Article

pubs.acs.org/est

Response of Aerobic Granular Sludge to the Long-Term Presence of

CuO NPs in A/O/A SBRs: Nitrogen and Phosphorus Removal,
Enzymatic Activity, and the Microbial Community
Xiao-ying Zheng,*,†,‡ Dan Lu,‡ Wei Chen,†,‡ Ya-jie Gao,‡ Gan Zhou,‡ Yuan Zhang,‡ Xiang Zhou,‡
and Meng-Qi Jin‡
†
Ministry of Education Key Laboratory of Integrated Regulation and Resource Development on Shallow Lakes, Hohai University,
Nanjing 210098, PR China
‡
College of Environment, Hohai University, Nanjing 210098, PR China
See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.
Downloaded via ECOLE POLYTECHNIQUE MONTREAL on July 1, 2020 at 00:47:43 (UTC).

*
S Supporting Information

ABSTRACT: The increasing use of cupric oxide nanoparticles

(CuO NPs) has raised concerns about their potential environmental
toxicity. Aerobic granular sludge (AGS) is a special form of microbial
aggregates. In this study, the removal efficiencies of nitrogen and
phosphorus, enzyme activities and microbial community of AGS
under long-term exposure to CuO NPs (at concentrations of 5, 20,
50 mg/L) in aerobic/oxic/anoxic (A/O/A) sequencing batch
reactors (SBRs) were investigated. The results showed the chronic
toxicity caused by different concentrations of CuO NPs (5, 20, 50
mg/L) resulted in increases in the production of ROS of 110.37%,
178.64%, and 188.93% and in the release of lactate dehydrogenase
(LDH) of 108.33%, 297.05%, 335.94%, respectively, compared to
the control. Besides, CuO NPs decreased the activities of
polyphosphate kinase (PPK) and exophosphatase (PPX), leading to lower phosphorus removal efficiency. However, the
NH4+-N removal rates remained stable, and the removal efficiencies of TN increased due to the synthesis of nitrite and nitrous
oxide (N2O) reductases. In addition, CuO NPs at concentrations of 0, 5, 20 mg/L increased the secretion of protein (PN) to 90,
91, 105 mg/gVSS, respectively, which could alleviate the toxicity of CuO NPs. High-throughput sequencing showed that CuO
NPs increased the abundance of nitrogen-removal bacteria and reduced the abundance of phosphorus-removal bacteria, which is
consistent with the results of pollutant removal upon long-term exposure to CuO NPs.

1. INTRODUCTION fore, it is necessary to explore the potential impacts of CuO

Because of the unique physicochemical properties of cupric
oxide nanoparticles (CuO NPs), they have been widely utilized
in various fields, such as in gas sensors, wood preservation,
antimicrobial textiles, batteries, catalytic processes, marine
antifouling, plastics, and metallic coating.1,3,2 However, the
negative impacts of CuO NPs on organisms and cell tissue
injury have attracted extensive attention because of their
nanometer size and specific properties, for instance, strong
adsorption capacity and high chemical activities. CuO NPs also
have shown evident toxicity in bacteria,1 algae,4 yeast,
protozoa,5 mammalian cells,6 and Daphnia magna.7 Some
studies also pointed out that CuO NPs can damage organisms
at the cellular, protein, and gene levels.8 At the same time,
nanomaterials can lead to significant pulmonary disease, when
people inhale them.
Meanwhile, CuO NPs are inevitably released into industrial
and municipal wastewater owing to the rapid increases in their
production and applications.9 The nanomaterials adsorbed by
activated sludge will have a detrimental effect on the growth of
some microorganisms in wastewater treatment plants. There-
NPs on biological wastewater treatment systems with different
types of activated sludge, which are crucial to a normal
ecosystem. In general, there are two different types of activated
sludge in sewage treatment: the flocculent form, such as
flocculent sludge, and the aggregate form, for instance, biofilms
and granular sludge. Different types of sludge may respond
differently to the presence of nanoparticles due to their varying
structures and microbial properties. Hou et al.10 found that the
presence of CuO NPs had an impact on the flocculating ability
of flocculent sludge because it affected the composition of
extracellular polymeric substances (EPS). Moreover, CuO NPs
decreased the nitrogen and phosphorus removal rates and
microbial enzymatic activities of flocculent sludge.11 Besides,
studies have shown that the acute toxicity response mechanism
of a biofilm to CuO NPs exposure is different from that of
Received: May 30, 2017
Revised: August 13, 2017
Accepted: August 23, 2017
Published: August 23, 2017

© 2017 American Chemical Society 10503 DOI: 10.1021/acs.est.7b02768

Environ. Sci. Technol. 2017, 51, 10503−10510
Environmental Science & Technology
flocculent sludge because of the denser and stronger microbial
aggregate structure of a biofilm under short-term exposure (24
h).12 Researchers elsewhere13 also pointed out that short-term
exposure (8 h) to 1 and 50 mg/L CuO NPs induced negligible
effects on the nitrogen-removal efficiency in a sequencing batch
biofilm reactor (SBBR). On the contrary, aerobic granular
sludge (AGS) is rich in microbial populations with different
functions due to the different intraparticle oxygen environ-
ments, and has a dense structure that enhances the internal
bacterial resistance to external toxic substances. As far as we
know, little information is available that enables evaluation of
the long-term effects of CuO NPs on the performance
(nitrogen- and phosphorus-removal rates), microbial enzymatic
activities and microbial community of AGS. Furthermore,
previous studies have rarely focused on the toxicity of CuO
NPs toward AGS in an anaerobic−oxic−anoxic (A/O/A)
sequencing batch reactor (SBR).
Therefore, the major purposes of this study were: (i) to
display the long-term (90-d) effects of CuO NPs on the
nitrogen and phosphorus removal, microbial activities and
microbial enzymatic activities of AGS in an A/O/A SBR; (ii) to
investigate the integrity of the cells and oxidative stress induced
by CuO NPs via measurements of lactate dehydrogenase
(LDH) and reactive oxygen species (ROS); (iii) to evaluate the
variations in microbial richness and diversity in the aerobic
granular sludge at different CuO NPs concentrations through
high-throughput sequencing. This study will provide detailed
information on the impacts of chronic CuO NPs exposure on
the special microbial aggregate of AGS.
2. MATERIALS AND METHODS
2.1. Preparation of CuO NPs Suspension. CuO NPs
were obtained from Shanghai Sigma-Aldrich Trading Co., Ltd.
The morphology of aggregated CuO NPs was observed by
scanning electron microscopy (SEM), which showed CuO NPs
had an average particle diameter of about 50 nm (Figure S1).
The preparation of a CuO NPs stock solution was carried out
using the ultrasonic method,14 and the steps can be
summarized as follows: 500 mg CuO NPs were put into 1 L
of Milli-Q water and followed by 1 h of ultrasonication (25 °C,
120 W, 40 kHz) to obtain a 500 mg/L stock solution. Then the
CuO NPs stock solution was diluted to 5, 20, 50 mg/L prior to
use.
2.2. Set-up and Operation of the Granular SBR. The
inoculated AGS for the CuO NPs exposure experiments was
obtained from a laboratory culture of 2 months, and it had an
average particle diameter of 1.50 mm. The experiments were
carried out in SBRs with inner diameters of 120 mm, heights of
700 mm and volume exchange ratios of 60%, giving an effective
volume of 7 L. The quantity of mixed liquor suspended solids
(MLSS) of AGS in each reactor was 3 g/L. The AGS was fed
with synthetic wastewater, which was composed of (mg/L):
COD 400 (sodium acetate), NH4+-N 50 (NH4Cl), PO43−-P 10
(KH2PO4), CaCl2 10, MgSO4 50 and 5 mL of a concentrated
trace elements solution (mg/L) containing H3BO4 1.16,
FeSO4·7H2O 2.78, ZnSO4·7H2O 1.25, MnSO4·H2O 1.69,
CuSO4·5H2O 0.38, CoCl2·6H2O 0.15, and MoO3 0.10.
Solutions with CuO NPs concentrations of 5, 20, 50 mg/L
were added to three SBRs during the feeding period, while the
control reactor received no CuO NPs. These reactors were
operated on a 6-h cycle, consisting of feeding (10 min),
anaerobic phase (90 min), aerobic phase (140 min), anoxic
phase (116 min), settling time (2 min), and effluent discharge
10504
Article
periods (2 min). The air was supplied by a fine-bubble aerator
connected to the bottom of each reactor with an airflow of 2 L/
min, and the dissolved oxygen (DO) concentration was stable
at about 5.0 mg/L during the aerobic stage. The temperature
was controlled at 20 ± 3 °C, and the pH was maintained
between 7 and 8.
2.3. Determination of Key Enzyme Activities in the
AGS. Biological nitrogen removal processes include ammoni-
fication, nitrification, and denitrification, and the latter two
especially have pivotal roles in the process. Generally,
autotrophic ammonia oxidizing bacteria (AOB) uses ammonia
monooxygenase (AMO) to catalyze ammonia oxidation,
followed by the oxidation of nitrite to nitrate via nitrite
oxidoreductase (NOR) in nitrite oxidizing bacteria (NOB).
Finally, denitrification is catalyzed by nitrate reductase (NR)
and nitrite reductase (NIR). And exophosphatase (PPX) and
polyphosphate kinase (PPK), which are closely related to
biological phosphorus removal, can hydrolyze and synthesize
phosphorus during the anaerobic and anoxic phases,
respectively. Therefore, AMO, NOR, NR, NIR, PPX, and
PPK play significant roles in biological nitrogen and
phosphorus removal, and the methods of measurement of the
activities of these enzymes have been described in the
literature.15,16
2.4. Determination of ROS Production and LDH
Release in the AGS. The production of intracellular ROS
can be used to evaluate the extent of oxidative stress caused by
CuO NPs. The amount of extracellular LDH released can be
used to evaluate the integrity of the cell membranes. Hence,
ROS release and LDH production can measure the toxic
mechanisms of CuO NPs after long-term exposure. The
intracellular ROS production was determined according to the
literature.17 In short, AGS samples were first washed with
phosphate buffer solution (PBS) three times; then the particles
(wet weight 15 mg) were resuspended in 0.1 M phosphate
buffer containing 20 M dichlorodihydrofluorescein acetate at 35
± 1 °C in the dark for 30 min; the particles were harvested by
centrifugation and suspended in 0.1 M phosphate buffer and
inoculated in a 96-hole plate. The fluorescein DCF generated
was measured after 30 min using a microplate reader (Tecan
InfiniteM200, Switzerland) with 485 nm excitation and 520 nm
emission filters. LDH is used to characterize the integrity of the
cell membrane, and the LDH level was determined according
to previous research.18
2.5. Evaluation of the Microbial Community in the
AGS. First, triplicate samples were collected from each SBR
reactor for high-throughput sequencing in order to ensure the
integrity of the AGS samples. Genomic DNA of the mixed AGS
sample was extracted directly with the E.Z.N.A. Tissue DNA kit
(Omega Biotek, Norcross, GA, USA) according to the
manufacturer’s instructions. The extracted DNA samples were
stored at −20 °C until use. Then, partial 16S rDNA based on
high-throughput sequencing was used to determine the
microbial diversity and composition of each AGS sample.
PCR amplification was based on the primers 341F
(CCCTACACGACGCTCTTCCG ATCTGCC-
TACGGGNGGCWGCAG) and 805R (GACTG-
GAGTTCCTTGGC ACCCGAGAATTCCAGACTACHVG
GGTATCTAATCC) in the V3 and V4 regions of 16S rDNA .
Bacterial communities were measured by Illumina high-
throughput sequencing technology, which was conducted by
Sangon Biotech (Shanghai) Co., Ltd.
DOI: 10.1021/acs.est.7b02768
Environ. Sci. Technol. 2017, 51, 10503−10510
Environmental Science & Technology Article

Operational units (OTUs) were clustered with a 97%

similarity cutoff using UPARSE (version 7.1 http://drive5.
com/uparse/), and chimeric sequences were identified and
removed using UCHIME. The sequences were systematically
classified using the RDP classifier and assigned to different
levels. Besides, the phylogenetic relationships of each 16S
rRNA gene sequence were analyzed by RDP classifier against
the silva (SSU115) 16S rRNA database using a confidence
threshold of 70%. Coverage, Shannon, Chao, ACE, and
Simpson indexes were generated in MOTHUR for each AGS
sample. A Venn diagram with shared and unique OTUs was
used to describe the similarities and differences between AGS
samples at different CuO NPs concentrations.
2.6. Other Analytical Methods and Statistical Analysis.
The concentration of copper ions in the solution was measured
by inductively coupled plasma spectrometry (ICP-AES, Spectro
Arcoss Eop, Germany). The granule size was measured using a
particle-size analyzer (Mastersizer 2000, England). The surface
of the AGS was observed by scanning electron microscopy
(SEM, S4800, Hitachi, Japan). EPS was extracted with the
cationic resin extraction method. In addition, methods used to
measure the soluble protein (PN) and polysaccharide (PS)
contents of the EPS extraction were the Coomassie Brilliant
Blue and anthracene−Cu methods, respectively. The proce-
dures for determining COD, TN, NH4+-N, NO3−-N, NO2−-N,
TP, MLVSS, and SVI are detailed in the Standard Methods
(APHA, 2005). The pH and DO were measured using a pHS-
25 m and YSI5000 m. All assays were performed in triplicate, an
analysis of variance (ANOVA) was used to test the significance Figure 1. Effects of CuO NPs on the removal of (a) COD (solide)
of the results and p < 0.05 was considered to be statistically and NH4+-N (hollow), (b) TN, (c) TP, (d) MLVSS, (e) SVI, and (f)
significant. granule size in the AGS reactors.

3. RESULTS AND DISCUSSION
3.1. Reactor Performance and Sludge Properties
during CuO NPs Exposure. Some studies have shown that
the important reasons for the effects of CuO NPs on biological
nitrogen and phosphorus removal are nanosize effect and the
release of copper ions (Cu2+) from CuO NPs.19 In our
experiments, the average concentrations of the released Cu2+
were 0.08, 0.19, and 0.27 mg/L at CuO NPs concentrations of
5, 20, and 50 mg/L, respectively (Figure S2). The performance
of the AGS reactors and sludge properties in response to the
long-term exposure to CuO NPs were determined, and the
results are presented in Figure 1.
The average removal efficiencies of COD and ammonia
nitrogen in the AGS reactors at CuO NPs concentrations of 5,
20, and 50 mg/L were almost the same as the control reactor
throughout the whole operation period (Figure 1a,b),
remaining at about 97% and 91%, respectively, at the end of
the exposure. The average removal efficiency of total nitrogen
(TN) at CuO NPs concentrations of 5 mg/L was almost the
same as that of the control reactor (Figure 1c). However, with
increased concentrations of CuO NPs (20 and 50 mg/L), the
TN removal rates increased to 80.62% and 81.68%,
respectively, when the removal rate of the control was
76.09%. It can be easily seen that the increase in Cu2+
enhances the effects of CuO NPs on TN removal. It is
known that copper is responsible for the positive synthesis and
activation of nitrite reductase (CuNIR) and N2O reductase.
CuNIR folds into a homotrimeric structure with two distinct
Cu-binding sites and can catalyze the conversion of nitrite to
nitric oxide (NO2− to NO), and N2O reductase is the enzyme
catalyzing the final step of bacterial denitrification (i.e., reducing
10505
N2O to N2).20 Therefore, when the growth conditions of the
sludge lacked Cu2+, the denitrifying process was inhibited,
resulting in the accumulation of NO2−-N and N2O.21 However,
it has been found that the impacts of ZnO NPs and AgO NPs
on the activities and functions of the bacteria in AGS reactors
are different from that of CuO NPs.22,23 And ZnO NPs and
AgO NPs show some suppressor effects on the AGS. At the end
of operation (on day 90), the total phosphorus (TP) removal
efficiencies had dropped to 74.01%, 53.19%, and 69.53%
because of the increased CuO NPs concentrations of 5, 20, and
50 mg/L, respectively, much lower than the control (77.46%)
(Figure 1d). These data indicate that high CuO NPs
concentrations had chronic toxic effects on biological
phosphorus removal.
Figure 1e demonstrates that the biomass at a low CuO NPs
concentration of 5 mg/L was basically the same as that of the
control reactor, while the reactors fed with 20 and 50 mg/L
CuO NPs had biomasses of 3.40 and 3.39 gMLVSS/L,
respectively, slightly lower than the control (3.89 gMLVSS/
L). These data indicate that long-term CuO NPs exposure
brought down the biomass production in AGS reactors, which
was a similar trend to the effect of chronic toxicity of CuO NPs
on biological phosphorus removal.
The sludge volume index (SVI) is an important indicator of
sludge settling performance. With the increased concentrations
of CuO NPs (5, 20, and 50 mg/L), the SVI decreased to 28.81,
25.20, and 23.85 mL/g, respectively, as compared to the control
(29.13 mL/g) (Figure 1f), which indicates an improvement in
AGS settling ability. The settling ability of the biofilm in
response to exposure to CuO NPs was enhanced, which was
similar to the results of the AGS. 12 However, high
DOI: 10.1021/acs.est.7b02768
Environ. Sci. Technol. 2017, 51, 10503−10510
Environmental Science & Technology
concentrations of CuO NPs resulted in the deterioration of the
settling ability of flocculent sludge.11 And the average particle
size of the AGS increased with increased CuO NPs
concentrations (5, 20, and 50 mg/L) to 1.92, 2.21, and 2.58
mm, respectively, when the average particle size of the control
was 1.59 mm (Figure 1g). This phenomenon can be explained
by the following: more CuO NPs accumulated in the AGS with
the extension of exposure time, resulting in chronic toxicity
toward the microbial cells and more extracellular DNA
production in the EPS matrix, which in turn could induce
more cells to be adsorbed and accumulate on the surface of the
AGS.
In general, the AGS maintained good endurance with long-
term exposure to CuO NPs and preserved its particle size,
shape, sedimentation, and good effluent qualities (especially
TN).
3.2. Influences of CuO NPs on the Transformations of
Nitrogen and Phosphorus. The removal efficiencies of
NH4+-N were nearly the same in the four reactors during one
cycle (Figure 2a), which almost corresponded with the NH4+-N
removal efficiencies during the long-term (90-d) exposure.
Figure 2. (a) Effects of CuO NPs on the variations of (a) NH4+-N
(color) and NO2−-N (black), (b) TP (color), and NO3−-N (black)
during one cycle after long-term (90d) exposure. Error bars represent
standard deviations of triplicate measurements. (b) Effects of CuO
NPs on the variations of (a) NH4+-N (color) and NO2−-N (black), (b)
TP (color) and NO3−-N (black) during one cycle after long-term (90-
d) exposure. Error bars represent standard deviations of triplicate
measurements.
10506
Article
However, there were significant differences in the variations of
NO2−-N, NO3−-N and TP at different concentrations of CuO
NPs during one cycle. For example, with the increased
concentrations of CuO NPs (5, 20, and 50 mg/L), the
NO2−-N and NO3−-N values were 0.26 and 8.61, 0.15 and 5.33,
0.07, and 4.85 mg/L, respectively, at the end of the anoxic
stage, when the concentrations of NO2−-N and NO3−-N were
0.32 and 12.19 mg/L in the control (Figure 2a). These data
indicate that the CuO NPs could reduce the accumulation of
NO2−-N and NO3−-N. Obviously, the positive effects of CuO
NPs on the removal of TN mainly occurred in the
denitrification stage, which is consistent with the above results
that the copper was beneficial for the syntheses involving
CuNIR and N2O reductase that catalyze the conversion of
NO2− to NO and N2O to N2, respectively.20
Nevertheless, the different variations in TP during one cycle
were mainly due to the different amounts of phosphorus
released during the anaerobic phase (Figure 2b). The maximum
amounts of phosphorus release dropped with increased CuO
NPs concentrations (5, 20, and 50 mg/L) to 46.01, 33.97, and
34.77 mg/L, respectively, at the end of the anaerobic stage,
when the phosphorus release of the control was 46.33 mg/L
(Figure 2b). Thus, CuO NPs had an obvious inhibitory effect
on phosphorus release in the anaerobic stage. A possible reason
may be that CuO NPs can inhibit the conversion of the carbon
source to polyhydroxyalkanoates (PHA). In turn, lower
amounts of carbon source were consumed for phosphorus
removal, and higher amounts of carbon source would be left for
denitrification, which would also be one of the reasons why
CuO NPs promotes TN removal.
3.3. Effects of CuO NPs on the Microbial Enzymatic
Activities of AGS. The performances of biological nitrogen
and phosphorus removal are closely related to the activities of
some enzymes, for example AMO and NOR play a significant
role in nitrification, and NR and NIR are two important
enzymes in denitrification. Besides, the activities of PPX and
PPK are related directly to phosphorus removal. As shown in
Figure 3a, CuO NPs had no obvious impact on the activities of
AMO and NOR, which could explain why NH4+-N levels did
not change significantly during one cycle. However, CuO NPs
had a positive role in the production of NR and NIR, and
caused the inhibition of PPX and PPK activities. When the
concentrations of CuO NPs were 0, 5, 20, 50 mg/L, NR and
NIR increased from 0.022 and 0.139 to 0.024 and 0.147, 0.028
and 0.167, 0.03 (μmol NO2−-N/mg protein·min) and 0.17
(μmol NO2−-N/mg protein·min) (Figure 3a), respectively.
These results show that CuO NPs could improve denitrification
in the AGS by promoting the synthesis of NR and NIR to
decrease the accumulation of NO2−-N and NO3−-N. Con-
versely, with the increased concentrations of CuO NPs (0, 5,
20, 50 mg/L), the PPK and PPX activities decreased from
0.214 and 0.037 to 0.201 and 0.035, 0.143 and 0.026, 0.093
(μmol NADPH/ (min·mg protein)) and 0.021 (μmol p-
nitrophenol/(min·mg protein)) (Figure 3b), respectively.
These data indicate that CuO NPs were inversely related to
the production of the PPK and PPX. The variational tendencies
of PPK and PPX were in accordance with the removal rates of
TP during the long-term exposure to CuO NPs.
3.4. Assessment of the Toxicity of the CuO NPs
toward the AGS. It is well-known that poorly biodegraded
and toxic substances, such as nanomaterials, are removed by
adsorption onto the AGS, leading to the accumulation of
nanomaterials on the surface of the AGS.24 Compared with the
DOI: 10.1021/acs.est.7b02768
Environ. Sci. Technol. 2017, 51, 10503−10510
Environmental Science & Technology Article

Figure 4. Relative ROS production and LDH release for AGS at

different CuO NPs concentrations. Asterisks indicate statistical
differences (p < 0.05) from the controls. Error bars represent standard
deviations of triplicate measurements.

respectively, compared to the control (100%). And the

variations in LDH and ROS of the biofilm and flocculent
sludge in response to exposure to CuO NPs were consistent
with our experimental results.11,12 These data show that high
CuO NPs concentrations resulted in a serious imbalance
between the levels of oxidation and antioxidation in the AGS.
Bacteria secrete EPS as a barrier against toxic substances in
response to long-term exposure to NPs. Meanwhile, EPS plays
a significant role in maintaining the structure and stability of the
Figure 3. (a) Microbial enzymatic activities of AGS at different CuO AGS, which is composed of proteins (PN) and polysaccharides
NPs concentrations: AMO, NOR, NR, and NIR Asterisks indicate (PS). Therefore, it is particularly important to analyze the
statistical differences (p < 0.05) from the controls. Error bars represent variations in EPS in the AGS. In this experiment, the contents
standard deviations of triplicate measurements. (b) Microbial of EPS secreted by the AGS were measured under different
enzymatic activities of AGS at different CuO NPs concentrations: concentrations of CuO NPs on day 90 after long-term
PPK and PPX. Asterisks indicate statistical differences (p < 0.05) from exposure. The concentrations of PS remained stable at about
the controls. Error bars represent standard deviations of triplicate 71 ± 2 mg/gVSS at different levels of CuO NPs exposure (0, 5,
measurements. 20 mg/L), while the concentrations of PN increased
significantly to 90, 91, and 105 mg/gVSS, respectively (Figure
control reactor, the surface of the AGS with a CuO NPs 5). Thus, the ratio of PN to PS (PN/PS) also grew
concentration of 50 mg/L added accumulated a large amount dramatically. One possible explanation for the elevated PN
of CuO NPs (Figure S3). And EDX elemental analysis showed could be the induction of heat shock-like proteins as a defense
that the amounts of CuO NPs absorbed by the AGS increased mechanism against high heavy metal ion concentrations.25
from 0.10% to 0.17%, 0.20%, 0.24% with increasing
concentrations of CuO NPs of 0, 5, 20, 50 mg/L, respectively.
CuO NPs on the surface of the AGS could induce oxidative
damage in the microorganisms, leading to a loss of integrity of
the cell membrane. And lactate dehydrogenase (LDH) is a type
of endoenzyme that can be released to the extracellular region
when the cytomembrane is inflicted with serious damage.
Therefore, the amounts of LDH release can be used to
represent these injuries to the cytomembrane. Compared to 0
mg/L, the LDH increased by 108.33%, 297.05%, 335.94% at 5,
20, 50 mg/L CuO NPs (Figure 4), respectively. Obviously, high
concentrations of CuO NPs could destroy the cytomembrane
integrity of microorganisms in the AGS, releasing cellular
contents into the extracellular region and resulting in excessive
production of reactive oxygen species (ROS). Meanwhile,
excessive production of ROS would destroy the balance of
oxidation and antioxidation within the cells, leading to excessive
oxidation of DNA, lipids, proteins and other molecules, and Figure 5. Effects of CuO NPs on EPS concents of AGS on the 90th
affecting the metabolic functions of the organisms. As shown in day. Asterisks indicate statistical differences (p < 0.05) from the
Figure 4, with the increased concentrations of CuO NPs (5, 20, controls. Error bars represent standard deviations of triplicate
50 mg/L), the ROS increased to 110.37%, 178.64%, 188.93%, measurements.

10507 DOI: 10.1021/acs.est.7b02768

Environ. Sci. Technol. 2017, 51, 10503−10510
Environmental Science & Technology Article

Table 1. Similarity-Based OTUs and Species Richness and Diversity Estimates for Microbial Communities in SBR at Different
CuO NPs Concentrations
CuO NPs concentrations (mg/L) OTUsa coverageb Chaoc Acec Shannond Simpsond
R1 (0) 2579 0.996 23597.12 53929.31 3.93 0.11
R2 (5) 2257 0.995 19908.92 44721.42 4.21 0.08
R3 (20) 2139 0.996 16372.78 32305.17 3.76 0.12
R4 (50) 1824 0.996 15704.21 31641.58 2.91 0.28
a
OTUs: Operational taxonomic units. bCoverage: Estimates the possibility that the next read will belong to a specific OTU. cChao/Ace diversity
estimator: Total amount of OTUs estimated by infinite sampling. A higher number reflects more diversity. dShannon/Simpson richness index: Index
to characterize species richness. A higher level represents higher richness.

However, when the CuO NPs concentration was 50 mg/L, the

concentrations of PS and PN decreased substantially to 36 and
74 mg/gVSS, respectively. This was the reason why the toxicity
caused by high concentrations of CuO NPs resulted in a large
number of cellular deaths in the AGS, which is consistent with
the substantial release of LDH and the overproduction of ROS.
3.5. Effects of CuO NPs on the Microbial Community
of the AGS. Under the different concentrations of CuO NPs
(0, 5, 20, 50 mg/L), the microbial community was analyzed
through high-throughput sequencing, and effective sequences
of the AGS in the four reactors were 49863, 42075, 34826, and
37083 genomes, respectively. Meanwhile, the effective
sequences for the 0, 5, 20, 50 mg/L concentrations of CuO
NPs were divided into 2579, 2257, 2139, and 1824 operational
taxonomic units (OUT), respectively, based on the similarities
of the domain values (0.97) (Table 1). The Good’s coverages
of the four samples were all higher than 99% (Table 1),
indicating that the microbial diversities were basically covered
by the obtained sequence libraries. The richness and diversity
of the microorganisms at different concentrations of CuO NPs
could be indicated by the Chao, Ace, Shannon, and Simpson
indexes in Table 1. The results show that high CuO NPs
concentrations reduced the diversity and richness of the
microbial community, which was contrary to the decrease in
microbial diversity of the biofilm in response to short-term
exposure to CuO NPs.12 Moreover, the similarities and
differences among the microbial communities were compared
via a Venn diagram (Figure S4).
To better characterize the differences of the functional
bacteria in nitrogen and phosphorus removal among the four
AGS samples, the microbial communities of the AGS were Figure 6. Heat-maps of the identified genus for the four AGS samples
analyzed at the genus level. The heat-maps of the genus levels at the end of the exposure. R1, R2, R3, and R4 represent the control
showed that the prevailing genera in the four AGS samples test, 5 mg/L CuO NPs, 20 mg/L CuO NPs, and 50 mg/L CuO NPs,
were Zoogloea (43.28−57.90%), Nitrospira (2.22−8.80%), respectively.
Dechloromonas (1.02−6.00%), Def luviimonas (0.31−8.13%),
Gemmatimonas (2.03−2.99%), and Tepidisphaera (1.05− the CuO NPs concentrations (Table S1). Thermomonas and
2.82%) (Figure 6). It can be seen that Zoogloea was present Flavobacterium are able to convert nitrite into N2,27 and their
in the largest proportion (about 50%), which was associated relative abundances increased from 0.73% and 0.27% to 1.68%
with the resistance to heavy metal ions. Therefore, with the and 0.62%, 2.84% and 0.82%, 3.78%, and 0.94%, respectively,
increase in CuO NPs concentrations, AGS increased the with the increased concentrations of CuO NPs (0, 5, 20, 50
resistance of the sludge system to the CuO NPs toxicity, mg/L). In addition, anaerobic ammonium oxidizing bacteria
resulting in a slight increase in the relative abundance of the (Gemmata) were found in the reactors. It can be seen that the
Zoogloea. However, the relative abundance of the Zoogloea in addition of CuO NPs increased the abundance of nitrogen-
the biofilm in response to short-term exposure to CuO NPs removal bacteria, which also proves that CuO NPs promote
decreased because of its weakly antitoxic activity.12 Besides, nitrogen removal from another angle. The genera Acinetobacter
there were significant differences in nitrogen- and phosphorus- and Pseudomonas, which have phosphorus-removal ability,
removal bacteria at the genus level (Figure 7). Nitrosomonas displayed decreasing relative abundances with increases in
and Nitrospira are closely related to the nitrification process, CuO NPs concentration, which were in accordance with the TP
and can, respectively, oxidize ammonia and nitrite into nitrite removal rates under long-term exposure. It was also found that
and nitrate.26 Compared with the former, the latter was greatly the relative abundance of Dechloromonas, which are glycogen
affected by CuO NPs, and the effect was positively related to accumulating organisms (GAO), was negatively correlated with
10508 DOI: 10.1021/acs.est.7b02768
Environ. Sci. Technol. 2017, 51, 10503−10510
Environmental Science & Technology
Figure 7. Relative distribution of bacterial genus (nitrogen and
phosphorus removal related bacteria) for the four AGS samples at the
end of the exposure. R1, R2, R3, and R4 represent the control test, 5
mg/L CuO NPs, 20 mg/L CuO NPs, and 50 mg/L CuO NPs,
respectively.
CuO NPs concentration. And some studies showed that GAO
can produce N2O during denitrification,28 revealing that high
CuO NPs could reduce the generation of N2O.
■
ASSOCIATED CONTENT
* Supporting Information
S reactor. J. Environ. Manage. 2017, 187, 330−339.
The Supporting Information is available free of charge on the
ACS Publications website at DOI: 10.1021/acs.est.7b02768.
Relative distribution of bacterial genus for the four AGS
samples at the end of the exposure, SEM images of the
CuO NPs, kinetics of CuO NPs dissolution, SEM images
of the sludge samples, and Venn diagram of OTUs
(PDF)
■
AUTHOR INFORMATION
Corresponding Author
*E-mail: zhxyqq@hhu.edu.cn. Tel: 86-25-83786707. Fax: 86-
25-83786707.
ORCID
Xiao-ying Zheng: 0000-0002-8122-0448
Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS
This work was supported by the National Natural Science
Foundation of China (Grant No. 51678214), the Jiangsu
Province Natural Science Foundation (Grant No.
BK20161505), the Fundamental Research Funds for the
Central Universities (Grant No. 2005B16414), and a Project
Funded by the Priority Academic Program Development of
Jiangsu Higher Education Institutions (PAPD).
■
REFERENCES
(1) Heinlaan, M.; Ivask, A.; Blinova, I.; Dubourguier, H.; Kahru, A.
Toxicity of nanosized and bulk ZnO, CuO and TiO2 to bacteria Vibrio
fischeri and crustaceans Daphnia magna and Thamnocephalus
platyurus. Chemosphere 2008, 71, 1308−1316.
(2) Adam, N.; Vakurov, A.; Knapen, D.; Blust, R. The chronic toxicity
of CuO nanoparticles and copper salt to Daphnia magna. J. Hazard.
Mater. 2015, 283, 416−422.
(3) Mortimer, M.; Kasemets, K.; Kahru, A. Toxicity of ZnO and CuO
nanoparticles to ciliated protozoa Tetrahymena thermophila. Toxicol-
ogy 2010, 269, 182−189.
10509
Article
(4) Aruoja, V.; Dubourguier, H.; Kasemets, K.; Kahru, A. Toxicity of
nanoparticles of CuO, ZnO and TiO2 to microalgae Pseudokirchner-
iella subcapitata. Sci. Total Environ. 2009, 407, 1461−1468.
(5) Kasemets, K.; Ivask, A.; Dubourguier, H.; Kahru, A. Toxicity of
nanoparticles of ZnO, CuO and TiO2 to yeast Saccharomyces
cerevisiae. Toxicol. In Vitro 2009, 23, 1116−1122.
(6) Bondarenko, O.; Juganson, K.; Ivask, A.; Kasemets, K.; Mortimer,
M.; Kahru, A. Toxicity of Ag, CuO and ZnO nanoparticles to selected
environmentally relevant test organisms and mammalian cells in vitro:
a critical review. Arch. Toxicol. 2013, 87, 1181−1200.
(7) Mwaanga, P.; Carraway, E. R.; van den Hurk, P. The induction of
biochemical changes in Daphnia magna by CuO and ZnO nano-
particles. Aquat. Toxicol. 2014, 150, 201−209.
(8) Weichenthal, S.; Dufresne, A.; Infante-Rivard, C. Indoor ultrafine
particles and childhood asthma: exploring a potential public health
concern. Indoor Air 2007, 17, 81−91.
(9) Ganesh, R.; Smeraldi, J.; Hosseini, T.; Khatib, L.; Olson, B. H.;
Rosso, D. Evaluation of Nanocopper Removal and Toxicity in
Municipal Wastewaters. Environ. Sci. Technol. 2010, 44, 7808−7813.
(10) Hou, J.; Miao, L.; Wang, C.; Wang, P.; Ao, Y.; Lv, B. Effect of
CuO nanoparticles on the production and composition of extracellular
polymeric substances and physicochemical stability of activated sludge
flocs. Bioresour. Technol. 2015, 176, 65−70.
(11) Wang, S.; Li, Z.; Gao, M.; She, Z.; Ma, B.; Guo, L.; Zheng, D.;
Zhao, Y.; Jin, C.; Wang, X.; Gao, F. Long-term effects of cupric oxide
nanoparticles (CuO NPs) on the performance, microbial community
and enzymatic activity of activated sludge in a sequencing batch
(12) Miao, L.; Wang, C.; Hou, J.; Wang, P.; Ao, Y.; Li, Y.; Yao, Y.; Lv,
B.; Yang, Y.; You, G.; Xu, Y.; Gu, Q. Response of wastewater biofilm to
CuO nanoparticle exposure in terms of extracellular polymeric
substances and microbial community structure. Sci. Total Environ.
2017, 579, 588−597.
(13) Hou, J.; You, G.; Xu, Y.; Wang, C.; Wang, P.; Miao, L.; Ao, Y.;
Li, Y.; LV, B.; Yang, Y. Impacts of CuO nanoparticles on nitrogen
removal in sequencing batch biofilm reactors after short-term and
long-term exposure and the functions of natural organic matter.
Environ. Sci. Pollut. Res. 2016, 23, 22116−22125.
(14) Keller, A. A.; McFerran, S.; Lazareva, A.; Suh, S. Global life cycle
releases of engineered nanomaterials. J. Nanopart. Res. 2013, 15, 15.
(15) Wang, S.; Gao, M.; She, Z.; Zheng, D.; Jin, C.; Guo, L.; Zhao,
Y.; Li, Z.; Wang, X. Long-term effects of ZnO nanoparticles on
nitrogen and phosphorus removal, microbial activity and microbial
community of a sequencing batch reactor. Bioresour. Technol. 2016,
216, 428−436.
(16) Wang, S.; Gao, M.; Li, Z.; She, Z.; Wu, J.; Zheng, D.; Guo, L.;
Zhao, Y.; Gao, F.; Wang, X. Performance evaluation, microbial
enzymatic activity and microbial community of a sequencing batch
reactor under long-term exposure to cerium dioxide nanoparticles.
Bioresour. Technol. 2016, 220, 262−270.
(17) Mu, H.; Chen, Y. Long-term effect of ZnO nanoparticles on
waste activated sludge anaerobic digestion. Water Res. 2011, 45, 5612−
5620.
(18) Han, X.; Gelein, R.; Corson, N.; Wade-Mercer, P.; Jiang, J.;
Biswas, P.; Finkelstein, J. N.; Elder, A.; Oberdörster, G. Validation of
an LDH assay for assessing nanoparticle toxicity. Toxicology 2011, 287,
99−104.
(19) Gao, J.; Youn, S.; Hovsepyan, A.; Llaneza, V. L.; Wang, Y.;
Bitton, G.; Bonzongo, J. J. Dispersion and Toxicity of Selected
Manufactured Nanomaterials in Natural River Water Samples: Effects
of Water Chemical Composition. Environ. Sci. Technol. 2009, 43,
3322−3328.
(20) Nojiri, M.; Koteishi, H.; Nakagami, T.; Kobayashi, K.; Inoue, T.;
Yamaguchi, K.; Suzuki, S. Structural basis of inter-protein electron
transfer for nitrite reduction in denitrification. Nature 2009, 462, 117−
120.
(21) Granger, J.; Ward, B. B. Limnol. Oceanogr. 2003, 48, 313−318.
(22) He, Q.; Yuan, Z.; Zhang, J.; Zhang, S.; Zhang, W.; Zou, Z.;
Wang, H. Insight into the impact of ZnO nanoparticles on aerobic
DOI: 10.1021/acs.est.7b02768
Environ. Sci. Technol. 2017, 51, 10503−10510
Environmental Science & Technology Article

granular sludge under shock loading. Chemosphere 2017, 173, 411−

416.
(23) Quan, X.; Cen, Y.; Lu, F.; Gu, L.; Ma, J. Response of aerobic
granular sludge to the long-term presence to nanosilver in sequencing
batch reactors: Reactor performance, sludge property, microbial
activity and community. Sci. Total Environ. 2015, 506−507, 226−233.
(24) Kiser, M. A.; Ryu, H.; Jang, H.; Hristovski, K.; Westerhoff, P.
Biosorption of nanoparticles to heterotrophic wastewater biomass.
Water Res. 2010, 44, 4105−4114.
(25) Bradford, A.; Handy, R. D.; Readman, J. W.; Atfield, A.;
Muhling, M. Impact of silver nanoparticle contamination on the
genetic diversity of natural bacterial assemblages in estuarine
sediments. Environ. Sci. Technol. 2009, 43, 4530−4536.
(26) Hoang, V.; Delatolla, R.; Abujamel, T.; Mottawea, W.; Gadbois,
A.; Laflamme, E.; Stintzi, A. Nitrifying moving bed biofilm reactor
(MBBR) biofilm and biomass response to long term exposure to 1C.
Water Res. 2014, 49, 215−224.
(27) Adrados, B.; Sánchez, O.; Arias, C. A.; Becares, E.; Garrido, L.;
Mas, J.; Brix, H.; Morató, J. Microbial communities from different
types of natural wastewater treatment systems: Vertical and horizontal
flow constructed wetlands and biofilters. Water Res. 2014, 55, 304−
312.
(28) Lemaire, R.; Meyer, R.; Taske, A.; Crocetti, G. R.; Keller, J.;
Yuan, Z. Identifying causes for N2O accumulation in a lab-scale
sequencing batch reactor performing simultaneous nitrification,
denitrification and phosphorus removal. J. Biotechnol. 2006, 122,
62−72.

10510 DOI: 10.1021/acs.est.7b02768

Environ. Sci. Technol. 2017, 51, 10503−10510