Basic Research—Technology

Odontoblastic Differentiation, Inflammatory Response, and

Angiogenic Potential of 4 Calcium Silicate–based Cements:
Micromega MTA, ProRoot MTA, Retro MTA, and
Experimental Calcium Silicate Cement
Seok-Woo Chang, DDS, PhD,* Won-Jung Bae, MSD,† Jin-Kyu Yi, DMD, PhD,*
Soojung Lee, DMD, PhD,‡ Deok-Won Lee, DMD, PhD,‡ Kee-Yeon Kum, DDS, PhD,‡ and
Eun-Cheol Kim, DDS, PhD†

Abstract
Introudction: The aim of this study was to analyze the
effects of different calcium silicate–based cements
(CSCs) for pulp capping materials including MicroMega
MTA (MMTA; MicroMega, Besanchon, France), Retro
MTA (RMTA; BioMTA, Seoul, Korea), ProRoot MTA
(PMTA; Dentsply, Tulsa, OK), and experimental CSC
(ECSC) on odontoblastic differentiation, in vitro angio-
genesis, and the inflammatory response in human
dental pulp cells. Methods: Differentiation was
evaluated by alkaline phosphatase activity, alizarin red
staining, and reverse-transcriptase polymerase chain re-
action (RT-PCR) for the marker genes. The levels of in-
flammatory mediators and cytokines were measured
by RT-PCR and an enzyme-linked immunosorbent assay.
In vitro angiogenesis was assessed by RT-PCR for
angiogenic genes and an endothelial tube formation
assay. Results: PMTA, MMTA, and ECSC increased
the alkaline phosphatase activity and mineralization
nodule formation and up-regulated messenger RNA
(mRNA) expression of odontoblastic markers compared
with RMTA. In addition, PMTA, MMTA, and ECSC up-
regulated the mRNA of angiogenic genes in human
dental pulp cells and increased the capillary tube forma-
tion of endothelial cells compared with RMTA. However,
all CSCs showed similar expression levels of inducible
nitric oxide synthase and cyclooxygenase-2 protein as
well as proinflammatory mediators such as nitric oxide,
prostaglandin E2, tumor necrosis factor alpha, inter-
leukin (IL)-1b, IL-6, and IL-8 mRNA. Conclusions: Taken
together, our experimental results suggest that all CSCs
are favorable materials for pulp capping, but PMTA,
MMTA, and ECSC may be recommended over RMTA.
(J Endod 2015;-:1–6)
Key Words
Angiogenesis, dental pulp cells, differentiation, experimental calcium silicate cement,
Micromega MTA, ProRoot MTA, Retro MTA
C alcium silicate–based cements (CSCs), such as ProRoot mineral trioxide aggregate
(PMTA; Dentsply, Tulsa, OK) and Portland cement, are mainly composed of hydro-
philic particles of dicalcium and tricalcium silicate and tricalcium aluminate (1). MTA
powder is essentially a mixture of Portland cement and bismuth (III) oxide and has
been used successfully in dental applications for root perforation repair, 1-visit apex-
ification, and pulp capping (2–4). We previously reported that MTA is superior to
calcium hydroxide in terms of inducing the dentinogenic process in human pulp
capping (5). However, MTA has some disadvantages, such as prolonged setting time,
high cost, potential of discoloration, and poor handling (6).
To reduce the setting time and extend its clinical use, new CSCs have been designed
by adding different compounds (7, 8). Recently, MicroMega MTA (MMTA; MicroMega,
Besanchon, France) was developed using tricalcium silicate, dicalcium silicate,
tricalcium aluminate, bismuth oxide, calcium sulfate dehydrate, magnesium oxide,
and calcium carbonate (8). The manufacturer proclaims that MMTA has a short setting
time of 20 minutes because of the addition of calcium carbonate (CaCO3) (9). More-
over, we found that the biocompatibility, odontoblast differentiation, and inflammatory
response of MMTA are all equal to those of PMTA (10).
Retro MTA (RMTA; BioMTA, Seoul, Korea) is another newly introduced CSC. The
manufacturer states that the composition of RMTA includes calcium carbonate (60%–
80%), silicon dioxide (5%–15%), aluminum oxide (5%–10%), and calcium zirconia
complex (20%–30%) (11). According to the manufacturer, RMTA uses the calcium
zirconia complex as a contrast media (radiopacifier). In addition, the manufacturer
indicates that RMTA has a very short initial setting time of 180 seconds. Considering
that the initial setting time of PMTA is 148 minutes (12), this is a substantially shorter
time, and it can be clinically beneficial because a pulp capping material should set
quickly to avoid being washed out by blood or tissue fluid (11).
Experimental CSC (ECSC) is a provisionally manufactured Portland cement (Chon-
nam National University, Gwangju, Korea), which is produced in the laboratory by the
formation and grinding of calcium silicate clinker and is mainly composed of tricalcium
silicate and dicalcium silicate (13). A previous study reported that the setting time of

From the Departments of *Conservative Dentistry, †Oral and Maxillofacial Pathology and Research Center for Tooth and Periodontal Regeneration, and ‡Oral Phys-
iology, School of Dentistry, Kyung Hee University, Seoul, Republic of Korea.
Address requests for reprints to Dr Eun-Cheol Kim, Department of Oral and Maxillofacial Pathology and Research Center for Tooth and Periodontal Regeneration,
School of Dentistry, Kyung Hee University, 1 Heogi-dong, Dongdaemun-gu, Seoul, 130-701, Republic of Korea. E-mail address: eckim@khu.ac.kr
0099-2399/$ - see front matter
Copyright ª 2015 American Association of Endodontists.
http://dx.doi.org/10.1016/j.joen.2015.04.018

JOE — Volume -, Number -, - 2015 Effects of Various CSCs on Differentiation 1

Basic Research—Technology
ECSC is 47 minutes, which is shorter than ProRoot MTA (13). Our pre-
vious report showed that ECSC contains 64.8% CaO and 21.6% SiO2,
whereas PMTA contains 41.2% CaO and 19.4% SiO2 (14), indicating
ECSC contains more silicon than PMTA. Although ECSC and PMTA
showed similar cytotoxicity and cell morphology to the human osteosar-
coma cell line MG-63 (13), the effects of ECSC on differentiation and its
angiogenic potential for human dental pulp cells (HDPCs) are not
known.
Thus, the aim of this study was to investigate the biocompatibility,
inflammatory response, and potential for odontogenic differentiation
and in vitro angiogenesis of different CSCs, including PMTA, RMTA,
MMTA, and ECSC compared with an intermediate restorative material
(IRM; Dentsply Tulsa Dental, Tulsa, OK).
Materials and Methods
Sample Preparation
Under aseptic conditions, PMTA, RMTA, MMTA, and IRM were
mixed with distilled water following the manufacturer’s instructions.
ECSC was mixed with distilled water in a water-to-powder ratio of 1:3
(13). Each sample (6 mm in diameter and 2 mm in thickness) were
left to incubate for 24 hours at 37
C in 100% humidity. The samples
were placed in 24-well tissue culture plates, washed twice with
phosphate-buffered solution, dried under laminar flow for 24 hours
at room temperature, and sterilized by gamma radiation with 37.2 Gy
before being used to culture cells.
Cell Culture
Immortalized HDPCs (courtesy of Professor Takashi Takata, Hir-
oshima University, Hiroshima, Japan) transfected with human telome-
rase catalytic component (15) were cultured in alpha-minimum
essential medium supplemented with 10% fetal bovine serum, 100
U/mL penicillin, and 100 U/mL streptomycin in a humidified atmo-
sphere of 5% CO2 at 37
C.
Alkaline Phosphatase Activity Assay
Treated cells were washed with phosphate-buffered saline, and then
the cell layers were scraped into a solution containing 20 mmol/L Tris-
HCl (pH = 8.0), 150 mmol/L NaCl, 1% Triton X-100 (Sigma-Aldrich, St
Louis, MO), 0.02% NaN3, and 1 mg/mL aprotinin. The lysates were ho-
mogenized. Then, alkaline phosphatase (ALP) activity was assayed by
spectrophotometric measurement (410 nm; Beckman Coulter, Fuller-
ton, CA) of p-nitrophenol release at 37
C. To normalize protein expres-
sion to total cellular protein, a fraction of the lysate solution was used in a
Bradford protein assay (n = 4).
Alizarin Red Staining
The cells were fixed in 70% ice-cold ethanol for 1 hour and rinsed
with distilled water. The cells were then stained with 40 mmol/L alizarin
red S (pH = 4.2) for 10 minutes under gentle agitation.
RNA Isolation and Reverse-transcriptase
Polymerase Chain Reaction
The total RNA of the cells was extracted by using Trizol reagent
(Life Technologies, Gaithersburg, MD) according to the manufacturer’s
instructions. Then, 1 mg RNA was reverse transcribed for first-strand
complementary DNA synthesis (Gibco BRL, Rockville, MD). The com-
plementary DNA was amplified for 30 cycles in a DNA thermal cycler.
The primer sequences are detailed in Table 1. The polymerase chain
reaction products were resolved on a 1.5% agarose gel stained with
ethidium bromide.
Western Blot Analysis
Cells were solubilized in a PRO-PREP protein extraction kit (Intron
Biotechnology, Seongnam, Korea) for 20 minutes. An equal amount
of protein for each sample was resolved by using 12% sodium dodecyl
sulfate–polyacrylamide gel electrophoresis and then electrophoretically
transferred onto a nitrocellulose membrane (Bio-Rad, Richmond, CA).

TABLE 1. Reverse-transcriptase Polymerase Chain Reaction Primers and Conditions

Gene Sequence (50 -30 ) Size (bp) Temperature (
C)
ON Forward: GTGCAGCCTTTGTGTCCAAGCAGGA 196 62
Reverse: CCGTAGAAGCGCCGATAGGCC
OPN Forward: CCCACAGACCCTTCCAAGTA 244 60
Reverse: GGGGACAACTGGAGTGAAAA
OCN Forward: AGCCCTCACACTCCTCGCCCTAT 301 60
Reverse: AGCCTGGTTCACCCCAGCTCA
DSPP Forward: GCAAAAGTCCAGGACAGTGGGCC 342 61
Reverse: GTCAAATTTCCACCTCAGTTGGCCA
DMP-1 Forward: CACCAACACCACCCTTGGAGAGCA 346 65
Reverse: TGCCCTTGTGGGGCACTCTCT
VEGF Forward: CACCGCCTCGGCTTGTCACAT 404 58
Reverse: CTGCTGTCTTGGGTGCATTGG
FGF-2 Forward: GGCTTCTTCCTGCGCATCCA 354 60
Reverse: GCTCTTAGCAGACATTGGAAGA
Ang-1 Forward: GCTCCACACGTGGAACCGGA 140 59
Reverse: GTGCAAGAAAGGAAAAAGGTCCGTG
TNF-a Forward: GGAAGACCCCTCCCAGATAG 413 52
Reverse: CCCCAGGGACCTCTCTCTAA
IL-1b Forward: GGA TAT GGA GCA ACA AGT GG 288 60
Reverse: ATG TAC CAG TTG GGG AAC TG
IL-6 Forward: TAG CCG CCC CAC ACA GAC AG 408 60
Reverse: GGC TGG CAT TTG TGG TTG GG
IL-8 Forward: ATGACTTCCAAGCTGGCCGTGG 297 62
Reverse: TGAATTCTCAGCCCTCTTCAAAAAC
b-actin Forward: CATGGATGATGATATCGCCGCG 371 55
Reverse: ACATGATCTGGGTCATCTTCTCG
Ang-1, angiopoietin 1; DMP-1, dentin matrix protein 1; DSPP, dentin sialophosphoprotein; FGF-2, fibroblast growth factor 2; IL, interleukin; OCN, osteocalcin; ON, osteonectin; OPN, osteopontin; TNF-a, tumor
necrosis factor alpha.

2 Chang et al. JOE — Volume -, Number -, - 2015


The membrane was blocked with 5% skim milk and sequentially incu-
bated with each primary antibody and secondary antibody followed by
enhanced chemiluminescence detection (Amersham Pharmacia Biotech,
Piscataway, NJ).
Enzyme-linked Immunosorbent Assay
The nitric oxide (NO) and prostaglandin E2 (PGE2) concentra-
tions in the culture supernatants were determined with an enzyme-
linked immunosorbent assay kit (R&D Systems, Minneapolis, MN)
according to the manufacturer’s procedure. The plates were read at
450 nm on a microplate reader (Molecular Devices, Sunnyvale, CA).
In Vitro Angiogenesis Assay
Human umbilical vein endothelial cells (HUVECs) obtained from
American Type Culture Collection (Manassas, VA) were cultured in
endothelial cell medium (ECM; ScienCell Research Laboratories, Carls-
bad, CA) at 37
C under a 5% CO2 atmosphere. ECM Gel Solution (Cell
Biolabs, San Diego, CA) of 50 mL was poured onto a 96-well culture plate
and were allowed to solidify (37
C, 1 hour). HUVECs (1.5  104 cells/
well) were seeded on the ECM gel and cultured with condition medium
obtained from CSC-treated HDPCs for 3 days. After 12 hours, tube forma-
tion was observed and quantified under a light microscope.
Statistical Analysis
Differences among groups were analyzed using 1-way analysis of
variance combined with the Bonferroni test. All values were expressed
as mean  standard deviation, and differences were considered signif-
icant at P < .05.
Results
Effects of CSCs on Odontoblastic
Differentiation of HDPCs
To investigate the effects of CSCs on the odontoblastic differen-
tiation of HDPCs, the ALP activity, formation of mineralized nodules,
Basic Research—Technology
and expression of odontoblast-related marker genes were measured.
ALP activity and the formation of mineralized nodules were both
increased with all CSCs but decreased with IRM (Fig. 1A and C).
The most intense ALP activity and biomineralization were exhibited
by the PMTA, MMTA, and ECSC groups at 7 and 14 days. In addition,
all CSC materials were shown to up-regulate the messenger RNA
(mRNA) expression of odontogenic markers such as osteonectin
(ON), osteopontin (OPN), osteocalcin (OCN), dentin sialophospho-
protein (DSPP), and dentin matrix protein 1 (DMP-1) at 14 days
(Fig. 1B). PMTA, MMTA, and ECSC showed similarly high levels of
mRNA expression compared with the RMTA-treated groups. However,
the expression of the marker genes in the IRM group were markedly
less compared with the other groups.
Effects of CSCs on In Vitro Angiogenesis
To examine the effects of CSCs on in vitro angiogenesis, mRNA
expression of angiogenic factors in CSC-treated HDPCs and capillary-
like structures formations in condition medium–treated HUVEC cells
were examined (Fig. 2). The results showed that all CSCs increased
the mRNA expression of vascular endothelial growth factor (VEGF),
fibroblast growth factor 2, and angiopoietin 1 (Ang-1) (Fig. 2A)
as well as the formation of anastomosed networks of human endo-
thelial cell tubules (Fig. 2B). PMTA, MMTA, and ECSC induced a sig-
nificant increase in the expression of angiogenic genes and capillary
tube formation compared with RMTA (Fig. 2B and C).
Effects of CSCs on Inflammatory Effects
To evaluate the effect of CSCs on the inflammatory effects, the
protein expression of inducible NO synthase and cyclooxygenase-2
(COX-2), which catalyzes the release of NO and PGE2, was exam-
ined in CSC-treated HDPCs. As shown in Figure 3A, the expressions
of iNOS and COX-2 were similar among the CSCs; however, these
levels were higher in the IRM group than in the CSC groups. The
same results were obtained for the production of proinflammatory
mediators NO and PGE2 (Fig. 3B and C). Moreover, mRNA

Figure 1. The effect of CSCs on odontoblastic differentiation in HDPCs. Differentiation was determined by (A) ALP activity, (B) mRNA expression by RT-PCR, and (C
and D) mineralization nodule formation by alizarin red staining. (A–D) The cells were treated with an osteogenic supplement (OS) containing 50 mg/mL ascorbic
acid and 10 mmol/L b-glycerophosphate. (D) The histogram shows the quantification of mineralization by densitometry and is presented as fold increase compared
with nonstimulated control cells. These data are representative of 3 independent experiments. *Statistically significant difference compared with the control group
(P < .05). #Statistically significant difference compared with each group (P < .05).

JOE — Volume -, Number -, - 2015 Effects of Various CSCs on Differentiation 3

Basic Research—Technology
Figure 2. The effects of CSCs on in vitro angiogenesis in HDPCs. (A) The mRNA expression levels of angiogenic genes were examined by RT-PCR from a 3-day
culture of the HDPCs. Conditioned medium (CM) from the HDPCs was obtained by a 24-hour incubation period of CSCs. The angiogenic activity of CM was examined
via a tube formation assay in HUVEC cells. (B) HUVEC cells were cultured in CM for 18 hours, and (C) the tube numbers were counted and quantified. Data are
representative of 3 independent experiments. *Statistically significant difference compared with the control group (P < .05). #Statistically significant difference
compared between each group (P < .05).
expression levels of proinflammatory cytokines tumor necrosis fac-
tor alpha, interleukin (IL)-1b, IL-6, and IL-8 were similar among
the CSCs (Fig. 3D).
Discussion
The differentiation and angiogenesis of progenitor cells into odon-
toblastlike cells are critical in the pulp healing process (16), and
inducing differentiation and angiogenesis is required characteristics
of pulp capping materials. We recently reported that odontoblastic dif-
ferentiation of HDPCs was promoted by glutamine (17) and sodium tri-
and hexametaphosphate (18). In addition, we showed that simvastatin
and Emdogain (Biora AB, Malm€o, Sweden) improved cell growth and
the differentiation of the bismuth oxide containing Portland cement in
HDPCs (19). Moreover, the biocompatibility or inflammatory effects of
pulp capping materials are important to avoid or limit pulp tissue irri-
tation or degeneration. To our knowledge, this is the first study to
examine the angiogenic and odontogenic potential of HDPCs with the
newly developed RMTA, MMTA, and ECSC.
ALP activity is most often used as an early marker of odontoblastic
differentiation (20). In addition, the formation of mineral nodules and
mRNA expression of DMP-1, DSPP, ON, OCN, and OPN have been used
as markers of odontoblastic differentiation (21, 22). HDPCs in teeth can
differentiate into odontoblasts when cultured in an osteogenic medium,
even in the absence of dexamethasone, which is known to induce
differentiation (23, 24). In the present study, PMTA, MMTA, and
ECSC showed similar ALP activity, calcified nodule formation, and up-
regulation of odontoblastic markers such as ON, OPN, OCN, DSPP,
and DMP-1 in HDPCs compared with RMTA and IRM at 7 and
14 days. Interestingly, RMTA showed the lowest odontogenic potential
in the CSCs. These results are consistent with our previous study, which
reported similar odontoblastic differentiation between MMTA and
PMTA in HDPCs (10). The inorganic ions released from silicon-
4 Chang et al.
based materials have been found to influence cell proliferation and os-
teogenesis marker protein secretion (25).
Angiogenesis is a key step in the dental pulp healing sequence
that involves formation of the dentin bridge (16). This process is
regulated by the interplay of angiogenic factors such as VEGF
and fibroblast growth factor 2, which is essential for the odonto-
blast differentiation of immature pulp cells (20, 22). Ang-1 is
another family of growth factors that plays an important role in
vascular development (26). The secretion of angiogenic factors
such as von Willebrand factor and Ang-1 can be promoted through
the indirect contact of HDPCs with CSCs such as PMTA (27). HU-
VECs are a valuable model of in vitro angiogenesis because of their
ability to form capillarylike structures called ‘‘tubes’’ in response to
appropriate stimuli (28). Our results indicate that all CSCs up-
regulated angiogenic factors such as VEGF, fibroblast growth factor
2, and Ang-1 and enhanced the formation of capillarylike tubes,
which suggests that all CSCs induce angiogenic activity in vitro.
Moreover, PMTA, MMTA, and ECSC showed superior angiogenic
gene expression levels as well as HUVEC capillary tube formation
compared with RMTA. Therefore, PMTA, MMTA, and ECSC might
be suitable pulp capping materials.
MTA has been shown to be biocompatible and induces complete
dentin bridge formation with no signs of inflammation in human pulp
capping (5, 29). In contrast, PMTA has been shown to induce the
up-regulation of proinflammatory cytokines as well as iNOS and COX-
2 in subcutaneous tissue in mice (30). PGE2 and nitrite are downstream
products of arachidonic acid metabolism involving COX-2 and iNOS.
PMTA significantly increased IL-1b and IL-8 secretion in human neutro-
phils (15). In this study, all CSCs exhibited similar expression levels of
iNOS and COX2 as well as proinflammatory mediators such as NO, PGE2,
tumor necrosis factor alpha, IL-1b, IL-6, and IL-8 compared with IRM,
which suggests that all CSCs do not affect inflammatory mediators in
HDPCs. This result was consistent with our previous report that cytokine
JOE — Volume -, Number -, - 2015

Figure 3. The effects of CSCs on (A) iNOS and COX-2 expression, (B) NO, and (C) PGE2 levels, and (D) proinflammatory cytokine expression in HDPCs. The cells
were cultured with each material for 72 hours. These findings are representative of 3 independent experiments. *Statistically significant difference compared with
control (P < .05). #Statistically significant difference compared with each group (P < .05).
production or inflammatory response by CSCs such as PMTA and MMTA
was not found in HDPCs (10).
In summary, this study reports, for the first time, that PMTA,
MMTA, and ECSC exhibit superior odontogenic differentiation and
in vitro angiogenic potential compared with RMTA. These results sug-
gest that PMTA, MMTA, and ECSC can be useful for dental pulp capping.
Acknowledgments
Seok-Woo Chang and Won-Jung Bae contributed equally to
this study.
Supported by the National Research Foundation of Korea
(NRF) grant funded by the Korea government (MEST) (no.
2012R1A5A2051384).
The authors deny any conflicts of interest related to this study.
References
1. MSDS. Available at: www.tulsadentalspecialties.com. Accessed December 29, 2014.
2. Lee SJ, Monsef M, Torabinejad M. Sealing ability of a mineral trioxide aggregate for
repair of lateral root perforations. J Endod 1993;19:541–4.
3. Rafter M. Apexification: a review. Dent Traumatol 2005;21:1–8.
4. Park SJ, Heo SM, Hong SO, et al. Odontogenic effect of a fast-setting Pozzolan-based
pulp capping material. J Endod 2014;40:1124–31.
5. Min KS, Park HJ, Lee SK, et al. Effect of mineral trioxide aggregate on dentin bridge
formation and expression of dentin sialoprotein and heme oxygenase-1 in human
dental pulp. J Endod 2008;34:666–70.
6. Wongkornchaowalit N, Lertchirakarn V. Setting time and flowability of accelerated
Portland cement mixed with polycarboxylate superplasticizer. J Endod 2011;37:
387–9.
7. Chang SW, Lee SY, Ann HJ, et al. Effects of calcium silicate endodontic cements on
biocompatibility and mineralization-inducing potentials in human dental pulp cells.
J Endod 2014;40:1194–200.
JOE — Volume -, Number -, - 2015
Basic Research—Technology
8. Kum KY, Kim EC, Yoo YJ, et al. Trace metal contents of three tricalcium silicate ma-
terials: MTA Angelus, Micro Mega MTA and Bioaggregate. Int Endod J 2014;47:
704–10.
9. Available at: http://www.micro-mega.com. Accessed December 29, 2014.
10. Chang SW, Lee SY, Kum KY, Kim EC. Effects of ProRoot MTA, Bioaggregate, and Mi-
cromega MTA on odontoblastic differentiation in human dental pulp cells. J Endod
2014;40:113–8.
11. Available at: http://www.bioMTA.com. Accessed December 29, 2014.
12. Lovschall H, Illeman K, Schmidt OH, et al. Gillmore testing of initial setting time:
iMTA, Dycal, Biodentine, and MTA. Presented at IADR/PER. September 10–13,
2014, Dubrovnik, Croatia.
13. Hwang YC, Kim DH, Hwang IN, et al. Chemical constitution, physical properties, and
biocompatibility of experimentally manufactured Portland cement. J Endod 2011;
37:58–62.
14. Chang SW, Yoo HM, Park DS, et al. Ingredients and cytotoxicity of MTA and 3 kinds
of Portland cements. Restor Dent Endod 2008;33:369–76.
15. Kitagawa M, Ueda H, Iizuka S, et al. Immortalization and characterization of human
dental pulp cells with odontoblastic differentiation. Arch Oral Biol 2007;52:727–31.
16. Tran-Hung L, Mathieu S, About I. Role of human pulp fibroblasts in angiogenesis.
J Dent Res 2006;85:819–23.
17. Kim DS, Jue SS, Lee SY, et al. Effects of glutamine on proliferation, migration, and
differentiation of human dental pulp cells. J Endod 2014;40:1087–94.
18. Bae WJ, Jue SS, Kim SY, et al. Effects of sodium tri- and hexametaphosphate on pro-
liferation, differentiation, and angiogenic potential of human dental pulp cells.
J Endod 2015;41:896–902.
19. Lee SY, Min KS, Choi GW, et al. Effects of simvastain and enamel matrix derivative on
Portland cement with bismuth oxide-induced growth and odontoblastic differentia-
tion in human dental pulp cells. J Endod 2012;38:405–10.
20. Min KS, Lee YM, Hong SO, Kim EC. Simvastatin promotes odontoblastic differentia-
tion and expression of angiogenic factors via heme oxygenase-1 in primary cultured
human dental pulp cells. J Endod 2010;36:447–52.
21. Kim EC, Lee HJ, Kim Y. Lysyl oxidase and the lysyl oxidase-like protein modulate
odontoblastic differentiation of human dental pulp cells. J Endod 2012;38:769–73.
22. Kim JJ, Kim SJ, Kim YS, et al. The role of SIRT1 on angiogenic and odontogenic
potential in human dental pulp cells. J Endod 2012;38:899–906.
23. Kim YS, Min KS, Jeong DH, et al. Effects of fibroblast growth factor-2 on the expres-
sion and regulation of chemokines in human dental pulp cells. J Endod 2010;36:
1824–30.
Effects of Various CSCs on Differentiation 5
Basic Research—Technology
24. Lee SY, Kim SY, Park SH, et al. Effects of recombinant dentin sialoprotein in dental
pulp cells. J Dent Res 2012;91:407–12.
25. Mladenovic Z, Johansson A, Willman B, et al. Soluble silica inhibits osteoclast for-
mation and bone resorption in vitro. Acta Biomater 2014;10:406–18.
26. Miller TW, Isenberg JS, Roberts DD. Molecular regulation of tumor angiogenesis
and perfusion via redox signaling. Chem Rev 2009;109:3099–124.
27. Chou MY, Kao CT, Hung CJ, et al. Role of the P38 pathway in calcium silicate cement-
induced cell viability and angiogenesis-related proteins of human dental pulp cell
in vitro. J Endod 2014;40:818–24.
6 Chang et al.
28. Matsui J, Wakabayashi T, Asada M, et al. Stem cell factor/c-kit signaling promotes the
survival, migration, and capillary tube formation of human umbilical vein endothe-
lial cells. J Biol Chem 2004;279:18600–7.
29. Nowicka A, Lipski M, Parafiniuk M, et al. Response of human dental pulp
capped with biodentine and mineral trioxide aggregate. J Endod 2013;39:
743–7.
30. Reyes-Carmona JF, Santos AS, Figueiredo CP, et al. Host-mineral trioxide aggregate
inflammatory molecular signaling and biomineralization ability. J Endod 2010;36:
1347–53.
JOE — Volume -, Number -, - 2015