2.

Method and Result:

2.1. Sg-RNA designing.

We used Usinglin1 gene (chromosome 6), to design three gRNAs that target exon 1 oflin1.
The sequence was selected as a reference for studying the in-silico approach for the design of
sgRNA. Designing tools include integrated genomes of specific organisms with their Gene
IDs retrieved from the ENSEMBL, UCSC genome browsers. The candidate search of
genomic targets includes the 20-nucleotide gene sequence. It is unique compared to the rest
of the genome and the target sequence, which should be immediately upstream of a
Protospacer Adjacent Motif (PAM). By using an offline tool called serial cloner, this study
will analyze the lin1 gene as a query target sequence to select a potential target sequence that
meets the above two conditions.

We did use serial cloner to find out the specific sequence along with restriction enzyme from
sequence map. Serial Cloner initially requires a nucleotide sequence of a selected gene of
interest. Firstly, we have retrieved the full-length nucleotide sequence of candidate gene lin1
(Os06g0675200) of Oryza sativa L. subsp. japonica ‘Nipponbare’ genome from ENSAMBL
database and then fast it in a FASTA format in sequence box. Then we used find option in the
display to find (G-19nt-NGG) sequence in this box. After starting search, all the occurrences
of the sequence are displayed here that we looked for. The strand where the sequence has
been found is indicated (- or + strand). We can sort the occurrence according to their position,
to their size or to the strand where they were found upon clicking on the corresponding
header of the column. Then we select best three (23bp) target site in axon that contains a
recognition site of restriction enzyme by using sequence map option of serial cloner software.
The target site of the restriction enzyme should span the site of Cas9 cleavage within 6 bp at
3 bp upstream of PAM. This will allow us to use the restriction enzyme length polymorphism
(RFLP) assay for detecting mutation in the genome of Oryza Sativa.

Most sgRNA design tools apply the most fundamental basis for high on-target action, by
distinguishing all PAM sites for the predetermined Cas9. These tools have different degrees
of adaptability with respect to the genome and PAM site choices, and permit clients to enter
any gene of interest. A few design tools offer choices for selecting client-predefined PAMs
To suit elective Cas9 PAM prerequisites . Infact, more than one sgRNA is utilized for each target
as not all designed sgRNAs are effective even with the best efficacy-prediction tools
(Karlapudi et al., 2018).

The selected sgRNA sequences against the lin1(Os06g0675200) of Oryza sativa

No. of Sequence Position in Strand Exon Restriction Restriction Site

sgRNA Exon No Enzyme

01 GCCGGAGCCGGC 862-884 + 1 EcoRV 5'---GAT   ATC---3'

3'---CTA   TAG---5'
GATATCCAAGG
02 CCCGCGAGAACC 1211-1233 - 1 FauI 5′...CCCGCNNNNNNN... 3′
5′...GGGCGNNNNNN N...3′
CCCGGGAGAGC
03 CCCGCGCCGTCG 1701-1723 - 1 BsaWI 5'---W   CCGGW---3'
3'---WGGCC   W---5'
ACCGGTCATAC

Table 1: Representation of sgRNA with their position at the exon number-1 and restriction
site on the sequence(Yellow). IUPAC nucleotide code W means A or T.

Figure 3: Schematic representation of Lin1 gene with selected g-RNA. The lin1 gene are
2189bp long and contain only an exon. Three g-RNA are designed using serial cloner
software at different position of the exon such as 862-884, 1211-1233, 1701-1723.
2.2. Off-target Analysis.

Cas-OFFinder (Bae et al., 2014a) to rapidly identify potential off-target sites in a user-defined
genome. We used a simple brute-force approach to find potential off-target sites with a DNA
bulge. In short, the program inserts up to three additional ‘N’ nucleotides or deletes up to 3
nucleotides in the target sequence for identifying potential off-target sites with a DNA bulge.
It (Off-site targeting) is a critical issue for CRISPR/Cas9-mediated genome editing (Schaefer
et al., 2017). Luckily, various bioinformatics tools have been developed to computational
predictions of designed sgRNA for target specificity and any off-site targeting (Hameed et al.,
2019) to avoid knocking out genes that share the 20 bp target site or highly similar sites
putative off-target site. For this, we use the Cas-OFFinder program (Sangsu Bae et al., 2014).

In the case of SpCas9 Streptococcus pyogenes recognizes 5′-NGG-3′ PAM sequences, at first
Cas-OFFinder compiles all the 23-bp DNA sequences composed of 20-bp sequences
corresponding to the sgRNA sequence of interest and the 5′-NRG-3′ PAM sequences. Then
Cas-OFFinder compares all the compiled sequences with the query sequence and then counts
the number of mismatched bases in the 20-bp sgRNA sequence.

Cas-OFFinder is composed of two different OpenCL kernels (a searching kernel and a

comparing kernel) and C++ parts. For evaluating the performance of Cas-OFFinder, we first
chose arbitrary SpCas9 target sites in the human genome and ran CasOFFinder with query
sequences via CPU (Intel i7 3770K) or GPU (AMD Radeon HD 7870). As a result, running
time per target site was decreased as the number of target sites was increased. This result was
expected because the searching kernel works only once for many input targets. The speed of
CasOFFinder based on GPU (3.0 s) was 20 times faster than that of CPU (60.0 s) when 1000
target sites were analyzed. In conclusion, Cas-OFFinder enables searching for potential off-
target sites in any sequenced genome rapidly without limiting the PAM sequence or the
number of mismatched bases. These qualities make Cas-OFFinder applicable to ZFNs,
TALENs and transcription factors which are prone to off-target DNA recognition.
 Bulge Target Chromosome Direction Mismatch Bulge Number
Type size of
Found
Target

DNA crRNA: Chr-6 + 0 ⨯ 1

GCCGGAGCCGGCGATATCCANGG
  DNA:
GCCGGAGCCGGCGATATCCAAGG

DNA crRNA: Chr-6 - 0 ⨯ 1

GCTCTCCCGGGGGTTCTCGCNGG
  DNA:
GCTCTCCCGGGGGTTCTCGCGGG

DNA crRNA: Chr-6 - 0 ⨯ 1

GTATGACCGGTCGACGGCGCNGG
  DNA:
GTATGACCGGTCGACGGCGCGGG

2.3. Designing of doner sequence.

Among three Guide RNA (gRNA), one g-RNA protospacer sequences (1211bp-1233bp) was
selected. Transgenic constructs must have all the critical elements for gene expression to
occur, such as promoters, introns, the protein coding sequence of interest (cDNA or genome)
and transcription termination site like other plasmid constructs used to express proteins in a
transgenic plant.

The binary construct nos (Furtado and Henry, 2005) was used to prepare all the constructs
employed for rice transformation. To generate transcriptional fusions between the promoter
(35S) and the lin1 gene sequence, overlapping polymerase chain reaction (PCR) (Mike, 1989)
with Pfx polymerase was used (Heim andTsien, 1995; Patterson et  al., 1997).

As a positive control for constitutive expression, CaMV35S (Guilley et  al., 1982) was
included. The promoter–lin1 fragments were directionally cloned into the nos construct for
generating the relevant promoter construct suitable for Agrobacterium‐mediated
transformation. The correctness of all constructs was checked through sequence analysis
(Sanger et  al., 1977).

Donor sequences must also share perfect homology as the targeted locus should flank the
non-homologous sequences to be introduced into the genome. We use 750 bp homology arms
as they are sufficient to achieve HR in rice with high efficiency, yet they allow for the
detection of precise integration events by PCR amplification. However, we note the optimal
extent of homology arms has yet to be determined, and reports have found that longer
homology arms in donor molecules enhance the frequency of HR (Shin et al., 2014). To
create homology arms harboring sequences that are identical with the genomes to be targeted,
we should first identify a selected breeding population with absent or reduced polymorphism
bordering the nuclease target site and then PCR amplify sequences (from founder genomes).

Genomic DNA, for using as template to generate homology arms should be extracted from
breeding population which are likely to have uniform sequence in the region of the target site.
Typically, three PCR-amplified fragments are initially generated and then joined to vector
sequences by classical ligation methods in the preparation of a donor plasmid. Each
homology arm of about 750 bp is prepared by PCR amplification using high fidelity DNA
polymerase with primers that introduce at the ends of the arm’s appropriate restriction
enzyme recognition sequences.

Figure 4: Schematic representation of transgene integration into targeted site. The Transgene
TaSTRG is under the strong 35S promoter from cauliflower mosaic virus; TT, transcription
termination region from nos. The two DNA sequence that are homologous (each 750bp) to a
specific chromosomal region in the targeted sites. After the breakdown of targeted DNA by
Crispr/Cas9, the recombination between the homologous blocks of DNA on the vector and on
chromosomal DNA will integrate the transgene into the targeted site. RB, right border; LB,
left border.
3. Discussion

Rice is the staple food of millions of people around the world. Recently, the rice grain has
been the focus for a delivery system for nutritional bio-fortification (Datta et al., 2003) and
for edible vaccines (Hiroi and Takaiwa). Developing new rice varieties with higher and stable
yield across environments, climates and geographic locations is really needed. Availability of
rice genome will help in the discovery of genes that could be deployed for use in breeding or
transgenic approach for developing salt and drought tolerance rice. Mutation breeding can
and will have a significant contribution toward production of high-yielding, salinity tolerant
rice varieties. Recent studies identified knockout of lin1 gene associated with the grain length
and knocking of TaSTRG gene associated with the salt and drought tolerance in Triticum
aestivum that can provide significant breakthroughs in the development of salt and drought
tolerance rice.

To date, CRISPR/Cas9 system has been applied for basic research and trait development in
many plant species (Hooghvorst et al., 2019). We edit rice (Oriza sativa) genome by
CRISPR/Cas9 in this study. We executed this system to target the lin1 gene in rice, a
frameshift mutation in LIN1 gene results in increased grain length, the LIN1 protein functions
as a negative regulator. To improve our chances of success, we’ve designed gRNAs and
adapted an existing genetic transformation system in rice22. Another gene named TaSTRG is
selected in this study for knockin that showed higher salt and drought tolerance in Triticum
aestivum. It is predicted that functional knockin of TaSTRG gene at the specific site of
targeted gene by homologous recombination(HR) in rice and over expression of it will show
higher salt and drought tolerance than the control.

The LIN1 gene is consists of a single exon, spanning 1239 bp and encodes a protein with 412
amino acid residues. The gene product was annotated as “conserved hypothetical protein”.
No further information on its function was available in the rice annotation database, RAP-
DB. Protein domain analysis, using InterPro Scan showed that LIN1 encodes a protein
without significant homology to any proteins of known functions.

The highest LIN1 expression level was observed in the inflorescence. The LIN1 transcripts
were abundant in floral organs, such as the lemma, palea, pistil, ovary, and embryo. The
LIN1 transcripts were also detected in the leaf sheath, root, and stem. The analysis showed
that LIN1 is expressed in various tissues and organs, similar to other grain size–associated
genes like GW2 (Song et al. 2007) and GW6a (Song et al. 2015). The ubiquitous expression
pattern of LIN1 was consistent with the observation that lin1 plants show multiple phenotypic
changes, such as in grain length, plant height, and panicle length. A quantitative RT-PCR
experiments the LIN1transcript was most abundant in young panicles less than 1 cm in
length. According to these results, LIN1 functions mainly in young panicles, similar to GS3
(Takano-kai et al. 2009, Mao et al. 2010), GW8 (Wang et al. 2012), and GW7/SLG7 (Wang
et al.2015b, Zhou et al. 2015).

A BLAST-P search of the non-redundant protein sequences database indicated that LIN1
orthologs are widely conserved in both monocotyledonous and dicotyledonous plants, such as
Arabidopsis thaliana, Glycine max , Zea mays, Theobroma cacao, and Cucumissativus. An
ortholog was not found in the genomes of early diverging land plants (Selaginella
moellendorffii and Physcomitrella patens) and animals (Homo sapiens and Mus musculus)
(data notshown). These results shows that orthologs of rice LIN1 were conserved in seed
plants.

Multiple stresses, such as high salt, drought and low temperature are present in the
environment of plants, and plants are often affected by multiple stress. Different abiotic
stresses may have similar impacts on plant growth and development.

Many salt-induced calcineurinB like protein-interacting protein kinases (CIPKs)family genes

in rice can also be induced by drought and most ABA- or PEG-induced genes can be induced
by drought or high salt (Xiang et al., 2007). Therefore, genes induced by different stresses
can overlap (Xiong et al., 2002; Nambara andMarionPoll, 2005). In this study, the expression
of the TaSTRG gene under salt, drought, cold, and ABAtreatment was analyzed by real-time
quantitative PCR and the gene was found to be induced by a variety of stresses. Particularly,
TaSTRG expression increased over 4-fold in ABA treated leaves. ABA is an important plant
stress hormone and it participates in a number of abiotic stress reactions, so we presume that
the processes that TaSTRG gene responds to various stresses are likely to be ABA dependent.
For showing that the TaSTRG gene may play a role in improving stress tolerance of plants,
the gene was over-expressed in rice. The TaSTRG transgenic plants had higher survival rate,
FW and chlorophyll-content than the control plants after NaCl or PEGstress and thus
demonstrated higher stress tolerance.
Responding to environmental stresses, some plants accumulate soluble osmotic molecules,
such as proline (Liu and Zhu, 1997; Armengaud et al.,2004), betaine and soluble sugar
(Gupta and Kaur,2005) as osmoprotectants. Proline is known to be the most widely
distributed osmoprotectant. It has the highest water solubility among amino acids and it
functions to adjust osmotic balance under stress conditions, maintain stability of proteins,
membranes and subcellular structures and to remove reactive oxygen species. A large number
of studies have showed that the accumulation of proline is positively related to plant tolerance
to stresses (Kavi kishor et al., 1995; Honget al., 2000). Banu et al. (2009) have reported that,
proline and betaine protect plants from NaClinduced cell death, decreasing ROS
accumulation and lipid peroxidation. Besides,trehalose-overproducing transgenic rice plants
showed enhanced salt tolerance and maintained Na+/K+ homeostasis under salt stress (Garg et
al., 2002). According to present study, the TaSTRG over-expressing plants accumulated more
proline and soluble sugar than the control plants. The increase may partially explain the
enhanced drought and salt tolerance in TaSTRG over-expressing plants. Plants accumulate a
large amount of proline under stress conditions including drought, high salt, high
temperature, freezing, heavy metals & ultraviolet radiations.

This study assessed the farming patterns and farmers’ livelihood in coastal regions of our
country and improvement of it by genome editing via Crispr/Cas technology. Generally, the
farming system of coastal region is shrimp based. The major field crop was rice. During
kharif-I and rabi season, the salinity intensity becomes higher and farmers do not cultivate
‘aush’ and ‘boro’ rice in the coastal regions. Through surveyed regions lower crop production
was observed due to lower productivity of land caused by salinity. Crops, fish and livestock
were seriously damaged by the processes of shrimp cultivation. The labour hour spent by
both men and women has increased for shrimp cultivation in coastal
regions. Finally, it can be suggested that, proper planning, regulation and motivation of the
farmers are really needed to develop environment friendly crops farming along with
maintaining sustainable agricultural production practices in the coastal belt of Bangladesh
(Uddin & Nasrin, 2014). In Bangladesh, BR23, BRRI dhan41, BRRI dhan40, BRRI dhan53
and BRRI dhan54 have so far been released as salinity tolerant varieties with having high
yield potential, lodging tolerance and 10-38 days shorter growth duration compared to the
traditional rice varieties of wet season. The development of BRRI dhan47, BINA dhan8,
BRRI dhan53 and BRRI dhan55 has changed the rice cultivation scenario in Bangladesh in
the dry season. BRRI dhan47 can easily tolerate salt stress. The potential yield of the varieties
ranged from 5.4 to 8.3 t/ha in different saline prone areas. In this study, we selected TaSTRG
from wheat that show salt and drought tolerance in wheat is functionally knockin in rice by
homologous recombination using sg-RNA designed to target the specific site in rice genome.

Ref:
Karlapudi, A. P., Venkateswarulu, T. C., Tammineedi, J., Srirama, K., Kanumuri, L., & Kodali, V. P.
(2018). In silico sgRNA tool design for CRISPR control of quorum sensing in Acinetobacter
species. Genes & diseases, 5(2), 123-129.https://doi.org/10.1016/j.gendis.2018.03.004

Furtado, A., Henry, R. J., & Takaiwa, F. (2008). Comparison of promoters in transgenic rice. Plant
biotechnology journal, 6(7), 679-693.https://doi.org/10.1111/j.1467-7652.2008.00352.

Datta, K., Baisakh, N., Oliva, N., Torrizo, L., Abrigo, E., Tan, J., ... & Datta, S. K. (2003).
Bioengineered ‘golden’indica rice cultivars with β‐carotene metabolism in the endosperm with
hygromycin and mannose selection systems. Plant Biotechnology Journal, 1(2), 81-
90.https://doi.org/10.1046/j.1467-7652.2003.00015.

Hiroi, T., & Takaiwa, F. (2006). Peptide immunotherapy for allergic diseases using a rice-based edible
vaccine. Current opinion in allergy and clinical immunology, 6(6), 455-
460.https://doi.org/10.1097/01.all.0000246621.34247.fa

Li, X., Ma, S., Shan, N., Zhang, X., & Sui, X. (2017). A protocol for Agrobacterium-mediated
transformation of cucumber (Cucumis sativus L.) from cotyledon
explants.https://doi.org/10.1038/protex.2017.107

Hooghvorst, I., López-Cristoffanini, C., & Nogués, S. (2019). Efficient knockout of phytoene
desaturase gene using CRISPR/Cas9 in melon. Scientific reports, 9(1), 1-7.
https://doi.org/10.1038/s41598-019-53710-4
Mao, H., Sun, S., Yao, J., Wang, C., Yu, S., Xu, C., ... & Zhang, Q. (2010). Linking differential domain
functions of the GS3 protein to natural variation of grain size in rice. Proceedings of the National
Academy of Sciences, 107(45), 19579-19584. https://doi.org/10.1073/pnas.1014419107

Uddin, M. T., & Nasrin, M. (2013). Farming practices and livelihood of the coastal people of
Bangladesh. Progressive Agriculture, 24(1-2), 251-262.https://doi.org/10.3329/pa.v24i1-2.19177