Research Article

ClpXP-mediated Degradation of the TAC

Antitoxin is Neutralized by the SecB-like
Chaperone in Mycobacterium
tuberculosis

Pauline Texier 1, Patricia Bordes 1⇑, Jyotsna Nagpal 2, Ambre Julie Sala 1,
Moise Mansour 1, Anne-Marie Cirinesi 1, Xibing Xu 1, David Andrew Dougan 2⇑ and
Pierre Genevaux 1⇑

1 - Laboratoire de Microbiologie et de Génétique Moléculaires, Centre de Biologie Intégrative (CBI), Université de Toulouse,
CNRS, UPS, Toulouse, France
2 - Department of Biochemistry and Genetics, La Trobe Institute for Molecular Science, La Trobe University, Melbourne,
Victoria 3086, Australia

Correspondence to Patricia Bordes, David Andrew Dougan and Pierre Genevaux: patricia.bordes@univ-tlse3.fr
(P. Bordes), d.dougan@latrobe.edu.au (D.A. Dougan), pierre.genevaux@univ-tlse3.fr (P. Genevaux)
https://doi.org/10.1016/j.jmb.2021.166815
Edited by Urs Jenal

Abstract
Bacterial toxin-antitoxin (TA) systems are composed of a deleterious toxin and its antagonistic antitoxin.
They are widespread in bacterial genomes and mobile genetic elements, and their functions remain lar-
gely unknown. Some TA systems, known as TAC modules, include a cognate SecB-like chaperone that
assists the antitoxin in toxin inhibition. Here, we have investigated the involvement of proteases in the acti-
vation cycle of the TAC system of the human pathogen Mycobacterium tuberculosis. We show that the
deletion of endogenous AAA+ proteases significantly bypasses the need for a dedicated chaperone
and identify the mycobacterial ClpXP1P2 complex as the main protease involved in TAC antitoxin degra-
dation. In addition, we show that the ClpXP1P2 degron is located at the extreme C-terminal end of the
chaperone addiction (ChAD) region of the antitoxin, demonstrating that ChAD functions as a hub for both
chaperone binding and recognition by proteases.
Ó 2021 Elsevier Ltd. All rights reserved.

Introduction treatments and the immune response.9–15 TA sys-

Toxin-antitoxin (TA) systems are small genetic
modules encoding a toxic protein and its
antagonistic antitoxin, which inhibits activity or
expression of the toxin. They are ubiquitous in
bacterial genomes and have been classified in
different types according to the mode of inhibition
of the toxin by the antitoxin, which can be a
protein or an RNA.1–4 The role of chromosomal TA
systems remains largely unknown, partly due to
the lack of phenotype associated with their mutation
under laboratory conditions.5–8 Yet, in some cases,
it has been found that certain TA systems can help
bacteria to survive infection by phages, antibiotic
tems are also frequently found on mobile genetic
elements, where they generally contribute to gen-
ome stability.16 In addition, the highly toxic nature
of certain toxins has raised the possibility that new
antibacterial properties carried by toxins might be
used to identify new drug targets in pathogens or
directly as antimicrobials, alone or in combination
with antibiotherapy.17
The widespread type II TA systems are
composed of a labile antitoxin protein that directly
binds and inhibits its cognate toxin, and also acts
as a transcriptional repressor of its own promoter.2
Under normal conditions, the toxin is sequestered
in an inactive state, by the antitoxin and bacterial

0022-2836/Ó 2021 Elsevier Ltd. All rights reserved. Journal of Molecular Biology 433 (2021) 166815
P. Texier, P. Bordes, J. Nagpal, et al.
growth is not affected. It has been proposed that
under certain stress conditions, the less stable anti-
toxin is degraded by proteases, leading to either the
direct release of free toxin or an increase in de novo
toxin synthesis. The resulting active toxin would
then target essential cellular processes, including
translation, DNA replication or cell wall synthesis,
leading to growth inhibition and eventually cell
death.1,2 Yet, recent work performed in E. coli
showed that antitoxin degradation and transcrip-
tional activation of TA operons by different stresses
do not lead to any detectable toxin activation,7 indi-
cating that the specific signals that trigger toxin acti-
vation in vivo remain to be identified.
The role of AAA+ (ATPases associated with a
variety of cellular activities) proteases in the
turnover of type II antitoxins has been highlighted
in several studies. For example, Lon is involved in
the turnover of CcdA and PemI,18,19 ClpAP in the
degradation of Kis and MazE, and ClpXP in the
degradation of PhD and DinJ.20–23 Although certain
antitoxins possess intrinsically flexible domains or
carboxy-terminal regions sensitive to proteolysis
that are protected when bound to the toxin, the
degradation signals (degrons) within antitoxins that
determine selective proteolysis are currently
unknown.24–30 In addition, it remains to be deter-
mined whether stress-induced proteolytic adaptors
could participate in the regulated proteolysis of TA
systems, as it was observed with the Staphylococ-
cus aureus adaptor protein TrfA, which is required
for the ClpCP-mediated turnover of the antitoxin
MazE.31
The toxin-antitoxin-chaperone (TAC) system of
M. tuberculosis is an atypical TA system
composed of the three genes Rv1955-Rv1956-
Rv1957 organized into a single operon, which
encodes the toxin-antitoxin pair (Rv1955 and
Rv1956, respectively) followed by the chaperone
(Rv1957). Given Rv1957 is related to the
canonical SecB chaperone, involved in Sec-
dependent export of proteins in E. coli,32 we herein
refer to Rv1957 as SecBTA. Although transcription
of the TAC operon is significantly induced in host
phagocytes and by several stress conditions rele-
vant for M. tuberculosis, including DNA damage,
heat shock, nutrient starvation, hypoxia and drug
persistence, its role in M. tuberculosis stress-
adaptive response has yet to be established.33–37
The toxin-antitoxin pair of TAC was originally
named Mtb-HigB1-HigA1 due to its unusual
inverted gene organization, with toxin first and anti-
toxin second, as found in the HigB-HigA TA system
of Proteus vulgaris.38 While the HigA1 antitoxin pos-
sesses a conserved helix-turn-helix (HTH) DNA
binding domain, which binds to the TAC promoter
region, the HigB1 toxin likely belongs to the Gp49
subclass of the RelE toxin superfamily of
ribosome-dependent endoribonucleases.4
Although the influence of HigB1 toxin on M. tubercu-
losis growth under physiological condition is
2
Journal of Molecular Biology 433 (2021) 166815
unknown, its overexpression was shown to be
highly toxic,39,40 affecting the abundance of a small
subset of transcripts mainly related to iron and zinc
homeostasis.40
In contrast with classical two-component TA
systems, the TAC toxin-antitoxin pair is tightly
controlled by SecBTA, through a direct interaction
between the chaperone and the antitoxin HigA1.41
We previously showed that the TAC antitoxin pos-
sesses an unusual C-terminal extension, named
ChAD (chaperone-addiction region), which renders
the antitoxin aggregation-prone and thus unable to
efficiently inhibit the toxin in absence of chaper-
one.39,41,42 Indeed, the dedicated SecBTA chaper-
one was shown to specifically bind the ChAD
region of the antitoxin, with ChAD occupying a dis-
tinct zone within the substrate-binding site of the
chaperone,42 to facilitate its folding and subsequent
toxin inhibition. 39,43
Previous data showed that the TAC antitoxin
cannot be detected in whole cell extracts unless
the chaperone is present, strongly suggesting that
the aggregation-prone antitoxin might be sensitive
to proteolysis in vivo.41 Yet, nothing is known about
a possible involvement of proteases in the TAC acti-
vation cycle. In this work, we show that the absence
of protease can significantly bypass the need for the
dedicated SecBTA chaperone. In addition, we iden-
tify the mycobacterial ClpXP protease as the main
protease involved in HigA1 degradation and show
that the ClpXP degron is located at the extreme
C-terminal end of ChAD. Remarkably, this work
shows that the short ChAD region contains all the
determinants for both chaperone binding and
recognition by proteases, although different resi-
dues are involved. The relevance for such intricate
interplay between ClpXP and SecB in the TAC acti-
vation cycle is discussed.
Results
Control of TAC system(s) involves cellular
proteolysis
Initially we asked whether altered cellular
proteolysis could bypass the need for
activation/folding of the TAC antitoxin by the Mtb-
SecBTA chaperone in vivo. To do so, we
transformed chaperoneless Mtb-HigBA1 in a set
of single E. coli AAA+ protease mutants, including
Dlon, DclpP, DhslV (encoding ClpQ) and DftsH,
and tested their growth in the in vivo toxin
inhibition assay. Significantly, in the absence of
SecBTA only the DclpP strain was capable of
restoring partial bacterial growth in the presence
of Mtb-HigBA1 (Figure 1(A)). These data indicate
that ClpP is likely to be the main protease
involved, as previously observed for several two-
component TA systems.20–23,44,45 Consistently,
bacterial growth was also partially restored when
both clpX and clpA, the ATP-dependent unfoldase
P. Texier, P. Bordes, J. Nagpal, et al.
Figure 1. The M. tuberculosis TAC system Mtb-HigA1
antitoxin is degraded by AAA+ proteases in E. coli (A)
E. coli AAA + protease deletion allows the chaperone-
less Mtb-HigA1 to suppress Mtb-HigB1 toxicity. E. coli
W3110 wild type (WT), DclpA, DclpX, DclpAX, DclpP,
Dlon, DhslU, DhslV, DftsH and D3 (DclpXP, Dlon, DhslV)
strains were transformed with pK6-Mtb-HigBA1, and
both WT and D3 strains were co-transformed with pK6-
Mtb-HigBA1 and pSE-Mtb-SecBTA. Transformants or
double transformants were grown to mid-log phase,
serially diluted and spotted on LB agar plates containing
kanamycin (and ampicillin for double transformants) and
arabinose inducer as indicated. Plates were incubated at
37 °C overnight, except for the DftsH temperature-
sensitive mutant, which was incubated at 30 °C. (B) Mtb-
HigA1 is stabilized in a strain of E. coli deleted for the
main AAA+ proteases. Steady-state level of Mtb-HigA1
in E. coli W3110 WT and D3 strain co-transformed with
pK6-Mtb-HigBA1 and pSE380DNcoI or with pK6-Mtb-
HigBA1 and pSE-Mtb-SecBTA. Expression of Mtb-
higBA1 and Mtb-secBTA was induced at mid-log phase
with 0.2% Ara and 50 mM IPTG for 1 h. Mtb-HigA1 was
detected in whole-cell extracts using a rabbit anti-Mtb-
HigA1 antibody.
subunits that associate with ClpP, are deleted.
Notably, deletion of clpX or clpA alone was not suf-
ficient to restore toxin inhibition by the chaperone-
less Mtb-HigBA1 (Figure 1(A)), suggesting that
3
Journal of Molecular Biology 433 (2021) 166815
both subunits contribute to the turnover of the
Mtb-HigA1 antitoxin in E. coli. In addition, we found
that rescue of bacterial growth by DclpA DclpX or by
DclpP mutations was less robust than rescue by the
Mtb-SecBTA chaperone. This finding suggests that,
in the absence of ClpP, other E. coli proteases could
degrade the antitoxin. Therefore, we constructed an
E. coli mutant strain in which the genes encoding
three cytosolic AAA+ proteases (ClpP, Lon and
ClpQ) were deleted (D3 strain) and tested the effect
of Mtb-HigBA1 expression in vivo. In this case, dele-
tion of ftsH was not included with the other three
protease coding genes, since it is known that a sin-
gle ftsH mutation leads to a highly sensitive growth
phenotype and that the mutant readily accumulates
extragenic suppressors needed for survival.46
Importantly, the combined deletion of three cytoso-
lic AAA+ proteases was sufficient to significantly
improve the cells tolerance to expression of the
toxic chaperoneless Mtb-HigBA1 pair in vivo (Fig-
ure 1(A)), without affecting toxin levels (Supplemen-
tary Figure S1). Consistent with our previous
proposal41 these data suggest that Mtb-HigA1 is
highly sensitive to degradation in vivo. Moreover,
in the absence of its cognate chaperone, the lack
of protease likely promotes the accumulation of mis-
folded and aggregated, partially active antitoxin,
which might be sufficient to inhibit the effect of the
toxin. Such a hypothesis is in agreement with the
observation that robust overexpression of the anti-
toxin can also prevent growth without chaper-
one.34,41 Accordingly, we found that in the
absence of proteases, the cellular levels of antitoxin
increased (Figure 1(B)), albeit mainly in an insoluble
form in the absence of chaperone (Supplementary
Figure S1). Importantly, reduced proteolysis alone
does not appear to replace the need for a TAC
chaperone, at least in the context of E. coli. This is
illustrated by the fact that growth rescue is less effi-
cient in the triple protease mutation than in the pro-
tease containing strain expressing the dedicated
chaperone (Figure 1(A); compare D3 to and
WT + SecBTA).
We next asked whether the sensitivity of Mtb-
HigA1 to proteolysis in vivo, in the absence of
chaperone, is a conserved feature of TAC
antitoxins. To address this, four different TAC
systems from distant bacteria were analyzed: the
previously described (i) Mmet-TAC from
Methylomonas methanica strain MC09 with a TA
couple belonging to the HicAB family, (ii) Vcho-
TAC from Vibrio cholerae strain RC385 with a TA
couple belonging to the MqsRA family, (iii) Glov-
TAC from Geobacter lovleyi strain ATCC BAA-
1151 with a TA couple belonging to the HigBA
family,39,43 and (iv) the newly identified Saci-TAC
from Syntrophus aciditrophicus strain SB with a
TA couple belonging to the MqsRA family.32 Strik-
ingly, in all four cases the absence of cytosolic pro-
teases promotes growth of E. coli expressing each
chaperoneless TA pair (Figure 2), as is the case
P. Texier, P. Bordes, J. Nagpal, et al.
for Mtb-TAC (Figure 1(A)). Yet, we noticed that tox-
icity of the Vcho-mqsRA system of V. cholerae was
somehow less efficiently inhibited by the absence of
E. coli proteases, as judged by the appearance of
smaller and translucent colonies (Figure 2).
Although growth rescue was slightly better at higher
growth temperatures (Supplementary Figure S1),
the level of rescue for the Vcho-mqsRA system
was consistently less than that observed in the
other systems tested, suggesting that the Vcho-
mqsA antitoxin might not be very active in the
absence its chaperone when expressed in E. coli
and/or that other E. coli proteases might also
degrade it. Collectively, these data strongly suggest
that the TAC toxin-activation cycle is indeed regu-
lated by proteolysis.
M. tuberculosis ClpXP1P2 degrades Mtb-HigA1
antitoxin
In light of the above results, we next investigated
whether M. tuberculosis ClpP protease was indeed
involved in the turnover of Mtb-HigA1 antitoxin. In
contrast to E. coli, M. tuberculosis lacks both Lon
and ClpQ.47 The M. tuberculosis ClpP protease
(ClpP1P2) is composed of two different subunits,
encoded by the clpP1 and clpP2 genes, and func-
Figure 2. Other TAC systems also rely on proteases.
Strains W3110 WT and D3 were transformed with pK6
plasmids harboring the chaperoneless TAC system
HicAB of Methylomonas methanica, MqsRA of Vibrio
cholerae strain RC385, HigBA of Geobacter lovleyi or
MqsRA of Syntrophus aciditrophicus (pK6-Mmet-HicAB,
pK6-Vcho-MqsRA, pK6-Glov-MqsRA and pK6-Saci-
MqsRA respectively). Transformants were grown to
mid-log phase, serially diluted and spotted on LB agar
plates containing kanamycin and arabinose as
indicated.
4
Journal of Molecular Biology 433 (2021) 166815
tions together with two different AAA+ regulatory
subunits encoded by clpX and clpC1 genes.48–50
Note that M. tuberculosis also contains another
ClpC protein (ClpC2), which lacks a characteristic
AAA+ module (and hence IGL-loop for interaction
with ClpP), and currently there is no evidence that
ClpC2 can cooperate with the ClpP protease, thus
only bona fide AAA+ partners of ClpP1P2 (i.e. ClpX
and ClpC1) were considered here. Initially to deter-
mine which M. tuberculosis AAA+ protease
(ClpXP1P2 or ClpC1P1P2) was responsible for
Mtb-HigA1 antitoxin degradation, both mycobacte-
rial proteases were purified and in vitro degradation
assays of Mtb-HigA1 were performed. Here, the
AAA+ subunits of M. tuberculosis were used
together with the proteolytic complex ClpP1P2 of
the closely related Mycobacterium smegmatis,
which shows 88% identity and can fully cooperate
with the AAA+ subunits of M. tuberculosis.51 We
found that the ClpP1P2-dependent turnover of
Mtb-HigA1 was mediated exclusively by Mtb-ClpX,
and not by Mtb-ClpC1 (Figure 3(A)). As a control,
the purified ClpC1P1P2 protease was active
in vitro, as judged by its ability to degrade FITC-
casein (Supplementary Figure S2). Strikingly, addi-
tion of the TAC chaperone Mtb-SecBTA to the reac-
tion, completely inhibited antitoxin turnover
(Figure 3(A)). To further confirm the role of Mtb-
ClpXP1P2 in TAC antitoxin degradation, we took
advantage of our E. coli triple protease mutant
and used it as a tool to co-express the Mtb-
ClpXP1P2 protease together with Mtb-HigBA1 to
determine if expression of the protease could
restore growth inhibition by the toxin. Specifically,
Mtb-clpX and clpP1P2 were cloned, into a compat-
ible plasmid, under the control of IPTG-inducible
promoters and expressed in our in vivo growth res-
cue assay. As observed with E. coli proteases, Mtb-
HigBA1 expression only inhibited growth when all
components of Mtb-ClpXP1P2 protease were co-
expressed (Figure 3(B)). In addition, such a Mtb-
ClpXP1P2 dependent growth defect was efficiently
rescued by co-expression of the Mtb-SecBTA chap-
erone (Supplementary Figure S1). Together these
data show that Mtb-HigA1 antitoxin turnover is
specifically mediated by ClpXP1P2 and that this
process is inhibited by the dedicated SecB-like
chaperone.
Residues at the extreme carboxy-terminal end
of ChAD are critical for degradation by Mtb-
ClpXP1P2
Next, we sought to identify the degradation motif
(degron) recognized by the protease. Given that
substrate recognition by many proteases,
including the Clp-proteases, is generally mediated
by a degron located at either the N- or C-termini
(N-degron and C-degron, respectively)52 we exam-
ined the sequence of HigA for potential degrons.
From this analysis we identified a C-terminal dihy-
drophobic motif in Mtb-HigA1 (144RQVEVA149),
P. Texier, P. Bordes, J. Nagpal, et al. Journal of Molecular Biology 433 (2021) 166815

A
Mtb-HigA1
Time (min) 0 15 30 60
ClpXP1P2

ClpC1P1P2

ClpXP1P2
+ Mtb-SecBTA

B E. coli Δ3
Mtb-HigBA1 + + + +
ClpP1P2 - - + +
ClpX - + - +

no Ara

Ara 0.2%

-Mtb-HigB1

Figure 3. Mtb-HigA1 is degraded by the ClpXP1P2 protease of M. tuberculosis. (A) Mtb-HigA1 is degraded by M.
tuberculosis ClpXP1P2 in vitro. Degradation of purified Mtb-HigA1 by ClpXP1P2, with (green bars) and without (blue
bars) Mtb-SecBTA, or with ClpC1 of M. tuberculosis (red bars) was assayed in vitro. Time points were taken at 0, 15,
30 and 60 min of incubation at 37 °C, and Mtb-HigA1 was detected by immunoblot using rabbit anti-Mtb-HigA1
antibodies and quantified using GelEval 1.37. (B) Mtb-HigB1 toxicity is restored in E. coli D3 strain when Mtb-HigBA1
is co-expressed with Mtb-ClpXP1P2. E. coli D3 was co-transformed with pK6 plasmids either empty or harbouring
Mtb-HigBA1 (pK6-Mtb-HigBA1) and pSE380DNcoI plasmid harbouring either M. tuberculosis ClpP1P2, ClpX or
ClpXP1P2 (pSE-Mtb-ClpP1P2, pSE-Mtb-ClpX and pSE-Mtb-ClpXP1P2 respectively). Co-transformants were grown
to mid-log phase, serially diluted and spotted on LB agar plates containing kanamycin, ampicillin, arabinose (as
indicated) and IPTG (5 mM). Plates were incubated at 37 °C overnight. Lower panel shows whole-cell extracts of the
same co-transformants obtained after growth and induction at mid-log phase with 0.2% arabinose and 50 mM IPTG for
1 h, Mtb-HigB1 was detected using rabbit anti-Mtb-HigB1 antibody.

which shared similarity with the “classic” bacterial
ClpX C-degron (i.e. the SsrA-tag) (Figure 4(A)).
To determine the significance of this motif, we
replaced the last two residues of Mtb-HigA1 (resi-
dues 148 and 149) with aspartate (Figure 4(A))
and tested it in our in vivo assay. Strikingly, the
Mtb-HigA1V148D/A149D mutant rescued growth effi-
ciently in the absence of chaperone (Figure 4(B)),
suggesting that the last two amino acids of the anti-
toxin are indeed key residues for recognition by
Mtb-ClpX. To confirm the importance of this region
and the relative importance of each C-terminal resi-
due we generated a mutant of Mtb-HigA1 lacking
5
both residues (V148 and A149) and two additional
single point mutants of Mtb-HigA1, in which V148
or A149 were replaced with asparate (V148D and
A149D, respectively). Consistent with the double
mutant, both the deletion mutant and each single
mutant (V148D and A149D) rescued the growth
inhibition phenotype of the toxin in vivo when
expressed in E. coli (Figure 4(B)). Accordingly, the
Mtb-HigA1V148D/A149D mutant was also able to coun-
teract HigB1 toxicity in M. smegmatis in the
absence of the chaperone (Figure 4(C)). In this
case, the levels of the mutant antitoxin were stabi-
lized significantly in vivo, as judged by the accumu-
P. Texier, P. Bordes, J. Nagpal, et al. Journal of Molecular Biology 433 (2021) 166815

Figure 4. Mutation of the C-degron of Mtb-HigA1 prevent its turnover in vivo. (A) Schematic representation of Mtb-
HigA1 with the middle Helix-Turn-Helix (HTH) DNA binding domain and the C-terminal ChAD region. The last 7
residues (143–149) of Mtb-HigA1 and the underlined V148D/A149D mutations are shown. (B) Mtb-HigA1V148D/A149D
mutants counteract Mtb-HigB1 toxicity in E. coli independent of the presence of Mtb-SecBTA. E. coli W3110 strain was
co-transformed with either pK6-Mtb-HigBA1, pK6-Mtb-HigBA1V148D/A149D, its single mutant derivatives or the degron
deletion mutant pK6-Mtb-HigBA1DV148/A149, together with pSE380DNcoI or pSE-Mtb-SecBTA, grown to mid-log phase,
serially diluted and spotted on LB agar plates containing kanamycin and ampicillin supplemented with IPTG and/or
arabinose as indicated. Plates were incubated at 37 °C overnight. (C) Chaperoneless Mtb-HigA1V148D/A149D
counteracts Mtb-HigB1 toxicity in M. smegmatis. M. smegmatis was electroporated with pLAM-Mtb-HigBA1 and
pLAM-Mtb-HigBA1V148D/A149D. After 4 h of incubation at 37 °C, 1/100 of the transformations were directly plated on LB
agar supplemented with kanamycin (5 mg/ml) and 0.2% acetamide. Plates were incubated at 37 °C for 48 h. (D) Mtb-
HigBA1V148D/A149D is stabilized in vivo in M. smegmatis. Cultures of M. smegmatis transformed with pLAM-Mtb-
HigBA1 or pLAM-Mtb-HigBA1V148D/A149D were induced 6 h in the presence (+) or absence (-) of acetamide inducer
(0.2%) at 37 °C. Steady state level of Mtb-HigA1 was monitored by western blot using rabbit anti-HigA1 antibody.

lation of Mtb-HigA1V148D/A149D in M. smegmatis
cells lacking the chaperone (Figure 4(D)). We next
co-expressed either Mtb-HigBA1 or Mtb-
HigBA1V148D/A149D together with ClpXP1P2 in the
D3 protease mutant strain (Figure 5(A)). Consistent
with an important role for antitoxin turnover by
ClpXP1P2 in the restoration of growth inhibition by
the toxin (Figure 3(B)), expression of ClpXP1P2 in
the presence of Mtb-HigBA1V148D/A149D was unable
to decrease the steady state levels of antitoxin (Fig-
ure 5(B)) or restore growth inhibition by the toxin
(Figure 5(A)). Finally, the Mtb-HigA1V148D/A149D
mutant was purified and tested in our in vitro degra-
dation assay, in the presence of Mtb-ClpXP1P2.
Consistent with our in vivo findings (above), and in
contrast to wild type antitoxin (Figure 3(A)), the
Mtb-HigA1V148D/A148D mutant was resistant to Mtb-
ClpXP1P2 mediated degradation (Figure 5(C)).
6
To further investigate the role of the last two
residues of Mtb-HigA1 in the native host of Mtb-
TAC (M. tuberculosis), we generated two
chimeras of Photinus pyralis luciferase fused to
the C-terminus of HigA as a reporter system.
Specifically, the last 15 residues of Mtb-HigA1 or
Mtb-HigA1V148D/A149D, grafted to the C-terminal
end of luciferase, were cloned into an integrative
vector (pGMC) under the control of a tetracycline
inducible promoter, and expressed in the
pathogenic M. tuberculosis H37Rv strain.
Luciferase activity was monitored directly following
cell lysis of strains grown to mid-log phase and
induced with Atc for one week. In agreement with
the above work performed in E. coli and M.
smegmatis, the chimera containing the grafted C-
terminal residues of Mtb-HigA1V148D/A149D showed
a strong luminescent signal, comparable to that of
P. Texier, P. Bordes, J. Nagpal, et al. Journal of Molecular Biology 433 (2021) 166815

E. coli
Mtb
Mtb

Mtb
Mtb
Mtb
Mtb

E. coli

Mtb

Figure 5. Mtb-HigA1V148D/A149D is not degraded by ClpXP1P2. (A) Mtb-HigB1 toxicity is prevented in E. coli D3
strain when Mtb-HigBA1V148D/A149D is co-expressed with Mtb-ClpXP1P2. E. coli D3 strain was co-transformed with
pK6-Mtb-HigBA1 or pK6-Mtb-HigBA1V148D/A149D together with pSE380DNcoI or pSE-Mtb-ClpXP1P2. Double
transformants were grown to mid-log phase, serially diluted and spotted on LB agar plates containing kanamycin,
ampicillin, arabinose and IPTG as indicated. Plates were incubated at 37 °C overnight. (B) Mtb-HigBA1, Mtb-
HigBA1V148D/A149D and Mtb-HigB1 steady state level in the presence of Mtb-ClpXP1P2. Whole-cell extracts of E. coli
D3 strain double transformants were obtained after growth and induction at mid-log phase with 0.2% arabinose and
50 mM IPTG for 1 h. Mtb-HigB1, Mtb-HigA1 and Mtb-HigA1V148D/A149D were detected using rabbit anti-Mtb-HigB1 and
anti-Mtb-HigA1 antibodies respectively. (C) Mtb-HigA1V148D/A149D is not degraded by ClpXP1P2 in vitro. The in vitro
turnover of purified Mtb-HigA1 (blue bars) or Mtb-HigA1V148D/A149D (red bars) was monitored in the presence of
M. smegmatis ClpP1P2 and M. tuberculosis ClpX, as performed in Figure 3(A).

7
P. Texier, P. Bordes, J. Nagpal, et al.
luciferase alone, while the chimera with the grafted
C-terminal residues of wild type Mtb-HigA1
displayed very weak luminescence
(Supplementary Figure S3). Collectively these
data strongly suggest that, as observed both
in vitro and in vivo with E. coli and M. smegmatis,
the last 15 residues of Mtb-HigA1 are critical for
recognition by M. tuberculosis proteases in vivo.
Protease resistant mutations in Mtb-
HigA1 do not affect chaperone binding
As stated above, the TAC chaperone specifically
binds to the ChAD region of the TAC antitoxin and in
its absence, the ChAD region induces aggregation
of the antitoxin both in vivo and in vitro.39 Therefore,
we first asked whether mutations that affect ClpX
recognition also affect chaperone (SecBTA) binding.
To do so, we monitored complex formation of Mtb-
SecBTA chaperone with either Mtb-HigA1 or Mtb-
HigA1V148D/A149D by native gel separation in vitro,
as described.39 Under these conditions, we found
that chaperone binding to the protease resistant
mutant was unaffected (Figure 6(A)). Importantly,
and consistent with published findings,39 the nega-
tive control mutant (Mtb-HigA1W108A/W137A) failed
to interact with SecBTA (Figure 6(A)). We next used
an in vitro coupled transcription/translation assay to
determine if the protease resistant mutations in
Mtb-HigA1 altered the destabilizing effect of ChAD
on the antitoxin. Our data from Figure 6(B) clearly
show that newly synthesized Mtb-HigA1V148D/A149D
is largely insoluble in vitro, albeit slightly less than
wild type Mtb-HigA1. This indicates that replace-
ment of the dihydrophobic motif (Val-Ala) with the
dihydrophilic sequence (Asp-Asp) only weakly
impairs the overall destabilizing effect of Mtb-
ChAD in vitro (Figure 6(B)). Notably, as observed
for wild type Mtb-HigA1, the presence of chaperone
significantly enhances Mtb-HigA1V148D/A149D solu-
bility (Figure 6(B)), further supporting the view that
these mutations do not affect chaperone binding.
This is in sharp contrast with the Mtb-HigA1DC42
mutant, which lacks the entire ChAD region, and
remains soluble in the absence of chaperone.39 In
agreement with the weak but significant increased
solubility of Mtb-HigA1V148D/A149D compared to wild
type in vitro, we found that the steady state levels of
the soluble Mtb-HigA1V148D/A149D mutant accumu-
lates when overexpressed in wild type E. coli lack-
ing the Mtb-SecBTA chaperone (Figure 6(C)). This
suggests that the fraction of soluble HigA1V148D/
A149D
might be sufficient to rescue toxicity in vivo.
The fact that the protease resistant mutant fully
binds to the chaperone is supported by previous
findings that show chaperone binding mainly
occurs within the region encompassing residues
105 to 116 of Mtb-ChAD, with residues W108,
R110 and Y114 largely involved in this
interaction.42 Notably, the Y114A mutation in ChAD
was shown to inhibit chaperone binding without
8
Journal of Molecular Biology 433 (2021) 166815
affecting the destabilizing effect of ChAD on the
antitoxin, both in vivo and in vitro.39 We took advan-
tage of this mutation and showed in vivo in M. smeg-
matis within the context of the tripartite TAC operon,
that the single Y114A mutant is indeed unable to
rescue bacterial growth unless it is combined with
the V148D/A149D mutation (Supplementary
Figure S4), further suggesting that chaperone-
binding and recognition by proteases do not occur
within the same stretch of residues in ChAD.
Discussion
This work shows that proteolysis plays a key role
in the control of the TAC system of M. tuberculosis
and identifies the ClpXP1P2 protease as a main
player in this process. We demonstrated that the
degron (for recognition by ClpX) is located at the
extreme C-terminal end of the chaperone-binding
region of HigA and that both chaperone binding
and protease recognition involve unique residues
of ChAD. Notably, we found that in contrast to
chaperone binding, the last two hydrophobic
residues of the antitoxin are crucial for recognition
by ClpX and that substitution of these residues
with aspartate inhibited antitoxin turnover. In
support of this, the extreme C-terminal residues of
several ClpXP substrate proteins have been
shown to play a crucial role in ClpX
recognition,53,54 as is the case with the well-
characterized ClpX-degron, the SsrA-tag, where
substitution of the last two alanine residues with
aspartate inhibits recognition by ClpX.54 Notably,
both the position and composition of the Mtb-
HigA1 degron resembles that of several other M.
tuberculosis ClpP1P2 substrates identified so far,
namely RsdA, SsrA, ClgR, WhiB1, CarD, VapB20,
RelB1 and Hsp20.49,55–58 The fact that ClpXP1P2,
but not ClpC1P1P2, degrades Mtb-HigA1 in vitro
suggests that these substrates are likely to be rec-
ognized by the ClpX regulatory subunit. However,
we cannot exclude the possibility that ClpC1 may
still play a part in Mtb-HigA1 recognition in vivo in
M. tuberculosis. Analysis of the last 15 amino acid
residues of all the known and putative M. tuberculo-
sis antitoxins show high sequence variability, even
for antitoxins belonging to the same TA family
(Table S1). Only VapB19, VapB41, VapB44,
VapB45, Rv2017 and HigA2 possess at least two
hydrophobic residues at their extreme C-terminus.
These hydrophobic residues are mainly non-polar
aliphatic ones (A, V, L, I) as is usually observed in
C-terminal degrons. In addition, VapB41, VapB44,
and VapB45 also possess acidic residues before
the hydrophobic end, as found in Mtb-HigA1. This
suggests that these antitoxins might also be recog-
nized by M. tuberculosis ClpX. Remarkably, deple-
tion of endogenous ClpP1P2 in M. tuberculosis was
shown to stabilize several antitoxins that harbor dif-
ferent C-terminal ends, including MazE10, VapB22,
VapB9, VapB41 and HigA149 (Table S1). Whether
P. Texier, P. Bordes, J. Nagpal, et al. Journal of Molecular Biology 433 (2021) 166815

Mtb
Mtb

Mtb

Mtb

Mtb
Mtb

Mtb Mtb

Figure 6. Degron mutation does not affect Mtb-HigA1 interaction with Mtb-SecBTA . (A) Mtb-HigA1 V148D/A149D
interacts with Mtb-SecB in vitro. Native PAGE separation of Mtb-SecB (16 lM) incubated with either Mtb-HigA1 or
TA TA

Mtb-HigA1 V148D/A149D (2, 4 or 8 lM). As a negative control, the non-interacting mutant Mtb-HigA1 W108A/W137A (8 lM) is
also shown. (B) Solubilization of Mtb-HigA1 V148D/A149D requires Mtb-SecBTA. Mtb-HigA1 and Mtb-HigA1 V148D/A149D
were expressed in a cell-free expression system with and without Mtb-SecBTA (8 lM). Translation products were labelled
with [35S]-methionine. After 1 h of incubation at 37 °C, the total (t) and soluble (s) fractions were separated on SDS/
PAGE and quantified by phosphorimager. The mean solubility values (%) and the standard deviation are indicated. (C)
Mtb-HigA1V148D/A149D is partially soluble in vivo. E. coli wild type strain was co-transformed with pSE380DNcoI or pSE-
Mtb-SecBTA, and Mtb-HigBA1 or pK6-Mtb-HigBA1V148D/A149D. Double transformants were grown to midlog phase, and
the expression of Mtb-HigBA1 or Mtb-HigBA1 V148D/A149D and Mtb-SecBTA was induced for 1 h using 0.1% arabinose
and 50 mM IPTG. Soluble and insoluble fractions were separated by SDS/PAGE and analyzed by Western Blot using
anti-Mtb-HigA1 antibody. (D) Schematic representation of the ChAD region (ChAD) of the Mtb-HigA1 TAC antitoxin (A)
as a hot spot for interaction with the SecB-like chaperone (C; folding pathway) and the ClpXP1P2 protease (X/P1/P2;
degradation pathway), leading to toxin (T) inhibition or activation, respectively.

these antitoxins are ClpX- or ClpC1-dependent search for Mtb-ClpC1 interactors in vivo using a
remains to be determined. Interestingly, a recent bacterial two hybrid system has identified TA sys-
9
P. Texier, P. Bordes, J. Nagpal, et al.
tems a major substrate class of this protease,
including 8 antitoxins and 16 toxins.56 These data
indicate that indeed, activation of certain TA in M.
tuberculosis could rely on ClpC1. Yet, the fact that
toxins, as well as antitoxins, were identified as inter-
actors suggests that protease-mediated toxin
degradation could contribute to the inhibition of
toxin activity. Likewise, it is currently unknown if
adaptor proteins such as ClpS play a role in the
recognition of these toxins and/or antitoxins.56,59,60
To date, AAA+ proteases are the only proteases
that have been involved in antitoxin degradation.61
Yet, M. tuberculosis also encodes a eukaryotic-
like proteasome that could also participate to such
degradation.62,63 This proteasome was originally
described to drive the ATP-dependent degradation
of pupylated substrates. To date, no antitoxin has
been reported to be pupylated.64 However, the M.
tuberculosis pupylome was analyzed under stan-
dard laboratory growth conditions and since it has
been shown that changes in growth conditions mod-
ify the abundance of pupylated proteins we cannot
exclude that antitoxins could be pupylated under
certain stresses.65 Interestingly, the 20S core pro-
teasome can also be activated by PafE (also called
Bpa) a dodecameric activator.66,67 Since PafE is an
ATP-independent activator of proteasomal degra-
dation, it is largely believed to mediate the turnover
of partially or completely unfolded proteins and as
such it has been proposed that it may replace the
Lon protease in this bacterium.67 Interestingly, the
fact that many antitoxins have been reported to be
unstructured suggest that they could be putative
targets of this degradation pathway.
In contrast with the antitoxins, four toxins, namely
PemK, PhoH2, VapC17 and VapC31, were shown
to be pupylated.64,68 The relevance of such toxin
degradation is currently unknown, but it suggests
that some toxins could be differently regulated by
proteasomal degradation and antitoxin inhibition
depending on stress conditions.69 Interestingly,
the toxins, MazF3 and MazF7 were recently found
to be Mtb-ClpC1-interaction partners56 although
the significance of this observation on MazEF regu-
lation is currently unknown.
Our data show that the Mtb-SecBTA chaperone
efficiently protects the Mtb-HigA1 antitoxin from
degradation by ClpXP1P2 protease. Yet, it
remains to be determined whether ClpXP1P2
directly contribute to the Mtb-HigB1 toxin
activation in vivo in the context of the native TAC
operon. Interestingly, the E. coli SecB chaperone
was previously shown to protect its pre-secretory
protein clients from degradation by the AAA+
protease Lon, both in vivo and in vitro.70 Since SecB
binding motifs and Lon recognition signals share
significant similarities (enriched in hydrophobic
and aromatic residues), SecB binding to pre-
secretory substrates was proposed to mask Lon
recognition signals.70 Here, we show that the C-
terminal ChAD region combines both a middle
10
Journal of Molecular Biology 433 (2021) 166815
region required for interaction with the chaperone39
and an extreme C-terminal region important for
AAA+ proteases recognition (Figure 6(D)). The
proximity of these motifs suggests that chaperone
binding could inhibit ClpXP1P2 binding, somehow
masking the C-terminal degron from recognition
by ClpX. In this case, exposure of the chaperone-
bound ChAD C-terminal end to stress could tran-
siently expose its degron to ClpXP, leading to anti-
toxin degradation and subsequent growth
inhibition. This proposal is reminiscent of the recog-
nition of the C-terminal degron of DinJ by Lon, which
was shown to trigger dissociation of the DinJ/YafQ
complex in vitro.71 Alternatively, in the absence of
chaperone, destabilization of Mtb-HigA1 by the
unprotected ChAD region39 could also trigger
recognition by ClpXP1P2. In addition, we cannot
exclude that ClpXP1P2 might also need to bind
other unfolded parts of the Mtb-HigA1 antitoxin out-
side the ChAD region in order to efficiently degrade
it. Such regions would thus be folded and protected
in the presence of the chaperone, thus indirectly
interfering with ClpXP recognition.
The mechanism proposed in this work would
represent a sensitive switch for the post-
translational activation of TAC toxins. The fact that
all the SecBTA chaperones tested so far can
replace the E. coli export chaperone SecB in vivo
suggests that the accumulation of aggregated pre-
proteins (or the synthesis of specific exported
proteins) under certain stress conditions could
hijack the chaperone and subsequently induce
antitoxin degradation by ClpXP1P2, which in turn,
could lead to a transient activation of the Mtb-
HigB1 toxin until normal growth conditions resume.
Materials and methods
Bacterial strains and culture conditions
E. coli strains W3110, BL21(kDE3) (Novagen),
BL21 AI(kDE3) (Novagen), DhslV DclpPX-lon::
CmR,39 Mycobacterium smegmatis MC2155 (strain
ATCC 700084) and Mycobacterium tuberculosis
H37Rv (strain ATCC 25618) were previously
described. E. coli DclpA, DclpX, Dlon, DhslV and
DhslU strains were constructed as follows. The cor-
responding DclpA::KanR, DclpX::KanR, Dlon::
KanR, DhslV::KanR or DhslU::KanR allele from
strain JWK3903 (Keio collection) was first moved
in W3110 using P1-mediated transduction and the
kanamycin resistance cassette was then removed
using plasmid pCP20, as described.72 The E. coli
DclpAX strain was obtained by moving the DclpX::
KanR allele from strain JWK3903 (Keio collection)
in W3110 DclpA strain and by removing the kana-
mycin resistance cassette as described above. All
DNA cloning experiments were carried out in
DH5a (NEB). E. coli strains were routinely grown
in LB medium supplemented with kanamycin
(50 lg/ml), tetracycline (15 lg/ml) or ampicillin
(50 lg/ml) as required. Mycobacterium smegmatis
P. Texier, P. Bordes, J. Nagpal, et al.
strains were grown in 7H9 medium supplemented
with Tween 80 (0.05% (v/v)) and kanamycin (5 lg/
ml) and acetamide (0.2% (w/v)) as needed.
Mycobacterium tuberculosis H37Rv strain was
grown in 7H9 medium supplemented with 10%
OADC (oleic albumin dextrose catalase) supple-
ment and Tween 80 (0.05% (v/v)), and zeocin
(50 mg/ml) or anhydrotetracycline (Atc; 200 ng/ml)
if necessary.
Plasmids construct
Plasmids pMPMK6,73 pSE-Mtb-SecBTA,
pET15b-His6HigA1, pET15b-His6Rv1957, pK6-Mtb-
HigBA1, pK6-Mtb-HigB1 and pK6-Mtb-HigA1,41
pSE380DNcoI,74 pK6-Mmet-HicAB, pK6-Vcho-
MqsRA, pK6-Glov-MqsRA, pET15b-His6
HigA1W108A/W137A and pET-15b- His6HigA1Y114A,39
pET15b (Novagen), pET10C,75 pHUE76 and
pLAM1277 were previously described. The
pET30a-Mtb-6HisClpC1 was kindly provided by Dr.
Dileep Vasudevan (Institute of Life Sciences, Bhu-
baneswar 751023, India) and was constructed as
described.78
Plasmids pK6-Mtb-HigA1 and pET15b-His6HigA1
were used as templates to construct pK6-Mtb-
HigBA1V148D/A149D, pK6-Mtb-HigBA1D(V148/A149),
V148D
pK6-Mtb-HigBA1 , pK6-Mtb-HigBA1A149D and
V148D/A149D
pET15b-His6HigA1 respectively, using
Quickchange mutagenesis (Stratagene) with
higA1 codon change gtg to gac for V148D, gtg of
V148 to taa stop for D(V148/A149), and gca to
gac for A149D. Plasmid pK6-Mtb-HigB1K95A and
pET-20b-Mtb-HigB1optK95A were obtained by
Quickchange mutagenesis of pK6-Mtb-HigB1 and
pET-20b-Mtb-HigB1opt respectively, with higB1
codon change aag to gcg for K95A. Plasmid pET-
20b-Mtb-HigB1opt encoding higB1 sequence
optimized for E. coli codon usage between NdeI
and XhoI restriction site was synthesized by
Genscript.
Plasmid pK6-Saci-MqsRA was obtained by PCR
amplifying the genomic region comprising
the mqsR toxin SYN_00016 and the mqsA antitoxin
SYN_00015 using primers T_Saci_FOR_E: 50 -ttgaa
ttcatgatacaaaaaatcagtgaaaaacgc-30 and A_Saci_
REV_H/Bam: 50 -ttaagcttggatccctatgatccatatgtcgcc
tctttgg-30 , and S. aciditrophicus SB genomic DNA
(gift from Michael J. McInerney, University of
Oklahoma, USA) as a template. The PCR product
was digested with EcoRI–HindIII and was ligated
into pK6 digested with the same enzymes. To
construct pK6-Mtb-SecBTA, Mtb-SecBTA was
amplified from the pSE-Mtb-SecBTA using 1957_F_
(ERI/NdeI):50 -gagaattcatatgactgaccgaaccgacgccgac
-30 and 1957_R_(HIII/BHI): 50 -gaaagcttggatcct
cagggcgttcctctcgttgccggc-30 primers. The PCR
product was then digested by EcoRI and HindIII
and ligated into the pK6 vector digesting with the
same enzymes. To generate plasmid p29T-Mtb-
SecBTA, the EcoRI/HindIII-digested Rv1957
11
Journal of Molecular Biology 433 (2021) 166815
fragment was ligated into p29SEN (TetR) digested
with the same enzymes.
To construct pLAM-Mtb-HigBA1 and pLAM-Mtb-
HigA1 plasmids, higBA1 and higA1 were PCR
amplified using oligonucleotide primers HigB1_
For_Fusion: 50 -aagggagtccacatatgccgccccctgatc
cagccgccatg-30 and HigA1_Rev_Fusion: 50 -ataagc
ttcgaattctcatgccacctcaacctgccgaac-30 or HigA1_
For_Fusion: 50 -aagggagtccacatatgagcattgacttccctt
tgggtgac-30 and HigA1_Rev_Fusion: 50 -ataagcttc
gaattctcatgccacctcaacctgccgaac-30 , respectively,
and pK6-Mtb-HigBA1 or pK6-Mtb-HigA141 as tem-
plates. The PCR fragments were then cloned by
homologous recombination into the pLAM12 plas-
mid linearized by PCR with pLAM_For_Fusion: 50 -
gaattcgaagcttatcgatg-30 and pLAM_Rev_Fusion:
50 -catatgtggactccctttc-30 primers using the In-
Fusion PCR cloning system (Clontech). The
pLAM-Mtb-HigBA1 and pLAM-Mtb-HigA1 were
then used as templates to construct pLAM-Mtb-
HigBA1V148D/A149D and pLAM-HigA1V148D/A149D
respectively using Quickchange mutagenesis with
higA1 codon change gtg to gac for V148D and
gca to gac for A149D.
The pSE-Mtb-ClpXP1P2 plasmid, encoding M.
tuberculosis ClpX (Rv2457c) and ClpP1P2 operon
(Rv2461c-Rv2460c) under the control of two
different Ptrc, was constructed as follows.
Rv2457c and the Rv2461c-Rv2460c operon were
amplified by PCR using ClpX_For_Fusion: 50 -tctaga
ctcctcacaattgatggcgcgcataggagacggtggtga-30 ’ and
ClpX_Rev_Fusion: 50 -caaaacagccaagcttctacgcgct
cttgtcgcggcgctcc-30 or ClpP1P2_For_Fusion: 50 -a
caggagaattccagatgagccaagtgactgacatgcgttcga-30
and ClpP1P2_Rev_Fusion: 50 -caattgtgaggagtcta
gatcaggcggtttgcgcggagagcttccg-30 , respectively,
and M. tuberculosis genomic DNA as a template.
These two PCR fragments were then cloned
using the In-Fusion PCR cloning system into the
pSE380DNcoI linearized by PCR using pSE_
For_Fusion: 50 -aagcttggctgttttggcgg-30 and pSE_
Rev_Fusion: 50 -ctggaattctcctgtgtgaa-30 primers.
To add the second Ptrc upstream of Rv2457c, the
resulting plasmid was transformed into an E. coli
dam-/dcm- strain, purified, digested with XbaI-
MfeI and ligated to the DNA region of the
pSE380DNcoI plasmid encoding the Ptrc that was
amplified by PCR using the oligonuceleotide
primers Ptrc_For: 50 -gactctagacgcaacgcaattaatgtg
a-30 and Ptrc_Rev: 50 -gtccaattgttctcctgtgtgaaattgt-
30 and digested with the same restriction
enzymes. To construct the pSE-Mtb-ClpP1P2, the
pSE-Mtb-ClpXP1P2 was digested with XbaI-
HindIII in order to remove the Ptrc-ClpP1P2
encoding region. Extremities were blunted using
DNA polymerase I, Large (Klenow) fragment
(NEB) and ligated. To construct the pSE-Mtb-
ClpX, Rv2457c was amplified by PCR using the
oligonucleotide primers ClpX_For_NcoI: 50 -gacc
catggcgcgcataggagacgg-30 and ClpX_Rev_
HindIII: 50 -gtcaagcttctacgcgctcttgtcgcggc-30 and
P. Texier, P. Bordes, J. Nagpal, et al.
M. tuberculosis genomic DNA as a template. The
PCR product was then digested with NcoI-HindIII
and ligated into the pSE380 plasmid digested with
the same enzymes.
To construct the pGMC-Luc plasmid, the luciferase
gene from P. pyralis was PCR amplified using
Luc_For_Fusion: 50 -gaagacaggctgcccatggaagacgc
caaaaacataaag-30 and Luc_Rev_Fusion: 50 -tgtataa
taaagttgtcatctagacacggcgatctt-30 primers, and pK6-
Luc39 as a template. The PCR product was then
cloned into the pGMC plasmid linearized using
pGMC_For_Fusion: 50 -caactttattatacatagttgataattc-
30 and pGMC_Rev_Fusion: 50 -gggcagcctgtcttcctc-30
primers with the In-Fusion PCR cloning system.
The pGMC-Luc-CtHigA1 plasmid, encoding the luci-
ferase in fusion with the last 15 residues of Mtb-
HigA1, was constructed as follows. The pK6-Luc-
Mtb-ChAD39 was first amplified by PCR using
oligonucleotide primers Luc_CtHigA1_For: 50 -acgaa
ctgggcccgccacatttc-30 and Luc_CtHigA1_Rev: 50 -tct
agacacggcgatctttccg-30 in order to remove the coding
region of the first 27 ChAD residues, extremities were
phosphorylated with T4 polynucleotide kinase (NEB)
and ligated. The resulting pK6-Luc-CtHigA1 was
then used as a template to subclone Luc-Mtb-
CtHigA1 into the pGMC vector with the In-Fusion
PCR cloning system using the Luc_For_Fusion and
CtHigA1_Rev_Fusion: 50 -tgtataataaagttgtcatgccacct
caacctgccg-30 . Plasmid pGMC-Luc-CtHigA1V148D/
A149D
was constructed using the same protocol but
using the pK6-Luc-Mtb-ChADV148D/A149D as a tem-
plate. Note that the pK6-Luc-Mtb-ChADV148D/A149D
was obtained by Quickchange mutagenesis with
higA1 codon change gtg to gac for V148D and gca
to gac for A149D using pK6-Luc-Mtb-ChAD as a
template. To construct the pGMC-TAC plasmid, the
TAC operon from M. tuberculosis was amplified by
PCR using HigB1_For_Fusion 50 -gaagacaggc
tgcccatgccgccccctgatccagccgccatg-30 and Rv1957_
Rev_Fusion: 50 - tgtataataaagttgtcagggcgttcctctcgttg
ccgg-30 primers, and genomic DNA as template.
The PCR product was then cloned into the pGMC
plasmid linearized using pGMC_For_Fusion and
pGMC_Rev_Fusion primers with the In-Fusion
PCR cloning system. To construct the pET-15b-
Mtb-His6ClpX plasmid, Rv2457c gene was amplified
from M. tuberculosis genomic DNA using
pET_ClpX_For: 50 -gaccaattgcatatgatggcgcgcatagga
gac-30 and pET_ClpX_Rev: 50 - gacaagcttag
atctctacgcgctcttgtcgcg-30 . The resulting PCR product
was then digested with NdeI and BglII restriction
enzymes and subsequently ligated into the pET-
15b vector digested with NdeI and BamHI restriction
enzymes. The clpP1 and clpP2 genes were cloned
into pET10C and pHUE, respectively as described.51
Native gel separation of purified protein
complexes
Mtb-SecBTA was purified following
overexpression from pET15b in E. coli BL21
(kDE3) as described.41 Purified Mtb-HigA1 WT,
V148D/A149D and W108A/W137A (in 20 mM Tris,
12
Journal of Molecular Biology 433 (2021) 166815
pH 7.5, 150 mM NaCl, 1 mM DTT, 20% (v/v) glyc-
erol, 8 M urea) were obtained following over-
expression from pET15b-His6HigA1, pET15b-His6
HigA1V148D/A149D and pET15b-His6
HigA1W108A/W137A in E. coli BL21(kDE3) from the
aggregated fractions.41 Complexes were formed
by mixing 2, 4 or 8 mM of unfolded Mtb-HigA1,
Mtb-HigA1V148D/A149D or Mtb-HigA1W108A/W137A
and 16 mM of Mtb-SecBTA at 37 °C for 15 min in
10 ml reaction buffer (30 mM Hepes pH 7.5,
40 mM KCl, 7 mM MgAc and 50 mM NaCl). Reac-
tion mixtures were separated using native PAGE
on 4–20% Mini-PROTEAN TGX precast gels (Bio-
Rad) using Tris/Glycine buffer, and run at 125 V
for 2 h at room temperature. Gels were stained with
InstantBlue (Expedeon).
Cell-free protein synthesis and centrifugation-
based aggregation assay
Cell-free transcription/translation-coupled in vitro
assay using the PURE system (NEB) was carried
out as described.39 Briefly, DNA of Mtb-HigA1 and
Mtb-HigA1V148D/A149D were amplified by PCR using
primers containing T7 promoter and terminator and
added at a final concentration of 7.2 ng/ll to the
PURE system. When indicated, purified Mtb-
SecBTA was added to a final concentration of
8 mM. Protein synthesis was performed at 37 °C
for 60 min in the presence of 0.4 lCi/ll of 35S-
methionine. After removing an aliquot (total frac-
tion), the rest of the reaction was centrifuged at
21,600g for 30 min and the supernatant fraction
was collected. Both the total and supernatant frac-
tions were separated by SDS/PAGE on 4–20%
Mini-Protean TGX gels (Bio-Rad). Proteins were
visualized using a Typhoon phosphorimager (GE
Healthcare) and analyzed with Multigauge software
(Fuji). Results are presented as the mean and stan-
dard deviation (s.d.) of triplicate experiments.
Protein purification
Mtb-ClpX and Mtb-ClpC1 were overexpressed
from a BL21 (kDE3) strain containing plasmid
pET-15b-Mtb-His6ClpX and pET-30a-Mtb-His6ClpC1
respectively. Cells were grown to an OD600 of 0.8
in LB medium containing ampicillin at 37 °C, and
Mtb-ClpX and Mtb-ClpC1 expression was induced
with 0.5 mM IPTG overnight at 16 °C for Mtb-ClpX
and 4 h at 37 °C for Mtb-ClpC1. Cells were
harvested by centrifugation, resuspended in lysis
buffer [50 mM Tris-HCl pH 8.0, 200 mM KCl, 10%
(v/v) glycerol, 1 mM EDTA, 0.05% (v/v) Triton
X-100, 1 mM DTT, protease inhibitors (Roche)]
and lysed by successive steps, snap frozen in
liquid nitrogen and sonicated after addition of
1 mg/ml lysozyme and 1 ml/ml benzonase. The
lysate was clarified by centrifugation at 30 000g
for 40 min at 4 °C. A Ni-NTA agarose column
(Qiagen) pre-equilibrated with buffer A [20 mM
Tris-HCl pH 8.0, 300 mM NaCl, 10 mM imidazole,
P. Texier, P. Bordes, J. Nagpal, et al.
1 mM DTT] was loaded with the supernatant and
washed with 5 bead volumes (BV) of buffer A and
5 BV of buffer B [20 mM Tris-HCl pH 8.0, 300 mM
NaCl, 20 mM imidazole, 1 mM DTT]. Elution
fractions were collected with buffer C [20 mM Tris-
HCl pH 8.0, 300 mM NaCl, 250 mM imidazole,
1 mM DTT, 20% (v/v) glycerol]. Fractions
containing the Mtb-ClpX and Mtb-ClpC1 proteins
were pooled and snap-frozen in liquid nitrogen.
Msm-ClpP1 was overexpressed from a BL21
(kDE3) strain containing plasmid pET10C-Msm-
ClpP1 and purified as described above for Mtb-
ClpX except that an additional washing step was
performed with 5 BV of buffer D [20 mM Tris-HCl
pH 8.0, 300 mM NaCl, 65 mM imidazole, 1 mM
DTT] before the bound proteins were eluted with
buffer E [20 mM Tris-HCl pH 8.0, 300 mM NaCl,
500 mM imidazole, 1 mM DTT, 20% (v/v)
glycerol]. Msm-ClpP2 was purified in its processed
form (lacking the first 17 residues) and was
overexpressed from a BL21 CodonPlus (kDE3)
strain containing plasmid pHUE-Msm-pClpP2
allowing expression of a His6-Ub-fusion protein.
Msm-ClpP2 was first purified using Ni-NTA
agarose (Qiagen) as described above for Mtb-
ClpX. Then, the His6-Ub was cleaved using His6-
Usp2cc as described76 and the untagged protein
was isolated by reverse affinity chromatography.51
Western blot analysis
For E. coli fractionation, overnight cultures of
fresh transformants were diluted and grown to
mid-log phase at 37 °C. After induction, OD600
was measured and 1 ml aliquot of the culture was
harvested at 5 000 g. Whole-cell extract was
prepared by pellet resuspension in ¼ volume of
the initial OD600 of 1  SDS loading buffer. To
separate the insoluble and soluble fractions, 10 ml
of cells were collected by centrifugation at 5000g
for 10 min at 4 °C and resuspended in 300 ll of
fresh lysis buffer [10 mM Tris (pH 8), 100 mM KCl,
300 mM NaCl, 5 mM b-mercaptoethanol, 0.5% (v/
v) Triton X-100, and 0.6 mg/ml lysozyme].
Samples were incubated on ice for 20 min and the
cells were lysed by three freeze–thaw cycles
using liquid nitrogen followed by sonication. The
insoluble and soluble fractions were then
separated by centrifugation for 30 min at 4 °C (16
000g). The pellet was resuspended in 150 ll of
1  SDS loading buffer, and 5  SDS loading
buffer was added to the supernatant.
M. smegmatis whole-cell extracts were prepared
as follows. 48 h cultures of fresh transformants
were diluted and grown to mid-log phase. After
6 h of induction with 0.2% acetamide, OD600
were measured and aliquots of the cultures were
harvested at 4 000 g for 10 min. Pellets were
resuspended in 1x PBS to an OD600 per ml of 5,
and cells mechanically lysed using a bead beater
(Bertin technologies precellys 24). Lysates were
centrifuged at 1000g for 3 min to pellet unbroken
13
Journal of Molecular Biology 433 (2021) 166815
cells and the supernatant was kept as the whole-
cell extract fraction. Proteins were separated on
Mini-Protean TGX gels (Bio-Rad) by SDS/PAGE
and transferred to polyvinylidene difluoride
membranes (Bio-Rad) using the Trans-BlotÒ
TurboTM transfer system (Bio-Rad). Membranes
were blocked 1 h at room temperature or
overnight at 4 °C in 5% (w/v) nonfat dry milk in
PBS containing 0.05% (v/v) Tween 20. Primary
antibodies used in this study were anti-Mtb-HigA1
(1:1000), anti-Mtb-HigB1 (1:1000) and anti-Mtb-
SecBTA (1:1000).39,41 Horseradish peroxidase-
conjugated rabbit IgG was used as a secondary
antibody. Blots were developed by chemilumines-
cence using Clarity western ECL substrate (Bio-
Rad) with the ChemidocTM Touch imaging system
(Bio-Rad) and analysed with Image Lab software
(Bio-Rad).
In vitro degradation assay
Protein degradation assays using Mtb-HigA1 or
Mtb-HigA1V148D/A149D as a substrate were
performed as follows. 0.1–0.5 mM of substrate
(estimated by dilution of the denaturated stock)
was mixed in buffer A (50 mM K3PO4, 100 mM
KCl, 5% (v/v) glycerol, 50 mM MgCl2, 2 mM ATP,
0.5 mM Z-Leu-Leu) with 2.4 mM Mtb-ClpX or Mtb-
ClpC1, and 2.8 mM of Msm-ClpP1 and Msm-
ClpP2, and incubated at 37 °C. 5 mM of Mtb-
SecBTA was added when indicated. The reaction
was stopped, at the indicated time points, by the
addition of Laemmli buffer and the samples were
heated at 95 °C for 5 min. Proteins were
separated by SDS/PAGE and analyzed by
western-blot using anti-Mtb-HigA1 antibodies.
Proteins were quantified using FrogDance
software GelEval 1.37 or GelAnalzyer software
2010a and the results are presented as the mean
and SEM of triplicate experiments.
Luminescence assay
Luminescence assay were carried out on freshly
prepared whole-cell extracts of M. tuberculosis
H37Rv strain containing the integrative plasmid
pGMC-Luc, pGMC-LucCtHigA1 or pGMC-
LucCtHigA1 V148D/A149D. To this purpose, mid-log
phase cultures were induced with 200 ng/ml
anhydrotetracycline for 1 week and 5 ml aliquots
were harvested at 4000 g. Cells were
resuspended in 400 ml of PBS, mixed with glass
beads and mechanically lysed using a bead
beater (Bertin technologies precellys 24). After
double filtration (0.22 mm), 20 ml of the resulting
whole-cell extracts were mixed with 16.6 ml of
Luciferase Assay Substrate (Promega) diluted in
33.3 ml of 1x PBS, and luminescence was directly
monitored at an exposure time of 100 milliseconds
using the VarioskanFlash.
P. Texier, P. Bordes, J. Nagpal, et al. Journal of Molecular Biology 433 (2021) 166815

CRediT authorship contribution References

statement
1. Goeders, N., Van Melderen, L., (2014). Toxin-antitoxin
Pauline Texier: Conceptualization, Investigation, systems as multilevel interaction systems. Toxins, 6, 304–
Funding acquisition. Patricia Bordes: 324. https://doi.org/10.3390/toxins6010304.
Conceptualization, Investigation, Supervision. 2. Harms, A., Brodersen, D.E., Mitarai, N., Gerdes, K., (2018).
Jyotsna Nagpal: Conceptualization, Investigation. Toxins, targets, and triggers: an overview of toxin-antitoxin
biology. Mol. Cell., 70, 768–784. https://doi.org/10.1016/
Ambre Julie Sala: Conceptualization,
j.molcel.2018.01.003.
Investigation. Moise Mansour: Conceptualization,
3. Page, R., Peti, W., (2016). Toxin-antitoxin systems in
Investigation. Anne-Marie Cirinesi:
bacterial growth arrest and persistence. Nat. Chem. Biol.,
Conceptualization, Investigation. Xibing Xu: 12, 208–214. https://doi.org/10.1038/nchembio.2044.
Conceptualization, Investigation. David Andrew 4. Sala, A., Bordes, P., Genevaux, P., (2014). Multiple toxin-
Dougan: Conceptualization, Supervision, Funding antitoxin systems in Mycobacterium tuberculosis. Toxins,
acquisition. Pierre Genevaux: Conceptualization, 6, 1002–1020. https://doi.org/10.3390/toxins6031002.
Supervision, Funding acquisition. 5. Goormaghtigh, F., Fraikin, N., Putrinš, M., Hallaert, T.,
Hauryliuk, V., Garcia-Pino, A., Sjödin, A., Kasvandik, S.,
et al., (2018). Reassessing the role of Type II toxin-antitoxin
systems in formation of Escherichia coli Type II persister
Acknowledgements cells. MBio., 9 https://doi.org/10.1128/mBio.00640-18.
6. Pontes, M.H., Groisman, E.A., (2019). Slow growth
We thank Marie-Pierre Castanié-Cornet for determines nonheritable antibiotic resistance in
plasmid gift. This work was supported by the Salmonella enterica. Sci. Signal., 12 https://doi.org/
Agence Nationale de la Recherche (ANR-13- 10.1126/scisignal.aax3938.
BSV8-0010-01 and ANR-19-CE12-0026) to P.G., 7. LeRoux, M., Culviner, P.H., Liu, Y.J., Littlehale, M.L., Laub,
the Fondation pour la Recherche Médicale to P.T. M.T., (2020). Stress can induce transcription of toxin-
antitoxin systems without activating toxin. Mol. Cell., 79,
(FRM-FDT20160435132) and to M.M. (FRM
280–292.e8. https://doi.org/10.1016/j.molcel.2020.05.028.
FDT201805005796) and an EMBO short term
8. Harms, A., Fino, C., Sørensen, M.A., Semsey, S., Gerdes,
fellowship to P.T.
K., (2017). Prophages and growth dynamics confound
experimental results with antibiotic-tolerant persister cells.
Author contributions MBio, 8 https://doi.org/10.1128/mBio.01964-17.
9. Agarwal, S., Sharma, A., Bouzeyen, R., Deep, A., Sharma,
Conceptualization, all authors. Investigation, P. H., Mangalaparthi, K.K., Datta, K.K., Kidwai, S., et al.,
T., P.B., J.N., A.J.S., M.M., A-M.C., X.X. Writing, (2020). VapBC22 toxin-antitoxin system from
P.T, P.B, D.A.D, P.G. Funding acquisition, P.T., Mycobacterium tuberculosis is required for pathogenesis
D.A.D, P.G Supervision, P.B., D.A.D., P.G. and modulation of host immune response. Sci. Adv., 6,
eaba6944. https://doi.org/10.1126/sciadv.aba6944.
Declaration of Competing Interest 10. Correia, F.F., D’Onofrio, A., Rejtar, T., Li, L., Karger, B.L.,
Makarova, K., Koonin, E.V., Lewis, K., (2006). Kinase
The authors declare that they have no known activity of overexpressed HipA is required for growth arrest
competing financial interests or personal and multidrug tolerance in Escherichia coli. J. Bacteriol.,
relationships that could have appeared to 188, 8360–8367. https://doi.org/10.1128/JB.01237-06.
11. Helaine, S., Cheverton, A.M., Watson, K.G., Faure, L.M.,
influence the work reported in this paper.
Matthews, S.A., Holden, D.W., (2014). Internalization of
Salmonella by macrophages induces formation of
Appendix A. Supplementary material nonreplicating persisters. Science, 343, 204–208. https://
doi.org/10.1126/science.1244705.
Supplementary data to this article can be found 12. Kwan, B.W., Lord, D.M., Peti, W., Page, R., Benedik, M.J.,
online at https://doi.org/10.1016/j.jmb.2021. Wood, T.K., (2015). The MqsR/MqsA toxin/antitoxin
166815. system protects Escherichia coli during bile acid stress.
Environ. Microbiol., 17, 3168–3181. https://doi.org/
Received 5 November 2020; 10.1111/1462-2920.12749.
Accepted 5 January 2021; 13. Pecota, D.C., Wood, T.K., (1996). Exclusion of T4 phage
Available online 13 January 2021 by the hok/sok killer locus from plasmid R1. J. Bacteriol.,
178, 2044–2050. https://doi.org/10.1128/jb.178.7.2044-
Keywords: 2050.1996.
Toxin-antitoxin; 14. Ronneau, S., Helaine, S., (2019). Clarifying the link
HigB1-HigA1; between toxin-antitoxin modules and bacterial
SecB; persistence. J. Mol. Biol., 431, 3462–3471. https://doi.org/
ClpX; 10.1016/j.jmb.2019.03.019.
ClpC1 15. Talwar, S., Pandey, M., Sharma, C., Kutum, R., Lum, J.,
Carbajo, D., Goel, R., Poidinger, M., Dash, D., Singhal, A.,
Pandey, A.K., (2020). Role of VapBC12 toxin-antitoxin
14
P. Texier, P. Bordes, J. Nagpal, et al.
locus in cholesterol-induced mycobacterial persistence.
MSystems, 5 https://doi.org/10.1128/mSystems.00855-20.
16. Fraikin, N., Goormaghtigh, F., Van Melderen, L., (2020).
Type II toxin-antitoxin systems: evolution and revolutions.
J. Bacteriol.,. https://doi.org/10.1128/JB.00763-19.
17. Chan, W.T., Balsa, D., Espinosa, M., (2015). One cannot
rule them all: Are bacterial toxins-antitoxins druggable?.
FEMS Microbiol. Rev., 39, 522–540. https://doi.org/
10.1093/femsre/fuv002.
18. Tsuchimoto, S., Nishimura, Y., Ohtsubo, E., (1992). The
stable maintenance system pem of plasmid R100:
degradation of PemI protein may allow PemK protein to
inhibit cell growth. J. Bacteriol., 174, 4205–4211.
19. Van Melderen, L., Bernard, P., Couturier, M., (1994). Lon-
dependent proteolysis of CcdA is the key control for
activation of CcdB in plasmid-free segregant bacteria.
Mol. Microbiol., 11, 1151–1157.
20. Aizenman, E., Engelberg-Kulka, H., Glaser, G., (1996). An
Escherichia coli chromosomal “addiction module” regulated
by guanosine corrected 3’,5’-bispyrophosphate: a model
for programmed bacterial cell death. Proc. Natl. Acad. Sci.
U.S.A, 93, 6059–6063.
21. Diago-Navarro, E., Hernández-Arriaga, A.M., Kubik, S.,
Konieczny, I., Dı́az-Orejas, R., (2013). Cleavage of the
antitoxin of the parD toxin-antitoxin system is determined
by the ClpAP protease and is modulated by the relative
ratio of the toxin and the antitoxin. Plasmid, 70, 78–85.
https://doi.org/10.1016/j.plasmid.2013.01.010.
22. Lehnherr, H., Yarmolinsky, M.B., (1995). Addiction protein
Phd of plasmid prophage P1 is a substrate of the ClpXP
serine protease of Escherichia coli. Proc. Natl. Acad. Sci.
U.S.A, 92, 3274–3277.
23. Prysak, M.H., Mozdzierz, C.J., Cook, A.M., Zhu, L., Zhang,
Y., Inouye, M., Woychik, N.A., (2009). Bacterial toxin YafQ
is an endoribonuclease that associates with the ribosome
and blocks translation elongation through sequence-
specific and frame-dependent mRNA cleavage. Mol.
Microbiol., 71, 1071–1087. https://doi.org/10.1111/j.1365-
2958.2008.06572.x.
24. Garcia-Pino, A., Sterckx, Y., Vandenbussche, G., Loris, R.,
(2010). Purification and crystallization of Phd, the antitoxin
of the phd/doc operon. Acta Crystallograph Sect. F Struct.
Biol. Cryst. Commun., 66, 167–171. https://doi.org/
10.1107/S1744309109051550.
25. Hansen, S., Vulić, M., Min, J., Yen, T.-J., Schumacher, M.
A., Brennan, R.G., Lewis, K., (2012). Regulation of the
Escherichia coli HipBA toxin-antitoxin system by
proteolysis. PLoS ONE, 7 https://doi.org/10.1371/journal.
pone.0039185.
26. Kamada, K., Hanaoka, F., (2005). Conformational change
in the catalytic site of the ribonuclease YoeB toxin by YefM
antitoxin. Mol. Cell., 19, 497–509. https://doi.org/10.1016/
j.molcel.2005.07.004.
27. Kamada, K., Hanaoka, F., Burley, S.K., (2003). Crystal
structure of the MazE/MazF complex: molecular bases of
antidote-toxin recognition. Mol. Cell., 11, 875–884.
28. Loris, R., Marianovsky, I., Lah, J., Laeremans, T.,
Engelberg-Kulka, H., Glaser, G., Muyldermans, S., Wyns,
L., (2003). Crystal structure of the intrinsically flexible
addiction antidote MazE. J. Biol. Chem., 278, 28252–
28257. https://doi.org/10.1074/jbc.M302336200.
29. Madl, T., Van Melderen, L., Mine, N., Respondek, M.,
Oberer, M., Keller, W., Khatai, L., Zangger, K., (2006).
Structural basis for nucleic acid and toxin recognition of the
15
Journal of Molecular Biology 433 (2021) 166815
bacterial antitoxin CcdA. J. Mol. Biol., 364, 170–185.
https://doi.org/10.1016/j.jmb.2006.08.082.
30. Overgaard, M., Borch, J., Gerdes, K., (2009). RelB and
RelE of Escherichia coli form a tight complex that
represses transcription via the Ribbon–Helix–Helix Motif
in RelB. J. Mol. Biol., 394, 183. https://doi.org/10.1016/j.
jmb.2009.09.006.
31. Donegan, N.P., Marvin, J.S., Cheung, A.L., (2014). Role of
adaptor TrfA and ClpPC in controlling levels of SsrA-tagged
proteins and antitoxins in Staphylococcus aureus. J.
Bacteriol., 196, 4140–4151. https://doi.org/10.1128/
JB.02222-14.
32. Sala, A., Calderon, V., Bordes, P., Genevaux, P., (2013).
TAC from Mycobacterium tuberculosis: a paradigm for
stress-responsive toxin-antitoxin systems controlled by
SecB-like chaperones. Cell Stress Chaperones, 18, 129–
135. https://doi.org/10.1007/s12192-012-0396-5.
33. Stewart, G.R., Wermisch, L., Stabler, R., Mangan, J.A.,
Hinds, J., Laing, K.G., Butcher, P.D., Young, D.B., (2002).
The heat shock response of Mycobacterium tuberculosis:
linking gene expression, immunology and pathogenesis.
Comp. Funct. Genom., 3, 348–351.
[34]. Ramage, H.R., Connolly, L.E., Cox, J.S., (2009).
Comprehensive functional analysis of mycobacterium
tuberculosis toxin-antitoxin systems: implications for
pathogenesis, stress responses, and evolution. PLoS
Genet., 5, e1000767. https://doi.org/10.1371/journal.
pgen.1000767.
35. Betts, J.C., Lukey, P.T., Robb, L.C., Mcadam, R.A.,
Duncan, K., (2002). Evaluation of a nutrient starvation
model of Mycobacterium tuberculosis persistence by gene
and protein expression profiling. Mol. Microbiol., 43, 717–
731.
36. Keren, I., Shah, D., Spoering, A., Kaldalu, N., Lewis, K.,
(2004). Specialized persister cells and the mechanism of
multidrug tolerance in Escherichia coli. J. Bacteriol., 186,
8172–8180. https://doi.org/10.1128/JB.186.24.8172-
8180.2004.
37. Fivian-Hughes, A.S., Davis, E.O., (2010). Analyzing the
regulatory role of the HigA antitoxin within Mycobacterium
tuberculosis. J. Bacteriol., 192, 4348–4356.
38. Schureck, M.A., Dunkle, J.A., Maehigashi, T., Miles, S.J.,
Dunham, C.M., (2015). Defining the mRNA recognition
signature of a bacterial toxin protein. Proc. Natl. Acad. Sci.
U.S.A, 112, 13862–13867. https://doi.org/10.1073/
pnas.1512959112.
39. Bordes, P., Sala, A.J., Ayala, S., Texier, P., Slama, N.,
Cirinesi, A.-M., Guillet, V., Mourey, L., et al., (2016).
Chaperone addiction of toxin-antitoxin systems. Nat.
Commun., 7, 13339. https://doi.org/10.1038/
ncomms13339.
40. Schuessler, D.L., Cortes, T., Fivian-Hughes, A.S.,
Lougheed, K.E.A., Harvey, E., Buxton, R.S., Davis, E.O.,
Young, D.B., (2013). Induced ectopic expression of HigB
toxin in Mycobacterium tuberculosis results in growth
inhibition, reduced abundance of a subset of mRNAs and
cleavage of tmRNA. Mol. Microbiol., 90, 195–207. https://
doi.org/10.1111/mmi.12358.
41. Bordes, P., Cirinesi, A.M., Ummels, R., Sala, A., Sakr, S.,
Bitter, W., Genevaux, P., (2011). SecB-like chaperone
controls a toxin-antitoxin stress-responsive system in
Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. U.S.A,
108, 8438–8443. https://doi.org/10.1073/
pnas.1101189108.
P. Texier, P. Bordes, J. Nagpal, et al.
42. Guillet, V., Bordes, P., Bon, C., Marcoux, J., Gervais, V.,
Sala, A.J., Dos Reis, S., Slama, N., et al., (2019). Structural
insights into chaperone addiction of toxin-antitoxin
systems. Nat. Commun., 10, 782. https://doi.org/10.1038/
s41467-019-08747-4.
43. Sala, A.J., Bordes, P., Ayala, S., Slama, N., Tranier, S.,
Coddeville, M., Cirinesi, A.-M., Castanié-Cornet, M.-P.,
et al., (2017). Directed evolution of SecB chaperones
toward toxin-antitoxin systems. Proc. Natl. Acad. Sci. U.S.
A, 114, 12584–12589. https://doi.org/10.1073/
pnas.1710456114.
44. Koga, M., Otsuka, Y., Lemire, S., Yonesaki, T., (2011).
Escherichia coli rnlA and rnlB compose a novel toxin-
antitoxin system. Genetics, 187, 123–130. https://doi.org/
10.1534/genetics.110.121798.
45. Wang, X., Kim, Y., Hong, S.H., Ma, Q., Brown, B.L., Pu, M.,
Tarone, A.M., Benedik, M.J., et al., (2011). Antitoxin MqsA
helps mediate the bacterial general stress response. Nat.
Chem. Biol., 7, 359–366. https://doi.org/10.1038/
nchembio.560.
46. Ogura, T., Inoue, K., Tatsuta, T., Suzaki, T., Karata, K.,
Young, K., Su, L.H., Fierke, C.A., et al., (1999). Balanced
biosynthesis of major membrane components through
regulated degradation of the committed enzyme of lipid A
biosynthesis by the AAA protease FtsH (HflB) in
Escherichia coli. Mol. Microbiol., 31, 833–844.
47. Knipfer, N., Seth, A., Roudiak, S.G., Shrader, T.E., (1999).
Species variation in ATP-dependent protein degradation:
protease profiles differ between mycobacteria and
protease functions differ between Mycobacterium
smegmatis and Escherichia coli. Gene, 231, 95–104.
48. Leodolter, J., Warweg, J., Weber-Ban, E., (2015). The
Mycobacterium tuberculosis ClpP1P2 protease interacts
asymmetrically with its ATPase partners ClpX and ClpC1.
PLoS ONE, 10 https://doi.org/10.1371/journal.
pone.0125345.
49. Raju, R.M., Unnikrishnan, M., Rubin, D.H.F.,
Krishnamoorthy, V., Kandror, O., Akopian, T.N.,
Goldberg, A.L., Rubin, E.J., (2012). Mycobacterium
tuberculosis ClpP1 and ClpP2 function together in protein
degradation and are required for viability in vitro and during
infection. PLoS Pathog., 8, https://doi.org/10.1371/journal.
ppat.1002511 e1002511.
50. Schmitz, K.R., Carney, D.W., Sello, J.K., Sauer, R.T.,
(2014). Crystal structure of Mycobacterium tuberculosis
ClpP1P2 suggests a model for peptidase activation by AAA
+ partner binding and substrate delivery. Proc. Natl. Acad.
Sci. U.S.A, 111, E4587–E4595. https://doi.org/10.1073/
pnas.1417120111.
51. Nagpal, J., Paxman, J.J., Zammit, J.E., Alhuwaider, A.,
Truscott, K.N., Heras, B., Dougan, D.A., (2019). Molecular
and structural insights into an asymmetric proteolytic complex
(ClpP1P2) from Mycobacterium smegmatis. Sci. Rep., 9,
18019. https://doi.org/10.1038/s41598-019-53736-8.
52. Varshavsky, A., (2019). N-degron and C-degron pathways
of protein degradation. Proc. Natl. Acad. Sci. U.S.A, 116,
358–366. https://doi.org/10.1073/pnas.1816596116.
53. Flynn, J.M., Neher, S.B., Kim, Y.-I., Sauer, R.T., Baker, T.
A., (2003). Proteomic discovery of cellular substrates of the
ClpXP protease reveals five classes of ClpX-recognition
signals. Mol. Cell., 11, 671–683. https://doi.org/10.1016/
S1097-2765(03)00060-1.
54. Gottesman, S., Roche, E., Zhou, Y., Sauer, R.T., (1998).
The ClpXP and ClpAP proteases degrade proteins with
16
Journal of Molecular Biology 433 (2021) 166815
carboxy-terminal peptide tails added by the SsrA-tagging
system. Genes Dev., 12, 1338–1347.
55. Yamada, Y., Dick, T., (2017). Mycobacterial caseinolytic
protease gene regulator ClgR Is a substrate of caseinolytic
protease. MSphere, 2 https://doi.org/10.1128/
mSphere.00338-16.
56. Ziemski, M., Leodolter, J., Taylor, G., Kerschenmeyer, A.,
Weber-Ban, E., (2020). Genome-wide interaction screen
for Mycobacterium tuberculosis ClpCP protease reveals
toxin-antitoxin systems as a major substrate class. FEBS
J.,. https://doi.org/10.1111/febs.15335.
57. Barik, S., Sureka, K., Mukherjee, P., Basu, J., Kundu, M.,
(2010). RseA, the SigE specific anti-sigma factor of
Mycobacterium tuberculosis, is inactivated by
phosphorylation-dependent ClpC1P2 proteolysis. Mol.
Microbiol., 75, 592–606. https://doi.org/10.1111/j.1365-
2958.2009.07008.x.
58. Lunge, A., Gupta, R., Choudhary, E., Agarwal, N., (2020).
The unfoldase ClpC1 of Mycobacterium tuberculosis
regulates the expression of a distinct subset of proteins
having intrinsically disordered termini. J. Biol. Chem., 295,
9455–9473. https://doi.org/10.1074/jbc.RA120.013456.
59. Dougan, D.A., Alver, R., Turgay, K., (2020). Exploring a
potential Achilles heel of Mycobacterium tuberculosis:
defining the ClpC1 interactome. FEBS J.,. https://doi.org/
10.1111/febs.15430.
60. Schuenemann, V.J., Kralik, S.M., Albrecht, R., Spall, S.K.,
Truscott, K.N., Dougan, D.A., Zeth, K., (2009). Structural
basis of N-end rule substrate recognition in Escherichia coli
by the ClpAP adaptor protein ClpS. EMBO Rep., 10, 508–
514. https://doi.org/10.1038/embor.2009.62.
61. Muthuramalingam, M., White, J.C., Bourne, C.R., (2016).
Toxin-antitoxin modules are pliable switches activated by
multiple protease pathways. Toxins, 8 https://doi.org/
10.3390/toxins8070214.
62. Becker, S.H., Darwin, K.H., (2017). Bacterial proteasomes:
mechanistic and functional insights. Microbiol. Mol. Biol.
Rev. MMBR, 81 https://doi.org/10.1128/MMBR.00036-16.
63. Striebel, F., Imkamp, F., Özcelik, D., Weber-Ban, E.,
(1843). Pupylation as a signal for proteasomal
degradation in bacteria. Biochim. Biophys. Acta, 2014,
103–113. https://doi.org/10.1016/j.bbamcr.2013.03.022.
64. Festa, R.A., McAllister, F., Pearce, M.J., Mintseris, J.,
Burns, K.E., Gygi, S.P., Darwin, K.H., (2010). Prokaryotic
ubiquitin-like protein (Pup) proteome of Mycobacterium
tuberculosis corrected. PloS One, 5, https://doi.org/
10.1371/journal.pone.0008589 e8589.
65. Becker, S.H., Li, H., Heran Darwin, K., (2019). Biology and
biochemistry of bacterial proteasomes. Subcell. Biochem.,
93, 339–358. https://doi.org/10.1007/978-3-030-28151-
9_11.
66. Delley, C.L., Laederach, J., Ziemski, M., Bolten, M.,
Boehringer, D., Weber-Ban, E., (2014). Bacterial
proteasome activator bpa (rv3780) is a novel ring-shaped
interactor of the mycobacterial proteasome. PloS One, 9,
https://doi.org/10.1371/journal.pone.0114348 e114348.
67. Jastrab, J.B., Wang, T., Murphy, J.P., Bai, L., Hu, K.,
Merkx, R., Huang, J., Chatterjee, C., et al., (2015). An
adenosine triphosphate-independent proteasome activator
contributes to the virulence of Mycobacterium tuberculosis.
Proc. Natl. Acad. Sci. U.S.A, 112, E1763–E1772. https://
doi.org/10.1073/pnas.1423319112.
68. Chi, X., Chang, Y., Li, M., Lin, J., Liu, Y., Li, C., Tang, S.,
Zhang, J., (2018). Biochemical characterization of mt-
P. Texier, P. Bordes, J. Nagpal, et al.
PemIK, a novel toxin-antitoxin system in Mycobacterium
tuberculosis. FEBS Lett., 592, 4039–4050. https://doi.org/
10.1002/1873-3468.13280.
69. Burns, K.E., Cerda-Maira, F.A., Wang, T., Li, H., Bishai, W.
R., Darwin, K.H., (2010). “Depupylation” of prokaryotic
ubiquitin-like protein from mycobacterial proteasome
substrates. Mol. Cell., 39, 821–827. https://doi.org/
10.1016/j.molcel.2010.07.019.
70. Sakr, S., Cirinesi, A.-M., Ullers, R.S., Schwager, F.,
Georgopoulos, C., Genevaux, P., (2010). Lon protease
quality control of presecretory proteins in escherichia coli
and its dependence on the SecB and DnaJ (Hsp40)
chaperones. J. Biol. Chem., 285, 23506. https://doi.org/
10.1074/jbc.M110.133058.
71. Ruangprasert, A., Maehigashi, T., Miles, S.J., Dunham, C.
M., (2017). Importance of the E. coli DinJ antitoxin carboxy
terminus for toxin suppression and regulated proteolysis.
Mol. Microbiol.,. https://doi.org/10.1111/mmi.13641.
72. Datsenko, K.A., Wanner, B.L., (2000). One-step
inactivation of chromosomal genes in Escherichia coli K-
12 using PCR products. Proc. Natl. Acad. Sci. U.S.A, 97,
6640–6645.
73. Mayer, M.P., (1995). A new set of useful cloning and
expression vectors derived from pBlueScript. Gene, 163,
41–46.
17
Journal of Molecular Biology 433 (2021) 166815
74. Genevaux, P., Keppel, F., Schwager, F., Langendijk-
Genevaux, P.S., Hartl, F.U., Georgopoulos, C., (2004). In
vivo analysis of the overlapping functions of DnaK and
trigger factor. EMBO Rep., 5, 195–200. https://doi.org/
10.1038/sj.embor.7400067.
75. Truscott, K.N., Kovermann, P., Geissler, A., Merlin, A.,
Meijer, M., Driessen, A.J.M., Rassow, J., Pfanner, N.,
Wagner, R., (2001). A presequence- and voltage-sensitive
channel of the mitochondrial preprotein translocase formed
by Tim23. Nat. Struct. Mol. Biol., 8, 1074–1082. https://doi.
org/10.1038/nsb726.
76. Catanzariti, A.-M., Soboleva, T.A., Jans, D.A., Board, P.G.,
Baker, R.T., (2004). An efficient system for high-level
expression and easy purification of authentic recombinant
proteins. Protein Sci. Publ. Protein Soc., 13, 1331–1339.
https://doi.org/10.1110/ps.04618904.
77. van Kessel, J.C., Hatfull, G.F., (2007). Recombineering in
Mycobacterium tuberculosis. Nat. Methods, 4, 147–152.
https://doi.org/10.1038/nmeth996.
78. Vasudevan, D., Rao, S.P.S., Noble, C.G., (2013).
Structural basis of mycobacterial inhibition by cyclomarin
A. J. Biol. Chem., 288, 30883–30891. https://doi.org/
10.1074/jbc.M113.493767.