Inflammation ( # 2013)

DOI: 10.1007/s10753-013-9684-1

Changes of Inhibitory Receptors on NK-92 Cells and HLA-G

on BeWo Cells with Toxoplasma gondii Infection

Yang Liu,1 Ling Zhang,1 Meilan Gao,2 Fengmei Zhang,3 Xiaoyan Xu,1 Xianbing Liu,1
and Xuemei Hu1,4

Abstract—The aim of this study were to demonstrate the effects of Yellow fluorescent protein-
Toxoplasma gondii infection on the NK-92 cells co-cultured with BeWo cells in vitro and to verify the
implications upon adverse pregnancy outcome. There are four groups including NK-92 cells infected
or uninfected with T. gondii, and NK-92 cells co-cultured with BeWo cells in the presence or absent of
T. gondii infection. Cells were observed by fluorescence microscope at 12, 24, 36, 48, and 60 h after
infection. Levels of inhibitory receptors killer immunoglobulin-like receptor (KIR)2DL4 and ILT-2
expressed on NK-92 cells, and their common ligand HLA-G expressed on BeWo cells were measured
by real-time PCR and flow cytometry in all groups. Levels of KIR2DL4, ILT-2 and HLA-G increased
at 12, 24, 36, and 48 h, while decreased at 60 h in all T. gondii-infected groups compared with their
parallel control groups, respectively. KIR2DL4 and ILT-2 expression in co-culture groups with inf-
ection were higher than those in infected NK-92 groups at 12, 24, 36, and 48 h, while there were no
significant differences at 60 h. The expression of the two inhibitory receptors was correlated with
HLA-G expression in infected co-culture groups. The changes of inhibitory receptors on NK-92 cells
and their common ligand HLA-G on BeWo cells with T. gondii infection might contribute to the
occurrence of adverse pregnancy outcome.

KEY WORDS: Toxoplasma gondii; HLA-G; KIR2DL4; ILT-2; adverse pregnancy outcome.

INTRODUCTION dividuals. Specifically, if a primary infection with T. gondii

Toxoplasma gondii, a zoonotic pathogen of toxoplas-
mosis, is one of the pathogens of human TORCH syndrome
that can infect all warm-blooded animals [1, 2]. T. gondii
infection is generally asymptomatic among humans and
animals with normal immunity, but it can cause a high level
of morbidity and mortality in immunocompromised in-
Yang Liu and Ling Zhang contributed equally to this work.
1
Department of Immunology, Binzhou Medical University, No.346
Guan-Hai Road, Lai-shan, Yantai, Shandong 264003, People’s
Republic of China
2 important role during pregnancy both in mice and humans.
Department of Clinical Laboratory, Binzhou Affiliated Hospital of
Binzhou Medical University, Binzhou, Shandong 264003, People’s
Republic of China
3
School Hospital, Binzhou Medical University, Yantai, Shandong
264003, People’s Republic of China
4
To whom correspondence should be addressed at Department of
Immunology, Binzhou Medical University, No.346 Guan-Hai Road,
Lai-shan, Yantai, Shandong 264003, People’s Republic of China. E-
mail: xue-mei-hu@163.com
occurs during human pregnancy, particularly during the
first trimester, it can cause unfavorable pregnancy out-
comes such as miscarriage, stillbirth, or fetal abnormalities
[3, 4]. However, the mechanism by which T. gondii
infection causes these severe abnormalities during human
pregnancy remains unclear. Under normal circumstances,
there is a complex immune state of equilibrium at the
maternal–fetal interface. Many studies have shown that the
decidual natural killer (dNK) cell receptors and its ligand
MHC molecules are crucial factors in maintaining normal
pregnancy process [5].
It has been demonstrated that dNK cells play an
In humans, dNK cells constitute about 40–50 % of the total
decidual cells and approximately 70 % of the immune cells
present in the decidua during the first trimester of
pregnancy [6]. It is thought that the function of dNK cells
which connect directly with trophoblasts at the fetal–
maternal interface is to support remodeling of the uterine
spiral arteries and to facilitate successful placentation in

0360-3997/13/0000-0001/0 # 2013 Springer Science+Business Media New York


part through the regulation of trophoblast invasion [7].
Their interaction is mainly through the inhibitory receptors
expressed on dNK cells and their ligands nonclassic HLA
(HLAIb) molecules expressed by trophoblasts [8].
Human leukocyte antigen-G (HLA-G), a nonclassic
HLA (HLAIb), is expressed by extravillous cytotrophoblast,
which plays a crucial role in protecting semiallogeneic fetal
tissues from maternal uterine NK cytolysis through interac-
tion with dNK cell inhibitory receptors [8]. Killer immuno-
globulin-like receptor (KIR)2DL4, combining specifically
with its ligand HLA-G, was expressed on a significant
proportion of dNK cells in deciduas during the first trimester
of pregnancy and on large portion of NK cells obtained from
the placenta at term, which indicated its potential role in
maternal–fetal immune maintenance [5]. Another inhibitory
receptor immunoglobulin-like transcript (ILT)-2 expressed
on NK cells also has high affinity for HLA-G [9]. These
ligand–receptor pairs provide candidates for controlling the
interaction of dNK cells with extravillous trophoblast cells,
and their appropriate cooperation is critical for normal
pregnancy, otherwise it may be detrimental for normal
pregnancy [10, 11]. It was reported that the proportion of
dNK with inhibitory receptors KIR2DL4 and ILT-2
decreased significantly during abortion [12] and the level
of HLA-G on placental trophoblast cells was obviously
lower in unexplained RSA [13]. These studies indicated that
the normal state of dNK cells and HLA-G in the placenta is
necessary for successful pregnancy.
Our previous study has demonstrated that inhibitory
receptor NKG2A on dNK cells and its ligand Qa-1 were
upregulated in rats and mice during early pregnancy
infected with T. gondii [14, 15]. However, the mechanism
of the interaction between dNK cells and trophoblast cells
is still not clear in human adverse pregnancy resulting
from T. gondii infection.
In our study, we used dNK cell line NK-92 which
expressed KIR2DL4 and ILT-2 to substitute for human
dNK cells and used BeWo cells expressing high levels of
HLA-G to replace human trophoblast cells to investigate
the effects of T. gondii infection on the NK-92 cells co-
cultured with BeWo cells in vitro and to explore the
implications upon adverse pregnancy.
MATERIALS AND METHODS
Cell Line Culture
NK-92 cell line was a kind gift from Shandong
University and BeWo cell was kindly provided by
Liu, Zhang, Gao, Zhang, Xu, Liu, and Hu
Institute of Gynecology and Obstetrics of Fudan Univer-
sity. The IL-2-dependent NK-92 cells were cultured in α-
MEM medium (Hyclone, USA) with ribose nucleotides
and deoxyribose nucleotides, supplemented with 12.5 %
FBS, 12.5 % Horse Serum (Gibco, USA), and 100 U/ml
rIL-2. BeWo cells were maintained in DMEM/F12 medium
(Hyclone, USA) containing 10 % FBS (Invitrogen–
GIBCO, Carlsbad, CA). Because the NK-92 cells needed
higher nutrition than BeWo cells, we chose the culture
medium of NK-92 cells to co-culture NK-92 and BeWo
cells. The medium were changed every other day and kept
at 37 °C in 5 % CO2 saturated humidity.
Infection of NK-92 and Co-culture Cells with YFP-T.
gondii
Yellow fluorescent protein (YFP)-T. gondii is a
kind gift from Professor Striepen, who is from the
Center for Tropical and Emerging Global Diseases of
Georgia University, USA. YFP-T. gondii were maintained
in the peritoneal fluid of intraperitoneally (i.p)-infected
Kunming mice every 54 h. 1.0×106 NK-92 cells were
transferred to another culture flask as the infection group,
and then T. gondii tachyzoites at the number of 3.0×106
were added to NK-92 cells of infection group at the ratio of
3:1 (T. gondii/cells) and cultured for 12, 24, 36, 48, and
60 h, respectively. The same amount of normal NK-92 cells
was used as control groups. For the co-culture groups:
tachyzoites were collected sterilely and infected NK-92
cells at the ratio of 3:1 (T. gondii/cells) for 2 h, and then co-
cultured with prepared BeWo cells at the ratio of 3:1 (NK-
92 cells/BeWo cells) for 12, 24, 36, 48, and 60 h,
respectively. The same amount of uninfected co-culture
system was used as control group. Cells from all groups
were collected for real-time PCR and flow cytometry
analysis.
Real-Time PCR Analysis
Total RNA was extracted from NK-92 and BeWo
cells reverse transcribed into cDNA using random
hexamer primers and RNase H-reverse transcriptase
(Fermentas, USA) according to the manufacturer’s in-
structions. For real-time PCR, primers were designed
(Table 1) and entered into NCBI BLAST database to
ensure that they were specific for the target mRNA
transcription and then synthesized by Sangon Biotech Co.
(Shanghai, China). PCR were performed using Syber
Green real-time PCR regent box (Fermentas, USA ) in a
total volume of 20 μl. PCR conditions for KIR2DL4, ILT-
2 was performed at 95 °C for 5 min, 95 °C for 15 s,
Changes of KIR2DL4, ILT-2 and HLA-G with T. gondii infection
Table 1. Primers of Real-Time PCR
Genes Primers (5′–3′)
KIR2DL4 Forward : CATGAACTTAGGCTCCCTGCA
Reverse : CATGGAAAGAGCCGAAGCA
ILT-2 Forward : AGTGACGTATGCCGAGGTGAA
Reverse : TCTTCCGCCTGTCTGTCCTTT
HLA-G Forward : CTGACCCTGACCGAGACCTGG
Reverse : GTCGCAGCCAATCATCCACTGGAG
β-actin Forward : TTGTTACAGGAAGTCCCTTGCC
Reverse : ATGCTATCACCTCCCCTGTGTG
annealing at 58 °C for 15 s, and extension at 72 °C for
45 s, for 40 cycles. Values of all genes were normalized to
the housekeeping gene, β-actin. Gene expression levels
were expressed as fold increases relative to control by the
2−ΔCt method. All reactions were carried out using a
Corbett Rotorgene RG-3000 (Corbett Research, Sydney,
Australia) in triplicate per sample.
Flow Cytometry Analysis
To analyze changes of receptors expressions, the
following fluorophore-conjugated murine monoclonal anti-
bodies were used: mouse-anti-human KIR2DL4-PE
(Biolegend, USA), mouse-anti-human ILT-2-PE and anti-
CD56-PE-cy5 (both from BD Pharmingen, USA), and
mouse-anti-human HLA-G-PE (eBioscience, USA). In co-
cultured system, NK-92 and BeWo cells were collected,
stained with CD56-PE-cy5 antibody (eBioscience) and
HLA-G-PE (eBioscience) antibody, and then isolated with
fluorescence activated cell sorting. The CD56-positive cells
were considered as purified NK-92 and HLA-G-positive
cells were BeWo cells, respectively. Two-color flow cytom-
etry was performed on a FACS Calibur (Becton Dickinson).
All experimental and control groups were incubated with
antibodies at room temperature in the dark for 30 min and
fixed with 4 % paraformaldehyde. The results were analyzed
with Cell Quest software (Becton Dickinson).
Fluorescence Microscopy
YFP-T. gondii-infected NK-92 cells solely and NK-
92 cells co-cultured with BeWo cells at 12, 24, 36, 48, and
60 h were observed with fluorescence microscopy.
Statistical Analysis
Data are presented as mean ± S.E.M. All data analyses
were processed with SPSS 13.0 statistical software version.
Paired t test was used to analyze differences in levels of
inhibitory receptors KIR2DL4, ILT-2, and HLA-G expres-
sion between infection groups and control groups. Unpaired t
test was used to compare two independent groups. Correla-
tion analysis was used to analyze the correlations between
inhibitory receptors and their ligand HLA-G expression.
Two-tailed p values of less than 0.05 or 0.01 were
considered significant or very significant, respectively.
RESULTS
NK-92 and NK-92 Cells Co-cultured with BeWo
Cells Infected with YFP-T. gondii Were Observed
by Fluorescence Microscope
At 12 h after infection, a small number of
tachyzoites were observed inside of NK-92 cells or
BeWo cells under fluorescence microscope (Fig. 1b,
h). With the tachyzoites intruding into cells increas-
ingly, the parasitophorous vacuoles containing several
tachyzoites formed at 24 h (Fig. 1c, i). The number
of parasitophorous vacuoles becoming much more at
36 h than that at 24 h (Fig. 1d, j). As time goes on,
the tachyzoites proliferated constantly (Fig. 1e, k)
and a great quantity of progeny tachyzoites were
released outside the cells at 60 h resulting from lots
of infected cells (Fig. 1f, l). NK-92 and NK-92 cells
co-cultured with BeWo cells without YFP-T. gondii
infection were used as controls (Fig. 1a, g).
Fig. 1. NK-92 and NK-92 cells co-cultured with BeWo cells were infec-
ted with YFP-T. gondii. YFP-T. gondii emitting yellow-green fluorescence
and cells infected with YFP-T. gondii can be observed under the fluores-
cence microscope at 12 h (b, h), 24 h (c, i), 36 h (d, j), 48 h (e, k), and 60 h
(f, l). a Uninfected NK-92 cells and g uninfected NK-92 cells co-cultured
with BeWo cells were normal control groups. b, h NK-92 and co-culture
cells were attacked by YFP-T. gondii and one or two tachyzoites can be
seen inside cells at first 12 h, respectively. c, i The parasitophorous vacu-
oles were formed at 24 h following infection. d, j Tachyzoites invaded into
cells and multiplied constantly. e, k The number of parasitophorous vac-
uoles became much more at 48 h than that at 36 h. f, l Lots of progeny
tachyzoites were relaxed outside cells and large numbers of them can be
found in the culture at 60 h.
 Liu, Zhang, Gao, Zhang, Xu, Liu, and Hu

The Changes of Inhibitory Receptors KIR2DL4, ILT-2,
on NK-92 Cells Infected with YFP-T. gondii
Real-time PCR and flow cytometry were used to
analyze KIR2DL4 (Fig. 2a) and ILT-2 mRNA levels
(Fig. 2c) and mean fluorescence intensity (MFI; Table 2)
in NK-92 cells, respectively. We found obvious increase
of KIR2DL4 and ILT-2 in mRNA expression and MFI in
NK-92 cells in T. gondii-infected groups compared with
normal control groups at 12, 24, 36, and 48 h, and
decrease at 60 h.

Fig. 2. The mRNA levels of KIR2DL4 and ILT-2 in NK-92 cells co-cultured with or without BeWo cells at 12, 24, 36, 48, and 60 h infected by YFP-T.
gondii. a, c The mRNA expression of KIR2DL4 and ILT-2 in NK-92 cells infected by T. gondii were higher than their control groups at 12, 24, 36, and 48 h,
and lower at 60 h, respectively. b, d The mRNA levels of KIR2DL4, ILT-2 in NK-92 cells and e HLA-G mRNA levels in BeWo cells in the co-culture system
were upregulated at 12, 24, 36, and 48 h following T. gondii infection and then they were downregulated at 60 h, respectively (2−ΔCt; *p<0.05; **p<0.01).
Changes of KIR2DL4, ILT-2 and HLA-G with T. gondii infection

Table 2. MFI Values of KIR2DL4 and ILT-2 in NK-92 Groups Following T. gondii Infection

12 h 24 h 36 h 48 h 60 h

Receptors Control Infection Control Infection Control Infection Control Infection Control Infection
KIR2DL4 X mean 7.95 12.25** 8.33 14.45** 9.10 20.65** 9.30 15.53** 9.45 8.08*
SD 0.13 0.50 0.13 0.97 0.56 1.26 1.37 0.87 0.59 0.95
ILT-2 X mean 4.73 5.98* 5.23 14.68** 5.70 20.05** 5.78 16.78** 6.08 5.20*
SD 0.17 0.57 0.30 2.20 0.74 1.48 0.59 0.78 0.30 0.24

Note: values are shown as means ± SD

*
P<0.05 (significantly different from control group based on paired t test); ** P<0.01 (significantly different from control group based on paired t test)

The Changes of KIR2DL4, ILT-2 and HLA-G
in Co-culture Groups with T. gondii Infection
In co-culture groups, KIR2DL4 (Fig. 2b) and ILT-2
(Fig. 2d) mRNA levels and MFI (Table 3) were
upregulated in infected NK-92 cells co-cultured with
BeWo cells at 12, 24, 36, and 48 h, and then were
downregulated at 60 h following T. gondii infection
compared with their control groups. And the HLA-G
expression was also higher at 12, 24, 36, and 48 h after
infection and then became lower at 60 h in infected co-
culture groups than those in control groups both in mRNA
levels (Fig. 2e) and MFI (Table 3).
The Effect of HLA-G on KIR2DL4 and ILT-2
Expressed on NK-92 Cells in Co-culture Groups
with T. gondii Infection
To investigate the effect of HLA-G on KIR2DL4 and
ILT-2 expressed on NK-92 cells, the MFI of KIR2DL4 and
ILT-2 in normal co-culture groups relative to normal NK-92
cell groups, infected co-culture groups relative to infected
NK-92 cell groups were analyzed, respectively. As shown in
Fig. 3, the expression of KIR2DL4 (Fig. 3a) and ILT-2
(Fig. 3c) significantly higher in normal co-culture groups
than those in normal NK-92 cell groups at 12, 24, 36, 48, and
60 h. The MFI of KIR2DL4 (Fig. 3b) and ILT-2 (Fig. 3d) in
infected co-culture groups were also upregulated compared
with those in infected NK-92 groups at 12, 24, 36, 48, and
60 h, but at 60 h there were no significant differences. The
expression of the two inhibitory receptors KIR2DL4 and
ILT-2 were positively correlated with HLA-G expression in
infected co-culture groups by correlation analysis (r2 =0.80,
p<0.05 and r2 =0.88, p<0.05, respectively).
DISCUSSION
T. gondii infection may result in fatal teratogenesis
and adverse outcomes in pregnancies of both humans and
mice [16, 17]. As we all know, dNK cells display a vital
role in maintaining normal pregnancy. They are the
CD56brightCD16− NK subset expressing inhibitory and
activating receptors that have decreased cytotoxic
capabilities [18]. KIR2DL4 and ILT-2 are two important
inhibitory receptors expressing on dNK cells, and they can
combine with their common ligand the nonclassical HLA
class I molecules HLA-G which is expressed on
invading trophoblasts, transmitting inhibitory signals
to dNK cells [19, 20]. The interaction between HLA-
G and dNK inhibitory receptors is conducive to
protecting of fetal trophoblasts from being lysed by

Table 3. MFI values of KIR2DL4, ILT-2 and HLA-G in Co-culture Groups Following T. gondii Infection

12 h 24 h 36 h 48 h 60 h

Receptors Control Infection Control Infection Control Infection Control Infection Control Infection
KIR2DL4 X mean 8.53 14.2** 9.63 19.23** 12.08 28.88** 14.38 23.23** 14.95 9.73**
SD 0.38 0.47 0.45 1.06 0.54 1.72 0.28 1.15 0.66 0.98
ILT-2 X mean 5.45 8.23** 6.53 19.73** 9.40 27.03** 10.88 19.95** 11.13 5.98**
SD 0.47 1.12 0.68 0.79 0.88 1.08 0.77 2.07 0.39 0.62
HLA-G X mean 8.2 12.43** 8.23 18.98** 8.35 26.2** 8.22 19.38** 8.3 7.03*
SD 0.34 2.10 0.30 0.70 0.42 1.02 0.50 1.39 0.43 0.54

Note: values are shown as means ± SD

*
P<0.05 (significantly different from control group based on paired t test); ** P<0 .01 (significantly different from control group based on paired t test)
 Liu, Zhang, Gao, Zhang, Xu, Liu, and Hu

Fig. 3. The effect of HLA-G on the KIR2DL4 and ILT-2 expression in co-culture system. a, c The KIR2DL4 and ILT-2 expression increased obviously at
12, 24, 36, 48, and 60 h in uninfected co-culture groups compared with uninfected NK-92 groups, respectively. b, d The levels of the KIR2DL4 and ILT-2
were significantly higher at 12, 24, 36, and 48 h in the infected co-culture groups than those in infected NK-92 groups, and at 60 h there were not obvious
increase (*p<0.05;**p<0.01).

dNK cells and controlling of normal trophoblast
invasion. This is an important mechanism in
maintaining normal pregnancy. If they were
disordered, it may lead to abnormal pregnancy
outcomes [21, 22]. However, whether T. gondii
infection could affect the inhibitory receptor-HLA-G
combinations between dNK cells and trophoblasts
which contribute to the abnormal pregnancy outcome
was still unclear.
NK-92 is a human IL-2-dependent NK cell line that
was derived from a patient with non-Hodgkin’s lymphoma.
It has a CD3−CD16−CD56bright phenotype and inhibitory
receptors KIR2DL4 and ILT-2, which has been reported to
be characteristic of decidualized NK cells [23]. Therefore,
we chose NK-92 cell line to resolve the difficulties of
collecting human deciduas from normal abortion women
and obtaining pure NK cell populations free of
contaminating T lymphocytes. Human choriocarcinoma
cell line BeWo expressing HLA-G with cytotrophoblast
characteristic fused spontaneously in vitro and owned
invasiveness, so it was used to model placental trophoblast
cell functions [24].
Some study has shown that HLA-G was upregulated
in HCMV infection and declared that the increase of
HLA-G transmitted inhibitory signal to NK cells to limit
pro-inflammatory cytokines production and allow
infected cells to escape immune response [25]. Another
report was shown that elevated sHLA-G in amniotic fluid
from women with acquired toxoplasmosis during preg-
nancy. This suggested that excessive immunotolerance
induced by HLA-G could be associated with transplacen-
tal transmission and resulted in abnormal pregnancy
Changes of KIR2DL4, ILT-2 and HLA-G with T. gondii infection
outcome [26]. Our previous study has demonstrated that
nonclasscal MHC class I molecules Qa-1 and its ligand
dNK cells inhibitory receptor NKG2A were all upregulated
in rats and mice during early pregnancy infected with T.
gondii [14, 15]. In this study, we found that the HLA-G
expression on BeWo cells increased in infected co-culture
groups compared with uninfected groups; meanwhile, the
levels of KIR2DL4 and ILT-2 were both obviously
increased in infected NK-92 groups and infected co-culture
groups than their uninfected groups at 12, 24, 36, and 48 h.
Therefore, the overexpression of HLA-G and inhibitory
receptors KIR2DL4 and ILT-2 following T. gondii infec-
tion may induce strong inhibition of dNK cells and allow
infected cells to escape anti-T. gondii response, which is
dangerous for fetal development.
It has been reported that the proportion of dNK cells
expressing inhibitory receptors KIR2DL4 and ILT-2 on
dNK cells decreased in most recurrent miscarriages
patients [12]. Another reported that the level of HLA-G
on placental trophoblast cells was downregulated in
unexplained RSA. HLA-G regulates the invasion process
of trophoblasts and protect fetal from NK cytotoxicity
through interaction with dNK inhibitory receptors
KIR2DL4, ILT-2. The decrease of HLA-G and inhibitory
receptors on dNK cells caused extrovillous trophoblasts
lysis by dNK cytotoxicity [14]. So the changes of inhibitory
receptors KIR2DL4, ILT-2, and their ligand HLA-G
indicated the complexity of the immunopathogenesis of
pregnancy loss. In our study, the levels of KIR2DL4, ILT-2
were downregulated in infected NK-92 groups and infected
co-culture groups compared with their uninfected groups at
60 h. At the same time, HLA-G expression on BeWo cells
was also downregulated in infected co-culture groups. The
decreased expression of inhibitory receptors KIR2DL4 and
ILT-2 on NK-92 cells and HLA-G on BeWo cells during T.
gondii infection might cause over-cytotoxicity to tropho-
blast cells further resulting in pregnancy failure.
LeMaoult J et al. have reported that HLA-G could
upregulate the levels of the inhibitory receptors KIR2DL4
and ILT-2 to reduce NK cell activation. They declared that
upregulation of inhibitory receptors KIR2DL4 and ILT-2
might increase NK cells activation thresholds leading to
NK cells activation weaken [27]. In our study, we also
found that the expression of KIR2DL4 and ILT-2 were
positively correlated with HLA-G expression in co-
culture groups following T. gondii infection. So their
upregulation in pregnancy infection maybe further de-
creased the dNK cell activation and suppressed dNK cells
to anti-T. gondii response, which may aggravate fetal
infection and eventually resulting in abnormal pregnancy.
In view of the above, our data demonstrated that T.
gondii infection could lead to changes of KIR2DL4, ILT-2,
and HLA-G, and that the abnormal interaction between the
two inhibitory receptors and HLA-G might be associated
with adverse pregnancy. These observations might be
helpful to provide a new experimental theoretical basis on
the immunologic pathogenesis associated with the abnor-
mal pregnancy induced by T. gondii infection.
ACKNOWLEDGMENTS
We thank Professor Striepen in the Center for Tropical
and Emerging Global Diseases of Georgia University, USA,
for his kind gift of YFP-T. gondii. This study was supported
in part by funds from the National Natural Science
Foundation of China 81171591 and 81273243, Science
and Technology Development Planning Project of Shan-
dong Province 2012CSF11809, Shandong Province Uni-
versity Science and Technology Found J11LF93, Binzhou
Medical University Science and Technology Found
BY2010KJ081.
Conflict of Interest. All the authors have no conflict
of interest.
REFERENCES
1. Mahalakshmi, B., K.L. Therese, U. Devipriya, V. Pushpalatha, S.
Margarita, and H.N. Madhavan. 2010. Infectious aetiology of
congenital cataract based on TORCHES screening in a tertiary eye
hospital in Chennai, Tamil Nadu, India. The Indian Journal of
Medical Research 131: 559–564.
2. Leng, J., B.A. Butcher, and E.Y. Denkers. 2009. Dysregulation of
macrophage signal transduction by Toxoplasma gondii: past
progress and recent advances. Parasite Immunology 31: 717–728.
3. Commodaro, A.G., R.N. Belfort, L.V. Rizzo, C. Muccioli, C.
Silveira, M.N. Burnier Jr., and R. Belfort Jr. 2009. Ocular
toxoplasmosis: an update and review of the literature. Memórias
do Instituto Oswaldo Cruz 104: 345–350.
4. Wang, T., M. Liu, X.J. Gao, Z.J. Zhao, X.G. Chen, and Z.R. Lun.
2011. Toxoplasma gondii: the effects of infection at different stages
of pregnancy on the offspring of mice. Experimental Parasitology
127: 107–112.
5. Rajagopalan, S., and E.O. Long. 1999. A human histocompatibility
leukocyte antigen (HLA)-G-specific receptor expressed on all
natural killer cells. The Journal of Experimental Medicine 189:
1093–1100.
6. Koopman, L.A., H.D. Kopcow, B. Rybalov, J.E. Boyson, J.S.
Orange, F. Schatz, R. Masch, C.J. Lockwood, A.D. Schachter, P.J.
Park, and J.L. Strominger. 2003. Human decidual natural killer cells

are a unique NK cell subset with immunomodulatory potential. The
Journal of Experimental Medicine 198: 1201–1212.
7. Parham, P. 2004. NK cells and trophoblasts: partners in pregnancy.
The Journal of Experimental Medicine 200: 951–955.
8. Rouas-Freiss, N., R.M. Gonçalves, C. Menier, J. Dausset, and E.D.
Carosella. 1997. Direct evidence to support the role of HLA-G in
protecting the fetus from maternal uterine natural killer cytolysis.
Proceedings of the National Academy of Sciences of the United
States of America 94: 11520–11525.
9. Shiroishi, M., K. Kuroki, T. Ose, L. Rasubala, I. Shiratori, H. Arase,
K. Tsumoto, I. Kumagai, D. Kohda, and K. Maenaka. 2006.
Efficient leukocyte Ig-like receptor signaling and crystal structure
of disulfide-linked HLA-G dimer. The Journal of Biological
Chemistry 281: 10439–10447.
10. Hanna, J., D. Goldman-Wohl, Y. Hamani, I. Avraham, C. Greenfield,
S. Natanson-Yaron, D. Prus, L. Cohen-Daniel, T.I. Arnon, I.
Manaster, R. Gazit, V. Yutkin, D. Benharroch, A. Porgador, E.
Keshet, S. Yagel, and O. Mandelboim. 2006. Decidual NK cells
regulate key developmental processes at the human fetal–maternal
interface. Nature Medicine 12: 1065–1074.
11. Emmer, P.M., E.A. Steegers, H.M. Kerstens, J. Bulten, W.L. Nelen, K.
Boer, and I. Joosten. 2002. Altered phenotype of HLA-G expressing
trophoblast and decidual natural killer cells in pathological pregnan-
cies. Human Reproduction 17: 1072–1080.
12. Chao, K.H., M.Y. Wu, C.D. Chen, J.H. Yang, Y.S. Yang, and H.N.
Ho. 1999. The expression of killer cell inhibitory receptors on
Natural killer cells and activation status of CD4 + and CD8+ T cells
in the decidua of normal and abnormal early pregnancies. Human
Immunology 60: 791–797.
13. Peng, B., L. Zhang, A.Y. Xing, M. Hu, and S.Y. Liu. 2008. The
expression of human leukocyte antigen G and E on human first
trimester placenta and its relationship with recurrent spontaneous
abortion. Sichuan Da Xue Xue Bao. Yi Xue Ban 39: 976–979.
14. Yang, X., Y. Zhang, and X. Hu. 2008. Effect on the rat MHC IB and
NK receptor at maternal-fetal interface infected by Toxoplasma
gondii during early pregnancy. Current Immunology 328: 208–213.
15. Zhang, R.J., H.X. Zhang, X.B. Liu, Q. Fu, X.Y. Xu, and X.M. Hu.
2012. Immunoprotective role of interleukin-10 in abnormal pregnancy
outcome induced by Toxoplasma gondii infection. Gynecologic and
Obstetric 73: 223–229.
16. Senegas, A., O. Villard, A. Neuville, L. Marcellin, A.W. Pfaff, T.
Steinmetz, M. Mousli, J.P. Klein, and E. Candolfi. 2009. Toxoplas-
ma gondii-induced foetal resorption in mice involves interferon-
Liu, Zhang, Gao, Zhang, Xu, Liu, and Hu
gamma-induced apoptosis and spiral artery dilation at the
maternofoetal interface. International Journal of Parasitology 39:
481–487.
17. Tenter, A.M., A.R. Heckeroth, and L.M. Weiss. 2000. Toxoplasma
gondii: from animals to humans. International Journal of Parasitology
30: 1217–1258.
18. Word, A.S., and A. Arici. 2005. Natural killer cells and reproductive
failure. Current Opinion in Obstetrics and Gynecology 17: 237–241.
19. Vargas-Inchaustegui, D.A., T. Demberg, and M. Robert-Guroff.
2011. A CD8α (−) subpopulation of macaque circulatory natural
killer cells can mediate both antibody-dependent and antibody-
independent cytotoxic activities. Immunology 134: 326–340.
20. Rajagopalan, S., J. Fu, and E.O. Long. 2001. Cutting edge:
induction of IFN-gamma production but not cytotoxicity by the
killer cell Ig-like receptor KIR2DL4 (CD158d) in resting NK cells.
The Journal of Immunology 167: 1877–1881.
21. Varla-Leftherioti, M. 2005. The significance of the women’s
repertoire of natural killer cell receptors in the maintenance of
pregnancy. Chemical Immunology and Allergy 89: 84–95.
22. Gonen-Gross, T., R. Gazit, H. Achdout, J. Hanna, S. Mizrahi, G.
Markel, V. Horejsí, and O. Mandelboim. 2003. Special organization
of the HLA-G protein on the cells surface. Human Immunology 64:
132–136.
23. Maki, G., H.G. Klingemann, J.A. Martinson, and Y.K. Tam. 2001.
Factors regulating the cytotoxic activity of the human natural killer
cell line, NK-92. Journal of Hematotherapy & Stem Cell Research
10: 369–383.
24. Lam, K.K., R.T. Pang, C.L. Lee, H. Koistinen, M. Seppala, P.C. Ho, W.S.
Yeung, and P.C. Chiu. 2012. Glycodelin-A modulates syncytialization of
human BeWo choriocarcinoma cell line. Placenta 33: 750–752.
25. Onno, M., C. Pangault, G. Le Friec, V. Guilloux, P. André, and R.
Fauchet. 2000. Modulation of HLA-G antigens expression by human
cytomegalovirus: specific induction in active macrophages harboring
human cytomegalovirus infection. The Journal of Immunology 164:
6426–6434.
26. Robert-Gangneux, F., J.P. Gangneux, N. Vu, S. Jaillard, C. Guiguen,
and Amiot. 2011. High level of soluble HLA-G in amniotic fluid is
correlated with congenital transmission of Toxoplasma gondii.
Clinical Immunology 138: 129–134.
27. LeMaoult, J., K. Zafaranloo, C. Le Danff, and E.D. Carosella. 2005.
HLA-G up-regulates ILT2, ILT3, ILT4, and KIR2DL4 in antigen
presenting cells, NK cells, and T cells. The FASEB Journal 19: 662–
664.