Biomedicine & Pharmacotherapy 108 (2018) 1294–1302

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy

journal homepage: www.elsevier.com/locate/biopha

Mechanical stretch aggravates aortic dissection by regulating MAPK T

pathway and the expression of MMP-9 and inflammation factors
⁎
Yunnan Hu1, Lin Lu1, Zhihuang Qiu, Qiuyu Huang, Yinhai Chen, Liangwan Chen
Department of Cardiac Surgery, Fujian Medical University Union Hospital, Xinquan Road No. 29, Fuzhou, 350001, Fujian, China

A R T I C LE I N FO A B S T R A C T

Keywords: This study aimed to explore whether mechanical stretch aggravated aortic dissection through regulating MAPK
Mechanical stretch pathway, MMP-9, and inflammation factors. We first established aortic dissection model rats. Mechanical stretch
Aortic dissection (3 g) was exerted on vascular ring of aortic dissection which was also treated by inhibitors of MAPK pathway
MAPK (SB203580, SP600125, and U0126). HE and Masson staining showed that aortic dissection severity with 3 g
MMP-9
tension was worse than that without tension (0 g); after the treatments of diverse inhibitors, the fracture and
Inflammation factor
breakage of the elastic fibers decreased. The expression of MMP-9, TNF-α, IL-1β) p38/p-p38, JNK1/p-JNK1, and
ERK1/2/p-ERK1/2 were determined by immunohistochemical analysis, RT-PCR, and western blot. No matter
whether tension was exerted or inhibitors were added, there was no change in the expression of p38, JNK1, and
ERK1/2. However, compared to the 0 g group, the expression of MMP-9, TNF-α, IL-1β, p-p38, p-JNK1, and p-
ERK1/2 was significantly upregulated in the 3 g group (P < 0.05). In both 0 g and 3 g groups, the expression of
MMP-9, TNF-α, IL-1β, p-p38, p-JNK1, and p-ERK1/2 was remarkably downregulated after inhibitors treatment
(P < 0.05). In conclusion, mechanical stretch aggravated aortic dissection by regulating the MAPK pathway and
the consequent expression of MMP-9 and inflammation factors.

1. Introduction adventitia [5]. Therefore, various pathological factors such as in-

Aortic dissection (AD) is a kind of critical aortic diseases. Local
aortic intimal crevasse and intimal/medial exfoliation and expansion
caused by high velocity blood flow separate the middle layer of the
artery wall along the long axis, consequently producing true and false
lumens [1]. At present, effective drugs are lacked and surgery is the
most commonly used therapeutics. However, the surgery is compli-
cated, hugely traumatic, and accompanied with high risk. The surgery
may injure recurrent laryngeal nerve and phrenic nerve. Moreover,
intraoperative and postoperative bleeding frequently happens in the
suture. Therefore, drug adjunctive therapy shall be refocused.
Matrix metalloproteinase (MMP) is a protease family being capable
of lysing protein substrates [2]. MMP contains type II fibronectin-like
repeating segments in its catalytic domain and has strong ability of
hydrolyzing elastin and gelatin [3]. MMP-9 belongs to one of two kinds
of gelatinases in MMP family and it also has the common structural
characteristics of MMP [4]. Inflammatory cytokines can induce mul-
tiple cells to produce MMP-9, while as the enzymolysis substrate of
MMP-9, extracellular matrix (ECM) is mainly located in the media and
flammatory reaction will increase the expression of MMP-9 in the
media and adventitia, especially in the smooth muscle cells around the
degenerated media [5].
Mechanical stretch is an important factor in regulating the structure
and function of mammalian cells and tissues, but excessive mechanical
stretch will cause vascular remodeling [6]. The increase of MMP-9
expression degrades the elastin and collagen fibers in the media and
subsequently weakens the vascular wall [7]. Under the action of me-
chanical stretch, the intima is torn and separated from the media, and
then AD happens [7]. The mechanical stretch is derived from the
pulling and shearing stress caused by blood pressure and blood flow
[8].
Therefore, this study aims to explore whether mechanical stretch
aggravates AD through regulating mitogen-activated protein kinase
(MAPK) pathway, MMP-9, and inflammation factors, and then provide
promising targets in the drug development for AD therapy.

⁎
Corresponding author.
E-mail addresses: huyunnan-105@163.com (Y. Hu), lulinusa@163.com (L. Lu), qzhflm@126.com (Z. Qiu), terryhqy@163.com (Q. Huang),
798956199@qq.com (Y. Chen), chenliangwan@tom.com (L. Chen).
1
These authors contributed equally to this work.

https://doi.org/10.1016/j.biopha.2018.09.129
Received 27 June 2018; Received in revised form 22 September 2018; Accepted 24 September 2018
0753-3322/ © 2018 Elsevier Masson SAS. All rights reserved.
Y. Hu et al.
2. Materials and methods
2.1. Materials and animals
Scott bluing buffer (G1865), Masson trichrome staining solution
(G1340), 5% bovine serum albumin (BSA) blocking buffer (SW3015),
and β-aminopropionitrile (20170627) were purchased from Solarbio
(Beijing, China). SB203580 (22898), SP600125 (13701), and U0126
(19826) were bought from MedChem Express (NJ, USA). DAB kit
(CW0125), TRIzon reagent (CW0580), HiFiScript cDNA synthesis kit
(CW2569), and UltraSYBR mixture (CW0957) were gotten from CWBIO
(Beijing, China). Rabbit monoclonal antibody ERK1/2 (MAPK P44/42)
was from Cell Signaling Technology (1:1000, 4695, MA, USA). Rabbit
monoclonal antibodies MMP-9 (1:10000, ab76003), JNK1 (1:2000,
ab110724) and rabbit polyclonal antibodies p-JNK1 (1:4000, ab47337),
p-p38 (1:10000, ab47363), p-ERK1/2 (1:1000, ab214362) were ob-
tained from Abcam (MA, USA). Rabbit polyclonal antibodies p38
(1:1000, A0227) and interleukin-1β (IL-1β, 1:1000, A11369) were
bought from ABclonal (MA, USA). Rabbit polyclonal antibody tumor
necrosis factor-α (TNF-α) was from Bioss (1:400, bs-2150R, Beijing,
China). Peroxidase-conjugated goat anti-rabbit IgG(H + L) was pur-
chased from ZSGB-BIO (1:2000, ZB-2301, Beijing, China).
Forty-five male Spraque-Dawley (SD) rats (three weeks,
51.5 ± 1.2 g) were purchased from Shanghai SLAC Laboratory Animal
Co., Ltd (License No. SCXK(HU)2017-0005). All rats were housed in a
temperature-controlled room (22–25 °C) with a 12-h light/dark cycle
and were given free access to food and water. Study protocols were in
compliance with the NIH Guide for Care and Use of Laboratory
Animals.
2.2. AD model establishment and vascular management
β-aminopropionitrile (0.8%) was administrated into the rats for 5
weeks through water drinking. Then the rats were anesthetized by in-
traperitoneally injecting 1% pentobarbital sodium at 45 mg/kg. Hearts
and aortae (to kidney) were collected and immediately immersed in KH
solution pre-aerated by 95%O2-5%CO2 at 4 °C. The rats without un-
dergoing these treatments served as control (n = 5). Dissection was
evaluated under a microscope (CX41, Olympus, Japan). Vascular strips
were cut into a number of 3 mm vascular rings, and then the intima was
carefully removed. Each vascular ring was fixed by two stainless steel
triangular scaffolds through the vascular lumen. It was vertically sus-
pended in the bath containing 25 ml KH solution. The downward side
was fixed and the upward side was connected to a tension sensor. The
tension of the vascular rings was regulated and recorded by a bio-
function experiment system (BL-420S, Chengdu Techman Software,
China). The perfusion chamber was kept at 37 °C and 95%O2-5%CO2
was aerated continuously (HV1403, Chengdu Techman Software,
China). The KH solution was changed every 15 min. Balance tension
was 0.2 g. After balancing for 1 h, the artery was constricted with
60 mmol/L KCl. The vascular ring was washed to restore the tension to
the baseline before follow-up experiments. According to the require-
ments of the following eight groups, inhibitors were added. After
30 min, the vascular ring was immediately stored at −80 °C for the
follow-up tests.
2.3. Experimental grouping
Eight groups (n = 5): 1) 0 g (modeling only); 2) 3 g (3 g tension after
modeling); 3) 3 g + SB203580 (40 μmol/L); 4) 3 g + SP600125
(40 μmol/L); 5) 3 g + U0126 (40 μmol/L); 6) 0 g + SB203580
(40 μmol/L); 7) 0 g + SP600125 (40 μmol/L); 8) 0 g + U0126
(40 μmol/L). SP600125, SB203580 and U0126 inhibited JNK, p38 and
ERK1/2 pathways, respectively [9–11].
1295
Biomedicine & Pharmacotherapy 108 (2018) 1294–1302
2.4. Hematoxylin eosin (HE) staining
Samples were taken out, dehydrated in ethanol solution, and
transparentized in dimethylbenzene. After paraffin embedding, they
were cut into slices. The slices were baked, dewaxed, hydrated, and
incubated in hematoxylin solution for 3 min. Then they were differ-
entiated in alcoholic hydrochloric acid for 15 s and blued in Scott
bluing buffer for 15 s. The slices were washed and incubated in eosin
solution for 3 min. Finally, they were dehydrated, transparentized,
mounted, and observed under a microscope (CKX41, Olympus, Japan).
2.5. Masson staining
Samples were taken out, dehydrated in ethanol solution, and
transparentized in dimethylbenzene. After paraffin embedding, they
were cut into slices. The slices were incubated in Weigert solution for
10 min. Then they were differentiated in alcoholic hydrochloric acid for
10 s and blued in Masson bluing buffer for 4 min. The slices were wa-
shed and incubated in ponceau S-fuchsin solution for 7 min.
Subsequently, they were washed with weak acid solution and phos-
phomolybdic acid solution before staining in aniline blue solution for
1 min. Eventually, they were washed, dehydrated, transparentized,
mounted, and observed under a microscope (CKX41, Olympus, Japan).
2.6. Immunohistochemical analysis
Paraffin sections of the samples were made and baked at 75 °C for
1.5 h. The slices were immersed in dimethylbenzene for 10 min and in
fresh dimethylbenzene for another 10 min. After successively bathing in
100% ethanol, 100% ethanol, 95% ethanol, 80% ethanol, and water for
each 5 min, they were incubated in citrate buffer solution and washed
by phosphate buffer solution (PBS). Subsequently, the slices were in-
cubated in fresh 3% hydrogen peroxide at room temperature for
10 min. After PBS washing, goat serum buffer was dropwise added onto
the slices and incubated at room temperature for 30 min. The slices
were then incubated in primary antibody buffer at 4 °C overnight. After
washing with PBS, they were incubated in secondary antibody buffer at
room temperature for 1 h. Finally, they were stained, dehydrated,
transparentized, mounted, and microscopically examined.
2.7. RT-PCR
Total RNA of the samples was collected by Trizon reagent and re-
versely transcribed to cDNA by HiFiScript cDNA synthesis kit according
to the instruction for use. Sequences of primers were listed in Table 1.
PCR system (25 μl) included RNase free dH2O 9.5 μl, cDNA/DNA 1 μl,
forward primer 1 μl, reverse primer 1 μl, and 2×ULtraSYBR Mixture
12.5 μl. Reaction parameters were shown as follows: Pre-denaturation
for 10 min at 95 °C, Denaturation for 10 s at 95 °C, annealing for 30 s at
57.5 °C, elongation for 30 s at 72 °C, and 40 circles. Dissociation curve
was analyzed as follows: 15 s at 95 °C, 1 min at 57.5 °C, 15 s at 95 °C,
15 s at 57.5 °C, 15 s at 57.5 °C, and measured stepwise from 92 °C, every
0.5 °C. Eventually, the product was analyzed on a RT-PCR Detection
System (CFX Connect™, Bio-Rad, USA). GAPDH served as internal
control.
2.8. Western blot
Samples were incubated in lysis buffer for 30 min in an ice bath. The
lysate was centrifugated at 10,000 rpm and 4 °C for 10 min. Total pro-
tein was obtained by carefully collecting the supernatant. Protein
concentration was examined by BCA kit. Protein was thereafter dena-
tured and loaded to perform SDS-PAGE. The membrane was transferred
for 40 min through a wet method and subsequently incubated with
diluted primary antibodies at 4 °C overnight. It was rinsed and in-
cubated in secondary antibody buffer at room temperature for 1.5 h.
Y. Hu et al.
Table 1
PCR primers.
Primer Sequence Length of primer (bp)
MMP-9 For:CAAGGATGGTCTACTGGCACACG 23
Rev:AGGTGAAGGGAAAGTGACATGGG 23
IL-1β For:AGGAGAGACAAGCAACGACA 20
Rev:CTTTTCCATCTTCTTCTTTGGGTAT 25
TNF-α For:GCGTGTTCATCCGTTCTCTACC 22
Rev:TACTTCAGCGTCTCGTGTGTTTCT 24
GAPDH For:TACCCACGGCAAGTTCAA 18
Rev:ACCAGCATCACCCCATTT 18
Finally, enhanced chemiluminescence (ECL) solution was dropwise
added onto the membrane and the membrane was evaluated on a gel
imaging system (ChemiDoc™ XRS+, Bio-Rad, USA). Gray values were
analyzed with “Quantity one” software (v4.62, Bio-Rad, USA). GAPDH
served as the internal control.
2.9. Statistical analysis
Data were presented as mean ± standard deviation (SD). Statistical
analysis was conducted with one way analysis of variance (ANOVA)
followed by Tukey post‑hoc test via SPSS software (19.0, SPSS, USA).
Significant difference was considered at P < 0.05.
3. Results
3.1. AD model establishment
The establishment of AD model in rats was evaluated by HE and
Masson staining, which was shown in Fig. 1A. Normal aortae were
found in the control rats. However, in the model rats, there were elastic
fibers’ damages in the aortic media. The blood in the aortic lumen
entered the media. These resulted in the longitudinal tearing and
stripping of the media, which further induced the formation of true and
false lumens. It was indicated that AD model establishment in rats was
successful.
3.2. HE staining
Fig. 1B demonstrated the HE staining results of aortae in eight
groups. In the groups without tension (0 g), the intima and the elastic
fibers in the media were ruptured. After the treatments of diverse in-
hibitors (0 g + SB203580, 0 g + SP600125, 0 g + U0126), the
breakage of elastic fibers in the media was slightly reduced. In the
groups with tension (3 g), the intima rupture, the media tearing, and
the breakage and reduction of elastic fibers were found. After the
treatments of diverse inhibitors (3 g + SB203580, 3 g + SP600125,
3 g + U0126), the fracture of the elastic fibers in the media was ob-
viously decreased.
3.3. Masson staining
Fig. 1C showed the Masson staining results of aortae in eight groups.
In the Masson staining, collagenous fibers were blue, and muscle fibers,
red cells, and cellulose were orange red. As compared with the group
without tension and inhibitors (0 g), there was no obvious difference in
collagenous fibers after the treatments of diverse inhibitors
(0 g + SB203580, 0 g + SP600125, 0 g + U0126). The content of col-
lagenous fibers under 3 g tension seemed to be lower than that under
0 g tension. Comparing to the group with tension and without inhibitors
(3 g), the content of collagenous fibers increased after the treatments of
diverse inhibitors (3 g + SB203580, 3 g + SP600125, 3 g + U0126).
These results suggested that inhibitors SB203580, SP600125, and
1296
Biomedicine & Pharmacotherapy 108 (2018) 1294–1302
Length of product (bp) annealing temperature (°C)
158 57.5
148 60
196 60
111 57.5
U0126 could reduce the breakage of aortic collagenous fibers.
3.4. Levels of IL-1β and TNF-α
The mRNA and protein levels of IL-1β and TNF-α which were de-
termined by RT-PCR and western blot, respectively were depicted in
Fig. 2A. Similar results were found between RT-PCR and western blot.
Their levels in the 3 g group were much higher than those in the 0 g
group (P < 0.05). Interestingly, their levels were sharply down-
regulated by the addition of inhibitors SB203580, SP600125, and
U0126, which was true for both 0 g and 3 g groups (P < 0.05). It was
implied that stronger tension promoted the production of IL-1β and
TNF-α while inhibitors SB203580, SP600125, and U0126 suppressed
their production.
3.5. Level of MMP-9
The mRNA and protein levels of MMP-9 which were evaluated by
RT-PCR, western blot, and immunohistochemical analysis were shown
in Fig. 2B and C. Similar results were found among RT-PCR, western
blot, and immunohistochemical analysis. In comparison with the 0 g
group, the expression of MMP-9 was remarkably elevated in the 3 g
group (P < 0.05). As for both 0 g and 3 g groups, its expression was
sharply downregulated after inhibitors treatment (P < 0.05). It was
suggested that tension exertion upregulated the expression of MMP-9
while inhibitors SB203580, SP600125, and U0126 downregulated its
expression.
3.6. Levels of p-ERK1/2 and ERK1/2
The protein expression of p-ERK1/2 and ERK1/2 which was as-
sessed by immunohistochemical analysis and western blot was shown in
Fig. 3. Similar results were found between immunohistochemical ana-
lysis and western blot. No matter whether tension exertion or inhibitors
addition, there was no obvious change in the level of ERK1/2. However,
in comparison with the 0 g group, the ratio of p-ERK1/2 to ERK1/2 (p-
ERK1/2/ERK1/2) was remarkably elevated in the 3 g group
(P < 0.05). As for both 0 g and 3 g groups, the p-ERK1/2/ERK1/2 was
notably reduced after inhibitors exposure (P < 0.05). It was demon-
strated that stronger tension enhanced the production of p-ERK1/2
while inhibitors SB203580, SP600125, and U0126 depressed its pro-
duction.
3.7. Levels of p-p38&p38 and p-JNK1&JNK1
The protein expression of p-p38&p38 and p-JNK1&JNK1 which was
investigated by immunohistochemical analysis and western blot was
shown in Fig. 4A and B. Similar results were also found between the
immunohistochemical analysis and western blot. No matter whether
tension exert or inhibitors addition, there was no obvious change in the
expression of p38 and JNK1. However, comparing to the 0 g group, the
expression of p-p38 and p-JNK1 was significantly augmented in the 3 g
Y. Hu et al. Biomedicine & Pharmacotherapy 108 (2018) 1294–1302

Fig. 1. Pathological examination of aortae. (A) HE and Masson staining of aortae in the control and model rats to evaluate the success of the aortic dissection model
establishment. (B) HE staining of aortae in various groups with different tensions (0 g and 3 g) and inhibitors (SB203580, SP600125, and U0126). (C) Masson staining
of aortae in various groups with different tensions (0 g and 3 g) and inhibitors (SB203580, SP600125, and U0126).

group (P < 0.05). As for both 0 g and 3 g groups, inhibitors exposure
remarkably lowered their expression (P < 0.05). It was suggested that
stronger tension facilitated the generation of p-p38 and p-JNK1 but
inhibitors SB203580, SP600125, and U0126 reduced their expression.
4. Discussion
As one of the major diseases that endanger the patients’ lives, AD
has the characteristics of acute onset, rapid progress, and high mor-
tality. Its specific pathogenesis is not clear, and now it is considered to
be related to a variety of factors such as hypertension and inflammation
[12,13].
In this study, we explored whether mechanical stretch aggravated
AD by regulating the expression of MMP-9 and inflammation factors
through MAPK signaling pathway. We employed β-aminopropionitrile
to induce AD in SD rats and exerted different mechanical tensions to
stretch the vascular rings of aortae with dissection. HE and Masson
staining had validated the success of AD model establishment and re-
vealed that the AD was more severe after mechanical stretch.
Some studies have shown that mechanical stretch can activate a
large number of calcium channels on the vascular wall and intracellular
multiple signal transduction pathways including MAPK, reactive
oxygen species (ROS), protein kinase B (AKT), and nitric oxide (NO)
signaling pathways [14–16]. MAPK signaling pathway is closely related
to cell proliferation, differentiation, metastasis, apoptosis, and the pa-
thogenesis of aortic diseases [17,18]. Five different MAPK signal
transduction pathways have been found in mammalian organisms.
Thereinto, ERK1/2 signaling pathway regulates cell growth and

1297
Y. Hu et al. Biomedicine & Pharmacotherapy 108 (2018) 1294–1302

Fig. 2. Levels of IL-1β, TNF-α and MMP-9 (n = 5). (A) The mRNA and protein levels of IL-1β and TNF-α which were determined by RT-PCR and western blot,
respectively. (B) The mRNA and protein levels of MMP-9 which were determined by RT-PCR and western blot, respectively. (C) The protein level of MMP-9 which
was evaluated by immunohistochemical analysis. The target in the immunohistochemical image was shown in brown. *P＜0.05 vs. 0 g, #P＜0.05 vs. 3 g.

differentiation. JNK and p38 pathways play an important role in stress stimuli such as stress, injury, and inflammation activate the upstream
response such as inflammation and apoptosis. Advanced glycation end bispecific sites (Thrl83 and Tyrl8) of JNK to induce its active form
products participate in the proliferation of human aortic smooth muscle through phosphorylation [20]. P38 is mainly involved in the signal
cells via activating ERK1/2 pathway [19]. A variety of extracellular transduction of injury, stress, and inflammation processes. It can be

1298
Y. Hu et al.
Fig. 3. The protein expression of p-ERK1/2 and ERK1/2 which was assessed by immunohistochemical analysis and western blot (n = 5). The target in the im-
munohistochemical image was shown in brown. *P＜0.05 vs. 0 g, #P＜0.05 vs. 3 g.
activated by some factors such as proinflammatory cytokines and toxins
and its abnormal excessive activation may lead to growth arrest and
apoptosis of cells [21–25]. We revealed that after tension exertion, the
expression of p-JNK, p-ERK1/2, and p-p38 was remarkably upregu-
lated, but the expression of JNK, ERK1/2, and p38 was not changed. It
was demonstrated that mechanical stretch aggravated AD through ac-
tivating JNK, ERK1/2, and p38 pathways in a phosphorylation way.
MMP and its inhibitors have been reported to take part in the pa-
thological process of aortic diseases and have a correlation with the
pathogenesis of AD [26,27]. The MMP-9 secreted by aortic smooth
muscle cells plays an important role in the occurrence of AD. Normal
aortic smooth muscle cells are contractile phenotypes and MMP-9 can
1299
Biomedicine & Pharmacotherapy 108 (2018) 1294–1302
be secreted only if they are converted into synthetic phenotypes
[28–30]. The MMP-9 level in the plasma of patients with AD is higher
than that in the plasma of normal population [31–33]. This study found
that the expression of MMP-9 was significantly upregulated after me-
chanical stretch in the AD model, which was consistent with a previous
report [34].
TNF-α is mainly produced by monocytes and lymphocytes. It can
stimulate the generation of inflammatory factors and plays a direct role
in promoting inflammation, thereby affecting the thrombosis formation
and plaque stability [35,36]. It plays an important role in the devel-
opment and progression of AD [35,36]. IL-1β plays an important role in
the signaling transduction, the activation and regulation of immune
Y. Hu et al. Biomedicine & Pharmacotherapy 108 (2018) 1294–1302

Fig. 4. The protein expression of p-p38&p38 (A) and p-JNK1&JNK1 (B) which was investigated by immunohistochemical analysis and western blot (n = 5). The
target in the immunohistochemical image was shown in brown. *P＜0.05 vs. 0 g, #P＜0.05 vs. 3 g.

cells, the mediation of T cells and B cells activation, proliferation, and
differentiation, and the inflammatory response [37]. This study showed
that the expression of TNF-α and IL-1β was elevated after the exertion
of mechanical stretch. It was indicated that mechanical stretch medi-
ated the production of AD inflammation.
In order to prove that the expression of MMP-9, TNF-α, and IL-1β
was related to MAPK signaling pathways such as ERK1/2, JNK, and
p38, we performed inhibition tests by utilizing ERK1/2 inhibitor
U0126, JNK inhibitor SP600125, and p38 inhibitor SB203580.
Interestingly, we revealed that the expression of MMP-9, TNF-α, and IL-
1β was also inhibited after the treatment of these inhibitors. These
results suggested that the increase in the expression of MMP-9, TNF-α,
and IL-1β induced by mechanical stretch might be mediated by MAPK
signaling pathways. Moreover, the inhibitors of MAPK signaling path-
ways might alleviate the influence of mechanical stretch on AD by
downregulating the expression of MMP-9 and inflammation factors.
When mechanical stretch was exerted on the aortae with dissection,
stretch-activated channel on vascular smooth muscle cells might be
opened, and then the ERK1/2, p38, and JNK pathways were activated,
consequently upregulating the expression of MMP-9 and inflammation
factors at transcriptional and expression levels.
SP600125, SB203580 and U0126 inhibited JNK, p38 and ERK1/2
pathways through suppressing the activity of adenosine triphosphate
(ATP). SP600125 also showed some ability to inhibit p38 pathway [9].
SB203580 could also inhibit the expression of JNK to some extent [10].
Therefore, no matter what branch of the MAPK pathway was inhibited
all markers seemed to be downregulated. For example, ERK1/2 in-
hibition affected both JNK and p38 when they were not downstream of
ERK. Although all three inhibitors have the ability to inhibit ATP and
one of them will make moderate effect on the other two pathways, all of
them are selective inhibitors for the corresponding pathway. SP600125
is one of the most extensively used ATP-competitive JNK inhibitors
[38]. It binds reversibly and competitively to the anthrapyrazolone
domain of JNK [38]. A number of studies have shown that SP600125
can inhibit the phosphorylation of c-Jun induced by TNF-α activation,
and thereby prevent apoptosis in a variety of cell types [39–42]. A
number of in vivo experiments using SP600125 have demonstrated the
potential of directly inhibiting JNK for therapeutic intervention
[43,44]. SB203580 is also a well-known selective inhibitor of p38
pathway [45–47]. SB203580 directly inhibits p38 pathway by binding
to the ATP-binding pocket at an ATP-competitive manner [46]. U0126
is a highly selective inhibitor of both MEK1 and MEK2, a type of MAPK/
ERK kinase [48,49]. U0126 functionally antagonizes transcriptional
activity of activator protein 1 (AP-1) and prevents the activation of
MAP kinase p42 and p44 encoded by ERK2 and ERK1 genes respec-
tively via non-competitive inhibition of the dual specificity kinase MEK
[48,49]. The activation of ERK1/2 is significantly blocked by the
MEK1/2 inhibitor U0126 [47,50]. The effects of U0126 on the growth
of eight human breast cancer cell lines show that U0126 selectively
repressed anchorage-independent growth of MDA-MB231 and HBC4
cells, two lines with constitutively activated ERK [51]. In sum,
SP600125, SB203580 and U0126 selectively inhibit JNK, p38 and
ERK1/2 pathways, respectively, by majorly direct inhibition and min-
orly suppressing the ATP activity (Fig. 5).
Fig. 5. SP600125, SB203580 and U0126 inhibited JNK, p38 and ERK1/2
pathways through suppressing the activity of adenosine triphosphate (ATP).

1300
Y. Hu et al.
5. Conclusions
Mechanical stretch aggravated AD by regulating the MAPK sig-
naling pathway and the consequent expression of MMP-9 and in-
flammation factors. These results might provide novel and promising
insights into the mechanism understanding of AD and into the targeting
drug development for AD treatment.
Funding
This work was supported by the National Natural Science
Foundation of China [grant number 81370414].
Conflict of interest
None.
Appendix A. Supplementary data
Supplementary material related to this article can be found, in the
online version, at doi:https://doi.org/10.1016/j.biopha.2018.09.129.
References
[1] M.D. Dake, N. Kato, R.S. Mitchell, et al., Endovascular stent-graft placement for the
treatment of acute aortic dissection, N. Engl. J. Med. 340 (1999) 1546–1552.
[2] T. Sorsa, L. Tjäderhane, T. Salo, Matrix metalloproteinases (MMPs) in oral diseases,
Oral Dis. 10 (2004) 311–318.
[3] L.J. Xiao, P. Lin, F. Lin, et al., ADAM17 targets MMP-2 and MMP-9 via EGFR-MEK-
ERK pathway activation to promote prostate cancer cell invasion, Int. J. Oncol. 40
(2012) 1714–1724.
[4] R.J. Turner, F.R. Sharp, Implications of MMP-9 for blood brain barrier disruption
and hemorrhagic transformation following ischemic stroke, Front. Cell. Neurosci.
10 (2016) 56.
[5] T. Kurihara, R. Shimizu-Hirota, M. Shimoda, et al., Neutrophil-derived matrix
metalloproteinase 9 triggers acute aortic dissection, Circulation 126 (2012)
3070–3080.
[6] B.W. Benhampyle, B.L. Pruitt, W.J. Nelson, Mechanical strain induces E-cadherin-
dependent Yap1 and E-catenin activation to drive cell cycle entry, Science 348
(2015) 1024–1027.
[7] J.M. Ruiz-Morales, R. Dorantes-Heredia, O. Arrieta, et al., Neutrophil gelatinase-
associated lipocalin (NGAL) and matrix metalloproteinase-9 (MMP-9) prognostic
value in lung adenocarcinoma, Tumour Biol. 36 (2015) 3601–3610.
[8] G. Huang, A. Wang, X. Li, et al., Change in high-sensitive C-reactive protein during
abdominal aortic aneurysm formation, J. Hypertens. 27 (2009) 1829–1837.
[9] M.A. Bogoyevitch, I. Boehm, A. Oakley, et al., Targeting the JNK MAPK cascade for
inhibition: basic science and therapeutic potential, Biochim. Biophys. Acta 1697
(2004) 89–101.
[10] M.C. Bagley, T. Davis, P.G.S. Murziani, et al., Use of p38 MAPK inhibitors for the
treatment of Werner syndrome, Pharmaceuticals (Basel) 3 (2010) 1842–1872.
[11] X. Wang, S. Pesakhov, A. Weng, et al., ERK 5/MAPK pathway has a major role in
1α,25-(OH)2 vitamin D3-induced terminal differentiation of myeloid leukemia
cells, J. Steroid Biochem. Mol. Biol. 144PA (2014) 223–227.
[12] L.W. Chen, X.J. Wu, X.F. Dai, et al., Repair of acute type A aortic dissection with
ascending aorta replacement combined with open fenestrated stent graft placement,
Ann. Thorac. Surg. 101 (2016) 644–649.
[13] L.W. Chen, X.J. Wu, X.F. Dai, et al., Total arch repair for acute type A aortic dis-
section with open placement of a modified triple-branched stent graft and the arch
open technique, J. Cardiothorac. Surg. 9 (2014) 135.
[14] C.M. Ghantous, F.H. Kobeissy, N. Soudani, et al., Mechanical stretch-induced vas-
cular hypertrophy occurs through modulation of leptin synthesis-mediated ROS
formation and GATA-4 nuclear translocation, Front. Pharmacol. 6 (2015) 240.
[15] K.W. Seo, S.J. Lee, B.H. Ye, et al., Mechanical stretch enhances the expression and
activity of osteopontin and MMP-2 via the AKT1/AP-1 pathways in VSMC, J. Mol.
Cell. Cardiol. 85 (2009) 13–24.
[16] L. Du, P. Empery, J. Ji, et al., Probenecid and N-acetylcysteine prevent loss of in-
tracellular glutathione and inhibit neuronal death after mechanical stretch injury in
vitro, J. Neruotrauma 33 (2016) 1913–1917.
[17] E.K. Kim, E.J. Choi, Compromised MAPK signaling in human diseases: an update,
Arch. Toxicol. 89 (2015) 867–882.
[18] Y. Sun, W.Z. Liu, T. Liu, et al., Signaling pathway of MAPK/ERK in cell prolifera-
tion, differentiation, migration, senescence and apoptosis, J. Recept. Signal
Transduct. Res. 35 (2015) 600–604.
[19] G. Yuan, Y. Liu, H. Zeng, et al., Effect of ERK1/2 phosphorylation on proliferation of
human aortic vascular smooth muscle cells stimulated by advanced glycation end
products, J. Pract. Med. 32 (2016) 2430–2433.
[20] J. Li, Y. Xia, T. Liu, et al., Protective effects of astaxanthin on ConA-induced au-
toimmune hepatitis by the JNK/p-JNK pathway-mediated inhibition of autophagy
1301
Biomedicine & Pharmacotherapy 108 (2018) 1294–1302
and apoptosis, PLoS One 10 (2015) e0120440.
[21] L. Shi, X. Yu, H. Yang, et al., Advanced glycation end products induce human
corneal epithelial cells apoptosis through generation of reactive oxygen species and
activation of JNK and p38 MAPK pathways, PLoS One 8 (2013) e66781.
[22] K. Palanivel, V. Kanimozhi, B. Kadalmani, Verrucarin A alters cell-cycle regulatory
proteins and induces apoptosis through reactive oxygen species-dependent
p38MAPK activation in the human breast cancer cell line MCF-7, Tumour Biol. 35
(2014) 10159–10167.
[23] M.M. Yurinskaya, M.G. Vinokurov, S.V. Grachev, et al., Actovegin reduces the hy-
drogen peroxide-induced cell apoptosis of SK-N-SH neuroblastoma by means of
p38MAPK and PI-3K inhibition, Dokl. Biol. Sci. 456 (2014) 215–217.
[24] N. Wu, X. Lin, X. Zhao, et al., MiR-125b acts as an oncogene in glioblastoma cells
and inhibits cell apoptosis through p53 and p38MAPK-independent pathways, Br. J.
Cancer 109 (2013) 2853–2863.
[25] H.L. Chang, C.Y. Chen, Y.F. Hsu, et al., Simvastatin induced HCT116 colorectal
cancer cell apoptosis through p38MAPK-p53-survivin signaling cascade, Biochim.
Biophys. Acta 1830 (2013) 4053–4064.
[26] Y. Gao, W. Wu, C. Yu, et al., A disintegrin and metalloproteinase with thrombos-
pondin motif 1 (ADAMTS1) expression increases in acute aortic dissection, Sci.
China Life Sci. 59 (2016) 59–67.
[27] F. Giachino, M. Loiacono, M. Lucchiari, et al., Rule out of acute aortic dissection
with plasma matrix metalloproteinase 8 in the emergency department, Crit. Care 17
(2013) R33.
[28] L. Wang, J. Zhang, W. Fu, et al., Association of smooth muscle cell phenotypes with
extracellular matrix disorders in thoracic aortic dissection, J. Vasc. Surg. 56 (2012)
1698–1709.
[29] J. Zhang, L. Wang, W. Fu, et al., Smooth muscle cell phenotypic diversity between
dissected and unaffected thoracic aortic media, J. Cardiovasc. Surg. (Torino) 54
(2013) 511–521.
[30] V. Lesaukaite, P. Tanganelli, C. Sassi, et al., Smooth muscle cells of the media in the
dilatative pathology of ascending thoracic aorta:morphology, immunoreactivity for
osteopontin,matrix metalloproteinases, and their inhibitors, Hum. Pathol. 32
(2001) 1003–1011.
[31] D. Wen, X.L. Zhou, J.J. Li, et al., Plasma concentrations of interleukin-6, C-reactive
protein, tumor necrosis factor-α and matrix metalloproteinase-9 in aortic dissec-
tion, Clin. Chim. Acta 413 (2012) 198–202.
[32] G. Sangiorgi, S. Trimarchi, A. Mauriello, et al., Plasma levels of metalloproteinases-
9 and-2 in the acute and subacute phases of type A and type B aortic dissection, J.
Cardiovasc. Med. (Hagerstown) 7 (2006) 307–315.
[33] G.T. Karapanagiotidis, P. Antonitsis, N. Charokopos, et al., Serum levels of matrix
metalloproteinase-1,-2,-3,and-9 in thoracic aortic diseases and acute myocardial
ischemia, J. Cardiothorac. Surg. 4 (2009) 59.
[34] Z. Qiu, L. Chen, H. Cao, et al., Mechanical strain induced expression of matrix
Metalloproteinase-9 via stretch-activated channels in rat abdominal aortic dissec-
tion, Med. Sci. Monit. 23 (2017) 1268–1276.
[35] G.S. Hotamisligil, P. Peraldi, A. Budavari, et al., IRS-1-mediated inhibition of insulin
receptor tyrosine kinase activity in TNF-alpha- and obesity-induced insulin re-
sistance, Science 271 (1996) 665–668.
[36] C.D. Dumitru, J.D. Ceci, C. Tsatsanis, et al., TNF-α induction by LPS is regulated
posttranscriptionally via a Tpl2/ERK-Dependent pathway, Cell 103 (2000)
1071–1083.
[37] F.R. Greten, M.C. Arkan, J. Bollrath, et al., NF-κB is a negative regulator of IL-1β
secretion as revealed by genetic and pharmacological inhibition of IKKβ, Cell 130
(2007) 918–931.
[38] B.L. Bennett, D.T. Sasaki, B.W. Murray, et al., SP600125, an anthrapyrazolone in-
hibitor of Jun N-terminal kinase, Proc. Natl. Acad. Sci. U. S. A. 98 (2001)
13681–13686.
[39] E.L. Marderstein, B. Bucher, Z. Guo, et al., Protection of rat hepatocytes from
apoptosis by inhibition of c-Jun N-terminal kinase, Surgery 134 (2003) 280–284.
[40] L. Minutoli, D. Altavilla, H. Marini, et al., Protective effects of SP600125 a new
inhibitor of c-jun N-terminal kinase (JNK) and extracellular-regulated kinase
(ERK1/2) in an experimental model of cerulean-induced pancreatitis, Life Sci. 75
(2004) 2853–2866.
[41] N. Sharma, H. Suzuki, Q. He, et al., Tumor necrosis factor-α-mediated activation of
c-Jun NH(2)terminal kinase as a mechanism for fumonisin B(1) induced apoptosis
in murine primary hepatocytes, J. Biochem. Mol. Toxicol. 19 (2005) 359–367.
[42] K. Assi, R. Pillai, A. Gómez‐Muñoz, et al., The specific JNK inhibitor SP600125
targets tumour necrosis factor-α production and epithelial cell apoptosis in acute
murine colitis, Immunology 118 (2006) 112–121.
[43] C. Davies, C. Tournier, Exploring the function of the JNK (c-Jun N-terminal kinase)
signalling pathway in physiological and pathological processes to design novel
therapeutic strategies, Biochem. Soc. Trans. 40 (2012) 85–89.
[44] W. Wang, L. Shi, Y. Xie, et al., SP600125, a new JNK inhibitor, protects dopami-
nergic neurons in the MPTP model of Parkinson’s disease, Neurosci. Res. 48 (2004)
195–202.
[45] M. Baranclk, V. Bohacova, J. Kvackajova, et al., SB203580, a specific inhibitor of
p38-MAPK pathway, is a new reversal agent of P-glycoprotein-mediated multidrug
resistance, Eur. J. Pharm. Sci. 14 (2001) 29–36.
[46] P.R. Young, M.M. McLaughlin, S. Kumar, et al., Pyridinyl imidazole inhibitors of
p38 mitogen-activated protein kinase bind in the ATP site, J. Biol. Chem. 272
(1997) 12116–12121.
[47] E. Corcelle, N. Djerbi, M. Mari, et al., Control of the autophagy maturation step by
the MAPK ERK and p38: lessons from environmental carcinogens, Autophagy 3
(2007) 57–59.
[48] M.F. Favata, K.Y. Horiuchi, E.J. Manos, et al., Identification of a novel inhibitor of
mitogen-activated protein kinase kinase, J. Biol. Chem. 273 (1998) 18623–18632.
Y. Hu et al.
[49] J.V. Duncia, J.B. Santella 3rd, C.A. Higley, et al., MEK inhibitors: the chemistry and
biological activity of U0126, its analogs, and cyclization products, Bioorg. Med.
Chem. Lett. 8 (1998) 2839–2844.
[50] J. Qian, Y. Gu, C. Wu, et al., Agonist-induced activation of human FFA1 receptor
signals to extracellular signal-regulated kinase 1 and 2 through Gq- and Gi-coupled
1302
Biomedicine & Pharmacotherapy 108 (2018) 1294–1302
signaling cascades, Cell. Mol. Biol. Lett. 22 (2017) 13.
[51] H. Fukazawa, K. Noguchi, Y. Murakami, et al., Mitogen-activated protein/extra-
cellular signal-regulated kinase kinase (MEK) inhibitors restore anoikis sensitivity
in human breast cancer cell lines with a constitutively activated extracellular-
regulated kinase (ERK) pathway, Mol. Cancer Ther. 1 (2002) 303–309.