Available online at www.sciencedirect.

com

Domestic Animal Endocrinology 36 (2009) 32–44

Trilostane-induced inhibition of cortisol secretion results in reduced

negative feedback at the hypothalamic–pituitary axis
Takahiro Teshima a,∗ , Yasushi Hara a , Susumu Takekoshi b , Yoshinori Nezu a ,
Yasuji Harada a , Takuya Yogo a , Akira Teramoto c ,
Robert Y. Osamura b , Masahiro Tagawa a
a Division of Veterinary Surgery, Department of Veterinary Science, Faculty of Veterinary Medicine,

Nippon Veterinary and Life Science University, 1-7-1 Kyonan-cho, Musashino-shi, Tokyo 180-8602, Japan
b Department of Pathology, Tokai University School of Medicine, 143 Shimokasuya, Isehara-shi, Kanagawa 259-1193, Japan
c Department of Neurosurgery, Nippon Medical School, 1-1-5 Sendagi, Bunkyo-ku, Tokyo 113-8603, Japan

Received 4 September 2008; received in revised form 28 September 2008; accepted 1 October 2008

Abstract
Cushing’s disease caused by pituitary corticotroph adenoma in dogs is usually treated by medical treatment, and the efficacy of this
treatment has been reported. However, controversy remains as to whether reduced negative feedback through the inhibition of cortisol
secretion, similar to Nelson’s syndrome, may appear as an adverse effect. The purpose of this study was to investigate the effect
of reduced negative feedback through the inhibition of cortisol secretion by daily trilostane administration on the pituitary–adrenal
axis in clinically normal dogs. Dogs were administered 5 mg/kg trilostane twice a day every day for 8 weeks (n = 8) or 16 weeks
(n = 3). After the initiation of trilostane administration, plasma adrenocorticotropic hormone (ACTH) concentrations were increased
remarkably. As assessed by magnetic resonance imaging (MRI) during administration, the pituitary became enlarged. After trilostane
administration, the cytoplasmic areas of the pituitary corticotrophs were increased and the ratio of pituitary corticotrophs to all cells
in the anterior lobe was greater in the trilostane-treated dogs than that in untreated animals. In addition, histological examinations
revealed bilateral adrenal cortical hyperplasia. Using real-time PCR quantification, the expression of proopiomelanocortin (POMC)
mRNA in the pituitary and ACTH receptor (ACTH-R) mRNA in the adrenal gland was greater in the dogs treated with trilostane
than in untreated dogs. These results indicate that reduced negative feedback induced hyperfunction of the pituitary corticotrophs
and pituitary enlargement in healthy dogs. These changes suggest that the inhibition of cortisol secretion by trilostane may increase
the risk for accelerating the growth of corticotroph adenomas in dogs with Cushing’s disease.
© 2008 Elsevier Inc. All rights reserved.

Keywords: Corticotroph; Cushing’s disease; Dog; Nelson’s syndrome; Trilostane

1. Introduction corticism, a major endocrine disorder in dogs, and

Pituitary-dependent hyperadrenocorticism (PDH)
accounts for approximately 80–85% of hyperadreno-
∗ Corresponding author. Tel.: +81 422 31 4151;
fax: +81 422 33 8836.
E-mail address: teshima@bg8.so-net.ne.jp (T. Teshima).
the majority of these cases, which represent Cush-
ing’s disease, had adenomas of the pituitary corticotroph
[1,2]. In veterinary clinical medicine, the prevalence of
advanced imaging modalities for diagnosis, such as com-
puter tomography (CT) and magnetic resonance imaging
(MRI), has enabled a detailed visualization of the pitu-
itary, and, in combination with endocrinological tests,
has enabled the accurate diagnosis of Cushing’s disease.

0739-7240/$ – see front matter © 2008 Elsevier Inc. All rights reserved.
doi:10.1016/j.domaniend.2008.10.002
 T. Teshima et al. / Domestic Animal Endocrinology 36 (2009) 32–44
In regard to the treatment of PDH dogs, although sur-
gical treatment by transsphenoidal hypophysectomy has
been reported to be useful [3–5], most dogs with PDH
are treated clinically to inhibit cortisol excess [6].
Recently, trilostane has been used increasingly for
the treatment of PDH dogs, and its efficacy has been
reported [7–12]. Trilostane, a competitive inhibitor of
3␤-hydroxysteroid dehydrogenase, inhibits the synthesis
of several steroids in the adrenal cortex including corti-
sol [13,14]. Mitotane, which has been used for a long
time, inhibits the secretion of cortisol by cell necrosis
due to cytotoxicity on the zona fasciculata (ZF) and zona
reticularis (ZR) in the adrenal cortex [15–17]. However,
trilostane inhibits cortisol secretion by competitively
inhibiting enzymes and adverse effects are less frequent
than those that appear with mitotane treatment.
Although there are previous reports demonstrating
that the clinical symptoms of PDH dogs were improved
by treatment with trilostane [7–9,12], neither mitotane or
trilostane administration is aimed at a radical cure of the
disease arising from adenomas of the pituitary. More-
over, reduced negative feedback due to the inhibition of
cortisol secretion by mitotane or trilostane may increase
the risk for accelerating growth of the corticotroph
adenoma in dogs with Cushing’s disease. However, no
studies have investigated the effect of cortisol inhibition
by trilostane on the pituitary corticotroph that is the
cause the disease. In this study, in order to investigate the
effect of inhibition of cortisol secretion from the adrenal
cortex by trilostane on the pituitary corticotroph,
we examined the effect of daily administration of
trilostane on the hypothalamic–pituitary–adrenal
(HPA) axis in normal Beagle
dogs.
2. Materials and methods
2.1. Dogs
Twenty-one healthy Beagles were used. The group
characteristics were as follows: 9 males and 12 females;
1–6 years old (mean: 2.1 years old); and 7.0–15.0 kg
body weight (mean: 9.8 kg). Dogs were randomly
assigned to a control group (n = 10, 4 males and 6
females, mean age was 2.8 years, and mean weight was
9.8 kg), a short term of trilostane administration group
(TS group) (n = 8, 3 males and 5 females, mean age
was 1.5 years, and mean weight was 9.8 kg), and a long
term of trilostane administration group (TL group) (n = 3,
2 males and 1 female, mean age was 1.4 years, and
mean weight was 10.0 kg). Protocols for all experiments
involving the use of dogs were approved by the Bioethics
33
Committee at Nippon Veterinary and Life Science Uni-
versity.
2.2. Trilostane administration
In the trilostane administration group, adrenocor-
tical function was inhibited by the administration of
trilostane (DESOPAN® Tab.; Mochida Pharmaceutical,
Tokyo, Japan). Trilostane was capsuled at a dosage of
5 mg/kg body weight and administered orally twice a day
(10 mg/kg/day) with meals every day for 8 weeks (TS
group) and 16 weeks (TL group). The dosage was estab-
lished from several reports of trilostane [8–12,18–21].
During the administration period, the general condition
of dogs was monitored.
2.3. Endocrine tests and sample collection
Blood samples for hormone measurements were col-
lected from the jugular vein and transferred to ice-chilled
tubes containing EDTA and plain serum. Plasma and
serum were separated by centrifugation at 4 ◦ C for
15 min and stored at −80 ◦ C until assayed.
The adrenocorticotropic hormone (ACTH)-stimu-
lation test was performed by collecting blood samples
for measurement of the cortisol concentration at 0 and
60 min after the intravenous administration of 0.25 mg of
synthetic ACTH (Cortrosyn® ; Daiichi Sankyo, Tokyo,
Japan) [22].
The corticotropin releasing hormone (CRH)-
stimulation test was performed by collecting blood
samples for measurement of the ACTH concentration
at 0 and 30 min after the intravenous administration
of 1.5 ␮g ovine corticotropin-releasing factor (Peptide
institute, Inc., Osaka, Japan) per kg body weight [23,24].
In the trilostane administration group, the ACTH-
stimulation test was performed prior to trilostane
administration, every week until 8 weeks during the
trilostane administration, and every 2 weeks after 8
weeks (TL group). The CRH-stimulation test was per-
formed prior to trilostane administration, at 30 (4 weeks)
days, 58 (8 weeks) and 86 (12 weeks) days (TL group),
and after completion of the trilostane administration
period. All ACTH- and CRH-stimulation tests were per-
formed at 4 h after the administration of the morning
dose of trilostane.
2.4. Hormone determination
Serum cortisol concentrations were measured using a
competitive immunoassay (Immulite® Cortisol; Diag-
nostics Products Corporation, Los Angeles, USA) as
described previously [25]. The intra-assay coefficients of
34 T. Teshima et al. / Domestic Animal Endocrinology 36 (2009) 32–44
variation (CV) were 8.8 and 5.8% at cortisol levels of 74
and 524 nmol/l, respectively. The inter-assay CV were
10.0 and 6.3% at cortisol levels of 74 and 524 nmol/l,
respectively. The sensitivity of the assay was 5.5 nmol/l.
Plasma ACTH concentrations were measured
using a solid-phase, 2-site chemiluminescent enzyme
immunometric assay (Immulite® ACTH; Diagnostic
Products Corporation, Los Angeles, USA) in duplicate
as described previously [26,27]. The intra-assay coef-
ficients of variation were 9.6 and 4.9% at ACTH levels
of 5.3 and 221.8 pmol/l, respectively. The inter-assay
CV were 8.8 and 5.1% at ACTH levels of 5.8 and
248.9 pmol/l, respectively. The sensitivity of the assay
was 1.1 pmol/l. In cases that exceeded the measurement
range (>278 pmol/l), samples were diluted using a
special diluent (Diagnostics Products Corporation, Los
Angeles, USA).
2.5. Magnetic resonance imaging
Food was withheld from the trilostane group for 18 h
prior to MRI. Following the intramuscular administra-
tion of 0.25 mg droperidol (DROLEPTAN® ; Daiichi
Sankyo, Tokyo, Japan) per kg body weight, anesthe-
sia was induced by intravenous administration of 7 mg
propofol (Rapinovet® ; Schering-Plough Animal Health,
Tokyo, Japan) per kg body weight and maintained by
inhalation of isoflurane (Escain® ; Merck, Osaka, Japan)
and oxygen.
The MRI of the pituitary was performed using a
1.5 T superconducting magnet (VISART; Toshiba Medi-
cals, Tokyo, Japan). T1-weighted transverse images were
made before and after an intravenous bolus injection of
0.1 mmol contrast medium (Omniscan® , gadodiamide-
hydrate (Gd); Daiichi Sankyo, Tokyo, Japan) per kg body
weight. With the dogs in sternal recumbence, transverse
scans of the skull were made perpendicular to the skull
base from the rostral clinoid processes to the dorsum
sellae using the spin-echo method, which obtained a 350-
ms repetition time (TR), a 15-ms echo time (TE), and
2.0-mm thick consecutive slices. After Gd-T1-weighted
images of the pituitary were obtained, T1-weighted
imaging of the adrenal gland was performed prior to
trilostane administration. With the dogs in supine posi-
tion, coronal scans of the adrenal glands were obtained
perpendicular to the spinous process using the field-echo
method, which obtained a TR of 200 ms, a TE of 6.8 ms,
and 5.0-mm thick consecutive slices.
In each dog, the pituitary height was measured on
the image using the largest cross-section of the pitu-
itary. In order to enable adjustments for the size of the
dog, the edges of the brain were traced on this image
and the enclosed area was calculated by the computer
according to the method used in a study on CT [28].
From the height of the pituitary and the area of the
brain obtained in the Gd-T1-weighted image, the pitu-
itary height/brain area (P/B) ratio was calculated, as
previously described [28]. Pituitaries with a P/B ratio
of more than 0.31 × 10−2 mm−1 were considered to be
enlarged. The MRI of the pituitary was performed prior
to trilostane administration and every 2 weeks during the
trilostane administration.
2.6. Tissue samples
Each dog was euthanized by an intravenous injec-
tion of an overdose pentobarbital solution following the
CRH-stimulation test in the control group and after the
administration of trilostane in the trilostane administra-
tion group. The pituitary and bilateral adrenal glands
were carefully harvested and weighed before being fixed
in 4% paraformaldehyde for histological examination or
stored at −80 ◦ C for RNA extraction. Each pituitary was
cut at the median sagittal plane and each adrenal gland
was cut twice transversely, midway between the inden-
tation of the phrenicoabdominal vein and each pole [29].
2.7. Histological examination
Samples for histological examination were dehy-
drated and embedded in paraffin. Sections were cut at
2 ␮m. One section was stained with hematoxylin and
eosin (HE), and adjacent sections of pituitaries were
subjected to immunohistochemical staining by standard
enzyme antibody techniques using a monoclonal mouse
antibody to synthetic ACTH1–39 (Dako Japan, Kyoto,
Japan) [30].
2.8. Pituitary and adrenal morphometry
Pituitary and adrenal morphometry were per-
formed with the “Image J” software version 1.36
(http://rsb.info.nih.gov/ij/). In each dog, the area and
numbers of ACTH-positive cells in the anterior pitu-
itary gland were measured. For pituitary morphometry,
the anterior pituitary gland was divided equally into five
regions between the dorsal end and the ventral end of the
pituitary gland in the median section, and two fields each
were randomly selected from the five regions [30]. The
number of cells and the numbers of ACTH-positive cells
per field of the anterior pituitary gland were measured
in 10 fields at 400× magnification for each dog, and the
ratio of ACTH-positive cells were calculated.
In the adrenal glands, the width of the zona glomeru-
losa (ZG), zona fasciculata, and zona reticularis were
 T. Teshima et al. / Domestic Animal Endocrinology 36 (2009) 32–44
determined at 10 different places. The number of cells
per field of ZF and ZR were measured in 10 fields at
400× magnification for each dog.
2.9. RNA extraction and reverse transcription
Total RNA was extracted from pituitaries and adrenal
glands in tubes containing 2 ml Trizol (Invitrogen Japan,
Tokyo, Japan). The tissues were disrupted using a
standard homogenizer. For purification of total RNA,
samples were treated with RNeasy Mini Kit (QIAGEN,
Tokyo, Japan). The yield of RNA was quantified by mea-
suring the optical density of a sample diluted to 1:20
at 260 and 280 nm. 0.5 ␮g of total RNA of pituitary
and adrenal gland were then reverse transcribed with
the SuperScriptTM III first-Strand Synthesis SuperMix
(Invitrogen Japan, Tokyo, Japan). Reverse transcribed
samples were diluted to 20 ␮l in DEPC treated water
(Invitrogen Japan, Tokyo, Japan).
2.10. Real-time quantitative RT-PCR
Real-time quantitative RT-PCR analysis for proopi-
omelanocortin (POMC) and ACTH receptor (ACTH-R)
mRNAs were performed using the Applied Biosys-
tems 7500 Sequence Detections System (Applied
Biosystems Japan, Tokyo, Japan). Sequences of the
canine POMC and ACTH-R were obtained from NCBI
(http://www.ncbi.nlm.nih.gov/). Corresponding primer
pairs (forward and reverse) for the Sybergreen sys-
tem, as listed in Table 1, were designed using the
NCBI database (http://www.ncbi.nlm.nih.gov/) and used
according to methods described in the literature [31,32].
The PCR reaction was performed in MicroAmp Strio
Tubes (Applied Biosystems, Tokyo, Japan) with an
end-volume of 20 ␮l. A master mix containing 1.0 ␮l
Table 1
Primer sequences.
Gene Sequence (5 → 3 )
POMC For GGCCTCTGTGGAAGTGAGTG
Rev ACGCCAGCAGGTTACTTTCC
ACTH-R For GATCTTGACGCTTCCCAGAG
Rev ATGTAGCAGGCGCAGTAAGG
GAPDH For GATGGGCGTGAACCATGAG
Rev TCATGAGGCCCTCCACGAT
GUS For CCTCCTGCCGTATTACCCTTG
Rev TCTGGACGAAGTAACCCTTGG
RPS5 For TCACTGGTGAGAACCCCCT
Rev CCTGATTCACACGGCGTAG
35
reverse transcribed RNA, 10 ␮l SYBR GREEN PCR
Master Mix, 0.4 ␮l (10 ␮mol/l) of respective forward
and reverse primer, and 8.2 ␮l DEPC treated water per
reaction was prepared. The PCR reaction was divided
into three stages: (1) 2 min at 50 ◦ C; (2) 2 min at
95 ◦ C, and (3) 15 s at 95 ◦ C, and 60 s at 60 ◦ C. Stage
3 was repeated 40 times. All samples were assayed
in duplicate. The specificity and the size of the PCR
products were assessed by adding a melt curve at the
end of the amplifications and a single melting curve
peak was observed. Data were quantitatively analyzed
using a serial dilution of control samples included in
each reaction to produce a standard curve. To normal-
ize the expression level of each gene in each sample,
the expression level of three commonly used refer-
ence genes (glyceraldehyde-3-phosphate dehydrogenase
(GAPDH), beta glucuronidase (GUS), and ribosomal
protein S5 (RPS5)) was determined for each sample. The
most stable reference gene for normalization of the rel-
ative concentrations of mRNA was identified using the
GeNorm Visual basic application for Microsoft Excel
(http://medgen.ugent.be/∼jvdesomp/genorm/) [33]. We
found that GAPDH was the most stably expressed refer-
ence gene. The relative expression of each gene in each
sample was calculated by dividing by that of GAPDH.
2.11. Statistical analysis
All results were presented as median and range. In the
trilostane administration group, changes in serum corti-
sol concentration, plasma ACTH concentration, and P/B
ratio were analyzed by two-way ANOVA followed by
Tukey–Kramer’s post hoc tests. Regarding excised tis-
sue weights of pituitary and bilateral adrenal glands, the
ratios and area of ACTH-positive cells in the anterior
pituitary gland, the width of ZG, ZF, and ZR, the num-
Length (bp) Melting temperature (◦ C) Reference
80 84.8 Accession No. AY024339
147 82.4 Accession No. XM541098
131 84.0 Sieber-Ruckstuhl et al. [31]
117 81.4 Accession No. NM001003191
141 85.8 Brinkhof et al. [32]
36 T. Teshima et al. / Domestic Animal Endocrinology 36 (2009) 32–44

450

579.3 (408.0–636.9)
857.1 (710.2–886.6)
30.4 (27.6–41.4)
33.1 (30.4–77.3)
400

350

16 weeks
Cortisol (nmol/l)

300
250

27.6 (27.6–30.4)
33.1 (30.4–63.5)
200

14 weeks
150

∗ ∗ ∗ ∗

nd
nd
100
∗ ∗ ∗ ∗ ∗ ∗
∗ ∗
50

390.1 (315.9–405.4)
484.0 (316.6–624.4)
30.4 (27.6–41.4)
33.1 (30.4–35.1)
0
0 1 2 3 4 5 6 7 8 10 12 14 16
Time (weeks)

12 weeks
Fig. 1. Changes in serum cortisol concentrations. Serum cortisol
concentrations before (䊉) and after ACTH stimulation () during

33.1 (27.6–126.9)
trilostane administration. The post-stimulation serum cortisol con-

30.4 (27.6–82.8)
centrations decrease significantly during trilostane administration. *,
P < 0.01 vs. at time 0.

10 weeks

nd
nd
ber of cells per field of ZF and ZR, and the expression
of POMC and ACTH receptor mRNA were analyzed

204.2 (42.5–1623.0)
670.7 (238.5–758.6)
27.6 (24.8–186.5)
29.0 (24.8–65.5)
by one-way ANOVA, and then differences among the
means were analyzed using Tukey–Kramer’s post hoc
tests. Statistical analyses were performed using Excel

8 weeks
2003 with the add-in software Statcel 2. Differences were
considered significant when P < 0.05.

40.0 (27.6–143.5)
29.0 (21.3–38.6)
3. Results
6 weeks

nd
nd
Changes of serum cortisol and plasma ACTH concen-
Serum cortisol and plasma ACTH concentrations during trilostane administration.

trations during trilostane administration are summarized

543.4 (153.6–894.1)
38.9 (24.8–168.3)

138.2 (22.9–557.0)
28.8 (18.6–77.3)

in Table 2.
4 weeks

3.1. Effect on serum cortisol and plasma ACTH

Trilostane administration

concentrations
60.7 (27.6–173.8)
46.9 (27.6–85.5)

After the initiation of trilostane administration, post-

stimulation serum cortisol concentrations decreased
2 weeks

significantly compared to that observed before adminis-

nd
nd

tration (Fig. 1). The basal plasma ACTH concentrations

in the control group and the trilostane administra-
408.3 (324.0–510.4)
38.6 (27.6–107.6)

43.6 (22.4–75.5)

tion group before the administration of trilostane

Before trilostane

5.2 (3.3–10.1)
administration

were 5.2 (3.3–10.8) pmol/l and 5.2 (3.3–10.1) pmol/l,

respectively. The post-stimulation plasma ACTH con-
centrations in the control group and trilostane group
before the administration of trilostane were 40.9
post-ACTH concentration

post-CRH concentration

(19.1–66.9) pmol/l and 43.6 (22.4–75.5) pmol/l, respec-

Basal concentration

Basal concentration

tively. No significant difference was observed in the

nd = not determined.
Cortisol (nmol/l)

basal plasma ACTH concentrations and the plasma

ACTH (pmol/l)

ACTH concentrations after CRH-stimulation between

Table 2

the control and trilostane groups. After the initiation of

trilostane administration, both the basal plasma ACTH
 T. Teshima et al. / Domestic Animal Endocrinology 36 (2009) 32–44
1000
900 a, b, c, d
800
700
∗
TH (pmol/l)
a
600 a a
500
400 ∗ higher than that of the TS group (P < 0.05).
ACT
300
200
100
0 The ACTH-positive cell area in the control, TS,
0 4 8 12 16
Time (weeks)
Fig. 2. Changes in plasma ACTH concentrations. Plasma ACTH con-
centrations before (䊉) and after CRH-stimulation () during trilostane
administration. The basal and post-stimulation ACTH concentrations
increase significantly during trilostane administration. *, P < 0.05 vs.
before stimulation at time 0. a, P < 0.01 vs. after stimulation at time
0. b, P < 0.01 vs. after stimulation at 4 weeks. c, P < 0.05 vs. after
stimulation at 8 weeks. d, P < 0.05 vs. after stimulation at 12 weeks.
concentrations and the plasma ACTH concentrations
after CRH-stimulation increased significantly compared
to those before trilostane administration (Fig. 2). Finally,
the plasma ACTH concentrations after CRH-stimulation
at 16 weeks increased significantly compared to that at
12 weeks (P < 0.05).
3.2. P/B ratio
Before the administration of trilostane, the P/B ratio
was 0.269 (0.256–0.288; ×10−2 mm−1 ) in the trilostane
administration group. During the administration of
trilostane, the P/B ratios showed a significant increase
after trilostane administration (Figs. 3 and 4). The
P/B ratios at every 2 weeks were 0.288 (0.261–0.330;
2 weeks), 0.314 (0.264–0.332; 4 weeks), 0.329
(0.282–0.354; 6 weeks), 0.336 (0.294–0.368; 8 weeks),
0.342 (0.321–0.353; 10 weeks), 0.331 (0.321–0.355;
12 weeks), 0.348 (0.321–0.356; 14 weeks), and 0.350
(0.323–0.389; 16 weeks), respectively. Finally, the
increase of the P/B ratios at 16 weeks increased signifi-
cantly compared to that at 8 weeks (P < 0.05).
3.3. Tissue weights
The weight of the pituitary was 55 (50–70) mg,
90 (70–120) mg, and 120 (110–130) mg in the con-
trol, TS, and TL group, respectively. The weight of
the right adrenal gland was 0.65 (0.41–0.83) g, 1.49
(1.24–3.14) g, and 1.92 (1.91–1.96) g, and left adrenal
gland was 0.60 (0.42–0.84) g, 1.39 (1.11–2.88) g, and
37
1.63 (1.52–1.88) g in the control, TS and TL group,
respectively. The weights of the pituitary and bilateral
adrenal glands were significantly higher in the TS and TL
group than in the control group (pituitary, and right and
left adrenal gland, P < 0.01, respectively). The weight
of the pituitary of the TL group was also significantly
3.4. Pituitary and adrenal morphometry
and TL group were 78.54 (58.37–228.95) ␮m2 , 93.66
(72.03–253.22) ␮m2 , and 107.87 (78.87–289.77) ␮m2 ,
respectively. The ACTH-positive cell areas were signif-
icantly (P < 0.01) greater in the TS and TL group than in
the control group. The ACTH-positive cell areas of the
TL group were also significantly greater than that of the
TS group (P < 0.01) (Figs. 5 and 6). The ACTH-positive
cell ratios were 22.2 (18.0–28.2)%, 28.7 (24.2–38.1)%,
and 32.7 (32.1–38.9)% in the control, TS, and TL group,
respectively. The ACTH-positive cell ratio of the TS and
TL group were significantly (P < 0.05) higher than that
of the control group.
The MR images prior to trilostane administration
revealed no abnormalities in size and shape of the
bilateral adrenal glands in all dogs. The width of
ZG in the control, TS, and TL group were 0.132
(0.100–0.234) mm, 0.146 (0.112–0.329) mm, and 0.148
(0.108–0.305) mm, respectively. The width of ZF in the
control in the control, TS and TL group were 0.786
(0.560–1.719) mm, 1.839 (0.726–3.229) mm, and 1.607
(1.147–2.863) mm, respectively. The width of ZR in the
control in the control, TS, and TL group were 0.403
(0.257–0.888) mm, 0.858 (0.288–1.986) mm, and 1.101
(0.688–1.739) mm, respectively. The width of ZG, ZF,
and ZR were significantly (P < 0.01, respectively) greater
in the TS and TL group than in the control group. The
number of cells per field of ZF in the control, TS, and TL
group were 158.0 (114–194) cells, 110 (72–180) cells,
and 107 (94–141) cells, respectively. The number of
cells per field of ZR in the control, TS, and TL group
were 260 (188–394) cells, 209 (151–289) cells, and 204
(160–235) cells, respectively. The number of cells of
ZF and ZR were significantly lower (P < 0.01, respec-
tively) in the TS and TL group than in the control group
(Fig. 7).
3.5. Levels of POMC and ACTH receptor mRNA
expression
The levels of POMC mRNA expression in the TS
and TL group were about 3.3-fold (median 3.48, range
38 T. Teshima et al. / Domestic Animal Endocrinology 36 (2009) 32–44

Fig. 3. Changes in pituitary gland observed by Gd-T1-weighted transverse images. Gd-T1-weighted transverse images of a dog in the TS group
before (A) and after 8 weeks of trilostane administration (B). Before trilostane administration, pituitary gland height is 4.4 mm and P/B ratio is
0.273. After 8 weeks of trilostane administration, pituitary gland height is 5.6 mm and P/B ratio is 0.339. Gd-T1-weighted transverse images of a
dog in the TL group before (C) and after 16 weeks of trilostane administration (D). Before trilostane administration, pituitary gland height is 4.7 mm
and P/B ratio is 0.261. After 16 weeks of trilostane administration, pituitary gland height is 6.8 mm and P/B ratio is 0.389. Bar = 10 mm.

0.39 a, b, c, 2.09–4.45) and 4.0-fold (median 4.53, range 2.63–4.85)

e, f greater than that in the control group (P < 0.01). The
0.37
levels of ACTH-R mRNA expression in the TS and
P/B ratio x 10-2 (mm-1)

a, b, c
aa, b
b, c a, b
0.35 a, b b, d TL group were about 2.5-fold (median 2.14, range
a, b 1.52–4.35) and 2.7-fold (median 2.76, range 2.40–3.18)
0.33
a greater than that in the control group (P < 0.05)
0.31 (Fig. 8).
0.29
4. Discussion
0.27
27

0.25 Cortisol secretion from the adrenal cortex is regulated

0 2 4 6 8 10 12 14 16
Time (weeks) by the HPA axis, and a negative feedback mecha-
nism functions to control cortisol concentrations in vivo
Fig. 4. Changes in P/B ratios during the trilostane administration. P/B [34,35]. Several reports have shown that the inhibition
ratio of more than 0.31 × 10−2 mm−1 is considered to be pituitary
of cortisol secretion in dogs with Cushing’s disease
enlarged. a, P < 0.01 vs. time 0. b, P < 0.01 vs. 2 weeks. c, P < 0.01 vs.
4 weeks. d, P < 0.05 vs. 4 weeks. e, P < 0.01 vs. 6 weeks. f, P < 0.05 vs. by mitotane treatment suppressed negative feedback,
8 weeks. and may accelerate the growth of pituitary adenoma
 T. Teshima et al. / Domestic Animal Endocrinology 36 (2009) 32–44 39

Fig. 5. Immunohistochemical staining of the anterior pituitary gland using anti-ACTH antibody. The ACTH-positive cells in the control (A, B), TS
(C, D), and TL group (E, F). Bar = 100 ␮m (A, C, E) and 50 ␮m (B, D, F).

Fig. 6. Comparison of the ACTH-positive cell area and cell ratio in the anterior pituitary gland. *, P < 0.05 vs. control group (CT). **, P < 0.01 vs.
CT. #, P < 0.01 vs. TS group.
40 T. Teshima et al. / Domestic Animal Endocrinology 36 (2009) 32–44

Fig. 7. Comparison of the width and numbers of cells in the adrenal cortex. Hematoxylin and eosin staining of a section from the adrenal gland (A).
Left: TS group; right: control group. The adrenal cortex is enlarged in the TS and TL group. Bar = 1.0 mm. The width of the zona glomerulosa (ZG),
zona fasciculata (ZF), and zona reticularis (ZR) (B). The number of cells per field of ZF and ZR (C). **, P < 0.01 vs. control group. #, P < 0.01 vs.
TS group.

Fig. 8. Comparison of the relative levels of POMC mRNA and ACTH receptor mRNA expression. The relative levels of proopiomelanocortin
(POMC) mRNA expression in the pituitary gland and ACTH receptor (ACTH-R) mRNA expression in the adrenal gland. *, P < 0.05 vs. control
group (CT). **, P < 0.01 vs. CT.
 T. Teshima et al. / Domestic Animal Endocrinology 36 (2009) 32–44
[2,36–38]. In humans, a number of reports demonstrated
the occurrence of Nelson’s syndrome, in which pituitary
adenoma growth was accelerated, resulting from the dis-
appearance of cortisol secretion and negative feedback
that occurred after bilateral adrenalectomy in Cushing’s
disease patients [39–46]. Therefore, Nelson’s syndrome
was re-evaluated recently [47–49], and this phenomenon
caused by trilostane and mitotane in humans has been
termed “chemical Nelson’s syndrome” [50]. We have
experienced some PDH dogs in which large pituitary
adenomas were found after trilostane treatment. These
dogs were diagnosed with PDH without diagnostic imag-
ing, such as CT or MRI, and treated by trilostane.
However, several months later, the doses of trilostane
needed increased or neurological signs were observed.
However, assessing the potential risk in PDH dogs
treated with trilostane is difficult. Whether changes sim-
ilar to those observed in Nelson’s syndrome appear in
dogs with Cushing’s disease is controversial, and no
studies have investigated the effect of cortisol inhibi-
tion by trilostane on the normal pituitary corticotroph.
In this study, we investigated the effect of trilostane on
the pituitary–adrenal axis by inhibiting adrenal cortex
function through the daily administration of trilostane in
healthy Beagle dogs.
The dose of trilostane in the trilostane administration
group was determined based on reports of the dura-
tion of action and its use in PDH dogs [7–12,18–21].
In addition, the doses tended to increase as the therapy
continued [8,9,11,12,21]. Since the duration of trilostane
is less than 20 h [14], we attempted to suppress cor-
tisol secretion of the adrenal cortex continuously by
the twice daily administration in this experiment. The-
ACTH stimulation test revealed that cortisol secretion
was sufficiently suppressed during trilostane adminis-
tration, and adverse effects such as lethargy, anorexia,
vomiting and diarrhea were not observed. With regard to
ACTH secretion from the pituitary, the CRH-stimulation
test showed that ACTH concentrations sequentially
increased remarkably during the trilostane adminis-
tration, which suggests an increased production and
secretion of ACTH at the pituitary corticotroph. This
may be attributable to the suppressed negative feed-
back due to the decreased cortisol secretion from the
adrenal cortex induced by trilostane administration.
Indeed, increased plasma ACTH concentrations have
also been observed in PDH dogs treated with trilostane
[18,19].
MRI during the trilostane administration revealed
that the pituitary increased in size during the period of
trilostane administration. After 4 weeks of treatment,
evaluation using the P/B ratio, a common marker for the
41
size of the pituitary in dogs [28], revealed that the P/B
ratio was greater than 0.31, which was judged to indicate
an enlarged pituitary. Immunohistochemical analysis
revealed that there was a significant change in the
cytoplasmic areas of corticotrophs and the ratio of corti-
cotrophs to all cells in the anterior lobe of the pituitary in
the TS and TL group compared with the control group,
and, furthermore, the cytoplasmic areas of corticotrophs
in the TL group were greater than that of the TS group.
In addition, the weight of the pituitary after the end of
trilostane administration showed a significant increase in
the TS and TL groups. These results suggest that hyper-
trophy and hyperplasia of the corticotroph may account
for the enlargement of the pituitary, and that the longer
cortisol secretion is suppressed, the size of the pituitary
may become larger with increasing the plasma ACTH
concentrations.
Monoclonal expansion of the corticotroph may
induce adenomatous formation [51], but the hyperplasia
of the corticotrophs observed in this study was not mon-
oclonal. In humans and rats, adrenalectomy and chronic
increased secretion of CRH has been shown to result
in corticotroph hyperplasia and adenomatous formation
[52–54]. However, adenomatous formation of the cor-
ticotroph in dogs has not been examined. In this study,
since cortisol secretion was inhibited, the production and
secretion of ACTH were increased through reduced neg-
ative feedback, although adenomatous formation was not
observed in the trilostane administration group. Never-
theless, hypertrophy and hyperplasia of the corticotroph
and enlargement of the pituitary were observed, probably
resulted in reduced negative feedback. Although CRH,
which stimulates the production and secretion of ACTH
from the corticotrophs, was not measured in the present
experiment, an increase in ACTH concentrations and
POMC mRNA expression suggests that CRH secretion
from the hypothalamus was increased in the trilostane
administration group. In humans with Cushing’s dis-
ease, CRH secretion from the hypothalamus is believed
to increase after the adrenalectomy [49]. In regards
to dogs with Cushing’s disease, no study has exam-
ined whether CRH concentrations are increased by the
suppressed secretion of cortisol. However, if CRH con-
centrations are also increased by the suppressed secretion
of cortisol in dogs with Cushing’s disease, the risk of
occurrence of chemical Nelson’s syndrome may become
high.
After the end of trilostane administration, the level
of ACTH-R mRNA expression was increased, and the
size of the bilateral adrenal glands was increased in
the trilostane administration group. The ACTH-R is
observed principally in cells of the adrenal cortex and
42 T. Teshima et al. / Domestic Animal Endocrinology 36 (2009) 32–44
signals cells in the ZF to synthesize and secrete cortisol.
In many species, ACTH has been reported to up-regulate
the level of ACTH-R mRNA and the number of ACTH
binding sites in adrenocortical cells [55–58]. Moreover,
in murine adrenal glands, a high level of in vivo ACTH is
a major factor up-regulating ACTH-R gene expression,
while low circulating ACTH may not be a substantial
factor for ACTH-R gene expression [58]. With regard to
ACTH-R mRNA expression, the remarkably increased
ACTH may result in an up-regulation of ACTH-R
mRNA expression in the trilostane administration group.
Histological analysis using HE staining revealed that
each zona of the adrenal cortex was thickened in the TS
and TL groups. In addition, an enlargement of cytoplas-
mic areas and a decrease in cell number per area were
observed in ZF and ZR, where cortisol was produced
and secreted, suggesting the appearance of hyperplastic
changes. Two potential causes for these changes in the
adrenal cortex were considered. First, since the ACTH-
R mRNA expression and serum ACTH concentrations
were raised, stimulation of the adrenal cortex by ACTH
was increased. This may lead to hypertrophy and hyper-
plasia in the cells of the adrenal cortex. Second, the
mechanism of action of trilostane may be involved. With
inhibition of steroid synthesis in the adrenal cortex, pre-
cursors of steroids may accumulate in the cells, which
may lead to hypertrophy in the adrenal cortex [59,60].
Although the precursors of steroids were not measured
in this study, trilostane administration has been reported
to increase precursors of steroids in dogs, humans, and
guinea pigs [13,19,61]. Despite the reports that necro-
sis was observed in the adrenal cortex of the PDH dogs
treated with trilostane [59,62], no such changes were
observed in the adrenal cortex in the TS and TL groups
in this study.
It is not possible to conclude, based on the present
experiments using healthy dogs, that similar changes
observed in the pituitary corticotroph in the trilostane
group will be observed in dogs with Cushing’s dis-
ease. However, the negative feedback of cortisol on
ACTH secretion from the pituitary is presumed to
function even in dogs with Cushing’s disease. The
dexamethasone suppression test revealed that cortisol
secretion is not suppressed by low-dose dexamethasone
(0.01 mg/kg), but is suppressed by high-dose dexam-
ethasone (0.1 mg/kg) due to negative feedback in most
dogs with Cushing’s disease [63–65]. Moreover, a cor-
relation was found between the size of the pituitary
gland and resistance to dexamethasone, and the dex-
amethasone resistance was associated with high plasma
ACTH concentrations in dogs with Cushing’s disease
[28]. Considering these findings, negative feedback by
cortisol may occur in dogs with Cushing’s disease,
and ACTH secretion may be suppressed by negative
feedback by cortisol in the corticotroph adenoma as
well.
Since changes in the HPA axis during the trilostane
administration were examined in this study, it remains to
be clarified how enlargement of the pituitary and hyper-
function of the pituitary corticotroph by suppression of
cortisol secretion would change after cessation of the
trilostane administration. Taking into account the phar-
macology of trilostane, a competitive enzyme inhibitor,
these changes may return after cessation of administra-
tion. Clinically, however, it is difficult to end trilostane
administration in PDH dogs, and life-time treatment is
thought to be necessary.
In conclusion, due to the suppression of cortisol secre-
tion by trilostane, reduced negative feedback induced
hyperfunction of the pituitary corticotroph, which caused
an enlarged pituitary due to corticotroph hypertrophy
and hyperplasia in healthy dogs. Moreover, the longer
cortisol secretion was suppressed, the more corticotroph
hyperfunction increased and the larger the pituitary
became. These changes may help to understand whether
changes similar to Nelson’s syndrome appear in dogs
with Cushing’s disease.
Acknowledgment
The authors thank IDEXX Laboratories, KK (Tokyo,
Japan) for support in hormone determination.
References
[1] Guptill L, Scott-Moncrieff JC, Widmer WR. Diagnosis of canine
hyperadrenocorticism. Vet Clin North Am Small Anim Pract
1997;27:215–35.
[2] Feldman EC, Nelson RW. Canine hyperadrenocorticism (Cush-
ing’s syndrome). In: Feldman EC, Nelson RW, editors. Canine
and feline endocrinology and reproduction. Philadelphia: WB
Saunders Co.; 2004. p. 252–357.
[3] Hanson JM, van’t HM, Voorhout G, Teske E, Kooistra HS, Meij
BP. Efficacy of transsphenoidal hypophysectomy in treatment of
dogs with pituitary-dependent hyperadrenocorticism. J Vet Intern
Med 2005;19:687–94.
[4] Hanson JM, Teske E, Voorhout G, Galac S, Kooistra HS, Meij BP.
Prognostic factors for outcome after transsphenoidal hypophy-
sectomy in dogs with pituitary-dependent hyperadrenocorticism.
J Neurosurg 2007;107:830–40.
[5] Hara Y, Tagawa M, Masuda H, Sako T, Koyama H, Orima
H, et al. Transsphenoidal hypophysectomy for four dogs with
pituitary ACTH-producing adenoma. J Vet Med Sci 2003;65:
801–4.
[6] Braddock JA. Medical treatment of hyperadrenocorticism in the
dog. Aust Vet J 2003;81:31–3.
 T. Teshima et al. / Domestic Animal Endocrinology 36 (2009) 32–44
[7] Bell R, Neiger R, McGrotty Y, Ramsey IK. Study of
the effects of once daily doses of trilostane on corti-
sol concentrations and responsiveness to adrenocorticotrophic
hormone in hyperadrenocorticoid dogs. Vet Rec 2006;159:
277–81.
[8] Alenza DP, Arenas C, Lopez ML, Melian C. Long-term efficacy
of trilostane administered twice daily in dogs with pituitary-
dependent hyperadrenocorticism. J Am Anim Hosp Assoc
2006;42:269–76.
[9] Braddock JA, Church DB, Robertson ID, Watson AD. Trilostane
treatment in dogs with pituitary-dependent hyperadrenocorticism.
Aust Vet J 2003;81:600–7.
[10] Barker EN, Campbell S, Tebb AJ, Neiger R, Herrtage ME, Reid
SW, et al. A comparison of the survival times of dogs treated with
mitotane or trilostane for pituitary-dependent hyperadrenocorti-
cism. J Vet Intern Med 2005;19:810–5.
[11] Reine NJ. Medical management of pituitary-dependent hypera-
drenocorticism: mitotane versus trilostane. Clin Tech Small Anim
Pract 2007;22:18–25.
[12] Neiger R, Ramsey I, O’Connor J, Hurley KJ, Mooney CT.
Trilostane treatment of 78 dogs with pituitary-dependent hyper-
adrenocorticism. Vet Rec 2002;150:799–804.
[13] Potts GO, Creange JE, Hardomg HR, Schane HP. Trilostane,
an orally active inhibitor of steroid biosynthesis. Steroids
1978;32:257–67.
[14] Plumb DC. Trilostane. In: Plumb DC, editor. Veterinary drug
handbook. 5th ed. Ames: Iowa State University Press; 2005. p.
778–9.
[15] Peterson ME. Medical treatment of canine pituitary-dependent
hyperadrenocorticism (Cushing’s disease). Vet Clin North Am
Small Anim Pract 2001;31:1005–14.
[16] Kintzer PP, Peterson ME. Mitotane (o,p’-DDD) treatment of 200
dogs with pituitary-dependent hyperadrenocorticism. J Vet Intern
Med 1991;5:182–90.
[17] den Hertog E, Braakman JC, Teske E, Kooistra HS, Rijnberk
A. Results of non-selective adrenocorticolysis by o,p’-DDD in
129 dogs with pituitary-dependent hyperadrenocorticism. Vet Rec
1999;144:12–7.
[18] Witt AL, Neiger R. Adrenocorticotropic hormone levels in
dogs with pituitary-dependent hyperadrenocorticism following
trilostane therapy. Vet Rec 2004;154:399–400.
[19] Sieber-Ruckstuhl NS, Boretti FS, Wenger M, Maser-Gluth C,
Reusch CE. Cortisol, aldosterone, cortisol precursor, androgen
and endogenous ACTH concentrations in dogs with pituitary-
dependant hyperadrenocorticism treated with trilostane. Domest
Anim Endocrinol 2006;31:63–75.
[20] Wenger M, Sieber-Ruckstuhl NS, Müller C, Reusch CE. Effect
of trilostane on serum concentrations of aldosterone, cortisol,
and potassium in dogs with pituitary-dependent hyperadrenocor-
ticism. Am J Vet Res 2004;65:1245–50.
[21] Ruckstuhl NS, Nett CS, Reusch CE. Results of clinical exam-
inations, laboratory tests, and ultrasonography in dogs with
pituitary-dependent hyperadrenocorticism treated with trilostane.
Am J Vet Res 2002;63:506–12.
[22] Hansen BL, Kemppainen RJ, MacDonald JM. Synthetic ACTH
(cosyntropin) stimulation tests in normal dogs: comparison of
intravenous and intramuscular administration. J Am Anim Hosp
Assoc 1994;30:38–41.
[23] Meij BP, Mol JA, Bevers MM, Rijnberk A. Residual pitu-
itary function after transsphenoidal hypophysectomy in dogs
with pituitary-dependent hyperadrenocorticism. J Endocrinol
1997;155:531–9.
43
[24] Reusch CE, Steffen T, Hoerauf A. The efficacy of l-deprenyl in
dogs with pituitary-dependent hyperadrenocorticism. J Vet Intern
Med 1999;13:291–301.
[25] Fracassi F, Gandini G, Diana A, Preziosi R, Ingh TS, Famigli-
Bergamini P, et al. Acromegaly due to a somatroph adenoma in a
dog. Domest Anim Endocrinol 2007;32:43–54.
[26] Granger N, de Fornel P, Devauchelle P, Segond S, Delisle
F, Rosenberg D. Plasma pro-opiomelanocortin, pro-
adrenocorticotropin hormone, and pituitary adenoma size
in dogs with Cushing’s disease. J Vet Intern Med 2005;19:
23–8.
[27] Scott-Moncrieff JC, Koshko MA, Brown JA, Hill K, Refsal KR.
Validation of a chemiluminescent enzyme immunometric assay
for plasma adrenocorticotropic hormone in the dog. Vet Clin
Pathol 2003;32:180–7.
[28] Kooistra HS, Voorhout G, Mol JA, Rijnberk A. Correlation
between impairment of glucocorticoid feedback and the size of
the pituitary gland in dogs with pituitary-dependent hyperadreno-
corticism. J Endocrinol 1997;152:387–94.
[29] Meij BP, Mol JA, van den Ingh TS, Bevers MM, Hazewinkel
HA, Rijnberk A. Assessment of pituitary function after transsphe-
noidal hypophysectomy in beagle dogs. Domest Anim Endocrinol
1997;14:81–97.
[30] Taoda T, Hara Y, Takekoshi S, Itoh J, Teramoto A, Osamura RY,
et al. Effect of mitotane on pituitary corticotrophs in clinically
normal dogs. Am J Vet Res 2006;67:1385–94.
[31] Sieber-Ruckstuhl NS, Meli ML, Boretti FS, Gönczi E, Lutz H,
Reusch CE. Quantitative real-time PCR for the measurement
of 11beta-HSD1 and 11beta-HSD2 mRNA levels in tissues of
healthy dogs. Horm Metab Res 2007;39:548–54.
[32] Brinkhof B, Spee B, Rothuizen J, Penning LC. Development and
evaluation of canine reference genes for accurate quantification
of gene expression. Anal Biochem 2006;356:36–43.
[33] Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De
Paepe A, et al. Accurate normalization of real-time quantitative
RT-PCR data by geometric averaging of multiple internal control
genes. Genome Biol 2002;18(3) [RESEARCH0034].
[34] Keller-Wood ME, Dallman MF. Corticosteroid inhibition of
ACTH secretion. Endocr Rev 1984;5:1–24.
[35] Bertoy EH, Feldman EC, Nelson RW, Dublin AB, Reid
MH, Feldman MS. One-year follow-up evaluation of magnetic
resonance imaging of the brain in dogs with pituitary-
dependent hyperadrenocorticism. J Am Vet Med Assoc 1996;208:
1268–73.
[36] Nelson RW, Feldman EC, Shinsako J. Effect of o,p’DDD therapy
on endogenous ACTH concentrations in dogs with hypophysis-
dependent hyperadrenocorticism. Am J Vet Res 1985;46:1534–7.
[37] Peterson ME, Orth DN, Halmi NS, Zielinski AC, Davis DR,
Chavez FT, et al. Plasma immunoreactive proopiomelanocortin
peptides and cortisol in normal dogs and dogs with Addi-
son’s disease and Cushing’s syndrome: basal concentrations.
Endocrinology 1986;119:720–30.
[38] Sarfaty D, Carrillo JM, Peterson ME. Neurologic, endocrino-
logic, and pathologic findings associated with large pituitary
tumors in dogs: eight cases (1976–1984). J Am Vet Med Assoc
1988;193:854–6.
[39] Nelson DH, Meakin JW, Dealy Jr JB, Matson DD, Emerson Jr
K, Thorn GW. ACTH-producing tumor of the pituitary gland. N
Engl J Med 1958;259:161–4.
[40] Nelson DH, Meakin JW, Thorn GW. ACTH-producing pituitary
tumors following adrenalectomy for Cushing’s syndrome. Ann
Intern Med 1960;52:560–9.
44 T. Teshima et al. / Domestic Animal Endocrinology 36 (2009) 32–44
[41] Kelly WF, MacFarlane IA, Longson D, Davies D, Sutcliffe
H. Cushing’s disease treated by total adrenalectomy: long-term
observations of 43 patients. Q J Med 1983;52:224–31.
[42] Barnett AH, Livesey JH, Friday K, Donald RA, Espiner EA.
Comparison of preoperative and postoperative ACTH concen-
trations after bilateral adrenalectomy in Cushing’s disease. Clin
Endocrinol 1983;18:301–5.
[43] Thomas JP, Hall R. Medical management of pituitary disease.
Clin Endocrinol Metab 1983;12:771–88.
[44] Kasperlik-Załuska AA, Nielubowicz J, Wisławski J, Hartwig W,
Załuska J, Jeske W, et al. Nelson’s syndrome: incidence and
prognosis. Clin Endocrinol 1983;19:693–8.
[45] Thomas Jr CG, Smith AT, Benson M, Griffith J. Nelson’s
syndrome after Cushing’s disease in childhood: a continuing prob-
lem. Surgery 1984;96:1067–77.
[46] Pereira MA, Halpern A, Salgado LR, Mendonça BB, Nery M,
Liberman B, et al. A study of patients with Nelson’s syndrome.
Clin Endocrinol 1998;49:533–9.
[47] Gil-Cárdenas A, Herrera MF, Díaz-Polanco A, Rios JM, Pantoja
JP. Nelson’s syndrome after bilateral adrenalectomy for Cushing’s
disease. Surgery 2007;141:147–52.
[48] Assié G, Bahurel H, Coste J, Silvera S, Kujas M, Dugué MA, et al.
Corticotroph tumor progression after adrenalectomy in Cushing’s
disease: a reappraisal of Nelson’s Syndrome. J Clin Endocrinol
Metab 2007;92:172–9.
[49] Assié G, Bahurel H, Bertherat J, Kujas M, Legmann P, Bertagna
X. The Nelson’s syndrome . . . revisited. Pituitary 2004;7:
209–15.
[50] Teramoto A. Diagnosis and treatment of Cushing’s disease. Jpn J
Neurosurg 2001;10:86–91.
[51] Asa SL, Ezzat S. The cytogenesis and pathogenesis of pituitary
adenomas. Endocr Rev 1998;19:798–827.
[52] Suda T, Tomori N, Tozawa F, Mouri T, Demura H,
Shizume K. Effects of bilateral adrenalectomy on immunore-
active corticotropin-releasing factor in the rat median emi-
nence and intermediate-posterior pituitary. Endocrinology
1983;113:1182–4.
[53] Scheithauer BW, Kovacs K, Randall RV. The pituitary gland
in untreated Addison’s disease. A histologic and immunocy-
tologic study of 18 adenohypophyses. Arch Pathol Lab Med
1983;107:484–7.
[54] Gertz BJ, Contreras LN, McComb DJ, Kovacs K, Tyrrell JB,
Dallman MF. Chronic administration of corticotropin-releasing
factor increases pituitary corticotroph number. Endocrinology
1987;120:381–8.
[55] Mountjoy KG, Bird IM, Rainey WE, Cone RD. ACTH induces
up-regulation of ACTH receptor mRNA in mouse and human
adrenocortical cell lines. Mol Cell Endocrinol 1994;99:R17–20.
[56] Penhoat A, Jaillard C, Saez JM. Corticotropin positively regulates
its own receptors and cAMP response in cultured bovine adrenal
cells. Proc Natl Acad Sci U S A 1989;86:4978–81.
[57] Lebrethon MC, Naville D, Begeot M, Saez JM. Regulation of
corticotropin receptor number and messenger RNA in cultured
human adrenocortical cells by corticotropin and angiotensin II. J
Clin Invest 1994;93:1828–33.
[58] Kijima H, Kubo M, Shimizu C, Ishizuka T, Takano K, Nagai S,
et al. Effects of hypophysectomy and in vivo administration of
ACTH or dexamethasone on the level of ACTH receptor mRNA
in adrenal glands and adipose tissues of mice. Endocr Regul
2004;38:87–95.
[59] Reusch CE, Sieber-Ruckstuhl N, Wenger M, Lutz H, Perren A,
Pospischil A. Histological evaluation of the adrenal glands of
seven dogs with hyperadrenocorticism treated with trilostane. Vet
Rec 2007;160:219–24.
[60] Mantis P, Lamb CR, Witt AL, Neiger R. Changes in ultra-
sonographic appearance of adrenal glands in dogs with
pituitary-dependent hyperadrenocorticism treated with trilostane.
Vet Radiol Ultrasound 2003;44:682–5.
[61] Lambert F, Corcelle-Cerf F, Lammerant J, Kolanowski J. On
the specificity of the inhibitory effect of trilostane and aminog-
lutethimide on adrenocortical steroidogenesis in guinea pig. Mol
Cell Endocrinol 1984;37:115–20.
[62] Chapman PS, Kelly DF, Archer J, Brockman DJ, Neiger R.
Adrenal necrosis in a dog receiving trilostane for the treatment of
hyperadrenocorticism. J Small Anim Pract 2004;45:307–10.
[63] Mack RE, Feldman EC. Comparison of two low-dose dexam-
ethasone suppression protocols as screening and discrimination
tests in dogs with hyperadrenocorticism. J Am Vet Med Assoc
1990;197:1603–6.
[64] Feldman EC. Evaluation of a six-hour combined dexamethasone
suppression/ACTH stimulation test in dogs with hyperadrenocor-
ticism. J Am Vet Med Assoc 1986;189:1562–6.
[65] Feldman EC, Nelson RW, Feldman MS. Use of low- and high-
dose dexamethasone tests for distinguishing pituitary-dependent
from adrenal tumor hyperadrenocorticism in dogs. J Am Vet Med
Assoc 1996;209:772–5.