Journal of Life Sciences and Technologies Vol. 3, No.
1, June 2015
Sequence Variation of CSLA Gene Responsible
for the Synthesis of Glucomannan in Porang
(Amorphophallus Muelleri Blume) Collected
from Java, Indonesia
Estri Laras Arumingtyas and Arik Arubil Fatinah
Biology Department, Faculty of Science, Brawijaya University, Jl. Veteran, Malang, Indonesia 65145
Email: laras@ub.ac.id, {larasbio, arik.arubil}@gmail.com

Abstract—Porang (Amorphophallus muelleri Blume)
collected from various geographical locations has been
known to show variation on glucomannan content.
Glucomannan is polysaccharide consisting hydrocoloid d-
glucose and d-mannose which has high economical value.
One of the most important genes responsible for the
synthesis of glucomannan is cellulose synthase-like A (CSLA)
glycosyltransferase. From previous study, CSLA gene was
only found in the the flower spatha and bulb of only one
sample, lead to the failure to detect it is effect to the
glucomannan content. So, in this research, identification of
CSLA gene was conducted using Polymerase Chain
Reaction (PCR) technique with different primer, to detect
the influence of CSLA gene to the glucomannan content of
porang collected from varous part of Java Island, Indonesia.
The result showed that glucomannan content between
porang originating from different locations were not the
same. This might be due to genetic and environmental
factors. It was detected that the sequence of CSLA genes of
porang from different location were different, the
interaction of both factors are likely to cause differences in
the glucomannan produced.
Index Terms—porang (amorphophallus muelleri blume),
CSLA gene, glycosil transferase, glucomannan
I. INTRODUCTION
Amorphopallus muelleri Blume, known by the local
name Porang, belongs to the genus Amorphopallus which
is the member of the family Araceae. Amorphophallus is
native to Indonesia, India and West Thailand. This time,
as many as 170 species the genus of Amorphopallus have
identified, 27 of which were found in Indonesia and the A.
muelleri Blume is a species that has the highest
glucomannan [1].
In the last ten years Porang much sought after because
of the high demand from Japan, Hong Kong and
Australia. The glucomannan of Porang used in the food
industry (healthy food diet), paper industry,
pharmaceuticals and cosmetics. High demand for porang
was not paired by the porang production in Indonesia.
One of the reasons is because of the low production
Manuscript received December 2, 2014; revised July 11, 2015.
© 2015 Journal of Life Sciences and Technologies
doi: 10.18178/jolst.3.1.7-10
porang which was caused by the lack of high-yielding
varieties [2]. This is due to the lack of information of
varieties with high yield and high glucomannan content.
Glucomannan is a hydrocoloid polysaccharide
consisting of D-glucose and D-mannose. Based on
research Azrianingsih (personal communication) has
found the difference in Porang glucomannan content on a
variety grows in different environments in East Java.
Based on RAPD known that there is variation in the
Porang genome growing on the island of Java [2].
However, Arumingtyas (unpublished) that showed the
difference was not detected using ITS analysis. Thus
there are two possible causes for this difference, the first
is the difference in genes or alleles, the second is the
influence of the environment that cause differences in the
expression of genes / alleles.
Various studies on various crops showed that many
genes play a role in the formation of glucomannan.
Components of glucomannan are mannose and glucose.
The formation of guanosine 5'-diphosphate glycosil (GDP)
-D-mannose require enzyme GDP-mannose
pyrophosphorylase-D [3]-[5], while the formation of
GDP-D glucose requires enzymes GDP- D-glucose
pyrophosphorylase [6], [7]. It also reported the presence
of mannose GDPD- enzyme 2-epimerase that catalyzes
the interconversion of GDP-D-mannose to glucose
GDPD- and vice versa [8]. Furthermore, the formation of
glucomannan chain done with the help of enzymes
syntase glucomannan [9]. Group members of
glucomannan synthase enzyme that has been shown to
play a role in the formation of glucomannan in various
parts of the plant are a family of cellulose synthase-like A
(CSLA) Glycosyltransferase. Some preliminary studies
mention the existence of genes forming glucomannan on
some plants, but glucomannan is not synthesized. It is
because of differences in the mechanism of formation of
the polysaccharide. In general, the formation of
polysaccharides on the tuber is through glycolysis which
will produce UDP-D-glucose. The formation of UDP-D-
glucose is catalyzed by the enzyme sucrose synthase and
UDP-D-Glucose pyrophosphorilase (UGPase) [10].
UGPase is a key enzyme that affects the formation of the
polysaccharide with β 1-4 bond as the glucomannan [10].
7
 Journal of Life Sciences and Technologies Vol. 3, No. 1, June 2015
Genes that play a role in the formation of these enzymes
in Porang until now has not been reported. Information of
the identity, structure and sequence of these genes will
greatly assist in the identification of high yielding
varieties and plant breeding program.
Thus, in this research, the identification and
characterization of key genes that play a role in the
formation of glucomannan (CSLA) in Porang collected
from four locations at Java island was conducted to
provide information of differences in the genes / alleles
and the relation with the glucomannan content.
Identification will be done by using Polymerase Chain
Reaction (PCR) to amplify the gene CSLA and continued
with sequencing to detect any differences in the gene
sequence.
II. MATERIALS AND METHODS
A. Plant Material and DNA Isolation
DNA samples taken from the collection of Wahyudi.
Then PCR was performed using specific primers
designed from the CSLA gene sequence of
Amorphophalus konjac AkCSLA_680F: 5'-
CTACCACTTCAAGGTGGAGCAG-3 as the forward
primer and AkCSLa_1288R: 5'-
CTCCCGATCTCCAACAAACC-3 'as the reverse primer
[10]. PCR cocktail made by mixing 4 mL BSA, 2 mL of
10 pmol forward primer, 2 mL of 10 pmol of reverse
primer, 10 mL of the master mix (Intron), and 2 mL DNA.
Subsequently PCR cocktail was mixed and centrifuged at
3000 rpm. Samples were inserted into CyclerTM Biorad
Gene with an initial denaturation at 95 °C for 5 minutes.
The PCR program was set to 33 cycles of denaturation at
95 °C for 45 seconds, annealing at a temperature of 54 °
C for 45 seconds, and extension at 72 °C for 45 seconds.
PCR cycle ended with a final extension at 72 °C for 10
minutes. The PCR products was visualized on an 1.5%
agarose gel with ethidium bromide dye. A positive result
is indicated by the formation of the DNA band with the
size of ~ 300 bp. PCR products were further purified by
gel extraction and sequenced using the ABI Prism 3730 at
First Base, Singapore.
Aligned sequence data using software MEGA5. Long
sequences analyzed using software equated GBlock. The
output was further analyzed using software MEGA5 for
phylogenetic tree construction and determine the value of
similarity.
TABLE I. GLUCOMANNAN CONTENT OF PORANG USED IN THE
EXPERIMENT
No. Varian Glucomannan content (gr)
1. Karang Tengah Wonogiri (E) 0,555
2. Cisompet I (G) 0,419
3. Cisompet II (K) 0,522
4. Pamedaran I (N) 0,328
5. Pamedaran II (O) 0,257
6. Grobogan Purwodadi (Q) 0,321
© 2015 Journal of Life Sciences and Technologies
III. RESULT AND DISCUSSION
A. Glucomannan Content
Measurement of glucomannan content (Table I)
showed that porang varian collected from Karang Tengah
Wonogiri possess the highest glucomannan content
compared with other locations. Porang from similar
location like Cisompet I and II, Pamedaran I and II
showed different glucomannan content.
There are two possibilities that cause that phenomenon
to happen. The first possibility was genetic factor. The
first possibility of genetic factor was all the porang
variants possess different sequence of CSLA genes which
in turn will produce different kind of enzyme or enzyme
activity. Differences of the kind of enzyme or enzyme
activity will produce different level of glucomannan
content. This suggestion need to be proven by sequencing
the CSLA genes of each sample. The second possibility
of genetic factor is the enzyme was available which mean
the gene was available and active, however as has been
investigated before [11] the level of glucomannan
resulted depend on the concentration ratio of GDP-D-
glucose and GDP-D-mannose available. The second
possibility is the effect of environtment. Different
location give different environtment. This may caused
differences in the expression of a gene, although the gene
was similar.
Moreover, there are many genes responsible for the
formation of glucomannan. The components of
glucomannan are mannose and glucose. The formation of
glycosil guanosine 5'-diphosphate(GDP)-D-mannose
need the existence of GDP-D-mannose
pyrophosphorylase enzyme [3]-[5], whereas the
formation of GDP-D glucose need the presence of GDP-
D-glucose pyrophosphorylase enzyme [6], [7]. It was also
reported GDP-D- mannose 2-epimerase catalyzed GDP-
D-mannose to GDPD- glucose interconversion [8].
Subsequent formation of glucomannan chains made with
the help of enzymes glucomannan syntase [9].
The members of glucomannan synthase enzymes
group that has been proven to have a role in the formation
of glucomannan in many part of plants was the family of
cellulose synthase-like A (CSLA) glycosyltransferase.
There are nine members of CSLA gene family of
Arabidopsis, and all of them were differentially expressed
in various part of plants [10]. It was also showed that
glycocil transferase is an active centre which capable of
utilizing GDP-D-mannose or GDP-D-glucose to be
synthesized to heteropolisaccharide [10]. So, if there is a
change in the sequence of CSLA gene, glucomannan
chain cannot be produced.
The second possibility is the environmental factor.
Environment where porang is growing affects porang
content [12]. So even though porang have the same genes,
but because it grows in a different environment then
CSLA gene expression is different. So in addition to
genetic factors, environmental factors also play a role in
determining glucomannan content
8
 Journal of Life Sciences and Technologies Vol. 3, No. 1, June 2015
B. Identification of CSLA Gene
It has been investigated that A. muelleri Blume from
Java has a high genetic diversity based on RAPD analysis
[2]. RAPD is an analysis for investigating genome
diversity without referring to a certain gene. So if the
analysis recognized differences, the variation could be
caused by differences in DNA sequence or differences in
DNA size. Based on research done by Arumingtyas
(unpublished) porang at East Java showed no variation
based on trnL or rbcL sequence.
PCR using primers designed based on the sequence of
A. konjac gene CSLA resulted in a band in the size of
about 400 bp (Fig. 1). Sequencing of this PCR result
showed variation of the sequence of CSLA gene fragment
of the six samples.
400 bp
Figure 1. PCR result using CSLA primer. M = marker; A&D = Data
not used for further sequencing ; E= Karang Tengah Wonogiri;
G=Cisompet I; K= Cisompet II; N= Pamedaran I; O= Pamedaran
II; Q= Grobogan Purwodadi
The sequence of the six sample showed variation in
some sites (Fig. 2). The variation was shown at the sites
1-6, 17, 36, 44, 47, 61, 64, 71, 74, 75, 93, 95, 100, 105,
106, 113, 115, 116, 121, 122, 130, 140, 147, 154, 173,
174, 179, 184, 187,188, 190, 200, 2015, 206, 210,
225,229, 236, 238.
10 20 30 40 50 60 70
....|....|....|....|....|....|....|....|....|....|....|....|....|....|
E CCTGGTTTCTCCCAACCCCTCCCCGTTGGCCAGCCTTAGCACAACCCTTGTGTTTTCCAGCAGGGGAAAA
G CTCGGTTTCTCCGCACCTCTCCCCGTTTGCCAGCCCTAGCACACCCCTTGTGCTTTCCAGCAGGGGAAAA
K TCAGGGTTCTCCGCACTTCTCCCCGTTTGCAAGCCCTACCACAACCTTTGTGTTTTCCAGAAGGGGAAAA
N TCCGGTTTCTCCGCACCTCTCCCCGTTTGCCAGCCTTAGCACAACCTTTGTGTTTTCCAGCAGTGGAAAA
O CTCCGGTTCTCCGCACTTCTCCCCGTTGGCAAGCCCTAGCACAACCTTTGTGTTTTCCAGCAGGGGAAAA
Q TCTGGTTCCTCTGAACCTCTCCCCGTTGGCAAGCCTTAGCACAACCCTTGTGTTTTCAAGAAGGGGAAAA
80 90 100 110 120 130 140
....|....|....|....|....|....|....|....|....|....|....|....|....|....|
E TTCTCCCCACCATCCCTAGGGGTCATTTTTCCAATCCGGGGAAAGCTTTTGTCAAAGGGGACCCACGGAG
G GTCCCCCCACCATCCCTAAGGGCCATTTTTCCAAGTCGGGGAAAGTTTTCTTCAAAGGGGACCCCCGGAT
K TTCTTCCCACCATCCCTAGGGGTCTTTTTCCCCAGCCGGGGAAAGCTTTTTTCAAAGGGTACCCCCGGAG
N TTCCCCCCACCATCCCTAGGGGCCTTTTTCCCAAGCCGGGGAAAGCTTTCTTCAAAGGGGACCCCCGGAG
O TTCCCCACACCATCCCTAGGGGCCATTTTCCCAAGTCGGGGAAAGTTTTTTTCAAAGGGGACCCCCGGAG
Q TTCTCCCCACCATCCCTAGGGGTCTTTTTTCCAAGTCGGGGGAAATTTTTGTCAAAGGGGACCCCCGGAG
150 160 170 180 190 200 210
....|....|....|....|....|....|....|....|....|....|....|....|....|....|
E ATTTTTTTGGGCGCTTTGCCCCCCCCAAAAAATTCTCGGGGCCACACCCAGGGGGAGACCAACCCAAAAC
G ATTTTTTTGGGCGTTTTGCCCCCCCCAAAAAATTCTCGGGGCCCCACTCTGGGGGGGCCTAACCAACAAA
K ATTTTTTTGGGGGTTTTGCGCCCCCCAAAAAACTCTCGGGGCCTAATTCAGGGGGGGACCAACCCAAAAA
N ATTTTTTTGGGCGTTTTGCCCCCCCCAAAAAACCCTCGGGGCCCCACTCAGGGGGGGCCCAACCAAAAAA
O ATTTTCTTGGGCGTTTTGCCCCCCCCAAAAAACTCTCGCGGCCCCAACCAGGGGGGGACCAACCAAAAAC
Q ATTTTCTTGGGCGTTTTGTCCCCCCAAAAAAATTCTCTGGGCCCCACCCTGGGGGGGACCAACCAAAAAA
220 230 240 250
....|....|....|....|....|....|....|....|.
E GGGGCGGGGGCCCGGGGGTGCCCCCTTGAAAGGGGAAAAA-
G GGGGCGGGGGCCCGGGGGTGCCCCCTTGAAAGGGGGAAAA-
K GGGGCGGGGGCCCGGGGGGGCCCCCTTGAAAGGGGGAAAA-
N GGGGCGGGGGCCCGGGGGGGCCCCCTTGAAAGGGGAAAAA-
O GGGGCGGGGGCCCCGGGGGGCCCCCTTGAAAGGGGGAAAA-
Q GGGGCGGGGGCCCGCGGGGGCCCCCCTTAAAGGGGGAAAA-
Figure 2. Sequence gene CSLA E= Karang Tengah Wonogiri;
G=Cisompet I; K= Cisompet II; N= Pamedaran I; O= Pamedaran II; Q=
Grobogan Purwodadi
Based on the sequences a dendogram was developed
(Fig. 3). The dendogram showed the grouping of the
© 2015 Journal of Life Sciences and Technologies
samples that seem not correlated to the location where the
plant grows. The dendogram showed two group, the first
group consist of the sample collected from Cisompet and
Pamedaran and the second group consist of Porang from
Karang Tengah Wonogiri and Grobogan Purwodadi.
However if it is analyzed more deeply, the dendogram
showed that Porang that collected from Cisompet I and
Pamedaran I shows high similarity and formed one group,
whilst Porang that come from Cisompet II and
Pamedaran II show high similarity too, and also produced
a group but different from the first group. A separate
group which showed high departure from the first two
group was formed by the group of Porang collected from
Karang Tengah Wonogiri and Grobogan Purwodadi.
Figure 3. Dendogram developed from the sequence gene CSLA of
Porang collected from E= Karang Tengah Wonogiri;
G=Cisompet I; K= Cisompet II; N= Pamedaran I; O=
Pamedaran II; Q= Grobogan Purwodadi
The grouping showed by Porang collected from
Cisompet and Pamedaran revealed the closer distance
between Cisompet and Pamedaran. Those two location
place in different province, however geographically close.
Those location may have similar soil condition and
climate to give an appropriate condition for growing
similar genotype of Porang. On the other hand Porang
collected from a quite far distance geographically to those
location, Karang Tengah Wonogiri and Grobogan
Purwodadi, give rise to a variation on the CSLA gene.
This finding is in accordance to the result of previous
rsearch that environtment could affect the genetic
property of Porang [12].
When the grouping crrelated to the glucomannan
content, there seem no correlation between the loccation
where Porang collected and the glucomannan content.
Based on the grouping, Porang collected from Cisompet
and Pamedaran should have similar content of
glucomanan, and similarly Porang collected from Karang
Tengah Wonogiri and Grobogan Purwodadi shoul also
have similar glucomannan content, but it was not the case
in this research. It seem that there are many factors that
affect the glucomannan content other than genetic and
environtmental factor. Maybe interaction of both factor,
could give rise to differences in glucomannan content.
IV. CONCLUSION
Glucomannan content between porang originating
from different locations were not the same. This might be
due to genetic and environmental factors. It was detected
that the sequence of CSLA genes of porang from
different location were different, the interaction of both
9
 Journal of Life Sciences and Technologies Vol. 3, No. 1, June 2015
factors are likely to cause differences in the glucomannan
produced.
ACKNOWLEDGMENT
The author would like to thanks Didik Wahyudi for
providing DNA sample. This research is a part of PHK
project of directorate of Higher Education, Indonesia.
REFERENCES
[1] P. C. M Jansen, C. van der Wilk, and W. L. A. Hetterscheid,
“Amorphophallus blume ex decaisne,” in Plant Resource of South
East Asia, F. M dan F. Rumawas, Ed., Plant Yielding Non-Seed
Carbohydrates, Bogor: Prosea, 1996, no. 9.
[2] Y. S. Poerba and D. Martanti, “Keragaman genetik berdasarkan
marka random amplified polymorphic DNA pada amorphophallus
muelleri blume di Jawa,” Biodiversitas, vol. 9, no. 4, pp. 245-249,
2008.
[3] A Munch-Petersen, “Enzymatic synthesis and pyrophosphorolysis
of guanosine diphosphate mannose,” Arch. Biochem. Biophys, no.
55, pp. 592-593, 1955.
[4] J. Preiss and E. Wood, “Sugar nucleotide reactions in Arthrobaeter.
I. guanosine diphosphate rnannose pyrophosphorylase:
Purification and properties,” J. Biol. Chem, vol. 239, pp. 3115-
3126, 1964
[5] L. J. De Asua, H. Carminatti, and S Passeron, “Guanosine
diphosphate t)-mannose pyrophosphorylase from Gleditschia
macraeantha,” Biochim. Biophys. Acta, vol. 128, pp. 582-585,
1966.
[6] G. A. Barber and W. S. Hassid, “The formation of guanosine
diphosphate D-glucose by enzymes of higher plants,” Biochim
Biophys. Acta, vol. 86, pp. 397-399, 1964.
© 2015 Journal of Life Sciences and Technologies
[7] I. Danishsky and O. Heritier-Watkins, “Nucleoside diphosphate
glucose pyrophosphorylases in mast cell tumors,” Biochim.
Biophys. Acta, vol. 139, pp. 349-357, 1967.
[8] A. D. Elbein, “Biosynthesis of a cell wall glucomannan in mung
bean seedlings,” J.Biol. Chem, vol. 244, pp. 1608-1616, 1969.
[9] G. Piro, A. Zuppa, G. Dalessandro, and D. H. Northcote,
“Glucomannan synthesis in pea epicotyls: The mannose and
glucose transferases, Planta, vol. 190, no. 2, pp. 206-20, 1993.
[10] S. Gille, K. Cheng, and M. E. Skinner, “Deep sequencing of
Voodoo Lily (Amorphophallus konjac): An approach to identify
relevant genes involved in the synthesis of the hemicellulose
glucomannan,” Planta, vol. 234, pp. 515-526, 2011.
[11] A. H. Liepman, J. Nairn, W. G. T. Willats, et al., “Functional
genomic analysis supports conservation of function among
cellulose synthase-like a gene family members and suggests
diverse roles of mannans in plants,” Plant Physiol., vol. 143, pp.
1881–1893, 2007.
[12] S. Indriyani, E. Arisoesiloningsih, T. Wardiyati, and H.
Purnobasuki, “A model of relationship between climate and soil
factors related to oxalate content in porang (amorphophallus
muelleri blume) corm,” Biodiversitas, vol. 12, no. 1, pp. 45-51,
2011.
Estri L. Arumingtyas was born in Trenggalek
dated August 18, 1963. Completed the S1 in
the Department of Agronomy, Faculty of
Agriculture, Bogor Agricultural University in
1987 and graduated S2 on the the Department
of Plant Science, University of Tasmania,
Hobart 1992 Australia. S3 education completed
in 2006, on the program of Agricultural
Science, Post Graduate UB. In 1988 until now
as a lecturer of Department of Biology, State
University of Brawijaya field of Plant Molecular Genetics study. In the
year 2011 until now the Head of the Laboratory of Physiology, Plant
tissue culture and Microtechnic
10