Biochemical and Biophysical Research Communications 522 (2020) 270e277

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications

journal homepage: www.elsevier.com/locate/ybbrc

TOPK promotes epithelial-mesenchymal transition and invasion of

breast cancer cells through upregulation of TBX3 in TGF-b1/Smad
signaling
Young-Ju Lee a, 1, Jung-Hwan Park a, 1, Sang-Muk Oh a, b, *
a
Department of Biochemistry, College of Medicine, Konyang University, Daejeon, 35365, South Korea
b
Priority Research Center, Myunggok Medical Research Institute, College of Medicine, Konyang University, Daejeon, 35365, South Korea

a r t i c l e i n f o a b s t r a c t

Article history: TOPK has been suggested to contribute to invasion of lung, prostate, gastric, pancreatic or breast cancer
Received 1 November 2019 cells. However, how TOPK mediates TGF-b1/Smad signaling leading to epithelial-mesenchymal transition
Accepted 16 November 2019 (EMT) and invasion of breast cancer cells remains unknown. Here we report that TOPK upregulates T-box
Available online 20 November 2019
transcription factor TBX3 to enhance TGF-b1-induced EMT and invasion of MDA-MB-231 breast cancer
cells. Expression of endogenous TOPK was promoted by TGF-b1 treatment of MDA-MB-231 cells time-
Keywords:
dependently. In addition, knockdown of TOPK attenuated TGF-b1-induced phosphorylation or tran-
Breast cancer
scriptional activity of Smad3. Meanwhile, levels of both mRNA and protein of TBX3 induced by TGF-b1
Invasion
TBX3
were abolished by TOPK depletion. Also, knockdown of TBX3 inhibited TGF-b1 induction of EMT-related
TOPK genes Snail, Slug or Fibronectin. Furthermore, ablation of TOPK or TBX3 suppressed TGF-b1-induced
Epithelial-mesenchymal transition MDA-MB-231 cell invasion. Collectively, we conclude that TOPK positively regulates TBX3 in TGF-b1/
TGF-b1 Smad signaling pathway, thereby enhancing EMT and invasion of breast cancer cells, implying a
mechanistic role of TOPK in TGF-b1/Smad signaling.
© 2019 Elsevier Inc. All rights reserved.

1. Introduction invasion of breast cancer cells [6,7]. Also, TBX3 phosphorylated by

It has been suggested that TGF-b1 is known to be one of cyto-
kines that play a key role in EMT of cancer cells as well as cell
proliferation, differentiation and apoptosis, and that TGF-b1
recognized by TbR-I (TGF-b receptor I) transduces signaling
through phosphorylation of Ser/Thr kinase in TbR-I’s cytoplasmic
domains [1,2]. Also, TGF-b1 was reported to promote Notch
pathway mediated by Smad3/ERK-dependent synthesis of Jagged1,
leading to induction of EMT in normal mouse mammary gland
epithelium [3]. On the other hand, TBX3 is known to be a type of T-
box transcription factor family that contain DNA binding domain, as
called T-box, and to be overexpressed in various cancers involving
melanoma, cervical, ovarian, breast, pancreatic, and liver [4,5].
Furthermore, it was reported that TBX3 acts a downstream effector
of TGF-b1 signaling pathway and is closely implicated in EMT and
* Corresponding author. Department of Biochemistry, College of Medicine,
Konyang University, Daejeon, 35365, South Korea
E-mail address: sangmuk_oh@konyang.ac.kr (S.-M. Oh).
1
These authors contributed equally to this work.
AKT3, leading to its stability was shown to induce invasion by
suppressing E-cadherin in human melanoma cells, and TBX3 pro-
moted progression and invasiveness of pre-invasive breast cancer
cells through up-regulation of Slug [8,9].
It has been shown that T-LAK-cell originated protein kinase
(TOPK), a MAPKK-like protein kinase is strongly expressed in many
malignant cells and is implicated in invasion or metastasis of
several cancer cells [10]. Our previous study reported that TOPK
activated by LPS/TLR4 signaling promoted MMP-9 expression to
stimulate migration and invasion of human breast cancer cells [11].
Moreover, TOPK was shown to enhance invasion or metastasis of
prostate cancer via b-catenin-TCL/LEF signaling or PI3K/PTEN and
ERK signaling pathway [12,13]. Although these reports support that
TOPK plays an important role in the invasion or metastasis of
cancer cells, it remains unknown whether TOPK mediates TGF-b/
Smad signaling pathway or EMT in breast cancer cells. In this study,
we reveal that TOPK functions as a critical effector of TGF-b1/Smad
signaling and positively regulates TBX3 leading to promotion of
EMT and invasion of breast cancer cell induced by TGF-b1. We
demonstrate that TOPK knockdown greatly diminishes expression
of TGF-b1-induced TBX3 expression and Smad3 phosphorylation.

https://doi.org/10.1016/j.bbrc.2019.11.104
0006-291X/© 2019 Elsevier Inc. All rights reserved.
 Y.-J. Lee et al. / Biochemical and Biophysical Research Communications 522 (2020) 270e277 271

Fig. 1. Endogenous TOPK is induced by TGF-b1 treatment time-dependently and TOPK depletion attenuates both Smad3 phosphorylation and Smad transcriptional activity induced
by TGF-b1 in breast cancer cells. (A) MDA-MB-231 cells were incubated with TGF-b1 for indicated time. Immunoblot analysis was performed using TOPK or b-actin antibody.
Quantitation graph for TOPK normalized to b-actin is indicated. (B) MDA-MB-231 cells were pretreated with DMSO or LY364947 (1 mM) for 1 h, and then treated with or without
272 Y.-J. Lee et al. / Biochemical and Biophysical Research Communications 522 (2020) 270e277
We also found that TOPK knockdown attenuates TGF-b1-induced
Smad transcriptional activity, which results in reduction of TBX3
expression. These findings provide an evidence that TOPK mediates
EMT and invasion of breast cancer cells through upregulation of
TBX3 in TGF-b1/Smad signaling pathway.
2. Materials and methods
2.1. Cell lines and reagents
MDA-MB-231 human breast cancer cells were purchased from
American Type culture collection (ATCC). Cells were cultured in
RPMI-1640 (Sigma, St. Louis, MO) supplemented with 10% fetal
bovine serum (FBS) (Atlas Biologicals, Fort Collins, Co) and 1%
penicillin/streptomycin (Gibco, Grand Island, NY). Cells were
incubated in a humidified 5% CO2 atmosphere at 37
C. Recombi-
nant human TGF-b1 or LY-364947 was purchased from PEPROTECH
(Rocky Hill, NJ) or MedChem Express (Monmouth Junction, NJ),
respectively. A luciferase reporter vector containing Smad-binding
element (SBE), SBE-Luc was a gift from Bert Vogelstein (Addgene
plasmid #16527). Antibodies purchased from Cell Signaling Tech-
nology are Snail, Slug and Smad2/3. Antibodies purchased from
Abcam are TOPK and TBX3. Anti-Smad3 (p Ser423, p Ser425)
antibody was from Novus Biologicals (Centennial, Co). Anti-b-actin
antibody was from Sigma. Secondary antibodies were from Enzo
Life Sciences, Inc. (Farmingdale, NY).
2.2. siRNA transfection
ON-TARGETplus Human TBX3 siRNA-SMARTpool (L-012197-00-
0005) and ON-TARGETplus Non-Targeting Pool (D-001810-10-05)
were purchased from Dharmacon (Lafayette, CO). MDA-MB-
231 cells was transfected with each siRNA using Lipofect-
amine3000 (Invitrogen Life Technologies, USA) according to the
manufacturer’s instructions.
2.3. Construction of TOPK knockdown MDA-MB-231 cells
TOPK siRNA construct was generated as described [14]. Duplex
hairpin siRNA oligonucleotides for TOPK siRNA construct, 50 -
GATCCGAGGTTTGTCTCATTCTCC TTCAAGA GAGGAGAATGAGACAAA
CCTCTTTTTTGGAAA-30 (forward strand) and 50 -AAAAAACC
TTTTCGAGAGGTTTGTCTCATTCTCCTCTCTTGAAGGAGAATGAGACAA
ACCTCG-30 (reverse strand) were synthesized and annealed. The
oligonucleotides were subcloned into BamHI/HindIII sites of pSi-
lencer 3.1-H1 neo vector (Ambion, Austin, TX). TOPK siRNA
construct was confirmed by sequencing. To establish TOPK siRNA or
control siRNA cells, MDA-MB-231 cells were transfected with each
5 mg of TOPK siRNA construct or pSilencer neo vector (Ambion)
using Lipofectamine3000. 48 h after transfection, cell culture media
were replaced with G418 (400 mg/ml) containing media. After about
2 weeks, desired clones were selected and cultured.
2.4. Reverse transcription (RT)-PCR
RT-PCR was done as described [11]. Total RNAs were extracted
using TRIzol reagent (Invitrogen Life Technologies, USA). Reverse
transcription was performed using Superscript III reverse tran-
scriptase (Invitrogen Life Technologies, USA). After cDNA was
TGF-b1 for 6 h. Immunoblotting was done using indicated antibody. (C) MDA-MB-231 cells stably expressing control siRNA or TOPK siRNA were pretreated with DMSO or LY364947
(1 mM) for 1 h, and then incubated with or without TGF-b1 for 1 h. Immunoblotting using indicated antibody was carried out. Quantitation graphs are indicated. (D) Control siRNA
cells or TOPK siRNA cells were transfected with SBE-driven luciferase reporter construct (SBE-Luc) plus pRL-SV40 gene. 24 h after transfection, cells were treated with or without
TGF-b1 for 24 h. Renilla luciferase activity was used to normalize firefly luciferase activity. Shown are representative images of three independent experiments. *, p < 0.05, **,
p < 0.01, ***, p < 0.001 compared to controls. N.S, non-significant.
synthesized, PCR was done using the AccuPower RT-PCR PreMix kit
(Bioneer Corporation, Daejeon, Korea) with the following primer
sequences: 50 -gcgcgactttttgaaagcca-3’ (forward) and 50 -acgga-
gaggccgggatattt-3’ (reverse) for human TOPK; 50 -agatccggt-
cattcctggga-3’ (forward) and 50 -gctgtccgggtgaatgtaca-3’ (reverse)
for human TBX3; 50 -atggaaatcccatcaccatctt-3’ (forward) and 50 -
cgccccacttgattttgg-3’ (reverse) for human GAPDH.
2.5. Real-time quantitative RT-PCR
Real time qRT-PCR was carried out with synthesized cDNA from
total RNA and FastStart Essential DNA Green Master (Roche, Basel,
Switzerland). Primer sequences were as follows: 50 -ccactggat-
gaaaatatgactgtg-3’ (forward) and 50 -tccacagcttctttgggttt-3’
(reverse) for human TOPK; 50 -tacagcgagctgcaggact-3’ (forward) and
50 -atctccggaggtgggatg-3’ (reverse) for human Snail; 50 -
tggttgcttcaaggacacat-3’ (forward) and 50 -gcaaatgctctgttgcagtg-3’
(reverse) for human Slug; 50 -cgctgtgactgcataccaga6þ-3’ (forward)
and 50 -ccatttccagtgtcccggaa-3’ (reverse) for human TBX3; 50 -agc-
cacatcgctcagacac-3’ (forward) and 50 -gcccaatacgaccaaatcc-3’
(reverse) for human GAPDH.
2.6. In vitro invasion assay
MDA-MB-231 control siRNA cells, TOPK siRNA cells or TBX3
siRNA cells were seeded in six-well plates 24 h before TGF-b1
treatment. Cells were incubated with TGF-b1 for additional 24 h,
harvested and then each cell in serum-free medium was seeded in
the upper well of the chamber. Cells were allowed to invade
through a polycarbonate membrane filter coated with matrigel
(Corning, Corning, NY). The assay was done using a 48-Well
MicroChemotaxis Chamber (Neuro Probe, Inc., Gaithersburg, MD)
for 22 h at 37
C in 5% CO2. The filters were fixed and stained with
Diff-Quik reagents (Dade Behring, Inc., Newark, DE).
2.7. Immunoblot analysis
Each cell lysate was separated on SDS-PAGE and transferred to
nitrocellulose membrane (Bio-Rad, Hercules, CA). The membranes
were blocked with 5% skim milk (BD biosciences, San Jose, CA) for
1 h at room temperature. After washing, membranes were incu-
bated with primary antibodies at 4
C for overnight, washed and
incubated with horseradish-conjugated secondary antibodies
(Enzo Life Sciences, Inc., Farmingdale, NY) for 1 h at room tem-
perature. The blots were developed using chemiluminescence re-
agents (Abclon, Seoul, Korea) and exposed to X-ray film.
2.8. Luciferase reporter assay
MDA-MB-231 cells (2  105) grown on 12-well plates were
transfected with 1 mg of SBE-Luc reporter construct plus 0.5 mg of
pRL-SV40 gene using lipofectamine3000 reagent. 24 h after trans-
fection, cells were incubated with TGF-b1 for 24 h. Luciferase re-
porter assay was carried out using Luciferase assay systems
(Promega, Madison, WI) according to the manufacturer’s in-
structions. Firefly and Renilla luciferase activities were evaluated
using FB 12 Luminometer (Berthold Technologies, Calmbacher, BW,
German), and firefly luciferase activities was normalized with
Renilla luciferase activities.
 Y.-J. Lee et al. / Biochemical and Biophysical Research Communications 522 (2020) 270e277 273

2.9. Statistical analysis inhibits phosphorylation of Smad3 by TGFbR-I kinase. In order to

Results are shown as the mean ± standard deviation (SD) for at
least three independent experiments in duplicates. Statistical
analysis was performed by two-tailed student’s t-test or one-way
ANOVA. P values less than 0.05 were regarded as statistically
significant.
3. Results
3.1. TGF-b1 treatment promotes expression of endogenous TOPK in
MDA-MB-231 breast cancer cells and TOPK depletion decreases
phosphorylation or transcriptional activity of Smad3 induced by
TGF-b1
We first asked whether endogenous TOPK expression is affected
by TGF-b1 treatment in breast cancer cells. MDA-MB-231 cells were
incubated with or without TGF-b1 for 0.5, 2 or 6 h. Results indicated
that TOPK expression level was little changed until 2 h of TGF-b1
treatment but increased about 5.5-fold upon 6 h of TGF-b1 treat-
ment (Fig. 1A). We employed TGFbR-I inhibitor, LY364947 that
investigate effect of TGFbR-I inhibitor on the TGF-b1 induction of
endogenous TOPK, MDA-MB-231 cells were pretreated with
LY364947 for 1 h, and then incubated with or without TGF-b1 for
6 h. As expected, cotreatment of LY364947 effectively decreased
induction of endogenous TOPK mediated by TGF-b1 (Fig. 1B). To
next investigate the role of TOPK in TGF-b1/Smad-mediated
signaling pathways, we established stable TOPK knockdown MDA-
MB-231 cells using TOPK siRNA or control siRNA. Control cells or
TOPK knockdown cells were incubated with or without TGF-b1 for
1 h in presence or absence of LY364947. As shown in Fig. 1C,
phosphorylation of Smad3 was greatly elevated by TGF-b1 treat-
ment in control cells, but TOPK knockdown markedly alleviated
TGF-b1-mediated Smad3 phosphorylation. Also, LY364947 treat-
ment abolished TGF-b1-mediated the phosphorylation as expected.
We next investigated whether TOPK knockdown affects TGF-b1-
induced Smad transcriptional activity. Control cells or TOPK
knockdown cells were transfected with Smad binding element
containing luciferase (SBE-luc) construct. 24 h after transfection,
cells were incubated with TGF-b1 for additional 24 h. Results
showed that knockdown of TOPK significantly attenuated TGF-b1-

Fig. 2. TGF-b1 induction of TOPK upregulates TBX3 expression in breast cancer cells. (A) Control siRNA cells or TOPK siRNA cells were preincubated with serum-free media for 2 h,
and then treated with or without TGF-b1 for 4 h. RT-PCR analysis was done using indicated primer. Quantitation graph for relative mRNA level is shown. (B) Control siRNA cells or
TOPK siRNA cells were pretreated with serum-free media for 2 h, and then incubated with or without TGF-b1 for 4 h. Immunoblotting was performed using TOPK or TBX3 antibody.
Quantitation graph is shown. Representative images of three independent experiments are indicated. *, p < 0.05, **, p < 0.01, ***, p < 0.001 compared to controls. N.S, non-
significant.
274 Y.-J. Lee et al. / Biochemical and Biophysical Research Communications 522 (2020) 270e277

Fig. 3. Ablation of TBX3 alleviates TGF-b1 induction of EMT markers Snail, Slug or Fibronectin. (A) MDA-MB-231 cells were transfected with control siRNA or TBX3 siRNA. 48 h after
transfection, cell lysates were subjected to SDS-PAGE and subsequent immunoblotting. (B) MDA-MB-231 cells were transfected with control siRNA or TBX3 siRNA for 24 h, and then
cells were incubated with or without TGF-b1 for 24 h. Real-time quantitative RT-PCR analysis was done using indicated primers. Relative mRNA level normalized to GAPDH is
shown. (C) MDA-MB-231 cells were transfected with control siRNA or TBX3 siRNA. 24 h after transfection, cells were treated with or without TGF-b1 for 24 h. Protein level of Snail or
Slug was determined using immunoblotting. Representatives of three independent experiments are indicated. *, p < 0.05, **, p < 0.01, ***, p < 0.001 compared to controls.
 Y.-J. Lee et al. / Biochemical and Biophysical Research Communications 522 (2020) 270e277 275

induced Smad transcriptional activity as compared with control
(Fig. 1D). These findings demonstrate that TOPK expression is
induced by TGF-b1 treatment time-dependently, and that TOPK
might function as an important effector of TGF-b1/Smad signaling.
3.2. TOPK positively regulates TBX3 expression in response to TGF-
b1
It has been suggested that both TOPK and TBX3 are closely
implicated in regulation of stimuli-mediated invasion of several
cancer cells [6,11,15e18]. Therefore, we aimed to explore the cor-
relation of TOPK and TBX3 in TGF-b1 signaling to affect EMT and
invasion of breast cancer cells. To examine expression of TOPK or
TBX3 in TGF-b1 response, control cells or TOPK knockdown cells
were incubated with or without TGF-b1 for 4 h. Results indicated
that TGF-b1 treatment augmented mRNA level of both endogenous
TOPK and TBX3 in control cells, but the mRNA level was surpris-
ingly attenuated in TOPK knockdown cells (Fig. 2A). Moreover,
immunoblotting analysis showed that knockdown of TOPK greatly
decreased TGF-b1-induced TBX3 expression (Fig. 2B). Taken, these
findings demonstrate that TGF-b1-induced endogenous TBX3
expression is dependent on TOPK in breast cancer cells.
3.3. Ablation of TBX3 inhibits TGF-b1 induction of EMT markers
snail, slug or fibronectin
It has been shown that EMT is a requisite for cancer cell invasion,
and that TBX3 promotes breast cancer cell invasion by inducing
EMT [8,19]. However, it remains elusive whether TBX3 affects TGF-
b1-induced EMT in breast cancer cells. Therefore, we next investi-
gated effect of TBX3 knockdown on TGF-b1-induced expression of
EMT markers Snail or Slug. First, TBX3 siRNA was transfected into
MDA-MB-231 cells and 48 h after transfection, knockdown effect
was examined. As shown in Fig. 3A, endogenous TBX3 protein level
was almost abolished by expression of TBX3 siRNA. To investigate
whether TBX3 knockdown has implications for TGF-b1-induced
expression of EMT markers Snail, Slug or Fibronectin, MDA-MB-
231 cells were transfected with TBX3 siRNA or control siRNA and
24 h after transfection, cells were incubated with TGF-b1 for
additional 24 h. Real-time quantitative RT-PCR analysis showed

Fig. 4. Knockdown of TOPK or TBX3 blocks TGF-b1-induced breast cancer cell invasion. (A) MDA-MB-231 cells stably expressing control siRNA or TOPK siRNA were treated with or
without TGF-b1. After 48 h, in vitro invasion assay was carried out. Invaded cells were fixed, stained with Diff-Quik reagents and then invaded cells were counted using ImageJ
software (National Institutes of Health). Relative cell invasion (%) is indicated. (B) MDA-MB-231 cells were transfected with control siRNA or TBX3 siRNA. 24 h after transfection, cells
were treated with or without TGF-b1 for 24 h. Invasion assay was performed. Shown are representatives of three independent experiments. **, p < 0.01 compared to controls. N.S,
non-significant.
276 Y.-J. Lee et al. / Biochemical and Biophysical Research Communications 522 (2020) 270e277
that TGF-b1 treatment increased endogenous TBX3 mRNA level,
and that expression of TBX3 siRNA alleviated TGF-b1 induction of
Snail, Slug or Fibronectin mRNA compared with control siRNA
(Fig. 3B). In addition, effect of TBX3 knockdown on TGF-b1-induced
Snail or Slug protein level was examined. Results indicated that
knockdown of TBX3 diminished level of Snail or Slug protein
induced by TGF-b1 (Fig. 3C). These results demonstrate that TBX3
induced by TGF-b1 promotes TGF-b1-mediated EMT of breast
cancer cells.
3.4. Knockdown of TOPK or TBX3 suppresses TGF-b1-induced breast
cancer cell invasion
We next explored whether knockdown of TOPK or TBX3 in-
fluences breast cancer cell invasion mediated by TGF-b1. Stable
control siRNA cells or TOPK siRNA cells generated from MDA-MB-
231 cell line were incubated with or without TGF-b1 for 48 h. Also,
MDA-MB-231 cells were transfected with control siRNA or TBX3
siRNA and 24 h after transfection, cells were treated with or
without TGF-b1 for additional 24 h In vitro invasion assay indicated
that TGF-b1 promoted breast cancer cell invasion, which was
suppressed by TOPK knockdown (Fig. 4A), and that TBX3 knock-
down abolished TGF-b1-induced the invasion (Fig. 4B). These
findings imply that both TOPK and TBX3 mediates TGF-b1 signaling
leading to breast cancer cell invasion.
4. Discussion
It has been suggested that epithelial cells lose cell-cell adhesion
and develop characteristics of invasive mesenchymal cells via EMT,
and that EMT is essential for cancer cell invasion and metastasis as
well as establishment of various tissues or organs during devel-
opment [19]. TGF-b1 is known to promote EMT in breast cancer
cells via Smad-dependent pathways [20e22]. Meanwhile, previous
reports showed that TOPK positively regulates invasion or metas-
tasis of several cancer cells involving prostate, breast or colorectal
cancer [11,12,17]. Particularly, our previous study indicated that
TOPK mediates LPS-induced breast cancer cell migration and in-
vasion [11]. Based on these findings, we aimed to explore role of
TOPK in TGF-b1-induced EMT or invasion of breast cancer cells. In
this study, we demonstrate that TOPK mediates EMT or invasion of
MDA-MB-231 breast cancer cells induced by TGF-b1/Smad
signaling. Signaling pathways triggered by some stimuli such as
Ras, TPA or LPS have been reported to affect the activity or
expression of TOPK [11,23,24]. In other words, TOPK functions as a
downstream target of Ras, TPA or LPS-mediated signaling path-
ways. However, information about signal inducers influencing
TOPK is still not enough. Our data showed that expression of
endogenous TOPK was time-dependently increased by TGF-b1
treatment in breast cancer cells, and that TOPK depletion remark-
ably attenuated TGF-b1-induced Smad3 phosphorylation. These
findings imply that TOPK acts as a novel downstream effector of
TGF-b1/Smad signaling.
It has been reported that transcription factor TBX3 acts a
downstream target of TGF-b1 signaling and enhances cancer cell
invasion by inducing EMT through regulation of expression of EMT-
related genes such as E-cadherin or Slug [7,8,18]. Based on role of
TOPK and TBX3 in TGF-b1 signaling, we questioned whether TOPK
can affect TBX3 expression in TGF-b1/Smad signaling. Our findings
indicated that knockdown of TOPK inhibits Smad transcriptional
activity to abolish TGF-b1-induced TBX3 expression. Both putative
AP-1-binding sites and Smad-binding sites (SBEs) are shown to
exist on promotor of human TBX3 gene [7]. Therefore, TGF-b1 in-
duction of TBX3 expression seems to depend on TOPK-mediated
Smads transcriptional activity, although AP-1’s effect on the
expression cannot be ruled out. On the other hand, it was investi-
gated whether the TOPK-mediated EMT of breast cancer cells by
TBX3 in TGF-b1/Smad signaling affects breast cancer cell invasion.
Knockdown of TOPK or TBX3 greatly decreased TGF-b1-induced the
cell invasion. Taken, we conclude that TOPK upregulated by TGF-b1
promotes TBX3 expression, thereby inducing EMT and invasion of
breast cancer cells. The findings in this study expand our under-
standing regarding mechanistic role of TOPK in breast cancer
development and the potential use of TOPK inhibitors may be
emphasized to inhibit development of breast cancer.
Author contributions
Y.L. and J.P. conducted experiments, collected data and analyzed
data. S.O. designed and supervised the project. Y.L., J.P. and S.O.
wrote the manuscript.
Acknowledgement
This work was supported by the National Research Foundation
of Korea (NRF) grants funded by the Korea government (MSIP)
(NRF-2019R1I1A3A01063191). This work was also supported by the
Priority Research Centers Program through the NRF funded by the
MEST (NRF-2017R1A6A1A03015713).
Appendix A. Supplementary data
Supplementary data to this article can be found online at
https://doi.org/10.1016/j.bbrc.2019.11.104.
References
[1] A.J. Galliher, J.R. Neil, W.P. Schiemann, Role of transforming growth factore-b
in cancer progression, Future Oncol. 2 (2006) 743e763.
[2] H. Ikushima, K. Miyazono, TGFbeta signalling: a complex web in cancer pro-
gression, Nat. Rev. Cancer 10 (2010) 415e424.
[3] J. Zavadil, L. Cermak, N. Soto-Nieves, E.P. Bo €ttinger, Integration of TGF-b/Smad
and Jagged1/Notch signalling in epithelial-to-mesenchymal transition, EMBO
J. 23 (2004) 1155e1165.
[4] W.M.H. Hoogaars, P. Barnett, M. Rodriguez, D.E. Clout, A.F.M. Moorman,
C.R. Goding, V.M. Christoffels, TBX3 and its splice variant TBX3 þ exon 2a are
functionally similar, Pigment Cell Melanoma Res. 21 (2008) 379e387.
[5] T. Willmer, A. Cooper, J. Peres, R. Omar, S. Prince, The T-Box transcription
factor 3 in development and cancer, Biosci, Trends 11 (2017) 254e266.
[6] M. Krstic, C.D. Macmillan, H.S. Leong, A.G. Clifford, L.H. Souter, D.W. Dales,
C.O. Postenka, A.F. Chambers, A.B. Tuck, The transcriptional regulator TBX3
promotes progression from non-invasive to invasive breast cancer, BMC Canc.
16 (2016) 671.
[7] J. Li, M.S. Weinberg, L. Zerbini, S. Prince, The oncogenic TBX3 is a downstream
target and mediator of the TGF-beta1 signaling pathway, Mol. Biol. Cell 24
(2013) 3569e3576.
[8] M. Krstic, B. Kolendowski, M.J. Cecchini, C.O. Postenka, H.M. Hassan,
J. Andrews, C.D. MacMillan, K.C. Williams, H.S. Leong, M. Brackstone, J. Torchia,
A.F. Chambers, A.B. Tuck, TBX3 promotes progression of pre-invasive breast
cancer cells by inducing EMT and directly up-regulating SLUG, J. Pathol. 248
(2019) 191e203.
[9] J. Peres, S. Mowla, S. Prince, The T-box transcription factor, TBX3, is a key
substrate of AKT3 in melanomagenesis, Oncotarget 6 (2015) 1821e1833.
[10] K.J. Herbert, T.M. Ashton, R. Prevo, G. Pirovano, G.S. Higgins, T-LAK cell-
originated protein kinase (TOPK): an emerging target for cancer-specific
therapeutics, Cell Death Dis. 9 (2018) 1089.
[11] M.-A. Seol, J.-H. Park, J.H. Jeong, J. Lyu, S.Y. Han, S.-M. Oh, Role of TOPK in
lipopolysaccharide-induced breast cancer cell migration and invasion, Onco-
target 8 (2017) 40190e40203.
[12] J.D. Brown-Clay, D.N. Shenoy, O. Timofeeva, B.V. Kallakury, A.K. Nandi,
P.P. Banerjee, Erratum: PBK/TOPK enhances aggressive phenotype in prostate
cancer via beta-catenin-TCF/LEF-mediated matrix metalloproteinases pro-
duction and invasion, Oncotarget 7 (2016) 2153e2154.
[13] H. Sun, L. Zhang, C. Shi, P. Hu, W. Yan, Z. Wang, Q. Duan, F. Lu, L. Qin, T. Lu,
J. Xiao, Y. Wang, F. Zhu, C. Shao, TOPK is highly expressed in circulating tumor
cells, enabling metastasis of prostate cancer, Oncotarget 6 (2015)
12392e12404.
[14] H.R. Kwon, K.W. Lee, Z. Dong, K.B. Lee, S.M. Oh, Requirement of T-lymphokine-
activated killer cell-originated protein kinase for TRAIL resistance of human
HeLa cervical cancer cells, Biochem. Biophys. Res. Commun. 391 (2010)
 Y.-J. Lee et al. / Biochemical and Biophysical Research Communications 522 (2020) 270e277
830e834.
[15] M.C. Shih, J.Y. Chen, Y.C. Wu, Y.H. Jan, B.M. Yang, P.J. Lu, H.C. Cheng,
M.S. Huang, C.J. Yang, M. Hsiao, J.M. Lai, TOPK/PBK promotes cell migration via
modulation of the PI3K/PTEN/AKT pathway and is associated with poor
prognosis in lung cancer, Oncogene 31 (2012) 2389e2400.
[16] J. Peres, S. Prince, The T-box transcription factor, TBX3, is sufficient to promote
melanoma formation and invasion, Mol. Cancer 12 (2013) 117.
[17] T.A. Zykova, F. Zhu, L. Wang, H. Li, R. Bai, D.Y. Lim, K. Yao, A.M. Bode, Z. Dong,
The T-LAK cell-originated protein kinase signal pathway promotes colorectal
cancer metastasis, EBioMedicine 18 (2017) 73e82.
[18] X. Feng, W. Yao, Z. Zhang, F. Yuan, L. Liang, J. Zhou, S. Liu, J. Song, T-box
transcription factor Tbx3 contributes to human Hepatocellular carcinoma cell
migration and invasion by repressing E-Cadherin expression, Oncol. Res. 26
(2018) 959e966.
[19] S. Lamouille, J. Xu, R. Derynck, Molecular mechanisms of epithelial-
mesenchymal transition, Nat. Rev. Mol. Cell Biol. 15 (2014) 178e196.
277
[20] R. Derynck, Y.E. Zhang, Smad-dependent and Smad-independent pathways in
TGF-beta family signalling, Nature 425 (2003) 577e584.
[21] J. Johansson, V. Tabor, A. Wikell, S. Jalkanen, J. Fuxe, TGF-beta1-Induced
epithelial-mesenchymal transition promotes monocyte/macrophage proper-
ties in breast cancer cells, Front. Oncol. 5 (2015) 3.
[22] S. Kim, J. Lee, M. Jeon, S.J. Nam, J.E. Lee, Elevated TGF-beta1 and -beta2
expression accelerates the epithelial to mesenchymal transition in triple-
negative breast cancer cells, Cytokine 75 (2015) 151e158.
[23] Y.H. Liu, X.M. Gao, F.M. Ge, Z. Wang, W.Q. Wang, X.Y. Li, PBK/TOPK expression
during TPA-induced HL-60 leukemic cell differentiation, Asian Pac. J. Cancer
Prev. APJCP 13 (2012) 2145e2148.
[24] S.M. Oh, F. Zhu, Y.Y. Cho, K.W. Lee, B.S. Kang, H.G. Kim, T. Zykova, A.M. Bode,
Z. Dong, T-lymphokine-activated killer cell-originated protein kinase func-
tions as a positive regulator of c-Jun-NH2-kinase 1 signaling and H-Ras-
induced cell transformation, Cancer Res. 67 (2007) 5186e5194.