoflavimicrobium Citrulline, mg/g Amino acid 0.389 .0037 Firmicutes
Thermoflavimicrobium Glycine, mg/g Amino acid 0.249 .0201 Firmicutes
Shuttleworthia y-amino-n-butyric acid, Amino acid -0.373 .0174 Firmicutes
mg/g
Desulfuromonas Tyrosine, mg/g Amino acid 0.252 .0456 Proteobacteria
Dorea Lysine, mg/g Amino acid 0.589 .0061 Firmicutes
Marvinbryantia Alanine, mg/g Amino acid 0.252 .0169 Firmicutes
Marvinbryantia Glycine, mg/g Amino acid 0.259 .0191 Firmicutes
Marvinbryantia Leucine/isoleucine, mg/g Amino acid 0.285 .0098 Firmicutes
Marvinbryantia Phenylalanine, mg/g Amino acid 0.271 .0133 Firmicutes
Marvinbryantia Serine, mg/g Amino acid 0.303 .0160 Firmicutes
Marvinbryantia Threonine, mg/g Amino acid 0.344 .0027 Firmicutes
Marvinbryantia Tyrosine, mg/g Amino acid 0.257 .0042 Firmicutes
Marvinbryantia Arginine, mg/g Amino acid 0.282 .0099 Firmicutes
Marvinbryantia Lysine, mg/g Amino acid 0.506 .0000 Firmicutes
Clostridium.2 Serine, mg/g Amino acid -0.379 .0040 Firmicutes
Clostridium.2 Threonine, mg/g Amino acid -0.319 .0136 Firmicutes
Clostridium.2 Lysine, mg/g Amino acid -0.346 .0352 Firmicutes
Clostridium.3 y-amino-n-butyric acid, Amino acid 0.498 .0061 Firmicutes
mg/g
Clostridium.3 Histidine, mg/g Amino acid 0.543 .0102 Firmicutes
Agathobacter Glutamine, mg/g Amino acid -0.365 .0376 Firmicutes
Clostridium.4 Ornithine, mg/g Amino acid -0.377 .0077 Firmicutes
Bifidobacterium.1 Histidine, mg/g Amino acid -0.472 .0072 Actinobacteria
Microbacterium Taurine, mg/g Amino acid -0.403 .0083 Actinobacteria
Microbacterium Histidine, mg/g Amino acid -0.493 .0105 Actinobacteria
Flavonifractor Lysine, mg/g Amino acid -0.538 .0102 Firmicutes
Ruminococcaceae ucg Arginine, mg/g Amino acid -0.328 .0189 Firmicutes
Ruminococcaceae ucg Histidine, mg/g Amino acid -0.467 .0055 Firmicutes
Salibacterium Tryptophan, mg/g Amino acid 0.334 .0439 Firmicutes
[Eubacterium] oxidoreducens group Tryptophan, mg/g Amino acid -0.271 .0446 Firmicutes
11.e21 Fritsch et al Clinical Gastroenterology and Hepatology Vol. -, No. -

Supplementary Table 10. Continued

Metabolite Microbiome P Microbiome

Microbiome ID Metabolite ID category coefficient value phylum

Rikenellaceae_u_g Arginine, mg/g Amino acid -0.412 .0046 Bacteroidetes

Trichococcus Alanine, mg/g Amino acid 0.290 .0492 Firmicutes
Trichococcus Glycine, mg/g Amino acid 0.326 .0279 Firmicutes
Trichococcus Phenylalanine, mg/g Amino acid 0.344 .0133 Firmicutes
Trichococcus Taurine, mg/g Amino acid 0.358 .0010 Firmicutes
Trichococcus Tyrosine, mg/g Amino acid 0.264 .0212 Firmicutes
Trichococcus Valine, mg/g Amino acid 0.413 .0056 Firmicutes
Trichococcus Tryptophan, mg/g Amino acid 0.388 .0111 Firmicutes
Veillonella.1 Taurine, mg/g Amino acid 0.389 .0099 Firmicutes
Collinsella Proline, mg/g Amino acid -0.458 .0163 Actinobacteria
Collinsella Ornithine, mg/g Amino acid 0.316 .0044 Actinobacteria
Erysipelotrichaceae Alanine, mg/g Amino acid 0.491 .0020 Firmicutes
Erysipelotrichaceae Glycine, mg/g Amino acid 0.499 .0028 Firmicutes
Erysipelotrichaceae Leucine/isoleucine, mg/g Amino acid 0.593 .0003 Firmicutes
Erysipelotrichaceae Methionine, mg/g Amino acid 0.386 .0141 Firmicutes
Erysipelotrichaceae Phenylalanine, mg/g Amino acid 0.430 .0103 Firmicutes
Erysipelotrichaceae Threonine, mg/g Amino acid 0.510 .0049 Firmicutes
Erysipelotrichaceae Tyrosine, mg/g Amino acid 0.401 .0044 Firmicutes
Erysipelotrichaceae Valine, mg/g Amino acid 0.508 .0045 Firmicutes
Erysipelotrichaceae Arginine, mg/g Amino acid 0.360 .0137 Firmicutes
Erysipelotrichaceae Lysine, mg/g Amino acid 0.638 .0028 Firmicutes
Butyrivibrio Alanine, mg/g Amino acid 0.456 .0000 Firmicutes
Butyrivibrio Citrulline, mg/g Amino acid 0.573 .0001 Firmicutes
Butyrivibrio Glutamic acid, mg/g Amino acid 0.414 .0027 Firmicutes
Butyrivibrio Glutamine, mg/g Amino acid 0.207 .0208 Firmicutes
Butyrivibrio Glycine, mg/g Amino acid 0.497 .0000 Firmicutes
Butyrivibrio Leucine/isoleucine, mg/g Amino acid 0.438 .0002 Firmicutes
Butyrivibrio Methionine, mg/g Amino acid 0.367 .0005 Firmicutes
Butyrivibrio Phenylalanine, mg/g Amino acid 0.431 .0002 Firmicutes
Butyrivibrio Proline, mg/g Amino acid 0.422 .0002 Firmicutes
Butyrivibrio Serine, mg/g Amino acid 0.506 .0000 Firmicutes
Butyrivibrio Threonine, mg/g Amino acid 0.499 .0000 Firmicutes
Butyrivibrio Tyrosine, mg/g Amino acid 0.347 .0006 Firmicutes
Butyrivibrio Valine, mg/g Amino acid 0.488 .0001 Firmicutes
Butyrivibrio Lysine, mg/g Amino acid 0.351 .0241 Firmicutes
Lachnospiraceae_u_g Arginine, mg/g Amino acid 0.489 .0013 Firmicutes
Faecalibacterium Glutamine, mg/g Amino acid -0.350 .0156 Firmicutes
Faecalibacterium y-amino-n-butyric acid, Amino acid -0.759 .0000 Firmicutes
mg/g
Ruminococcaceae_u_g Glutamine, mg/g Amino acid -0.250 .0447 Firmicutes
Ruminococcaceae_u_g Arginine, mg/g Amino acid -0.416 .0094 Firmicutes
Ruminococcaceae_u_g Histidine, mg/g Amino acid -0.559 .0037 Firmicutes
Peptostreptococcaceae_u_g Lysine, mg/g Amino acid 0.460 .0223 Firmicutes
Bacteroides Alanine, mg/g Amino acid -0.295 .0276 Bacteroidetes
Bacteroides Glycine, mg/g Amino acid -0.340 .0143 Bacteroidetes
Bacteroides Serine, mg/g Amino acid -0.340 .0277 Bacteroidetes
Bacteroides Threonine, mg/g Amino acid -0.445 .0020 Bacteroidetes
Bacteroides Lysine, mg/g Amino acid -0.528 .0014 Bacteroidetes
Ruminiclostridium Arginine, mg/g Amino acid -0.281 .0419 Firmicutes
Oscillospira Glutamine, mg/g Amino acid -0.246 .0095 Firmicutes
Oscillospira Threonine, mg/g Amino acid -0.356 .0123 Firmicutes
Lachnospiraceae nk4a Citrulline, mg/g Amino acid 0.405 .0046 Firmicutes
Lachnospiraceae nk4a Taurine, mg/g Amino acid -0.311 .0050 Firmicutes
Lachnospiraceae nk4a Arginine, mg/g Amino acid 0.305 .0150 Firmicutes
Lachnospiraceae nk4a Lysine, mg/g Amino acid 0.597 .0000 Firmicutes
Planococcaceae_u_g Taurine, mg/g Amino acid 0.268 .0077 Firmicutes
Bacteria_u_g Citrulline, mg/g Amino acid 0.558 .0009 Bacteria_u_p
Bacteria_u_g Glutamic acid, mg/g Amino acid 0.464 .0060 Bacteria_u_p
Bacteria_u_g Methionine, mg/g Amino acid 0.325 .0188 Bacteria_u_p
Bacteria_u_g Lysine, mg/g Amino acid 0.499 .0031 Bacteria_u_p
Lachnoclostridium Alanine, mg/g Amino acid 0.354 .0273 Firmicutes
Lachnoclostridium Methionine, mg/g Amino acid 0.470 .0009 Firmicutes
- 2020 Manipulating Dietary Fat in UC 11.e22

Supplementary Table 10. Continued

Metabolite Microbiome P Microbiome

Microbiome ID Metabolite ID category coefficient value phylum

Lachnoclostridium Phenylalanine, mg/g Amino acid 0.497 .0016 Firmicutes

Lachnoclostridium Proline, mg/g Amino acid 0.333 .0410 Firmicutes
Lachnoclostridium Serine, mg/g Amino acid 0.453 .0045 Firmicutes
Lachnoclostridium Threonine, mg/g Amino acid 0.392 .0172 Firmicutes
Lachnoclostridium Tyrosine, mg/g Amino acid 0.462 .0018 Firmicutes
Lachnoclostridium Arginine, mg/g Amino acid 0.503 .0005 Firmicutes
Lachnoclostridium Lysine, mg/g Amino acid 0.477 .0045 Firmicutes
Lachnoclostridium Histidine, mg/g Amino acid 0.630 .0001 Firmicutes
[Eubacterium] coprostanoligenes group Glutamine, mg/g Amino acid -0.259 .0439 Firmicutes
Butyricicoccus.1 Arginine, mg/g Amino acid 0.337 .0011 Firmicutes
Butyricicoccus.1 Lysine, mg/g Amino acid 0.324 .0141 Firmicutes
Parabacteroides.1 Lysine, mg/g Amino acid -0.501 .0268 Bacteroidetes
Blautia.1 Aspartic acid, mg/g Amino acid 0.575 .0002 Firmicutes
Blautia.1 Glutamic acid, mg/g Amino acid 0.546 .0006 Firmicutes
Blautia.1 Methionine, mg/g Amino acid 0.378 .0026 Firmicutes
Blautia.1 Phenylalanine, mg/g Amino acid 0.367 .0089 Firmicutes
Blautia.1 Proline, mg/g Amino acid 0.317 .0236 Firmicutes
Blautia.1 Serine, mg/g Amino acid 0.369 .0130 Firmicutes
Blautia.1 Taurine, mg/g Amino acid -0.336 .0057 Firmicutes
Blautia.1 Threonine, mg/g Amino acid 0.328 .0241 Firmicutes
Blautia.1 Tyrosine, mg/g Amino acid 0.334 .0068 Firmicutes
Blautia.1 y-amino-n-butyric acid, Amino acid 0.331 .0363 Firmicutes
mg/g
Blautia.1 Arginine, mg/g Amino acid 0.314 .0202 Firmicutes
Blautia.1 Lysine, mg/g Amino acid 0.574 .0002 Firmicutes
Phormidium Tryptophan, mg/g Amino acid -0.249 .0460 Cyanobacteria
Fusicatenibacter Glutamic acid, mg/g Amino acid 0.483 .0084 Firmicutes
Fusicatenibacter y-amino-n-butyric acid, Amino acid -0.420 .0094 Firmicutes
mg/g
Fusicatenibacter Arginine, mg/g Amino acid 0.349 .0166 Firmicutes
Fusicatenibacter Lysine, mg/g Amino acid 0.668 .0011 Firmicutes
[Eubacterium] DCA, ug/g feces Bile acid 0.457 .0016 Firmicutes
Dialister LCA, ug/g feces Bile acid -0.623 .0003 Firmicutes
Family xiii_u_g LCA, ug/g feces Bile acid 0.524 .0009 Firmicutes
Trichococcus LCA, ug/g feces Bile acid -0.728 .0006 Firmicutes
Peptostreptococcaceae_u_g LCA, ug/g feces Bile acid 0.622 .0009 Firmicutes
Planococcaceae_u_g DCA, ug/g feces Bile acid -0.599 .0006 Firmicutes
Planococcaceae_u_g LCA, ug/g feces Bile acid -0.584 .0008 Firmicutes
Lactobacillaceae_u_g Propionic acid SCFA1 0.761 .0001 Firmicutes
Family xiii_u_g Acetic acid SCFA1 0.593 .0001 Firmicutes
Family xiii_u_g Propionic acid SCFA1 0.564 .0000 Firmicutes
Ruminococcus 1 Valeric acid SCFA2 0.450 .0026 Firmicutes
Bacteroidales_u_g Isovaleric acid SCFA2 0.493 .0001 Bacteroidetes
Mogibacterium Acetic acid SCFA2 0.463 .0002 Firmicutes
Ruminococcus Valeric acid SCFA2 0.424 .0026 Firmicutes
Eggerthellaceae_u_g Butyric acid SCFA2 0.428 .0006 Actinobacteria
Eggerthellaceae_u_g Valeric acid SCFA2 0.500 .0001 Actinobacteria
Family xiii_u_g Acetic acid SCFA2 0.506 .0001 Firmicutes
Family xiii_u_g Butyric acid SCFA2 0.444 .0002 Firmicutes
Family xiii_u_g Valeric acid SCFA2 0.559 .0001 Firmicutes
Subdoligranulum Valeric acid SCFA2 0.457 .0002 Firmicutes
[Eubacterium] hallii group Valeric acid SCFA2 0.448 .0003 Firmicutes
Lachnospiraceae_u_g Acetic acid SCFA2 0.483 .0004 Firmicutes
Faecalibacterium Isovaleric acid SCFA2 -0.396 .0023 Firmicutes
Lachnospiraceae nk4a Acetic acid SCFA2 0.430 .0005 Firmicutes
[Eubacterium] coprostanoligenes group Valeric acid SCFA2 0.539 .0000 Firmicutes
[Eubacterium] coprostanoligenes group Isovaleric acid SCFA2 0.441 .0011 Firmicutes
[Eubacterium] a-linolenic acid Untargeted_significant 0.648 .0000 Firmicutes
Dialister a-linolenic acid Untargeted_significant -0.387 .0343 Firmicutes
Turicibacter a-linolenic acid Untargeted_significant 0.408 .0134 Firmicutes
Sutterella a-linolenic acid Untargeted_significant 0.484 .0375 Proteobacteria
Enterococcus a-linolenic acid Untargeted_significant 0.409 .0240 Firmicutes
11.e23 Fritsch et al Clinical Gastroenterology and Hepatology Vol. -, No. -

Supplementary Table 10. Continued

Metabolite Microbiome P Microbiome

Microbiome ID Metabolite ID category coefficient value phylum

Blautia Dopaquinone Untargeted_sgnf 0.393 .0076 Bacteria_u_p

Lachnospiraceae nc20 a-linolenic acid Untargeted_sgnf 0.364 .0357 Firmicutes
Desulfuromonas a-linolenic acid Untargeted_sgnf -0.466 .0119 Proteobacteria
Marvinbryantia Dopaquinone Untargeted_sgnf 0.436 .0067 Firmicutes
Microbacterium Dopaquinone Untargeted_sgnf 0.452 .0062 Actinobacteria
Salibacterium a-linolenic acid Untargeted_sgnf -0.661 .0042 Firmicutes
Clostridioides a-linolenic acid Untargeted_sgnf 0.632 .0006 Firmicutes
Erysipelotrichaceae a-linolenic acid Untargeted_sgnf 0.452 .0100 Firmicutes
Bacteroides Dopaquinone Untargeted_sgnf -0.669 .0009 Bacteroidetes
Lachnospiraceae nk4a a-linolenic acid Untargeted_sgnf 0.311 .0334 Firmicutes
Lachnoclostridium a-linolenic acid Untargeted_sgnf 0.418 .0061 Firmicutes
Butyricicoccus.1 a-linolenic acid Untargeted_sgnf 0.291 .0417 Firmicutes
Peredibacter a-linolenic acid Untargeted_sgnf -0.621 .0004 Proteobacteria

DCA, deoxycholic acid; LCA, lithocholic acid; SCFA, short-chain fatty acid.
- 2020 Manipulating Dietary Fat in UC 11.e24

Supplementary Table 11. Correlation of Metabolites to Microbiota

Microbiome Metabolite Metabolite P

Metabolite Metabolite category Microbiome ID phylum coefficient value

C8:0 Fatty acid Lactobacillaceae_u_g Firmicutes 0.3106 .01

C16:1 Fatty acid Lactobacillaceae_u_g Firmicutes 0.2638 .023
C18:2 Fatty acid Lactobacillaceae_u_g Firmicutes 0.2671 .020
C18:3 Fatty acid Lactobacillaceae_u_g Firmicutes 0.3479 .006
C18:3 Fatty acid Rumen Bacteroidetes -0.3927 .003
C18:2 Fatty acid [Eubacterium] Firmicutes 0.5517 .001
C18:2 Fatty acid Acetitomaculum Firmicutes 0.7077 .0004
C18:3 Fatty acid Acetitomaculum Firmicutes 0.8216 .001
C8:0 Fatty acid Lachnospiraceae, ucg Firmicutes 0.3316 .037
C18:3 Fatty acid Lachnospiraceae, ucg Firmicutes 0.4000 .017
C4:0 Fatty acid Bifidobacterium Actinobacteria 0.4046 .001
C6:0 Fatty acid Bifidobacterium Actinobacteria 0.5145 .004
C8:0 Fatty acid Anaerostipes Firmicutes 0.3507 .0002
C18:3 Fatty acid Anaerostipes Firmicutes 0.3112 .006
C4:0 Fatty acid Dialister Firmicutes -0.5269 .001
C8:0 Fatty acid Dialister Firmicutes -0.3912 .008
C14:0 Fatty acid Dialister Firmicutes -0.4239 .004
C16:0 Fatty acid Dialister Firmicutes -0.4577 .004
C16:1 Fatty acid Dialister Firmicutes -0.3757 .009
C18:0 Fatty acid Dialister Firmicutes -0.4512 .007
C16:0 Fatty acid Prevotella Bacteroidetes -0.2763 .003
C18:0 Fatty acid Prevotella Bacteroidetes -0.2602 .007
C18:1 Fatty acid Prevotella Bacteroidetes -0.2823 .003
C18:2 Fatty acid Prevotella Bacteroidetes -0.2446 .008
C18:3 Fatty acid Bacteroidales_u_g Bacteroidetes -0.7018 .000
C4:0 Fatty acid Alistipes Bacteroidetes -0.1797 .045
C16:0 Fatty acid Alistipes Bacteroidetes -0.1983 .032
C16:1 Fatty acid Alistipes Bacteroidetes -0.1950 .038
C18:0 Fatty acid Alistipes Bacteroidetes -0.2079 .027
C18:1 Fatty acid Alistipes Bacteroidetes -0.1888 .044
C18:3 Fatty acid Alistipes Bacteroidetes -0.2708 .006
C4:0 Fatty acid Candidatus.5 Actinobacteria 0.4802 .0002
C6:0 Fatty acid Candidatus.5 Actinobacteria 0.5601 .004
C16:0 Fatty acid Candidatus.5 Actinobacteria 0.4050 .003
C16:0 Fatty acid Coprococcus Bacteria_u_p 0.2734 .025
C18:0 Fatty acid Coprococcus Bacteria_u_p 0.3154 .011
C18:1 Fatty acid Coprococcus Bacteria_u_p 0.2535 .042
C18:2 Fatty acid Coprococcus Bacteria_u_p 0.3082 .009
C18:3 Fatty acid Coprococcus Bacteria_u_p 0.3345 .010
C4:0 Fatty acid Tyzzerella 3 Firmicutes 0.4640 .015
C8:0 Fatty acid Tyzzerella 3 Firmicutes 0.6643 .000
C14:0 Fatty acid Tyzzerella 3 Firmicutes 0.3440 .049
C16:0 Fatty acid Tyzzerella 3 Firmicutes 0.3900 .029
C18:0 Fatty acid Tyzzerella 3 Firmicutes 0.4449 .015
C18:2 Fatty acid Tyzzerella 3 Firmicutes 0.3872 .024
C18:3 Fatty acid Tyzzerella 3 Firmicutes 0.4612 .014
C4:0 Fatty acid Thermoactinomycetaceae_u_g Firmicutes 0.2937 .046
C16:0 Fatty acid Thermoactinomycetaceae_u_g Firmicutes 0.3966 .007
C18:0 Fatty acid Thermoactinomycetaceae_u_g Firmicutes 0.4360 .004
C18:3 Fatty acid Blautia Bacteria_u_p 0.7794 .000
C16:1 Fatty acid Adlercreutzia Actinobacteria -0.2171 .021
C18:1 Fatty acid Probable genus 10 Firmicutes 0.4084 .017
C18:2 Fatty acid Probable genus 10 Firmicutes 0.4594 .004
C18:3 Fatty acid Probable genus 10 Firmicutes 0.6597 .000
C8:0 Fatty acid Ruminococcus Firmicutes 0.3274 .011
C18:2 Fatty acid Ruminococcus Firmicutes 0.3531 .010
C8:0 Fatty acid Lachnospiraceae nd30 Firmicutes 0.2754 .002
C4:0 Fatty acid Atopobiaceae_u_g Actinobacteria 0.3798 .004
C6:0 Fatty acid Atopobiaceae_u_g Actinobacteria 0.4939 .009
C8:0 Fatty acid Atopobiaceae_u_g Actinobacteria 0.3228 .012
C16:0 Fatty acid Atopobiaceae_u_g Actinobacteria 0.4417 .001
C18:0 Fatty acid Atopobiaceae_u_g Actinobacteria 0.4227 .002
11.e25 Fritsch et al Clinical Gastroenterology and Hepatology Vol. -, No. -

Supplementary Table 11. Continued

Microbiome Metabolite Metabolite P

Metabolite Metabolite category Microbiome ID phylum coefficient value

C4:0 Fatty acid Eggerthellaceae_u_g Actinobacteria 0.4303 .002

C6:0 Fatty acid Eggerthellaceae_u_g Actinobacteria 0.4941 .007
C8:0 Fatty acid Eggerthellaceae_u_g Actinobacteria 0.3990 .006
C4:0 Fatty acid Family xiii_u_g Firmicutes 0.2854 .003
C6:0 Fatty acid Family xiii_u_g Firmicutes 0.4505 .002
C4:0 Fatty acid Subdoligranulum Firmicutes 0.5029 .001
C6:0 Fatty acid Subdoligranulum Firmicutes 0.6302 .002
C18:3 Fatty acid Subdoligranulum Firmicutes 0.5292 .001
C12:0 Fatty acid Oribacterium Firmicutes 0.2698 .019
C14:0 Fatty acid Oribacterium Firmicutes 0.2630 .029
C18:2 Fatty acid [Eubacterium] hallii group Firmicutes 0.4388 .006
C18:3 Fatty acid [Eubacterium] hallii group Firmicutes 0.5974 .0003
C6:0 Fatty acid Thermoflavimicrobium Firmicutes 0.6202 .002
C8:0 Fatty acid Thermoflavimicrobium Firmicutes 0.5235 .004
C18:3 Fatty acid Dorea Firmicutes 0.5686 .00001
C6:0 Fatty acid Ruminiclostridium 5 Firmicutes -0.4696 .010
C4:0 Fatty acid Bifidobacterium.1 Actinobacteria 0.4530 .0002
C6:0 Fatty acid Bifidobacterium.1 Actinobacteria 0.6256 .0005
C18:0 Fatty acid Bifidobacterium.1 Actinobacteria 0.3741 .006
C6:0 Fatty acid Microbacterium Actinobacteria 0.3301 .039
C8:0 Fatty acid Microbacterium Actinobacteria 0.2401 .034
C18:0 Fatty acid Microbacterium Actinobacteria 0.2557 .033
C14:0 Fatty acid Salibacterium Firmicutes 0.2689 .048
C8:0 Fatty acid [Eubacterium] oxidoreducens Firmicutes 0.4332 .006
group
C18:3 Fatty acid Rikenellaceae_u_g Bacteroidetes -0.2638 .017
C16:0 Fatty acid Clostridioides Firmicutes 0.4697 .002
C16:1 Fatty acid Clostridioides Firmicutes 0.4459 .003
C18:1 Fatty acid Clostridioides Firmicutes 0.5206 .001
C18:2 Fatty acid Clostridioides Firmicutes 0.5844 .0001
C4:0 Fatty acid Veillonella.1 Firmicutes -0.3416 .003
C6:0 Fatty acid Veillonella.1 Firmicutes -0.4842 .002
C4:0 Fatty acid Collinsella Actinobacteria 0.5020 .001
C18:3 Fatty acid Erysipelotrichaceae Firmicutes 0.4146 .002
C8:0 Fatty acid Butyrivibrio Firmicutes 0.4544 .006
C4:0 Fatty acid Enorma Actinobacteria 0.5504 .001
C16:0 Fatty acid Enorma Actinobacteria 0.6004 .0003
C18:0 Fatty acid Enorma Actinobacteria 0.6070 .0004
C4:0 Fatty acid Lachnospiraceae_u_g Firmicutes 0.3204 .023
C8:0 Fatty acid Lachnospiraceae_u_g Firmicutes 0.3704 .005
C18:2 Fatty acid Lachnospiraceae_u_g Firmicutes 0.3141 .024
C18:3 Fatty acid Lachnospiraceae_u_g Firmicutes 0.5325 .001
C16:1 Fatty acid Faecalibacterium Firmicutes 0.2752 .011
C4:0 Fatty acid Peptostreptococcaceae_u_g Firmicutes 0.4531 .0003
C6:0 Fatty acid Peptostreptococcaceae_u_g Firmicutes 0.6748 .000001
C8:0 Fatty acid Bacteroides Bacteroidetes -0.3427 .022
C16:0 Fatty acid Bacteroides Bacteroidetes -0.3261 .037
C18:0 Fatty acid Bacteroides Bacteroidetes -0.3334 .038
C18:2 Fatty acid Bacteroides Bacteroidetes -0.3635 .017
C18:3 Fatty acid Bacteroides Bacteroidetes -0.4115 .012
C4:0 Fatty acid Lactobacillus Firmicutes 0.2617 .029
C6:0 Fatty acid Lactobacillus Firmicutes 0.3980 .009
C8:0 Fatty acid Lactobacillus Firmicutes 0.2403 .039
C18:2 Fatty acid Bacteria_u_g Bacteria_u_p 0.3459 .013
C18:3 Fatty acid Bacteria_u_g Bacteria_u_p 0.3284 .030
C16:1 Fatty acid Lachnoclostridium Firmicutes 0.4413 .0001
C18:2 Fatty acid Lachnoclostridium Firmicutes 0.4432 .00004
C18:3 Fatty acid Lachnoclostridium Firmicutes 0.4832 .00004
C4:0 Fatty acid Pseudomonas Proteobacteria -0.4392 .013
C16:0 Fatty acid Pseudomonas Proteobacteria -0.4551 .010
C16:0 Fatty acid Lachnospira Firmicutes -0.2078 .038
C18:1 Fatty acid Parabacteroides.1 Bacteroidetes -0.2143 .044
- 2020 Manipulating Dietary Fat in UC 11.e26

Supplementary Table 11. Continued

Microbiome Metabolite Metabolite P

Metabolite Metabolite category Microbiome ID phylum coefficient value

C18:3 Fatty acid Parabacteroides.1 Bacteroidetes -0.2403 .029

C12:0 Fatty acid Anaerotruncus Firmicutes 0.3601 .007
C14:0 Fatty acid Anaerotruncus Firmicutes 0.4369 .001
C16:0 Fatty acid Peredibacter Proteobacteria -0.3291 .044
C16:1 Fatty acid Peredibacter Proteobacteria -0.5577 .0001
C18:1 Fatty acid Peredibacter Proteobacteria -0.5319 .001
C18:2 Fatty acid Peredibacter Proteobacteria -0.5798 .0001
C16:1 Fatty acid Blautia.1 Firmicutes 0.5332 .0002
C18:1 Fatty acid Blautia.1 Firmicutes 0.4998 .001
C18:2 Fatty acid Blautia.1 Firmicutes 0.5320 .0001
C18:3 Fatty acid Blautia.1 Firmicutes 0.5728 .0002
C16:1 Fatty acid Fusicatenibacter Firmicutes 0.4440 .003
C18:2 Fatty acid Fusicatenibacter Firmicutes 0.4875 .0003
Taurine, mg/g Amino acid Lactobacillaceae_u_g Firmicutes -0.3645 .019
y-amino-n-butyric acid, Amino acid Lactobacillaceae_u_g Firmicutes -0.3777 .004
mg/g
Taurine, mg/g Amino acid Peptoclostridium Firmicutes 0.5705 .004
Arginine, mg/g Amino acid Acetitomaculum Firmicutes 0.8137 .0004
Lysine, mg/g Amino acid Acetitomaculum Firmicutes 0.6493 .001
Arginine, mg/g Amino acid Lachnospiraceae ucg Firmicutes 0.6472 .002
Taurine, mg/g Amino acid Bifidobacterium Actinobacteria -0.5548 .006
Lysine, mg/g Amino acid Bifidobacterium Actinobacteria 0.4573 .001
Alanine, mg/g Amino acid Anaerostipes Firmicutes 0.3854 .016
Citrulline, mg/g Amino acid Anaerostipes Firmicutes 0.2531 .027
Glycine, mg/g Amino acid Anaerostipes Firmicutes 0.3351 .029
Leucine/isoleucine, Amino acid Anaerostipes Firmicutes 0.3284 .032
mg/g
Taurine, mg/g Amino acid Anaerostipes Firmicutes -0.4770 .005
Threonine, mg/g Amino acid Anaerostipes Firmicutes 0.3701 .014
y-amino-n-butyric acid, Amino acid Anaerostipes Firmicutes -0.2798 .033
mg/g
Arginine, mg/g Amino acid Anaerostipes Firmicutes 0.3712 .019
Lysine, mg/g Amino acid Anaerostipes Firmicutes 0.3673 .002
y-amino-n-butyric acid, Amino acid Christensenellaceae Firmicutes 0.3222 .017
mg/g
Ornithine, mg/g Amino acid Christensenellaceae Firmicutes -0.2904 .040
Lysine, mg/g Amino acid Turicibacter Firmicutes 0.5069 .002
Citrulline, mg/g Amino acid Prevotella Bacteroidetes -0.2455 .013
Arginine, mg/g Amino acid Bacteroidales_u_g Bacteroidetes -0.4784 .008
Lysine, mg/g Amino acid Candidatus.5 Actinobacteria 0.4940 .002
Citrulline, mg/g Amino acid Coprococcus Bacteria_u_p 0.2904 .027
Taurine, mg/g Amino acid Coprococcus Bacteria_u_p -0.4930 .005
Lysine, mg/g Amino acid Coprococcus Bacteria_u_p 0.3132 .026
Citrulline, mg/g Amino acid Mogibacterium Firmicutes 0.5668 .0002
Citrulline, mg/g Amino acid Tyzzerella 3 Firmicutes 0.4339 .024
Glutamic acid, mg/g Amino acid Tyzzerella 3 Firmicutes 0.4214 .038
Taurine, mg/g Amino acid Tyzzerella 3 Firmicutes -0.5817 .007
Lysine, mg/g Amino acid Tyzzerella 3 Firmicutes 0.5758 .003
Phenylalanine, mg/g Amino acid Thermoactinomycetaceae_u_g Firmicutes -0.4142 .045
Proline, mg/g Amino acid Thermoactinomycetaceae_u_g Firmicutes -0.4779 .030
Serine, mg/g Amino acid Thermoactinomycetaceae_u_g Firmicutes -0.6547 .027
Valine, mg/g Amino acid Thermoactinomycetaceae_u_g Firmicutes -0.4071 .039
Ornithine, mg/g Amino acid Thermoactinomycetaceae_u_g Firmicutes 0.3863 .027
Citrulline, mg/g Amino acid Blautia Bacteria_u_p 0.6930 .001
Taurine, mg/g Amino acid Blautia Bacteria_u_p -0.7443 .001
Lysine, mg/g Amino acid Blautia Bacteria_u_p 0.8989 .000002
Histidine, mg/g Amino acid Adlercreutzia Actinobacteria -0.1955 .030
Taurine, mg/g Amino acid Probable genus 10 Firmicutes -0.6610 .004
Arginine, mg/g Amino acid Probable genus 10 Firmicutes 0.6440 .003
Lysine, mg/g Amino acid Probable genus 10 Firmicutes 0.5328 .003
Citrulline, mg/g Amino acid Ruminococcus Firmicutes 0.3732 .012
Arginine, mg/g Amino acid Lachnospiraceae nc20 Firmicutes 0.5101 .009
11.e27 Fritsch et al Clinical Gastroenterology and Hepatology Vol. -, No. -

Supplementary Table 11. Continued

Microbiome Metabolite Metabolite P

Metabolite Metabolite category Microbiome ID phylum coefficient value

Citrulline, mg/g Amino acid Atopobiaceae_u_g Actinobacteria 0.3514 .018

Ornithine, mg/g Amino acid Atopobiaceae_u_g Actinobacteria 0.3825 .017
Taurine, mg/g Amino acid Eggerthellaceae_u_g Actinobacteria -0.6552 .001
y-amino-n-butyric acid, Amino acid Eggerthellaceae_u_g Actinobacteria -0.4168 .014
mg/g
Lysine, mg/g Amino acid Eggerthellaceae_u_g Actinobacteria 0.4362 .012
y-amino-n-butyric acid, Amino acid Eisenbergiella Firmicutes 0.3622 .002
mg/g
Aspartic acid, mg/g Amino acid Subdoligranulum Firmicutes 0.4866 .003
Citrulline, mg/g Amino acid Subdoligranulum Firmicutes 0.5236 .003
Lysine, mg/g Amino acid Subdoligranulum Firmicutes 0.6432 .001
Citrulline, mg/g Amino acid Oribacterium Firmicutes 0.3850 .007
Glutamic acid, mg/g Amino acid Oribacterium Firmicutes 0.3803 .014
Ornithine, mg/g Amino acid Oribacterium Firmicutes 0.3986 .014
Aspartic acid, mg/g Amino acid [Eubacterium] hallii group Firmicutes 0.4829 .004
Citrulline, mg/g Amino acid [Eubacterium] hallii group Firmicutes 0.5424 .002
Citrulline, mg/g Amino acid Thermoflavimicrobium Firmicutes 0.5779 .004
Citrulline, mg/g Amino acid Dorea Firmicutes 0.4040 .004
Lysine, mg/g Amino acid Dorea Firmicutes 0.4673 .001
Lysine, mg/g Amino acid Marvinbryantia Firmicutes 0.7751 .0001
Taurine, mg/g Amino acid Clostridium.3 Firmicutes 0.4194 .014
Lysine, mg/g Amino acid Clostridium.3 Firmicutes -0.2607 .047
Citrulline, mg/g Amino acid Microbacterium Actinobacteria 0.2553 .042
Taurine, mg/g Amino acid Microbacterium Actinobacteria -0.4722 .008
Lysine, mg/g Amino acid Microbacterium Actinobacteria 0.3205 .015
Citrulline, mg/g Amino acid Flavonifractor Firmicutes -0.3399 .008
Lysine, mg/g Amino acid Flavonifractor Firmicutes -0.3348 .011
Tryptophan, mg/g Amino acid Salibacterium Firmicutes 0.3428 .046
Arginine, mg/g Amino acid Rikenellaceae_u_g Bacteroidetes -0.3998 .01
Lysine, mg/g Amino acid Rikenellaceae_u_g Bacteroidetes -0.2808 .02
Alanine, mg/g Amino acid Trichococcus Firmicutes 0.6435 .001
Glycine, mg/g Amino acid Trichococcus Firmicutes 0.6361 .001
Phenylalanine, mg/g Amino acid Trichococcus Firmicutes 0.6200 .002
Proline, mg/g Amino acid Trichococcus Firmicutes 0.5419 .01
Tyrosine, mg/g Amino acid Trichococcus Firmicutes 0.6083 .01
Valine, mg/g Amino acid Trichococcus Firmicutes 0.6099 .001
Tryptophan, mg/g Amino acid Trichococcus Firmicutes 0.5698 .003
Proline, mg/g Amino acid Collinsella Actinobacteria -0.8305 .001
Citrulline, mg/g Amino acid Erysipelotrichaceae Firmicutes 0.4413 .0005
Leucine/isoleucine, Amino acid Erysipelotrichaceae Firmicutes 0.6415 .0002
mg/g
Threonine, mg/g Amino acid Erysipelotrichaceae Firmicutes 0.5483 .001
Lysine, mg/g Amino acid Erysipelotrichaceae Firmicutes 0.5145 .0001
Alanine, mg/g Amino acid Butyrivibrio Firmicutes 0.8034 .0004
Aspartic acid, mg/g Amino acid Butyrivibrio Firmicutes 0.4429 .01
Citrulline, mg/g Amino acid Butyrivibrio Firmicutes 0.6783 .0001
Glutamic acid, mg/g Amino acid Butyrivibrio Firmicutes 0.5226 .005
Glycine, mg/g Amino acid Butyrivibrio Firmicutes 0.8867 .0001
Leucine/isoleucine, Amino acid Butyrivibrio Firmicutes 0.6872 .001
mg/g
Methionine, mg/g Amino acid Butyrivibrio Firmicutes 0.7065 .004
Phenylalanine, mg/g Amino acid Butyrivibrio Firmicutes 0.7061 .0003
Proline, mg/g Amino acid Butyrivibrio Firmicutes 0.6758 .001
Serine, mg/g Amino acid Butyrivibrio Firmicutes 0.7922 .0003
Threonine, mg/g Amino acid Butyrivibrio Firmicutes 0.8230 .0002
Tyrosine, mg/g Amino acid Butyrivibrio Firmicutes 0.7173 .001
Valine, mg/g Amino acid Butyrivibrio Firmicutes 0.6861 .0003
Glutamine, mg/g Amino acid Lachnospiraceae_u_g Firmicutes -0.6401 .002
Arginine, mg/g Amino acid Lachnospiraceae_u_g Firmicutes 0.6005 .004
Tryptophan, mg/g Amino acid Lachnospiraceae_u_g Firmicutes -0.4152 .011
Glutamine, mg/g Amino acid Faecalibacterium Firmicutes -0.4625 .016
Amino acid Faecalibacterium Firmicutes -0.4609 .0001
- 2020 Manipulating Dietary Fat in UC 11.e28

Supplementary T

Microbiome Metabolite Metabolite P

Metabolite Metabolite category Microbiome ID phylum coefficient value

y-amino-n-butyric acid,
mg/g
Citrulline, mg/g Amino acid Bacteroides Bacteroidetes -0.4862 .003
Glycine, mg/g Amino acid Bacteroides Bacteroidetes -0.4350 .050
Leucine/isoleucine, Amino acid Bacteroides Bacteroidetes -0.4258 .042
mg/g
Serine, mg/g Amino acid Bacteroides Bacteroidetes -0.4346 .038
Threonine, mg/g Amino acid Bacteroides Bacteroidetes -0.6058 .005
Lysine, mg/g Amino acid Bacteroides Bacteroidetes -0.5619 .001
Ornithine, mg/g Amino acid Bacteroides Bacteroidetes -0.4498 .021
Lysine, mg/g Amino acid Lachnospiraceae nk4a Firmicutes 0.7378 .000
Aspartic acid, mg/g Amino acid Bacteria_u_g Bacteria_u_p 0.3676 .008
Citrulline, mg/g Amino acid Bacteria_u_g Bacteria_u_p 0.5049 .000
Glutamic acid, mg/g Amino acid Bacteria_u_g Bacteria_u_p 0.4490 .007
Methionine, mg/g Amino acid Bacteria_u_g Bacteria_u_p 0.4607 .036
Taurine, mg/g Amino acid Bacteria_u_g Bacteria_u_p -0.4811 .020
Lysine, mg/g Amino acid Bacteria_u_g Bacteria_u_p 0.4553 .003
Methionine, mg/g Amino acid Lachnoclostridium Firmicutes 0.5982 .001
Arginine, mg/g Amino acid Lachnoclostridium Firmicutes 0.6018 .0002
Histidine, mg/g Amino acid Lachnoclostridium Firmicutes 0.4309 .0002
Glutamine, mg/g Amino acid [Eubacterium] coprostanoligenes Firmicutes -0.4565 .040
group
Arginine, mg/g Amino acid Butyricicoccus.1 Firmicutes 0.8174 .001
Ornithine, mg/g Amino acid Lachnospira Firmicutes -0.3501 .001
Lysine, mg/g Amino acid Parabacteroides.1 Bacteroidetes -0.2402 .045
Alanine, mg/g Amino acid Peredibacter Proteobacteria 0.3670 .039
Glycine, mg/g Amino acid Peredibacter Proteobacteria 0.3906 .028
Leucine/isoleucine, Amino acid Peredibacter Proteobacteria 0.3679 .040
mg/g
Phenylalanine, mg/g Amino acid Peredibacter Proteobacteria 0.4760 .009
Tyrosine, mg/g Amino acid Peredibacter Proteobacteria 0.4818 .013
Valine, mg/g Amino acid Peredibacter Proteobacteria 0.3824 .028
Tryptophan, mg/g Amino acid Peredibacter Proteobacteria 0.3861 .026
Aspartic acid, mg/g Amino acid Blautia.1 Firmicutes 0.5185 .0004
Citrulline, mg/g Amino acid Blautia.1 Firmicutes 0.4793 .002
Glutamic acid, mg/g Amino acid Blautia.1 Firmicutes 0.5974 .001
Methionine, mg/g Amino acid Blautia.1 Firmicutes 0.6344 .002
Tyrosine, mg/g Amino acid Blautia.1 Firmicutes 0.6201 .003
Lysine, mg/g Amino acid Blautia.1 Firmicutes 0.5893 .0002
Lysine, mg/g Amino acid Fusicatenibacter Firmicutes 0.5536 .0002
LCA, ug/g feces Bile acid Lactobacillaceae_u_g Firmicutes 0.2720 .023
DCA, ug/g feces Bile acid [Eubacterium] Firmicutes 0.6062 .0002
LCA, ug/g feces Bile acid [Eubacterium] Firmicutes 0.5236 .002
DCA, ug/g feces Bile acid Bifidobacterium Actinobacteria 0.3430 .003
DCA, ug/g feces Bile acid Dialister Firmicutes -0.4600 .003
LCA, ug/g feces Bile acid Dialister Firmicutes -0.5206 .0003
DCA, ug/g feces Bile acid Candidatus.5 Actinobacteria 0.3825 .003
DCA, ug/g feces Bile acid Coprococcus Bacteria_u_p 0.2638 .021
DCA, ug/g feces Bile acid Ruminococcus Firmicutes 0.3337 .007
LCA, ug/g feces Bile acid Ruminococcus Firmicutes 0.2950 .019
DCA, ug/g feces Bile acid Family xiii_u_g Firmicutes 0.2281 .014
LCA, ug/g feces Bile acid Family xiii_u_g Firmicutes 0.2589 .005
DCA, ug/g feces Bile acid Eisenbergiella Firmicutes 0.2821 .003
LCA, ug/g feces Bile acid Eisenbergiella Firmicutes 0.2922 .003
DCA, ug/g feces Bile acid Coprobacillus Firmicutes 0.5721 .0001
DCA, ug/g feces Bile acid Bifidobacterium.1 Actinobacteria 0.4191 .0002
LCA, ug/g feces Bile acid Bifidobacterium.1 Actinobacteria 0.3346 .005
DCA, ug/g feces Bile acid Microbacterium Actinobacteria 0.2553 .015
DCA, ug/g feces Bile acid Trichococcus Firmicutes -0.6087 .00002
LCA, ug/g feces Bile acid Trichococcus Firmicutes -0.6237 .00001
DCA, ug/g feces Bile acid Planococcaceae_u_g Firmicutes -0.6707 .00002
LCA, ug/g feces Bile acid Planococcaceae_u_g Firmicutes -0.6129 .00011
11.e29 Fritsch et al Clinical Gastroenterology and Hepatology Vol. -, No. -

Supplementary Table 11. Continued

Microbiome Metabolite Metabolite P

Metabolite Metabolite category Microbiome ID phylum coefficient value

LCA, ug/g feces Bile acid Bacteria_u_g Bacteria_u_p 0.2654 .043

LCA, ug/g feces Bile acid [Eubacterium] coprostanoligenes Firmicutes 0.2875 .009
group
DCA, ug/g feces Bile acid Pseudomonas Proteobacteria -0.3895 .015
Acetic acid SCFA1 Lactobacillaceae_u_g Firmicutes 0.3901 .002
Propionic acid SCFA1 Lactobacillaceae_u_g Firmicutes 0.4772 .0002
Acetic acid SCFA1 Peptoclostridium Firmicutes -0.4217 .007
Acetic acid SCFA1 Thermoactinomycetaceae_u_g Firmicutes -0.4006 .016
Propionic acid SCFA1 Probable genus 10 Firmicutes 0.4176 .023
Propionic acid SCFA1 Family xiii_u_g Firmicutes 0.2911 .014
Propionic acid SCFA1 Salibacterium Firmicutes -0.3910 .011
Propionic acid SCFA1 Trichococcus Firmicutes -0.5276 .003
Propionic acid SCFA1 Faecalibacterium Firmicutes 0.2441 .048
Acetic acid SCFA1 Lachnospiraceae nk4a Firmicutes 0.5669 .002
Propionic acid SCFA1 Lachnospiraceae nk4a Firmicutes 0.5542 .001
Acetic acid SCFA1 Bacteria_u_g Bacteria_u_p 0.4315 .006
Propionic acid SCFA1 Bacteria_u_g Bacteria_u_p 0.3581 .019
Acetic acid SCFA1 Prevotellaceae ucg-0 Bacteroidetes 0.4977 .001
Propionic acid SCFA1 Prevotellaceae ucg-0 Bacteroidetes 0.4512 .002
Valeric acid SCFA2 Ruminococcus 1 Firmicutes 0.3337 .004
Butyric acid SCFA2 Anaerostipes Firmicutes 0.2082 .037
Isovaleric acid SCFA2 Christensenellaceae Firmicutes 0.2575 .003
Acetic acid SCFA2 Turicibacter Firmicutes 0.4546 .001
Isovaleric acid SCFA2 Bacteroidales_u_g Bacteroidetes 0.4744 .0004
Isovaleric acid SCFA2 Alistipes Bacteroidetes 0.2574 .002
Butyric acid SCFA2 Coprococcus Bacteria_u_p 0.2311 .023
Valeric acid SCFA2 Coprococcus Bacteria_u_p 0.2682 .019
Acetic acid SCFA2 Mogibacterium Firmicutes 0.5042 .0004
Propionic acid SCFA2 Mogibacterium Firmicutes 0.4425 .004
Valeric acid SCFA2 Ruminococcus Firmicutes 0.3780 .002
Isovaleric acid SCFA2 Ruminococcus Firmicutes 0.2606 .010
Valeric acid SCFA2 Atopobiaceae_u_g Actinobacteria 0.2943 .023
Valeric acid SCFA2 Eggerthellaceae_u_g Actinobacteria 0.5081 .0001
Acetic acid SCFA2 Family xiii_u_g Firmicutes 0.3537 .0004
Valeric acid SCFA2 Family xiii_u_g Firmicutes 0.4163 .0001
Isovaleric acid SCFA2 Coprobacillus Firmicutes 0.3771 .001
Valeric acid SCFA2 Subdoligranulum Firmicutes 0.4907 .0002
Isovaleric acid SCFA2 Oribacterium Firmicutes 0.2428 .024
Valeric acid SCFA2 [Eubacterium] hallii group Firmicutes 0.4916 .0003
Acetic acid SCFA2 Clostridium.3 Firmicutes -0.2433 .018
Butyric acid SCFA2 Clostridium.3 Firmicutes -0.2317 .022
Acetic acid SCFA2 Flavonifractor Firmicutes -0.3854 .005
Butyric acid SCFA2 Rikenellaceae_u_g Bacteroidetes -0.2332 .041
Isovaleric acid SCFA2 Rikenellaceae_u_g Bacteroidetes 0.2918 .003
Acetic acid SCFA2 Lachnospiraceae_u_g Firmicutes 0.4812 .0002
Propionic acid SCFA2 Lachnospiraceae_u_g Firmicutes 0.4570 .001
Butyric acid SCFA2 Lachnospiraceae_u_g Firmicutes 0.3696 .004
Valeric acid SCFA2 Lachnospiraceae_u_g Firmicutes 0.2852 .034
Isovaleric acid SCFA2 Faecalibacterium Firmicutes -0.3077 .001
Acetic acid SCFA2 Lachnospiraceae nk4a Firmicutes 0.4504 .001
Propionic acid SCFA2 Lachnospiraceae nk4a Firmicutes 0.4100 .003
Butyric acid SCFA2 Lachnospiraceae nk4a Firmicutes 0.3344 .011
Valeric acid SCFA2 [Eubacterium] coprostanoligenes Firmicutes 0.5316 .00004
group
Isovaleric acid SCFA2 [Eubacterium] coprostanoligenes Firmicutes 0.3817 .0002
group
Isovaleric acid SCFA2 Pseudomonas Proteobacteria -0.3828 .006
a-linolenic acid Untargeted_significant [Eubacterium] Firmicutes 0.8053 .00004
Dopaquinone Untargeted_significant Sutterella Proteobacteria -0.4690 .0001
Docosahexaenoic acid Untargeted_significant Mogibacterium Firmicutes 0.3592 .010
a-linolenic acid Untargeted_significant Thermoactinomycetaceae_u_g Firmicutes 0.4037 .007
Docosahexaenoic acid Untargeted_significant Eggerthellaceae_u_g Actinobacteria -0.2676 .001
- 2020 Manipulating Dietary Fat in UC 11.e30

Supplementary Table 11. Continued

Microbiome Metabolite Metabolite P

Metabolite Metabolite category Microbiome ID phylum coefficient value

a-linolenic acid Untargeted_significant Salibacterium Firmicutes -0.7160 .0001

Eicosapentaenoic acid Untargeted_significant Salibacterium Firmicutes 0.4529 .027
a-linolenic acid Untargeted_significant Clostridioides Firmicutes 0.6588 .001
a-linolenic acid Untargeted_significant Enorma Actinobacteria 0.3053 .021
Dopaquinone Untargeted_significant Faecalibacterium Firmicutes -0.2089 .027
a-linolenic acid Untargeted_significant Faecalibacterium Firmicutes 0.2112 .040
Eicosapentaenoic acid Untargeted_significant Faecalibacterium Firmicutes 0.2217 .029
Dopaquinone Untargeted_significant Bacteroides Bacteroidetes -0.5885 .030
a-linolenic acid Untargeted_significant Lachnoclostridium Firmicutes 0.4031 .016
Eicosapentaenoic acid Untargeted_significant Lachnoclostridium Firmicutes 0.3432 .031
Docosahexaenoic acid Untargeted_significant Lachnoclostridium Firmicutes 0.3131 .041
Eicosapentaenoic acid Untargeted_significant Lachnospira Firmicutes 0.1991 .006
a-linolenic acid Untargeted_significant Peredibacter Proteobacteria -0.6137 .001

SCFA, short-chain fatty acid.