See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/41850042

An improved transconjugation protocol for Bacillus megaterium facilitating a

direct genetic knockout

Article  in  Applied Microbiology and Biotechnology · March 2010

DOI: 10.1007/s00253-010-2503-9 · Source: PubMed

CITATIONS READS

14 900

3 authors, including:

Michael Larsen Friedhelm Meinhardt

Technologiehof Münster University of Münster
16 PUBLICATIONS   380 CITATIONS    198 PUBLICATIONS   4,335 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Cell growth control by tRNase ribotoxins View project

Bio-process and Enzymes Production View project

All content following this page was uploaded by Friedhelm Meinhardt on 07 April 2015.

The user has requested enhancement of the downloaded file.

Appl Microbiol Biotechnol (2010) 86:1959–1965
DOI 10.1007/s00253-010-2503-9
METHODS AND PROTOCOLS
An improved transconjugation protocol for Bacillus
megaterium facilitating a direct genetic knockout
Janine Richhardt & Michael Larsen &
Friedhelm Meinhardt
Received: 20 January 2010 / Revised: 8 February 2010 / Accepted: 9 February 2010 / Published online: 10 March 2010
# Springer-Verlag 2010
Abstract We provide a simple but very efficient trans-
conjugation protocol for Bacillus megaterium. By combining
utile attributes of known transconjugation methods (small
size of the transferred DNA, close physical contact between
donor and recipient cells, and heat treatment of the latter) and
by determining the appropriate donor/recipient ratio, mating
approaches yielded 5 × 10−5 transconjugants/recipient.
Counter-selection for eliminating Escherichia coli donor
cells from the mating mixture was possible by pasteurization
in case a wild type sporulation proficient B. megaterium
served as the mating partner. For nonsporulating mutants, the
sacB gene from Bacillus subtilis coding for levansucrase was
successfully employed to select against the E. coli donor.
The transfer efficiency, up to 15,000 transconjugants
acquirable in a single experiment, sufficed—for the first
time in this species—to directly select a gene (uvrA)
knockout in a one-step procedure. By making use of a
mobilizable B. megaterium suicide vector, ten out of the 40
sampled putative transconjugants displayed the expected UV
sensitivity and were found to harbor the suicide vector at the
anticipated position. Along with the soon available informa-
tion arising from current B. megaterium sequencing projects,
the possibility to quickly inactivate genetic loci will
considerably speed up genetic work with this biotechnolog-
ically relevant species.
J. Richhardt : M. Larsen : F. Meinhardt (*)
Institut für Molekulare Mikrobiologie und Biotechnologie,
Westfälische Wilhelms Universität Münster,
Corrensstr. 3,
48149 Münster, Germany
e-mail: meinhar@uni-muenster.de
Keywords Bacillus megaterium . Transconjugation . sacB
counter-selection . Suicide vector . Direct gene knockout
Introduction
Among the Gram-positive, endospore-forming bacteria,
Bacillus subtilis is the most thoroughly researched organ-
ism. However, in terms of application, other members of
the genus such as Bacillus licheniformis and Bacillus
megaterium outrange this well-studied microbiological
model object. Already for a couple of decades, the latter,
rather widespread bacterial species is of biotechnological
interest (Vary 1994). Vitamins and diagnostic as well as
industrial enzymes are among the most prominent products
(Raux et al. 1998; Brümmer and Ebeling 1976; Martin et al.
1995). Since B. megaterium stably maintains plasmids and
does not produce alkaline proteases, it has been considered
to be ideally suited for production of homologous and
heterologous extracellular proteins (Sussman et al. 1988;
Meinhardt et al. 1989; Malten et al. 2005a).
Vector systems for inducible high-level expression using the
regulatory elements of the xylose-utilization operon are avail-
able (Rygus and Hillen 1991) and have been modified,
optimized, and marketed for recombinant gene expression
(Malten et al. 2005a, b; Biedendieck et al. 2007). For a broader
application in industry, sporulation and protease-deficient
mutants as well as UV-sensitive strains were generated
(Meinhardt et al. 1994; Wittchen et al. 1998; Wittchen and
Meinhardt 1995; Nahrstedt and Meinhardt 2004). Other useful
mutants such as strains lacking β-galactosidase (Rygus et al.
1991; Strey et al. 1999) and amylase activity (Lee et al. 2001)
are also at hand. For a compilation of disposable mutants and a
1960
general survey covering the biology as well as the industrial
significance of B. megaterium, we refer to a recent review by
Vary et al. (2007).
Currently, the genome sequences of three B. megaterium
strains (QM B1551, NAS7-L, and DSM319) are being
established and annotated (Sun et al. 2006, NCBI genome
projects with ID numbers: 42425, 41713, and 30165; http://
www.prodoric.de/megabac). As for other industrially
exploited members of the genus such as B. licheniformis,
the knowledge of the genome sequence (Rey et al. 2004;
Veith et al. 2004) will enhance the usefulness of B.
megaterium as an expression host and at the same time
will widely open the door for further strain development
and improvements by genetic engineering.
However, there is a major drawback severely impeding
genetic work with B. megaterium, it is the poor transforma-
tion efficiency. Though a functional comE-gene as part of the
DNA-uptake machinery exists (Lammers et al. 2004), B.
megaterium does not or only extremely poorly develop
natural competence. Hence, DNA transfer is commonly
achieved by protoplast transformation or, less frequent, by
biolistic bombardment (Brown and Carlton 1980; Vorobjeva
et al. 1980; Shark et al. 1991). Also, a conjugative approach
making use of pLS20 from B. subtilis (natto) yielded very
few transconjugants only (Koehler and Thorne 1987). In
addition, from the above sequencing projects, there is no
evidence for a DNA-restriction and -modification system
which, when knocked out, would help to enhance trans-
formability as for B. licheniformis (Waschkau et al. 2008).
Thus, the generation of mutants by the targeted integration of
marker genes and/or deletions still is a tedious and rather
cumbersome process that comprises several cultivation steps:
(1) to establish a plasmid-carrying transformant, (2) to
integrate the plasmid-borne disrupted or the deletion-
carrying copy into the respective chromosomal gene, (3) to
search for the possible different subsequent recombination
events by polymerase chain reaction (PCR), (4) to cure the
vector from the cells, and (5) to finally check the phenotype
as well as the genotype of an anticipated mutant.
To resolve such bottleneck in genetic manipulation of B.
megaterium, we improved the efficiency of a transconju-
gation procedure based on a method previously established
for Lysinibacillus sphaericus (Aquino de Muro and Priest
2000). Achieved improvements eventually allowed the
direct knockout of a gene in a one-step procedure.
Counter-selection to get rid of the Escherichia coli donor
from the mating mixture is routinely performed by
pasteurization, which leaves Bacillus spores unaffected.
However, in industrial applications, sporeless mutants are
routinely employed and that is why we concomitantly
applied an alternative counter-selection system based on the
B. subtilis sacB gene (Gay et al. 1985) to eliminate the E.
coli donor cells after mating.
Appl Microbiol Biotechnol (2010) 86:1959–1965
Materials and methods
Strains and growth conditions
The bacterial strains and plasmids used in this study are listed
in Table 1. Strains were grown at 37°C in Luria–Bertani
(LB) broth unless stated otherwise. To ensure plasmid-
maintenance in E. coli and Bacillus strains, antibiotics were
added to the media (chloramphenicol: 5 µg/ml for Bacilli
and 15 µg/ml for E. coli or ampicillin, 100 µg/ml).
Erythromycin (5 and 0.4 µg/ml) was used for the differen-
tiation between multiple and single copy (integrated vector)
situations.
Cloning in E. coli was performed essentially as
described in Sambrook and Russell (2001). Chloramphen-
icol resistance in E. coli was induced by adding chloram-
phenicol (0.5 µg/ml) subsequent to the 30-min regeneration
at 37°C that followed the heat shock (42°C); cells were
further kept for 30 min at 37°C (Winshell and Shaw 1969).
Plasmid DNA was purified using the “peqGOLD
Plasmid Miniprep Kit II” (peqlab Biotechnologie GmbH,
Erlangen, Germany) for E. coli and the “JETQuick Plasmid
Miniprep Spin Kit” (Genomed GmbH, Löhne, Germany)
for Bacillus. Genomic Bacillus DNA was isolated as
described in Gärtner et al. (1988).
PCR reactions contained 200 µM dNTPs, 100 ng template
DNA, 100 pmol of each primer, and 1 U of Taq DNA
polymerase (Eppendorf AG, Hamburg, Germany) or Phu-
sion DNA polymerase (Finnzymes Oy, Espoo, Finland). The
PCR primers (Invitrogen, Karlsruhe, Germany) used in this
study are listed in Table 2. Purification of amplified
fragments after gel electrophoresis was performed with the
“QIAquick Gel Extraction Kit” (Qiagen, Hilden, Germany).
Optimized conjugation protocol for B. megaterium
DSM319
The conjugation protocol established by Aquino de Muro
and Priest (2000) was optimized and adjusted to the donor
strain E. coli S17-1 carrying the mobilizable vector pJR1
(for construction see below) and B. megaterium DSM319.
Bacillus cells were grown in LB broth, and E. coli S17-1
pJR1 was cultivated in LB broth containing chloramphen-
icol; cultivations were performed at 37°C overnight.
Separate 250-ml Erlenmeyer flasks each containing 50 ml
LB medium were subsequently inoculated with 1 ml of the
above overnight Bacillus and E. coli S17-1 pJR1 cultures
and grown at 37°C until an OD600 nm of 0.6–0.8 was
reached. Cells were harvested by centrifugation (15 min,
3,220×g, 4°C), washed twice in 15 ml holding buffer
(12.5 mM KH2PO4, 12.5 mM K2HPO4, 1 mM MgSO4, pH
7.2), pelleted by centrifugation (15 min, 3,220×g, 4°C), and
resuspended in 30 ml holding buffer. Bacillus cells were
Appl Microbiol Biotechnol (2010) 86:1959–1965 1961

Table 1 Bacteria and plasmids used in this study

Strain or plasmid Description Source/reference

Strains
E. coli DH5αF′ endA1, hsdR17 (rk−, mk+), supE44, thi-1, Woodcock et al. 1989
recA1, gyrA96, relA1, Δ(lacIZYA-argF),
U169, deoR, F′(Φ80dlacZΔ(lacZ)M15)
E. coli S17-1 ΔrecA, endA1, hsdR17, supE44, thi-1, tra+ Simon et al. 1983
B. subtilis DB104 his, nprR2, nprE18, apr∆3 Kawamura and Doi 1984
B. megaterium DSM319 Wild type Hunger and Claus 1981; Stahl and Esser 1983
B. megaterium MS011 B. megaterium DSM319 ΔuvrA::bgl Nahrstedt and Meinhardt 2004
Plasmids
pC194 rep, CamR, ori Bacillus Horinouchi and Weisblum 1982
pBBR1MCS-3 mob, rep, lacZ, TcR Kovach et al. 1995
pUCTV2 E. coli/Bacillus shuttle vector; ApR, TcR, and orits Wittchen and Meinhardt 1995
pDUVRAbgl pUCTV2 with part of uvrA disrupted by deletion Nahrstedt and Meinhardt 2004
and insertion of bgl
pSKE194 E. coli/Bacillus shuttle vector; ApR, EmR, and orits Nahrstedt et al. 2005
pJRSu1 Mobilizable suicide vector, CamR, mob, oriT, rep This work
pJR1 Mobilizable vector; CamR, mob, oriT, orits, sacB, rep This work
pJRSu_uvrAerm uvrA-disruption vector This work

subjected to heat treatment (9 min at 49°C) prior to mixing
with the E. coli S17-1 pJR1 donor cells. The optimal mixing
ratio of donor/recipient cells is 1:2. The mixture was then
compressed on a sterile nitrocellulose filter with a pore size
of 0.45 µm to ensure close contact between donor and
recipient cells. According to the respective requirements for
counter-selection, the filter was either placed on LB or on
sporulation agar (Schaeffer et al. 1965) with the cells
forming the top layer. Filter mating was either performed
for 24 h at 30°C on LB agar or for 48 h at 30°C on
sporulation agar.
partners was placed on the sporulation medium and
incubated for 2 days at 30°C to ensure complete sporula-
tion. Cells were subsequently suspended in 900 µl holding
buffer and incubated for 20 min at 80°C, and then spread
on LB agar plates containing chloramphenicol. For deter-
mining conjugation efficiencies, cells were spread in
dilutions (10−5 to 10−7) on LB agar plates and incubated
for 24 h at 37°C. Conjugation efficiencies were calculated
as the number of Bacillus transconjugants divided by the
whole number of Bacillus spores determined as colony
forming units after the heat treatment (80°C).

Counter-selection by pasteurization Counter-selection by the sacB suicide system

When sporulating Bacillus strains were used in matings, the The mating-filter was incubated on LB agar for 24 h at 30°C.
counter-selection against E. coli was done by pasteuriza- As described above, cells were resuspended by soaking the
tion. For such purpose, the filter with the mixed mating filter in 900 µl holding buffer and plated on sucrose medium

Table 2 Polymerase chain reac-

tion primers used in this study Oligonucleotides 5′→3′ sequence

Generated restriction sites are
underlined and written in italics
pC194_1110 AACGAAAATTGGATAAAGTGGG
pC194_1970_1/2 EcoICRI CTCGGGGCAGGTTAGTGACATTA
sacB_679 TGCCCATGCAACAGAAAC
sacB_2682_1/2 EcoICRI CTCAATGATATGCCGCCCGGTAG
pE194_728 CGGTTGCAAAGCTCTAGG
pE194_1926_1/2 EcoICRI CTCGCAGTCGGCTTAAACCAG
uvrA_IntA_forw ACCTAACTCTCCGTCGCTATTG
uvrA_IntB_rev AAGTCCAGCGCCAGAAAC
uvrA_9_rev TATCGTTTGCCGTGGCAGAC
uvrA7 AAATGAAAGAAGCAGCCAAAGCGC
1962
containing chloramphenicol (10 g/l peptone, 5 g/l yeast
extract, pH7.4; to which the sucrose was added to a final
concentration of 10% after autoclaving). Plates were subse-
quently incubated for 20–24 h at 30°C. As no single colonies
but a lawn of cells was obtained, the lawn was resuspended in
3 ml holding buffer and again spread on sucrose medium to
obtain single colonies which could be visualized after an
incubation time of 20–24 h at 30°C.
Pheno- and genotypic analysis of knockout mutants
For the phenotypic analysis of UV-sensitive direct knockout
mutants, which were intended to arise by integration of the
erythromycin resistance gene into the uvrA locus, a drop-
dilution assay was performed. Cells were grown overnight
in LB broth containing 0.4 µg/ml erythromycin. The
OD546 nm of all cultures was adjusted to the same level,
and serial dilutions were dropped on LB agar plates. After
UV irradiation (50 J/m2), plates were incubated overnight in
the dark. A genotypic analysis of the knockout mutants was
performed by PCR using primers uvrA_9_rev/uvrA7 and
uvrA_9_rev/uvrA_IntA_forw.
Results
Vector construction
Conjugative DNA transfer needs mobilizable vectors
which, in this study, were based on pBRR1-MCS3 (Kovach
et al. 1995). To keep the vector as small as possible in size,
a selection marker was chosen that is functional in E. coli
a PstI
EcoRI
PstI
SmaI
BamHI
SpeI
XbaI
mob
cat
oriT
pJRSu1
4405 bps
EcoICRI
rep
Fig. 1 Schematic representation of mobilizable suicide plasmid
(pJRSu1) for Bacillus megaterium and the corresponding replicating
temperature-sensitive plasmid (pJR1). Genes are given as arrows, the
orientation of which corresponds to the transcriptional direction. Gene
description: cat, encoding chloramphenicol acetyltransferase; mob,
encoding the mobilization protein; oriT, origin of transfer; rep,
Appl Microbiol Biotechnol (2010) 86:1959–1965
and in several members of the genus Bacillus. Therefore,
the chloramphenicol resistance gene from plasmid pC194
(Horinouchi and Weisblum 1982) was amplified using
primers pC194_1110 and pC194_1970_l/2EcoICRI. After
cloning it into the EcoICRI site, the tetracycline resistance
gene of pBBR1MCS3 was deleted by EcoRI restriction and
religation of the vector achieving the suicide vector pJRSu1
(Fig. 1a). The temperature-sensitive origin of replication for
Bacillus was amplified from the plasmid pUCTV2 using
primer pair pE194_728/pE194_1926_l/2EcoICRI and ligat-
ed into the EcoICRI restricted vector pJRSu1. Furthermore,
to ensure counter-selection in matings with sporulation-
deficient Bacillus recipients, the sacB gene of B. subtilis
was amplified (primers sacB_679/sacB_2682) and cloned
into the EcoNI restricted vector eventually resulting in
pJR1 (Fig. 1b).
As a target for the exemplary direct knockout of a gene,
the uvrA locus was chosen because the anticipated
phenotype of the respective mutant can easily be moni-
tored. The corresponding knockout cartridge was based on
a previously constructed vector (pDUVRAbgl, Nahrstedt
and Meinhardt 2004) in which the bgl-gene of Paeniba-
cillus macerans is flanked by uvrA sequences serving as
recombination sites. Applying the above recombination
flanks by exchanging the bgl-gene with ermC gene of
pSKE194, the uvrA targeted erythromycin-resistant select-
able suicide plasmid (pJRSu_uvrAerm) was constructed.
Optimization of the conjugational transfer
E. coli S17-1 was transformed with the vector pJR1 and
subsequently served as the donor strain in matings with
b
SmaI
BamHI
SpeI
XbaI
mob
cat
EcoICRI
oriT
ori Bacillus pJR1
7616 bps rep
sacB
replication function for Escherichia coli; ori Bacillus, origin of
replication from plasmid pUCTV2; sacB, gene of Bacillus subtilis
coding for levansucrase. Selected sites for restriction enzymes are
marked and abbreviated as such. Due to the cloning approach which
was based on polymerase chain reaction strategy, there is only one
EcoICRI site in each of the plasmids
Appl Microbiol Biotechnol (2010) 86:1959–1965 1963

several Bacillus species. In addition to B. megaterium, we

successfully transconjugated B. licheniformis and Bacillus
pumilus strains which took up and stably maintained the
vector at the permissive temperature (data not shown).
When the sacB counter-selection system was employed,
less than 1% of the putative transconjugants were found to
react as Gram-negative cells in the KOH tests applied to
determine the number of donor and recipient cells after
mating.
Since at the beginning the number of transconjugants was
in the same range as previously described (10−7 to 10−9 for L.
sphaericus, Aquino de Muro and Priest 2000), we optimized
the protocol by making use of B. megaterium DSM319 as
the recipient and pJR1 as the mobilizable plasmid. The
optimal yield of transconjugants (up to 5×10−5 per recipient)
was eventually obtained following the procedure outlined in
“Materials and methods.” The heat treatment (9 min, 49°C)
of the recipient prior to the mating is crucial as it led to a
significant increase (×10) in the number of transconjugants.
OD600 values outside the given range as well as other mixing Fig. 2 Drop-dilution assay, performed with an uvrA-insertion mutant
ratios (donor/recipient) negatively influenced the outcome (mut) obtained after conjugational transfer. wt, Bacillus megaterium
DSM319, +, B. megaterium MS011 ΔuvrBA as the positive control
(data not shown). Routinely, 10,000 to 15,000 transconju- (Nahrstedt and Meinhardt 2004). The OD600 of all strains was
gants were obtained in the experiments performed under adjusted to the same level prior to irradiation. Undiluted (100) and
these conditions. serial dilutions were dropped on LB agar and irradiated with UV light
(254 nm) with the indicated fluence of 50 J/m2
Direct knockout
phase by compressing them on the surface of a sterile filter
The results of the above optimization work prompted us to disk as previously proposed for L. sphaericus (Aquino de
perform experiments to check whether it is possible to Muro and Priest 2000) and allowed matings to proceed for at
directly select a B. megaterium knockout mutant. For this least 24 h. The efficiency of the transfer (2–5×10−5) is
purpose, the suicide vector pJRSu_uvrAerm was applied in several orders of magnitude below the levels in E. coli
matings with B. megaterium DSM 319 as the recipient. intraspecies conjugation experiments using a pBBR1 deriv-
In four independently performed mating experiments, ative (up to 5×10−1, Szpirer et al. 2000) but is in good
eight to 12 erythromycin-resistant B. megaterium colonies accordance with values known for conjugal transfers with
were obtained from a resuspended plate. Forty randomly
chosen putative transconjugants were phenotypically ana-
B. megaterium DSM319 uvrA7 uvrA_9_rev
lyzed for UV sensitivity in a drop-dilution assay; ten out of
uvrBA-operon Fl A Fl B
these displayed UV sensitivity (see Fig. 2) due to the uvrB uvrA
integration of the vector into the bacterial uvrA locus which uvrA_IntB_rev
was proven by PCR-analysis and Southern-blotting (data uvrA_IntA_forw
Integrant A uvrA7 uvrA_9_rev
not shown). Both possible orientations (see Fig. 3), given as ermC mob oriT REP cat
integrant A and B, respectively, were found. Fl A Fl B Fl A Fl B
uvrB uvrA' 'uvrA
uvrA_IntB_rev
uvrA_IntA_forw
uvrA7 uvrA_9_rev
Discussion Integrant B mob oriT REP cat ermC
Fl A Fl B Fl A Fl B
uvrB uvrA' 'uvrA
Transfer of plasmids between bacteria by conjugation requires
cell contact between the donor and the recipient cell as well as Fig. 3 Schematic representation of the uvrBA operon of Bacillus
DNA metabolism (see a recent review about bacterial megaterium DSM319 and anticipated orientations (integrants A
conjugation by Llosa et al. 2002). To meet such requirement and B). Locations of the recombination flanks as in pJRSu_uv-
rAerm are indicated. Depending on the recombination flank
in our conjugation experiments, we brought into close involved in homologous recombination, either the orientation as
physical contact metabolically active donor and recipient in integrant A or B is to be anticipated. Positions of primers listed
bacteria, which have been grown to the mid-exponential in Table 2 are indicated
1964
other Gram-positive recipients (Aquino de Muro and Priest
2000; Ha et al. 2008; Schäfer et al. 1990; Strätz et al. 1994).
In addition to checking cultural parameters aiming at
optimizing the conjugal transfer to B. megaterium
DSM319, we found that a specific heat treatment of
recipient cells immediately prior to the filter mating
considerably enhanced the conjugal transfer to a rather
high level (factor 10). For Corynebacterium glutamicum,
such heat treatment was found to inactivate restriction
endonucleases making plausible the observed positive
effect on transconjugation efficiency (Schäfer et al. 1990).
However, to the best of our knowledge, there is no evidence
for restriction endonucleases in B. megaterium DSM319,
but the positive effect on transconjugation is undeniable.
Since growth of B. megaterium is already hampered at
temperatures above 42°C (Prasad and Chaloupka 1983), it
is conceivable that cells are severely threatened when
exposed to temperatures up to 49°C for 9 min. Presumably,
a panoply of different heat-induced damages such as
increased membrane fluidity and stress responses such as
the increased formation of chaperones contribute to the
observed outcome not only in B. megaterium but in other
bacteria such as C. glutamicum as well.
Spore-forming bacteria offer the possibility to kill the E.
coli donor cells after the mating by pasteurization making
elegantly and simply possible the discrimination and
isolation of transconjugants (Aquino de Muro and Priest
2000). As in industrial applications spore-forming producer
strains have a number of disadvantages (such as the
problems arising from inefficient sterilization, product
contamination, and costly product purification), sporeless
mutants are routinely employed. The sacB gene encodes
levansucrase, which is secreted by B. subtilis and other
Bacilli when cultivated on sucrose-containing media. The
enzyme catalyzes transfructorylation to various acceptors,
which severely damages Gram-negative bacteria where the
enzyme is secreted to the periplasm. Since the action of
levansucrase is lethal for E. coli (Gay et al. 1985), it is
rather frequently used as means to select against E. coli
cells. Here, we proved that B. megaterium transconjugants
can be freed from contaminating E. coli donor cells by
applying the levansucrase counter-selection procedure.
Anyway, the highly efficient conjugative transfer of
DNA developed in this study facilitated the first direct gene
knockout in B. megaterium. For scientific purposes, the
system suffices to functionally analyze a gene by knocking
it out, although the number of available marker genes
clearly limits its application. To resolve such limitation and
for industrial applications, it is recommended to make use
of deletion cartridges that contain an antibiotic resistance
gene as the selective trait as well as a gene that is
conditionally lethal for B. megaterium, such as uracil
phosphoribosyl-transferase encoding gene in B. subtilis
Appl Microbiol Biotechnol (2010) 86:1959–1965
(Fabret et al. 2002). Along with the soon available
annotated genome sequences of the three B. megaterium
strains mentioned above, the transconjugation protocol
developed in this study will tremendously speed up genetic
work and strain improvement in this industrially important
bacterial species.
Acknowledgement The work was supported by the Federal Ministry
of Education and Research (BMBF, Bonn-Bad Godesberg, Germany)
Grant No. 0315283.
References
Aquino de Muro M, Priest FG (2000) Construction of chromosomal
integrants of Bacillus sphaericus 2362 by conjugation with
Escherichia coli. Res Microbiol 151:547–555
Biedendieck R, Yang Y, Deckwer WD, Malten M, Jahn D (2007)
Plasmid system for the intracellular production and purification
of affinity tagged proteins in Bacillus megaterium. Biotechnol
Bioeng 96:525–537
Brown BJ, Carlton BC (1980) Plasmid-mediated transformation in
Bacillus megaterium. J Bacteriol 142:508–512
Brümmer W, Ebeling W (1976) Eigenschaften und Anwendungen der
Glucosedehydrogenase. Kontakte (MERCK) 2:3–7
Fabret C, Ehrlich SD, Noirot P (2002) A new mutation delivery
system for genome-scale approaches in Bacillus subtilis. Mol
Microbiol 46:25–36
Gärtner D, Geissendörfer M, Hillen W (1988) Expression of the
Bacillus subtilis xyl operon is repressed at the level of
transcription and is induced by xylose. J Bacteriol 1707:3102–
3109
Gay P, Le Coq D, Steinmetz M, Berkelman T, Kado CI (1985)
Positive selection procedure for entrapment of insertion
sequence elements in gram-negative bacteria. J Bacteriol
164:918–921
Ha HS, Hwang YI, Choi SU (2008) Application of conjugation using
phiC31 att/int system for Actinoplanes teichomyceticus, a
producer of teicoplanin. Biotechnol Lett 30:1233–1238
Horinouchi S, Weisblum B (1982) Nucleotide sequence and functional
map of pC194, a plasmid that specifies inducible chloramphen-
icol resistance. J Bacteriol 150:815–825
Hunger W, Claus D (1981) Taxonomic studies on Bacillus mega-
terium and on agarolytic Bacillus strains. In: Berkeley RCW,
Goodfellow M (eds) The aerobic endospore-forming bacteria:
classification and identification. Academic, London, pp 217–239
Kawamura F, Doi RH (1984) Construction of a Bacillus subtilis
double mutant deficient in extracellular alkaline and neutral
proteases. J Bacteriol 160:442–444
Koehler TM, Thorne CB (1987) B. subtilis (natto) plasmid pLS20
mediates interspecies plasmid transfer. J Bacteriol 169:5271–
5278
Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RM
2nd, Peterson KM (1995) Four new derivatives of the broad-
host-range cloning vector pBBR1MCS, carrying different
antibiotic-resistance cassettes. Gene 166:175–176
Lammers M, Nahrstedt H, Meinhardt F (2004) The Bacillus mega-
terium comE locus encodes a functional DNA uptake protein. J
Basic Microbiol 44:451–458
Lee JS, Wittchen KD, Stahl C, Strey J, Meinhardt F (2001) Cloning,
expression, and carbon catabolite repression of the bamM gene
encoding β-Amylase of Bacillus megaterium. Appl Microbiol
Biotechnol 56:205–211
Appl Microbiol Biotechnol (2010) 86:1959–1965
Llosa M, Gomis-Rüth FX, Coll M, de la Cruz F (2002) Bacterial
conjugation: a two-step mechanism for DNA transport. Mol
Microbiol 45:1–8
Malten M, Hollmann R, Deckwer WD, Jahn D (2005a) Production and
secretion of recombinant Leuconostoc mesenteroides dextransu-
crase in Bacillus megaterium. Biotechnol Bioeng 89:206–218
Malten M, Nahrstedt H, Meinhardt F, Jahn D (2005b) Coexpression of
the type I signal peptidase gene sipM increases recombinant
protein production and export in Bacillus megaterium MS 941.
Biotechnol Bioeng 91:616–621
Martin L, Prieto MA, Cortes E, Garcia JL (1995) Cloning and
sequencing of the pac gene encoding the penicillin-G-acylase of
Bacillus megaterium ATCC 14945. FEMS Microbiol Lett
125:287–292
Meinhardt F, Stahl U, Ebeling W (1989) Highly efficient expression of
homologous and heterologous genes in Bacillus megaterium.
Appl Microbiol Biotechnol 30:343–350
Meinhardt F, Busskamp M, Wittchen KD (1994) Cloning and
sequencing of the leuC and nprM genes and a putative spoIV
gene from Bacillus megaterium DSM 319. Appl Microbiol
Biotechnol 41:344–351
Nahrstedt H, Meinhardt F (2004) Structural and functional character-
ization of the Bacillus megaterium uvrBA locus and generation of
UV-sensitive mutants. Appl Microbiol Biotechnol 65:193–199
Nahrstedt H, Schröder C, Meinhardt F (2005) Evidence for two recA
genes mediating DNA repair in Bacillus megaterium. Microbi-
ology 151:775–787
Prasad R, Chaloupka J (1983) Combined effect of temperature and
nutrients on protein turnover in Bacillus megaterium. Folia
Microbiol 28:46–50
Raux E, Warren LA, MJ RA, Thermes C (1998) Cobalamin (vitamin
B 12) biosynthesis: identification and characterisation of a
Bacillus megaterium cobI operon. Biochem J 335:159–166
Rey MW, Ramaiya P, Nelson BA, Brody-Karpin SD, Zaretsky EJ,
Tang M, Lopet de Leon A, Xiang H, Gusti V, Clausen IG, Olsen
PB, Rasmussen MD, Andersen JT, Jorgensen PL, Larsen TS,
Sorokin A, Bolotin A, Lapidus A, Galleron N, Ehrlich SD, Berka
RM (2004) Complete genome sequence of the industrial
bacterium Bacillus licheniformis and comparisons with closely
related Bacillus species. Genome Biol 5:R77
Rygus T, Hillen W (1991) Inducible high-level expression of
heterologous genes in Bacillus megaterium using the regulatory
elements of the xylose-utilization operon. Appl Microbiol
Biotechnol 35:594–599
Rygus T, Scheler A, Allmannsberger A, Hillen W (1991) Molecular
cloning, structure promoters, and regulatory elements for tran-
scription of the Bacillus megaterium encoded regulon for xylose
utilization. Arch Microbiol 155:535–542
Sambrook J, Russell DW (2001) Molecular cloning: a laboratory
manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor
Schaeffer P, Millet J, Aubert JP (1965) Catabolic repression of
bacterial sporulation. Proc Natl Acad Sci USA 54:704–711
Schäfer A, Kalinowski J, Simon R, Seep-Feldhaus AH, Pühler A
(1990) High-frequency conjugal plasmid transfer from gram-
negative Escherichia coli to various gram-positive coryneform
bacteria. J Bacteriol 172:1663–1666
View publication stats
1965
Shark KB, Smith FD, Harpending PR, Rasmussen JL, Sanford JC
(1991) Biolistic transformation of a procaryote, Bacillus mega-
terium. Appl Environ Microbiol 57:480–485
Simon R, Priefer U, Pühler A (1983) A broad range mobilization
system for in vivo genetic engineering: transposon mutagenesis in
Gram-negative bacteria. Biotechnology 1:784–791
Stahl U, Esser K (1983) Plasmid heterogeneity in various strains of
Bacillus megaterium. E J Appl Biotechnol 17:248–251
Strätz M, Sauer U, Kuhn A, Dürre P (1994) Plasmid transfer into the
homoacetogen Acetobacterium woodii by electroporation and
conjugation. Appl Environ Microbiol 60:1033–1037
Strey J, Wittchen KD, Meinhardt F (1999) Regulation of β-
galactosidase expression in Bacillus megaterium by a XylS/
AraC-type transcriptional activator. J Bacteriol 181:3288–3292
Sun J, Wang W, Hundertmark C, Zeng AP, Jahn D, Deckwer WD
(2006) A protein database constructed from low-coverage
genomic sequence of Bacillus megaterium and its use for
accelerated proteomic analysis. J Biotechnol 124:486–495
Sussman MD, Vary PS, Hartmann C, Setlow P (1988) Integration and
mapping of Bacillus megaterium genes which code for small acid
soluble spore proteins and their protease. J Bacteriol 170:4942–
4945
Szpirer CY, Faelen M, Couturier M (2000) Interaction between the
RP4 coupling protein TraG and the pBHR1 mobilization protein
Mob. Mol Microbiol 37:1283–1292
Vary P (1994) Prime time for Bacillus megaterium. Microbiology
140:1001–1013
Vary P, Biedendieck R, Fuerch T, Meinhardt F, Rohde M, Deckwer
WD, Jahn D (2007) Bacillus megaterium-from simple soil
bacterium to industrial protein production host. Appl Microbiol
Biotechnol 76:957–967
Veith B, Herzberg C, Steckel S, Feesche J, Maurer KH, Ehrenreich P,
Baumer S, Henne A, Liesegang H, Merkl R, Ehrenreich A,
Gottschalk G (2004) The complete genome sequence of Bacillus
licheniformis DSM13, an organism with great industrial poten-
tial. J Mol Microbiol Biotechnol 7:204–211
Vorobjeva IP, Khmel IA, Alföldi L (1980) Transformation of Bacillus
megaterium protoplasts by plasmid DNA. FEMS Microbiol Lett
7:261–263
Waschkau B, Waldeck J, Wieland S, Eichstädt R, Meinhardt F (2008)
Generation of readily transformable Bacillus licheniformis
mutants. Appl Microbiol Biotechnol 78:181–188
Winshell E, Shaw WV (1969) Kinetics of induction and purification
of chloramphenicol acetyltransferase from chloramphenicol-
resistant Staphylococcus aureus. J Bacteriol 98:1248–1257
Wittchen KD, Meinhardt F (1995) Inactivation of the major
extracellular protease from Bacillus megaterium by gene replace-
ment. Appl Microbiol Biotechnol 42:871–877
Wittchen KD, Strey J, Bültmann A, Reichenberg S, Meinhardt F
(1998) Molecular characterization of the operon comprising the
spoIV gene of Bacillus megaterium DSM319 and generation of a
deletion mutant. J Gen Appl Microbiol 44:317–326
Woodcock DM, Crowther PJ, Doherty J, Jefferson S, DeCruz E,
Noyer-Weidner M, Smith SS, Michael MZ, Graham MW (1989)
Quantitative evaluation of Escherichia coli host strains for
tolerance to cytosine methylation in plasmid and phage recombi-
nants. Nucl Acids Res 17:3469–3478