Send Orders of Reprints at bspsaif@emirates.net.

ae
Current Topics in Medicinal Chemistry, 2012, 12, 2059-2069 2059

Estrogen Receptor 1 Agonist PPT Stimulates Slc2a4 Gene Expression and

Improves Insulin-Induced Glucose Uptake in Adipocytes

R.S. Campello1, A.B. Alves-Wagner1, T.F. Lucas 2, R.C. Mori1, D.T. Furuya1, C.S. Porto2 and
U.F. Machado1,*

1
Department of Physiology and Biophysics, Institute of Biomedical Sciences, University of São Paulo, São Paulo, Bra-
zil; 2Section of Experimental Endocrinology, Department of Pharmacology, Escola Paulista de Medicina, Universidade
Federal de São Paulo, São Paulo, Brazil

Abstract: Type 2 diabetes mellitus is characterized by disruption in glycemic homeostasis, involving impaired insulin-
induced glucose disposal. For that, reduced glucose transporter GLUT4, encoded by Slc2a4 gene, plays a fundamental
role. Conversely, increase in Slc2a4/GLUT4 expression improves glycemic homeostasis. Recent studies have proposed
that estradiol is able to modulate Slc2a4 expression, according to distinct effects upon estrogen receptors ESR1/ESR2. We
hypothesize that ESR1-agonist effect could stimulate Slc2a4 expression; thus, increasing cellular glucose disposal, which
could be beneficial to glycemic control. Differentiated 3T3-L1 adipocytes were treated (24 hours) with selective ESR1-
agonist PPT 1,3,5-tris(4-hydroxyphenyl)-4-propyl-1H-pyrazole, selective ESR1-antagonist MPP 1,3-Bis(4-
hydroxyphenyl)-4-methyl-5-[4-(2-piperidinylethoxy)phenol]-1H-pyrazole dihydrochloride, and selective ESR2 agonist
DPN 2,3-bis(4-Hydroxyphenyl)-propionitrile, with/without 17-estradiol (E2). We analyzed Slc2a4 mRNA (real time
PCR) and GLUT4 protein (Western blotting) expression, transcriptional activity of the Slc2a4 repressor Nuclear Factor-
B (NF-B) (electrophoretic mobility shift assay), and cellular glucose disposal (2-deoxi-D-[3H]glucose uptake, 2-DG).
ESR1-agonist PPT enhanced Slc2a4/GLUT4 expression (~30%) in the absence or presence of 0.1 and 10 nmol/L E2, and
decreased the NF-B binding activity (~50%). Conversely, ESR1-antagonist MPP, together with E2, decreased
Slc2a4/GLUT4 expression (20-40%) and increased NF-B binding activity (~30%). Furthermore, treatment with ESR2-
agonist DPN decreased Slc2a4/GLUT4 expression (20-50%). 2-DG uptake was modulated in parallel to that observed in
GLUT4 protein. The present results reveal that ESR1 activity enhances, whereas ESR2 activity represses, Slc2a4/GLUT4
expression. These effects are partially mediated by NF-B, and allow parallel changes in adipocyte glucose disposal. Fur-
thermore, the data provide evidences that ESR1-agonist PPT, as a Slc2a4/GLUT4 enhancer, can be a promising coadju-
vant drug for diabetes mellitus therapy.
Keywords: adipocyte, ESR1, ESR2, glucose uptake, GLUT4, NF-
B, PPT, Slc2a4

INTRODUCTION tional diabetes [10], Turner syndrome (TS) and polycystic

Type 2 diabetes mellitus (T2DM) incidence increases
continuously in the world, with a projection of almost half a
billion people with diabetes by 2030 [1]. Despite the avail-
able pharmacopeia, good glycemic control still remains to be
achieved [2]. Characterization of pathophysiological mecha-
nisms leads to potentially novel adjuvants for prevention
and/or treatment of diabetes. Insulin resistance plays a key
role in T2DM pathophysiology, and that includes decreased
insulin-induced glucose uptake by muscle and adipose tis-
sues [3]. Glucose transporter 4 protein (GLUT4), encoded by
the solute carrier 2A4 gene (SLC2A4), is fundamental for
glucose uptake in muscle and adipose tissue, and it has been
reported as decreased in T2DM for long [4, 5, 6].
Several conditions that course with altered levels of 17-
estradiol (E2) are related to impaired glycemic control such
as phases of the menstrual cycle [7, 8], gestation [9], gesta-
*Address correspondence to this author at the Department of Physiology
and Biophysics, Institute of Biomedical Sciences, University of São Paulo,
São Paulo, Brazil, Av. Prof. Lineu Prestes 1524, 05508-900, São Paulo
(SP), Brazil; Tel/Fax: (55)1130917494; Email: ubiratan@icb.usp.br
ovarian syndrome (PCOS) [11, 12]. Curiously, insulin resis-
tance can develop with both low (TS) and high (PCOS) lev-
els of E2, and the effects of estrogen replacement therapy in
postmenopausal women change according to the dose ad-
ministered: oral intake of high doses impair whereas low
doses improve insulin regulation of glucose metabolism [13,
14]. Furthermore, the interplay between estrogens and insu-
lin resistance has been recently extended to males [15].
Whether the estrogen modulates insulin sensitivity, it
should be regulating GLUT4 expression, and thus modulat-
ing peripheral glucose utilization. In fact, we reported that
gestational high concentration of E2 reduces GLUT4 expres-
sion in muscles of oophorectomized rats [16]. Additionally,
in vitro analysis of Slc2a4 mRNA and GLUT4 protein ex-
pression in L6 myotubes confirmed an estradiol-repressor
effect; although it seems to be distinct according to the dose
administered [17].
Most biological effects of estrogen are mediated by es-
trogen receptors 1 and 2 (ESR1 and ESR2), formerly known
as ER
and ER; respectively. These proteins are codified by

1873-5294/12 $58.00+.00 © 2012 Bentham Science Publishers

2060 Current Topics in Medicinal Chemistry, 2012, Vol. 12, No. 19
ESR1 and ESR2 genes, which are included in the nuclear
receptor subfamily (NRS) 3 group A, and thus also referred
to as NRS3A1 and NRS3A2 genes, according to the HGNC
(HUGO Gene Nomenclature Committee). Considering that i)
ESR1 and ESR2 usually coexpress in the same cell type in a
variable amount [17]; and that ii) ESR1 and ESR2 may have
opposite effects [18]; it is reasonable to suppose that ESR1-
and ESR2-mediated effects of E2 upon Slc2a4 expression
might be distinct.
Study in mice lacking ESR1 (ER-/-) revealed insulin
resistance in both male and female [19], but the effect of
ESR2 knockout (ER-/-) upon insulin sensitivity was not so
clear. Later on, we reported that GLUT4 immunofluores-
cence in gastrocnemius muscle of ER-/--mice is markedly
increased [20], suggesting that ESR1 has an enhancer effect
upon Slc2a2 gene expression, which is counterbalanced by
the presence of ESR2 in wild mice. Furthermore, it was
demonstrated that in aromatase knockout mice (ArKO), the
treatment with a selective ESR2 agonist severely decreased
GLUT4 immunoreactivity; thus, suggesting a Slc2a4-
repressor effect of ESR2 [20].
The involved mechanisms in these ESR-mediated regula-
tions are completely unknown. In addition to direct binding
of ESR into DNA of target genes, ESR can modulate gene
expression without binding to DNA, but interacting with
other transcriptional factors, which will bind to DNA [21].
Regarding that, the nuclear factor-kappa B (NF-B), a re-
pressor of Slc2a4 gene [22, 23], is a transcriptional factor
involved in some ESR-mediated effects, and has already
been proposed as a candidate for the E2 induced regulation
of Slc2a4 [21].
In spite of that, the ESR1/ESR2-mediated effects on
Slc2a4 gene expression, including potential enhancer effect
of a selective ESR1-agonist, as well as the involved mecha-
nisms, remain obscure. We hypothesize that ESR1-agonist
effect might stimulate Slc2a4 expression, by an NF-B-
mediated mechanism; thus, increasing cellular glucose dis-
posal, which might be beneficial to glycemic control. Thus,
we investigated in the insulin-target 3T3L1 adipose cell the
effects of the selective ESR1-agonist PPT, ESR1-antagonist
MPP, ESR2-agonist DPN and ESR2-antagonist PHTPP on
Slc2a4/GLUT4 expression, NF-B binding activity into the
Slc2a4 promoter, and glucose uptake. Additionally, the par-
ticipation of nuclear factor-kappa B (NF-B) in the transcrip-
tional regulation of Slc2a4 was also investigated. We expect,
by demonstrating the PPT as a Slc2a4/GLUT4 enhancer, to
establish an additional approach for improvement of glyce-
mic homeostasis in T2DM.
METHODOLOGY
3T3-L1 Cell Culture: Mouse 3T3-L1 fibroblasts were
obtained from American Type Culture Collection, Rio de
Janeiro Cell Bank, Rio de Janeiro, RJ, Brazil (ATCC®
Number: CL-173TM). Cells were propagated and differenti-
ated, as previously described [19]. Briefly, cells were cul-
tured in growth medium containing DMEM (Vitrocell Em-
briolife, Campinas, Brazil) containing 25 mmol/L glucose,
added by 10% FBS (Vitrocell Embriolife) and penicil-
lin/streptomycin (100 units/ml each, Sigma-Aldrich, St.
Campello et al.
Louis, EUA), at 37 °C and 5% CO2 atmosphere. On day 2
post-confluence the medium was supplemented with 10

g/ml insulin, 1
mol/L dexamethasone and 0.5 mmol/L 3-
isobutyl-1-methylxanthine (Sigma-Aldrich, St Louis, MO,
USA), for 6 days. After differentiation (days 8 to 10), cells
were switched back to DMEM without phenol (modified
Eagle Dulbecco medium, Sigma-Aldrich), and with FBS
(10%) treated with dextran carbon (Sigma-Aldrich), for one
day. According to the supplier, this cell undergoes a pre-
adipose to adipose like conversion when it accumulates fat.
Cells were used for experiments from days 9 to 11, when at
least 95% of the cells displayed the adipocyte phenotype
confirmed by fat droplets accumulation clearly observed
with oil red staining (Supplementary Fig. S1).
Cell treatments: Differentiated adipocytes were treated
for 24 hours with 10 nmol/L PPT, 4,4’,4’’-(4-Propyl-[1H]-
pyrazole-1,3,5-triyl)trisphenol (Tocris, St. Louis, MO,
USA), a selective ESR1 agonist [18, 25]; 1
mol/L MPP,
1,3-Bis(4-hydroxyphenyl)-4-methyl-5-[4-(2-
piperidinylethoxy)phenol]-1H-pyrazole dihydrochloride
(Tocris), a selective ESR1 antagonist [25, 26]; 100 nmol/L
DPN, 2,3-bis(4-Hydroxyphenyl)-propionitrile (Tocris), a
selective ESR2 agonist [18, 27]; and 100 nmol/L PHTPP, 4-
[2-Phenyl-5,7-bis(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-
3-yl]phenol (Tocris), a selective ESR2 antagonist [26];
added or not with 17-estradiol (E2) (Sigma-Aldrich) in
concentrations of 0.1 and 10 nmol/L [28, 29]. PPT, DPN and
PHTPP were solubilized in DMSO (dimethylsulfoxide),
which was added at the same final concentration (0.1%) in
MPP-treated cells, as well as in the control cells, treated with
this vehicle only.
ESR1 and ESR2 expression: Immunofluorescent analysis
of ESR1 and ESR2 was performed as previously described
[25]. Briefly, differentiated adipocytes were treated on cov-
erslips coated with gelatin (0.1%) and placed into six-well
plates. Medium was removed; the cells were washed with
PBS, fixed in 2% paraformaldehyde for 20 min at room tem-
perature, and washed with PBS containing 0.1 mol/L gly-
cine. After permeabilization with 0.01% saponin and block-
ing with 1% BSA in PBS, cells were incubated with one of
the following primary antibodies (Santa Cruz Biotechnology,
San Diego, CA): rabbit polyclonal antibody raised against
the carboxyterminal region of ESR1 of mouse origin
(MC20), and goat polyclonal antibody raised against the
aminoterminald region of ESR2 of mouse origin, at 1:50
dilution in PBS containing 0.01% saponin and 1% BSA.
Afterwards, cells were incubated with the appropriate Alexa
Fluor® 594-labelled secondary antibody (Molecular
Probes®) (1:300). Negative controls were performed either
with the primary antibody preadsorbed with its respective
blocking peptide (Santa Cruz Biotechnology) or in the ab-
sence of primary antibody. The slides were also incubated
with DAPI (40,60-diamidino-2-phenylindole; Sigma-
Aldrich) for cell nuclei visualization. Images were obtained
using an inverted confocal laser scanning microscope LSM
510 (Carl Zeiss Inc., Oberkochen, Germany). The He-Ne
543-nm laser was used for excitation of red fluorescence.
Serial z-axis sections were collected at a 0.4
m thick with a
63X PlanAploChromat objective (Carl Zeiss Inc.). Analysis
and reconstruction of confocal microscopy images were per-
Estrogen Receptors and Slc2a4 Regulation
formed using the free software Image J 1.37. Images are pre-
sented as projections of optical images stacks.
Quantification of ESR1 and ESR2 content was performed
by Western blotting analysis [30]. Briefly, treated adipocytes
were washed, lysed in ice cold buffer and centrifuged at
11,200 x g for 30 min at 4°C. Proteins from the supernatant
(50
g per lane) were subjected to 7.5% SDS-PAGE (sodium
dodecyl sulfate polyacrylamide gel electrophoresis). Proteins
were electrotransferred onto a PVDF (polyvinylidene fluo-
ride) membrane. The membrane was blocked and incubated
with rabbit anti-ESR1 and goat anti-ESR2 antibodies (dilu-
tion of 1:200). Proteins were visualized, after incubation
with the appropriate horseradish peroxidase (HRP)-
conjugated anti-IgG secondary antibodies (donkey anti-
rabbit [1:5,000] and rabbit anti-goat [1:4,000]; Jackson Im-
munoresearch Lab, West Grove, PA), followed by enhanced
chemiluminescence reagent Luminol (PerkinElmer, Boston,
MA). In negative controls, primary antibodies were pread-
sorbed with the respective peptide immunogen and proc-
essed as described above. Apparent molecular masses of
protein bands were determined from molecular mass stan-
dards (prestained protein marker, broad range 6–175 kDa;
New England Biolabs, Boston, MA). After analyses of ESR1
and ESR2 protein, the membranes were reprobed with anti-
-actin antibody (Monoclonal anti--actin antibody AC-74,
A2228, Sigma-Aldrich) at 1:3,000 dilution, to normalize the
data. The mean value of 0E2 was set as 100 in each mem-
brane, and data were expressed as arbitrary units (AU).
Slc2a4 mRNA and GLUT4 protein analysis: Slc2a4
mRNA was quantified by real-time polymerase chain reac-
tion analysis (qPCR). Total RNA (1
g) was extracted from
cells using Trizol (Invitrogen Life Technologies, Carlsbad,
USA). RNA was further treated with DNase I (Invitrogen)
and reverse transcribed (ImProm-IITM Reverse Transcriptase,
Promega Co, Madison, USA). cDNA amplification was per-
formed using Platinum ® SYBR ® Green qPCR SuperMix
UDG (Invitrogen) in the Rotor Gene 3,000 (Corbett Re-
search, Sydney, Australia). Primers for amplification of
mouse Slc2a4 and the housekeeping glyceraldehyde 3-
phosphate dehydrogenase (Gapdh) were designed with
Primer 3 v.0.4.0 (SourceForge, Geeknet Inc.): 5’-
CTGTGCCATCTTGATGACCGTG-3’ (fw) and 5’-
GTTGGAGAAACCAGCGACAGC-3’ (rv), 196 bp, RefSeq
Accession NM_009204.2 and 5’-GAAGGTCGGTGTGAAC
GGATT-3’ (fw) and 5’-AAGACACCAGTAGACTCCAC
GA-3’ (rv), 294bp, RefSeq Accession NM_008084.2, re-
spectively. Real-time PCR conditions were 50 °C for 2 min,
95 °C for 2 min, then 40 cycles at 95 °C for 20 s, followed
by 60 °C for 1 min and 72 °C for 15 s. Efficiency curves
within the range of 90–110% were obtained for each gene
and a dissociation curve was obtained at the end of each ex-
periment to confirm the product. PCR experiments for each
sample were performed in duplicates and the mean value of
the critical threshold (Ct) was used to calculate fold-change

in expression using the 2- Ct. method. Briefly, quantifica-
tions were normalized to the housekeeping gene (Ct; Ct of
target gene – Ct of housekeeping gene), and then normalized
to the medium control (0E2 group) by subtracting its Ct to
yield a Ct. Thus, the final values for samples are reported
as a fold change relative to the expression of the 0E2 group
Current Topics in Medicinal Chemistry, 2012, Vol. 12, No. 19 2061
Ct
(calculated as 2– ), with the mean value of this group arbi-
trarily set to 1.
GLUT4 protein was analyzed by Western blotting as
previously described [16]. 3T3-L1 treated cells were ho-
mogenized in phosphate buffer saline (PBS) containing 10
mM Tris-HCL, 1 mmol/L EDTA and 250 mmol/L sucrose
(pH 7.4), and centrifuged at 1,000 g and 4 °C, for 10 min.
The fat-free supernatant was centrifuged at 150,000 g and 4
°C, for 75 min. The pellet was resuspended in the same
buffer and used for the detection of GLUT4 content in a total
membrane fraction. Thirty micrograms of protein were sub-
jected to sodium dodecyl sulfate polyacrylamide gel electro-
phoresis, and electrotransferred to nitrocellulose membrane.
The membrane was blocked in PBS containing 8% (w/v)
dried milk, and probed with polyclonal anti-GLUT4 anti-
body [Chemicon, Temecula, USA, 1:4,000 in PBS contain-
ing 8% (w/v) bovine serum albumin (BSA)], followed by
horseradish peroxidase-linked anti-rabbit immunoglobulin
(Amersham Biosciences, Buckinghamshire, UK) and by en-
hanced chemiluminescence reagent Luminol (5-amino-2,3-
dihydro-1,4-phthalazinedione free acid, Sigma-aldrich),
PerkinElmer, Boston, MA). The intensity of chemilumines-
cence for the corresponding blots was quantified by densi-
tometry (ImageScanner III, GE Healthcare, Uppsala,
Sweeden). After analyses of GLUT4 protein, the membranes
were reprobed with anti--actin antibody, and results were
expressed as described above for ESR1/2 proteins.
Nuclear Factor-
B (NF-
B) binding activity: Binding of
nuclear proteins into a
B-binding site of Slc2a4 was ana-
lyzed by electrophoretic mobility shift assay (EMSA) Nu-
clear protein extract was obtained based on previously re-
ported [22, 31], and stored at -80 oC for further analysis. A
double-stranded oligonucleotide, containing a
B-binding
site in the -83 to -60 Slc2a4 promoter region [(-83)
GTGAAGGGCGTGTCCTATGGCG (-62)], was end-
labeled using 1U/
L T4 polymerase kinase (Invitrogen Life
Technologies, Carlsbad, CA, USA) and 4
L [-32P]ATP
(3Ci/mmol) (Amersham Pharmacia Biotech, Amersham,
UK). Nuclear proteins (1
g) were allowed to react with the
labeled oligonucleotide probe in a binding buffer [60 mM
HEPES, pH 7.6, 150 mmol/L KCl, 10% glycerol, 0.6
mmol/L EDTA, 1.93 mg/mL bovine serum albumin, 2.3
mmol/L dithiothreitol, and 0.25
g/
L polydeoxyinosinicde-
oxycytidylic acid (poly[dI-dC], Amersham Pharmacia Bio-
tech)], for 20 min at room temperature. The protein-DNA
complexes were electrophoresed on non-denaturing poly-
acrylamide gel (4%), using 45 mmol/L Tris, 45 mmol/L bo-
rate and 1 mmol/L EDTA buffer, for 2 hours at 4 °C. The gel
was dried and autoradiographied. The blots were analyzed by
scanner densitometry (ImageScanner III, GE Healthcare,
Uppsala, Sweden), the results were normalized considering
the mean value of control samples in each gel as 100. The
results of the binding activity were expressed as arbitrary
units.
2-Deoxi-D-[3H]glucose (2-DG) uptake. 2-DG uptake
assay was performed as previously described [28]. Briefly,
differentiated cells were treated during 21 hours as described
above, and then for 3 hours in medium without FBS, to
withdrawal any insulin effect. Afterwards, 17 nmol/L insulin
(Humulin® R, Eli Lilly Brasil, São Paulo, Brasil) was added
2062 Current Topics in Medicinal Chemistry, 2012, Vol. 12, No. 19 Campello et al.

or not to the medium for the last 20 min, prior to completing
24 hour-treatment. The cells were immediately washed, and
2-deoxy-[1,2-3H]-D-glucose (Perkin Elmer, USA) was added
for 5 min, and then washed again with cold saline to stop the
transport. Results were calculated as described [32], and ex-
pressed as pmol/mg protein/min.
Statistical analysis: Data were expressed as mean ±
SEM. Means were compared by one-way analysis of vari-
ance (ANOVA) and Student–Newman–Keuls as a post hoc
test. The use of parametric analysis was firstly checked by
comparing the standard deviation of the groups using the
Bartlett test. For 2-DG uptake, insulin effect was analyzed
by comparing basal (-) and insulin-stimulated (+) conditions
in each treatment, using unpaired Student t test. After that,
one-way ANOVA (Newman-Keuls post-test) was used to
compare means of different treatments, separately, in basal
or insulin-stimulated condition.
RESULTS AND DISCUSSION
ESR1 and ESR2 expression in 3T3L1 adipocytes: In or-
der to confirm that E2 effects in adipocytes are mediated by
both ESR1 and ESR2, we investigated the expression of
these proteins in differentiated untreated cells. ESR1 and
ESR2 immunostaining were detected in the nuclei of 3T3L1
cells, under basal conditions (Fig. 1A), and the yellow color
in nuclei of the merged images (Fig. 1B) depicts that the
receptors coexpress in the same nuclei. Additionally, West-
ern blotting analysis detected ESR1 and ESR2 as single pro-
tein band of about 66 and 55kDa; respectively (Fig.
2).Quantification of the receptors by Western blotting re-
vealed that 24-hour treatment with E2 (from zero to 10
nmol/L) did not alter ESR1 and ESR2 content (Fig. 2). That
is an important finding, indicating that effects observed on
Slc2a4/GLUT4 expression under E2-treatment must not be
related to changes in ESR1/ESR2 balance.

A
DAPI ESR1 Merged

DAPI ESR2 Merged

20 μm

B
ESR1 ESR2 Merged

20 μm

Fig. (1). ESR1 and ESR2 expression in 3T3L1 adipocytes: A. Colocalization of ESR1 and ESR2 with nuclear marker DAPI in untreated cells
using confocal laser scanning microscope. ESR1 and ESR2 immunostaining were detected in 3T3L1 cells nuclei (red). Nuclei were stained
with DAPI (blue). Colocalization of the red and blue labels is shown on the right as merged images (magenta). B. Colocalization of ESR1
(green) and ESR2 (red) in the same nuclei is shown on the merged images (yellow). Bar = 20
m. The data shown are representative of three
independent experiments.
Estrogen Receptors and Slc2a4 Regulation
PPT enhances and MPP represses Slc2a4 mRNA and
GLUT4 protein expression: (Fig. 3) shows that ESR1-agonist
PPT increased both Slc2a4 mRNA (Fig. 3A) and GLUT4
protein expression (Fig. 3C), regardless of E2 presence. Be-
sides, 10 nmol/L E2 promoted additional enhancer effect on
GLUT4 protein (P<0.001 vs 0E2+PPT). These results, espe-
cially those observed in the protein, suggest that E2 might
have a preponderant ESR1-mediated enhancer effect, which
became evident in high doses of E2. Conversely, the ESR1-
antagonist MPP decreased Slc2a4 mRNA (Fig. 3B) and
GLUT4 protein (Fig. 3D) expression in the absence of E2
(P<0.05 vs 0E2), which was exacerbated in the presence of
10 nmol/L estradiol (P<0.01 vs 0E2+MPP).
A the ESR1-mediated enhancer effect on Slc2a4/GLUT4 ex-
ESR1
Β-actin
100
ESR1 (AU)
50
0 Slc2a4 mRNA, no significant effects of PHTPP were ob-
0E2 0.1E2 10E2
B is, and translation efficiency increases [33]. Alterations in
ESR2
Β-actin
100
ESR2 (AU)
50
0 agonist.
0E2 0.1E2 10E2
Fig. (2). 17
-estradiol effect on ESR1 and ESR2 expression in
3T3L1 cells: ESR1 (A) and ESR2 (B) content was measured by
Western blotting, using total protein extracts (50
g per lane) from
3T3L1 adipocytes treated for 24 hours with zero (0E2), 0.1 (0.1E2)
and 10 (10E2) nmol/L of 17-estradiol (E2). Representative autora-
diograms are shown on top of each graph showing the means ±
SEM of 9 to 11 samples.
The additional effect of E2 over the isolated ago-
nist/antagonist effects seems to be stronger with MPP (an-
Current Topics in Medicinal Chemistry, 2012, Vol. 12, No. 19 2063
tagonist) than with PPT (agonist). This might be a conse-
quence of a repressor ESR2-mediated effect, occurring as the
E2 is added in the medium. Furthermore, the observation
that MPP can repress Slc2a4/GLUT4 expression in the ab-
sence of the ESR1 ligand (E2), suggests that the ESR1 has a
constitutive basal enhancer effect, and/or the MPP antagonist
also plays a role as an inverse agonist.
DPN represses Slc2a4 mRNA and GLUT4 protein ex-
pression: (Fig. 4) shows that ESR2-agonist DPN decreased
Slc2a4 mRNA (Fig. 4A) and GLUT4 protein (Fig. 4C) ex-
pression in the absence of E2, which depicts an ESR2-
mediated repressor effect. On the other hand, addition of E2
(0.1 and 10 nmol/L) to DPN reversed the effects of DPN
alone. This indicates that as E2 was included in the culture,
pression was triggered, counterbalancing the DPN-induced
repressor effect.
Conversely to that observed with ESR2-agonist, treat-
ment with PHTPP (ESR2-antagonist) increased Slc2a4
mRNA expression in 0 and 0.1 nmol/L E2 (Fig. 4B). Sur-
prisingly, this PHTPP effect on Slc2a4 mRNA disappeared
at 10 nmol/L E2, when an additional ESR1-mediated enhan-
cer effect should be expected. This unexpected result may be
related to the concentration of the PHTPP, considering that
as E2 concentration increases, the PHTPP might not be able
to completely block the ESR-2-mediated repressor effect
upon Slc2a4 expression. Further studies must be conducted
to clarify that. On the other hand, despite the effects on
served in GLUT4 protein (Fig. 4D). This indicates a post-
transcriptional regulation of Slc2a4 gene, which might in-
volve changes in the size of mRNA poly(A) tail. It is known
that the longer the poly-A tail is, the more stable the mRNA
Slc2a4 mRNA poly(A) tail have been able to explain dis-
crepancies between Slc2a4 mRNA and GLUT4 protein ex-
pression in skeletal muscle [34, 35, 36].
Despite the results observed with ESR2-antagonist, the
data obtained with DPN clearly evince the ESR2-mediated
repressor effect on Slc2a4/GLUT4 expression, and that may
explain the increased GLUT4 observed in muscle of ESR2
null mice, as well as the DPN-induced decrease of GLUT4
observed in muscle of aromatase knockout mice [20]. Be-
sides, the observation that ESR2-antagonist PHTPP in-
creases Slc2a4 mRNA expression in the absence of E2 sug-
gests that the ESR2 has a constitutive basal repressor effect,
and/or the PHTPP antagonist also plays a role as an inverse
ESRs effects upon Slc2a4 expression are mediated by
NF-B: NF-
B transcriptional factor has been implicated in
some ESR-induced biological effects [21]. Considering that:
i) the consensus ESR-binding sites described are not found
in the promoter of Slc2a4 gene; ii) some genomic effects of
ESR can occur independently of the ESR binding into the
DNA, but involving transactivation or transrepression effects
mediated by NF-
B [37]; and iii) the NF-
B has been de-
scribed as a repressor of Slc2a4 gene [22, 23], we investi-
gated the potential participation of NF-
B in the present
ESR1 and ESR2 induced regulations of Slc2a4 gene.
2064 Current Topics in Medicinal Chemistry, 2012, Vol. 12, No. 19 Campello et al.

A B
1.5 ** 1.2
**
*

Slc2a4/Gapdh (AU)
Slc2a4/Gapdh (AU)
* * §§
1.0 ££
***
0.6
0.5

0 0

C D
GLUT4 GLUT4

β-actin β-actin

&&
##
*** 100
150
** *
** §§
§§
***
***

GLUT4 (AU)
GLUT4 (AU)

100
50
50

0 0

Fig. (3). PPT and MPP effects on Slc2a4 mRNA and GLUT4 protein expression: 3T3L1 adipocytes were treated for 24 hours with 10 nmol/L
of the ESR1 agonist PPT (A and C) or 1
mol/L of the ESR1 antagonist MPP (B and D), in the absence (0E2+PPT) or presence of 0.1
(0.1E2+PPT) and 10 (10E2+PPT) nmol/L of 17-estradiol (E2). Cells treated only with vehicle were used as control (0E2). Slc2a4 mRNA (A
and B) and GLUT4 protein (C and D) were analyzed by qPCR and Western blotting, respectively, as described in Methodology. In panels C
and D, representative autoradiograms are shown on top. Data on the graphs are means ± SEM of 5 to 8 samples. *P<0.05, **P<0.01 and
***P<0.001 vs 0E2; ##P<0.01 vs 0E2+PPT; &&P<0.01 vs 0.1E2+PPT; §§P<0.01 vs 0E2+MPP; ££P<0.01 vs 0.1E2+MPP, one-way ANOVA
(Newman-Keuls post-test).

Electrophoretic mobility shift assay (EMSA) revealed
that Slc2a4-NF
B domain formed 3 complexes with nuclear
proteins of 3T3L1 adipocytes, named complexes A and B
and C (Supplementary Fig. 2). The oligonucleotide binding
specificity was checked by competition with unlabeled oli-
gonucleotide (Supplementary Fig. 2). Complex A seems to
be subdivided into complexes A1 and A2, and complexes B
and C showed a very weak signal. Multiple complexes can
occur by different dimerization of the NF-
B protein sub-
types, and modulations can be restricted to some of them. In
this study, complex C was invariable, and modulations oc-
curred similarly in complexes A and B. ER induced modula-
tions of NF-
B binding into the promoter of interleukin-6
gene were shown to occur only in complexes containing the
c-rel proto oncogene and the RelA protein [38], evincing that
regulation of protein/DNA complexes may be distinct. Quan-
tification of binding activity was performed by densitometry
of band A, as representative of both A and B complexes.
EMSA analysis demonstrated that PPT, alone or in the
presence of E2, reduced the binding activity of nuclear pro-
teins into the B-binding site of the Slc2a4 promoter region
(Fig. 5A). Since NF-B is a repressor of Slc2a4, this may
explain the PPT induced increasing in Slc2a4 mRNA. Con-
versely, the ESR1-antagonist MPP increased nuclear pro-
teins binding activity into the Slc2a4 B-site site, but only in
the presence of E2 (Fig. 5B). This indicates that MPP- in-
duced repression of Slc2a4 mRNA in the presence of E2 is
mediated by NF-B. Considering that this increase of
Slc2a4-B binding activity is dependent of E2, and occurred
in ESR1-blocked condition, this seems to be an ESR2-
mediated effect, which was induced as the ligand was added
into the medium. On the other hand, MPP alone did not alter
NF-B binding activity, suggesting that the Slc2a4 mRNA
decrease observed in this condition was not related to NF-B
activity.
Differently to that observed with the ESR1-agonist, the
ESR2-agonist DPN had no effect on Slc2a4-B-binding ac-
tivity in zero E2, but in the presence of 01 and 10 nmol/L
E2, the binding activity was clearly reduced (Fig. 5C). These
results indicate: i) that the DPN-mediated repression of
Slc2a4 mRNA expression independent of E2 was not related
to NF-B activity; and ii) that the reduction of Slc2a4-B-
binding activity observed with DPN plus E2 may be a ESR1-
mediated effect, which was induced as the ligand was added
into the medium.
Estrogen Receptors and Slc2a4 Regulation Current Topics in Medicinal Chemistry, 2012, Vol. 12, No. 19 2065

A B
1.2 **
& & 1.5 * ƒ

Slc2a4/Gapdh (AU)
Slc2a4/Gapdh (AU)
*
1.0
0.6

0.5

0 0

C D
GLUT4 GLUT4

β-actin β-actin

& 120
100 &
GLUT4 (AU)

GLUT4 (AU)
*
50 60

0 0

Fig. (4). DPN and PHTPP effects on Slc2a4 mRNA and GLUT4 protein expression: 3T3L1 adipocytes were treated for 24 hours with 100
nmol/L of the ESR2 agonist DPN (A and C) or 100 nmol/L of the ESR2 antagonist PHTPP (B and D), in the absence (0E2+PPT) or presence
of 0.1 (0.1E2+PPT) and 10 (10E2+PPT) nmol/L of 17
-estradiol (E2). Cells treated only with vehicle were used as control (0E2). Slc2a4
mRNA (A and B) and GLUT4 protein (C and D) were analyzed by qPCR and Western blotting, respectively, as described in Methodology. In
panels C and D, representative autoradiograms are shown on top. Data on the graphs are means ± SEM of 5 to 8 samples. *P<0.05 and
**P<0.01 vs 0E2; &P<0.05 vs 0E2+DPN; ƒP<0.05 vs 0.1E2+PHTPP, one-way ANOVA (Newman-Keuls post-test).

Finally, ESR2-antagonist PHTPP induced a strong reduc-
tion in Slc2a4-B binding activity (Fig. 5D); the effect of
PHTPP alone being exacerbated in the presence of E2, which
suggests an ESR1-mediated effect. The effects observed in 0
and 0.1 nmol/L E2 might participate on the Slc2a4 mRNA
increase observed under these conditions. However, the
regulation observed at 10 nmol/L E2 suggests the involve-
ment of mechanisms other than the NF-B activity. Further-
more, it is difficult to match the observation that ESR2-
agonist DPN alone had no effect on Slc2a4 B-binding, but
ESR2-antagonist PHTPP alone had a clear repressor effect.
That is something that remains to be clarified.
PPT increases whereas MPP and DPN decrease cellular
2-deoxi-D-[3H]glucose (2-DG) uptake: In order to confirm
that GLUT4 regulations induced by ESRs agonists and an-
tagonists are being accompanied by functional alterations in
adipocyte glucose disposal, the 2-DG uptake assay was per-
formed (Fig. 5). First of all, it is important to point out that in
all experimental conditions, as expected, insulin induced a
significant (P<0.05 to P<0.001) increase in 2-DG uptake,
statistically demonstrated by comparing basal (-) and insulin
stimulated (+) conditions (Student t test), in each experimen-
tal condition. This is related to the acute effect of insulin on
GLUT4 translocation into plasma membrane [32]. Further-
more, all agonist or antagonist treatments did not alter the
basal 2-DG uptake, indicating that in the absence of insulin,
plasma membrane glucose transporter content seems to be
the same.
(Fig. 6A) shows that PPT in 0 and 0.1 nmol/L E2 clearly
improved the insulin-stimulated 2-DG uptake (P<0.05 vs
0E2); however, 10 nmol/L E2 reversed the PPT effect
(P<0.05 vs 0E2+PPT), allowing the insulin-induced 2-DG
uptake to be similar to that observed in the absence of PPT.
Increased insulin-induced 2-DG uptake in 0E2+PPT and
0.1E2+PPT treatments was in accordance with increased
GLUT4 protein expression observed under these conditions.
However, in 10E2+PPT treatment, 2-DG uptake remained
unchanged, despite increased GLUT4 expression, which was
higher than that observed in 0E2+PPT (P<0.01), suggesting
that the highest concentration of E2 impaired insulin-induced
GLUT4 translocation. This might be related to an ESR2-
mediated repression of GLUT4 translocation, and/or to a
glucotoxic effect. Conversely, (Fig. 6B) shows that MPP
reduced insulin-induced 2-DG uptake (P<0.05 to P<0.01),
according to that observed in the GLUT4 protein. These data
depict that ESR1-mediated enhancer effect of
Slc2a4/GLUT4 expression allows the adipocyte to improve
glucose disposal.
2066 Current Topics in Medicinal Chemistry, 2012, Vol. 12, No. 19 Campello et al.

Slc2a4 - κB binding (AU)

100
A
# #
*** ***
50 *** B

0
1 2 3 4

§ §
B 140
Slc2a4 - κB binding (AU)
** **
A

70
B

0
1 2 3 4

C
Slc2a4 - κB binding (AU)

100
&&&
*** &&& A
***
50
B

0
1 2 3 4

D
Slc2a4 - κB binding (AU)

100

50
*** B
ƒƒƒ ƒƒƒ
*** ***
0
1 2 3 4

Fig. (5). ESRs effects upon Slc2a4 expression are mediated by NF-
B: 3T3L1 adipocytes were treated for 24 hours with 10 nmol/L of the
ESR1 agonist PPT (A), 1
mol/L of the ESR1 antagonist MPP (B), 100 nmol/L of the ESR2 agonist DPN (C) or 100 nmol/L of the ESR2
antagonist PHTPP (D), in the absence (0E2+) or presence of 0.1 (0.1E2+) and 10 (10E2+) nmol/L of 17-estradiol (E2). Cells treated only
with vehicle were used as control (0E2). Slc2a4-B binding activity to nuclear proteins was analyzed by electrophoretic mobility shift assay
(EMSA) as described in Methodology. In each panel, at right, representative autoradiogram shows 2 molecular complexes A and B; and lanes
1 to 4 corresponds to 0E2, 0E2+compound, 0.1E2+compound and 10E2+compound, respectively. Data on the graphs are means ± SEM of 5
to 7 samples. **P<0.01 and ***P<0.001 vs 0E2; #P<0.05 vs 0E2+PPT; §P<0.05 vs 0E2+MPP; &&&P<0.001 vs 0E2+DPN; ƒƒƒP<0.001 vs
0E2+PHTPP, one-way ANOVA (Newman-Keuls post-test).

Finally, ESR2-antagonist PHTPP induced a strong reduc-
tion in Slc2a4-B binding activity (Fig. 5D); the effect of
DPN effects on insulin-induced 2-DG uptake (Fig. 6C) were
also in accordance with that observed in GLUT4 protein.
The ESR2-agonist alone decreased 2-DG uptake, but, as the
E2 was added, the effect was counterbalanced, probably be-
cause of the ESR1-mediated effect. Finally, the ESR2-
antagonist PHTPP (Fig. 6D), according to the unchanged
GLUT4, did not alter insulin stimulated 2-DG uptake.
Estrogen Receptors and Slc2a4 Regulation Current Topics in Medicinal Chemistry, 2012, Vol. 12, No. 19 2067

A B
60 ** 40

2-DG uptake (pmol/mg/min)

2-DG uptake (pmol/mg/min)
**
εε *
εε
## **
40 **
20

20

0 0
E2 0 0 0.1 10 E2 0 0 0.1 10
PPT - - + + + + + + MPP - - + + + + + +
Insulin - + - + - + - + Insulin - + - + - + - +

C § D
40 &&& 40
2-DG uptake (pmol/mg/min)
2-DG uptake (pmol/mg/min)

**
***

20 20

0 0
E2 0 0 0.1 10 E2 0 0 0.1 10
DPN - - + + + + + + PHTTP - - + + + + + +
Insulin - + - + - + - + Insulin - + - + - + - +

Fig. (6). PPT increases whereas MPP and DPN decrease cellular 2-deoxi-D-[3H]glucose (2-DG) uptake: 3T3L1 adipocytes were treated for
24 hours with 10 nmol/L of the ESR1 agonist PPT (A), 1
mol/L of the ESR1 antagonist MPP (B), 100 nmol/L of the ESR2 agonist DPN (C)
or 100 nmol/L of the ESR2 antagonist PHTPP (D), in the absence (0) or presence of 0.1 (0.1) and 10 (10) nmol/L of 17-estradiol (E2). For
2-DG assay, cells were previously subjected (+) or not (-) to 20 min stimulus with 17 nmol/L insulin, as described in Methodology. Data on
the graphs are means ± SEM of 4 to 5 samples. Significant effect (P<0.05 to P<0.001) of insulin was confirmed by unpaired Student t test for
all experimental conditions (not shown on the graphs). No differences were observed among the groups in non-insulin stimulated 2-DG up-
take (one-way ANOVA), but under insulin-stimulated condition, 2-DG uptake was significantly affected by the treatments: *P<0.05,
**P<0.01 and ***P<0.001 vs 0E2 (+); ##P<0.01 vs 0E2+PPT (+); P<0.05 vs 0.1E2+PPT (+); &&&P<0.001 vs 0E2+DPN (+); §P<0.05 vs
0.1E2+DPN (+), one-way ANOVA, Newman-Keuls post-test.

Considering the present results, it is important to reflect [41]. In addition to the inconclusive effects of foods rich in
about the phytoestrogens actions. Some studies have pro- phytoestrogens, the main point is that these compounds have
posed beneficial effects of phytoestrogens in diabetes [39, a variable relative binding activity (RBA) to ESR1 and
40]. However, they have been conducted with foods rich in ESR2. For the most effectives, coumestrol and isoflavona
phytoestrogens, and the nature of the proteins as well as the genestein, the RBA is up to 7 to 22 times higher for ESR2
high-fiber content are proposed to participate in the effects than for ESR1, respectively; and the potency for ESR2 is
observed [40]. Soybean supplementation has shown to have similar (genestein) or higher (coumestrol) than that for E2
some effects in lipid profile, but no effects in glycemic ho- [42]. Furthermore, other phytoestrogens, such as apigenin,
meostasis were observed [39]. However, improvement in kaempferol and daidzein, despite their low affinity with
glycemic control and insulin sensitivity was observed in hu- ESRs, as compared to E2, their binding affinity with ESR2 is
mans supplemented with fermented soybean products, and also 5 to 30 times higher than that for ESR1 [42]. Thus the
such improvement was related to small bioactive peptides dominant ESR2-mediated action of phytoestrogens may rep-
and alterations in the structure and content of isoflavonoids resent a potentially powerful diabetogenic effect.
2068 Current Topics in Medicinal Chemistry, 2012, Vol. 12, No. 19
CONCLUSION
In a whole, the present data show that ESR2 activity re-
presses, whereas ESR1 activity enhances Slc2a4/GLUT4
expression, the former impairing and the latter improving
adipocyte glucose uptake. Thus, ESR2-mediated effects may
have a diabetogenic potential, whereas ESR1-mediated ef-
fects may contribute to glycemic control. Besides, the results
show that both ESR1 and ESR2 effects on Slc2a4 gene ex-
pression are partially mediated by NF-
B. The selective
ESR1-agonist PPT, by displaying the beneficial effects of
increased cellular glucose disposal, may be a promising co-
adjuvant drug for diabetes mellitus therapy.
CONFLICT OF INTEREST
The author(s) confirm that this article content has no con-
flicts of interest.
ACKNOWLEDGEMENTS
This research was supported by grant from FAPESP (São
Paulo State Foundation for Research) 2007/50554-1 and
2009/02217-1. The authors acknowledge Dr. Adauri Bre-
zolin for final English revision of the manuscript.
REFERENCES
[1] Chen, L.; Magliano, D.J.; Zimmet, P.Z. The worldwide epidemiol-
ogy of type 2 diabetes mellitus--present and future perspectives.
Nat. Rev. Endocrinol., 2011, 8(4), 228-236.
[2] Look AHEAD Research Group; Wing, R.R. Long-term effects of a
lifestyle intervention on weight and cardiovascular risk factors in
individuals with type 2 diabetes mellitus: four-year results of the
Look AHEAD trial. Arch. Intern. Med., 2010, 170(17), 1566-1575.
[3] Reaven, G.M. Pathophysiology of insulin resistance in human
disease. Physiol. Rev., 1995, 75(3), 473-486.
[4] Garvey, W.T.; Maianu, L.; Huecksteadt, T.P.; Bimbaum, M.J.;
Molina, J.M.; Ciaraldi, T.P. Pretranslational suppression of a glu-
cose transporter protein causes insulin resistance in adipocytes
from patients with non-insulin-dependent diabetes mellitus and
obesity. J. Clin. Invest., 1991, 87(3), 1072-1081.
[5] Dohm, G.L.; Elton, C.W.; Friedman, J.E.; Pilch, P.F.; Pories, W.J.;
Atkinson, S.M. Jr.; Caro, J.F. Decreased expression of glucose
transporter in muscle from insulin-resistant patients. Am. J.
Physiol., 1991, 260(3), E459-463.
[6] Wallberg-Henriksson, H.; Zierath, J.R. GLUT4: a key player regu-
lating glucose homeostasis? Insights from transgenic and knockout
mice (review). Mol. Membr. Biol., 2001, 18(3), 205-211.
[7] Case, A.M.; Reid, R.L. Menstrual cycle effects on common medi-
cal conditions. Compr. Ther., 2001, 27(1), 65-71.
[8] Solomon, C.G.; Hu, F.B.; Dunaif, A.; Rich-Edwards, J.; Willett,
W.C.; Hunter, D.J.; Colditz, G.A.; Speizer, F.E.; Manson, J.E.
Long or highly irregular menstrual cycles as a marker for risk of
type 2 diabetes mellitus. Jama, 2001, 286(19), 2421-2426.
[9] Reece, E.A.; Homko, C.; Wiznitzer, A. Metabolic changes in dia-
betic and nondiabetic subjects during pregnancy. Obstet. Gynecol.
Surv., 1994, 49(1), 64-71.
[10] Kaaja, R.J.; Greer, I.A. Manifestations of chronic disease during
pregnancy. Jama, 2005, 294(21), 2751-2757.
[11] Gravholt, C.H.; Nyholm, B.; Saltin, B.; Schmitz, O.; Christiansen,
J.S. Muscle fiber composition and capillary density in Turner syn-
drome: evidence of increased muscle fiber size related to insulin re-
sitance. Diabetes Care, 2001, 24(9), 1668-1673.
[12] Dunaif, A.; Segal, K.R.; Futterweit, W.; Dobrjansky, A. Profound
peripheral insulin resistance, independent of obesity, in polycystic
ovary syndrome. Diabetes, 1989, 38(9), 1165-1174.
[13] Cagnacci, A.; Soldani, R.; Carriero, P.L.; Paoletti, A.M.; Fioretti,
P.; Melis, G.B. Effects of low doses of transdermal 17 beta-
estradiol on carbohydrate metabolism in postmenopausal women.
J. Clin. Endocrinol. Metab., 1992, 74(6), 1396-1400.
Campello et al.
[14] Lindheim, S.R.; Presser, S.C.; Ditkoff, E.C.; Vijod, M.A.;
Stanczyk, F.Z.; Lobo, R.A. A possible bimodal effect of estrogen
on insulin sensitivity in postmenopausal women and the attenuating
effect of added progestin. Fertil. Steril., 1993, 60(4), 664-667.
[15] Meyer, M.R.; Clegg, D.J.; Prossnitz, E.R.; Barton, M. Obesity,
insulin resistance and diabetes: sex differences and role of oestro-
gen receptors. Acta Physiol. (Oxf)., 2011, 203(1), 259-269.
[16] Barros, R.P.; Morani, A.; Moriscot, A.; Machado, U.F. Insulin
resistance of pregnancy involves estrogen-induced repression of
muscle GLUT4. Mol. Cell. Endocrinol., 2008, 295(1-2), 24-31.
[17] Koehler, K.F.; Helguero, L.A.; Haldosen, L.A.; Warner, M.;
Gustafsson, J.A. Reflections on the discovery and significance of
estrogen receptor beta. Endocr. Rev., 2005, 26(3), 465-478.
[18] Helguero, L.A.; Faulds, M.H.; Gustafsson, J.A.; Haldosen, L.A.
Estrogen receptors alfa (ERalpha) and beta (ERbeta) differentially
regulate proliferation and apoptosis of the normal murine mam-
mary epithelial cell line HC11. Oncogene, 2005, 24(44), 6605-
6616.
[19] Heine, P.A.; Taylor, J.A.; Iwamoto, G.A.; Lubahn, D.B.; Cooke,
P.S. Increased adipose tissue in male and female estrogen receptor-
alpha knockout mice. Proc. Natl. Acad. Sci. USA., 2000, 97(23),
12729-12734.
[20] Barros, R.P.; Machado, U.F.; Warner, M.; Gustafsson, J.A. Muscle
GLUT4 regulation by estrogen receptors ERbeta and ERalpha.
Proc. Natl. Acad. Sci. USA., 2006, 103(5), 1605-1608.
[21] Barros, R.P.; Machado, U.F.; Gustafsson, J.A. Estrogen receptors:
new players in diabetes mellitus. Trends. Mol. Med., 2006, 12(9),
425-431.
[22] Silva, J.L.; Giannocco, G.; Furuya, D.T.; Lima, G.A.; Moraes,
P.A.; Nachef, S.; Bordin, S.; Britto, L.R.; Nunes, M.T.; Machado
U.F. NF-kappaB, MEF2A, MEF2D and HIF1-a involvement on in-
sulin- and contraction-induced regulation of GLUT4 gene expres-
sion in soleus muscle. Mol. Cell. Endocrinol., 2005, 240(1-2), 82-
93.
[23] Furuya, D.T.; Poletto, A.C.; Favaro, R.R.; Martins, J.O.; Zorn,
T.M.; Machado, U.F. Anti-inflammatory effect of atorvastatin ame-
liorates insulin resistance in monosodium glutamate-treated obese
mice. Metabolism, 2010, 59(3), 395-399.
[24] Gasperi, V.; Fezza, F.; Pasquariello, N.; Bari, M.; Oddi, S.; Agrò,
A.F.; Maccarrone, M. Endocannabinoids in adipocytes during dif-
ferentiation and their role in glucose uptake. Cell. Mol. Life Sci.,
2007, 64(2), 219-229.
[25] Muraki, K.; Okuya, S.; Tanizawa, Y. Estrogen receptor alpha regu-
lates insulin sensitivity through IRS-1 tyrosine phosphorylation in
mature 3T3-L1 adipocytes. Endocr. J., 2006, 53(6), 841-851.
[26] Ben-Jonathan, N.; Chen, S.; Dunckley, J.A.; LaPensee, C.; Kansra,
S. Estrogen receptor-alpha mediates the epidermal growth factor-
stimulated prolactin expression and release in lactotrophs. Endocri-
nology, 2009, 150(2), 795-802.
[27] Lahm, T.; Crisostomo, P.R.; Markel, T.A.; Wang, M.; Wang, Y.;
Tan, J.; Meldrum, D.R. Selective estrogen receptor-alpha and es-
trogen receptor-beta agonists rapidly decrease pulmonary artery
vasoconstriction by a nitric oxide-dependent mechanism. Am. J.
Physiol., 2008, 295(5), R1486-R1493.
[28] Dos Santos, E.G.; Dieudonne, M.N.; Pecquery, R.; Le Moal, V.;
Giudicelli, Y.; Lacasa, D. Rapid nongenomic E2 effects on p42/p44
MAPK, activator protein-1, and cAMP response element binding
protein in rat white adipocytes. Endocrinology, 2002, 143(3), 930-
940.
[29] Chen, Y.H.; Lee, M.J.; Chang, H.H.; Hung, P.F.; Kao, Y.H. 17
beta-estradiol stimulates resistin gene expression in 3T3-L1 adipo-
cytes via the estrogen receptor, extracellularly regulated kinase, and
CCAAT/enhancer binding protein-alpha pathways. Endocrinology,
2006, 147(9), 4496-44504.
[30] Lucas, T.F.; Siu, E.R.; Esteves, C.A.; Monteiro, H.P.; Oliveira,
C.A.; Porto, C.S.; Lazari, M.F. 17beta-estradiol induces the trans-
location of the estrogen receptors ESR1 and ESR2 to the cell mem-
brane, MAPK3/1 phosphorylation and proliferation of cultured
immature rat Sertoli cells. Biol. Reprod., 2008, 78(1), 101-114.
[31] Andrews, N.C.; Faller, D.V. A rapid micropreparation technique
for extration of DNA-binding proteins from limiting numbers of
mammalian cells. Nucleic Acids Res., 1991, 19(9), 2499.
[32] Sweeney, G.; Somwar, R.; Ramlal, T.; Volchuk, A.; Ueyama, A.;
Klip, A. An inhibitor of p38 mitogen-activated protein kinase pre-
vents insulin-stimulated glucose transport but not glucose trans-
Estrogen Receptors and Slc2a4 Regulation
porter translocation in 3T3-L1 adipocytes and L6 myotubes. J.
Biol. Chem., 1999, 274(15), 10071-10078.
[33] Wang, Z.; Day, N.; Trifillis, P.; Kiledjian, M. An mRNA stability
complex functions with poly(A)-binding protein to stabilize mRNA
in vitro. Mol.Cell. Biol., 1999, 19(7), 4552–4560.
[34] Seraphim, P.M.; Nunes, M.T.; Giannocco, G.; Machado, U.F. Age
related obesity-induced shortening of GLUT4 mRNA poly(A) tail
length in rat gastrocnemius skeletal muscle. Mol. Cell. Endocrinol.,
2007, 276(1-2), 80-87.
[35] Alves-Wagner, A.B.; De Freitas, H.S.; De Souza, P.B.; Seraphim,
P.M.; Mori, R.C.; Machado, U.F. Beta-adrenergic activity pre-
serves GLUT4 protein in glycolytic fibers in fasting. Muscle Nerve,
2009, 40(5), 847-854.
[36] Brunetto, E.L.; Teixeira, S.S.; Giannocco, G.; Machado, U.F.;
Nunes, M.T. T3 rapidly increases SLC2A4 gene expression and
GLUT4 trafficking to the plasma membrane in skeletal muscle of
rat and improves glucose homeostasis. Thyroid, 2012, 22(1), 70-79.
[37] Stein, B.; Yang, M.X. Repression of the interleukin-6 promoter by
estrogen receptor is mediated by NF-kappa B and C/EBP beta. Mol.
Cell. Biol., 1995, 15(9), 4971-4979.
Received: June 28, 2012 Accepted: October 11, 2012
Current Topics in Medicinal Chemistry, 2012, Vol. 12, No. 19 2069
[38] Galien, R.; Garcia, T. Estrogen receptor impairs interleukin-6 ex-
pression by preventing protein binding on the NF-kappaB site. Nu-
cleic Acids Res., 1997, 25(12), 2424-2429.
[39] Hermansen, K.; Sondergaard, M.; Hoie, L.; Carstensen, M.; Brock,
B. Beneficial effects of a soy-based dietary supplement on lipid
levels and cardiovascular risk markers in type 2 diabetic subjects.
Diabetes Care, 2001, 24(2), 228-233.
[40] Bhathena, S.J.; Velasquez, M.T. Beneficial role of dietary phytoes-
trogens in obesity and diabetes. Am. J. Clin. Nutr., 2002, 76(6),
1191-1201.
[41] Kwon, D.Y.; Daily, J.W. 3rd.; Kim, H.J.; Park, S. Antidiabetic
effects of fermented soybean products on type 2 diabetes. Nutr.
Res., 2010, 30(1), 1-13.
[42] Kuiper, G.G.; Lemmen, J.G.; Carlsson, B.; Corton, J.C.; Safe, S.H.;
van der Saag, P.T.; van der Burg, B.; Gustafsson, J.A. Interaction
of estrogenic chemicals and phytoestrogens with estrogen receptor
beta. Endocrinology, 1998, 139(10), 4252-4263.