European Journal of Pharmacology 849 (2019) 124–134

Contents lists available at ScienceDirect

European Journal of Pharmacology

journal homepage: www.elsevier.com/locate/ejphar

Molecular and cellular pharmacology

Cytotoxic and multidrug resistance reversal activity of phenothiazine T

derivative is strongly enhanced by theobromine, a phytochemical from
cocoa
Kamila Środa-Pomianeka, , Krystyna Michalaka, Anna Palko-Łabuza, Andrzej Połaa,
⁎

Piotr Dzięgielb, Bartosz Pułab,d, Piotr Świątekc, Olga Wesołowskaa

a
Department of Biophysics, Wroclaw Medical University, ul. Chalubinskiego 10, 50-368 Wroclaw, Poland
b
Division of Histology and Embryology, Department of Human Morphology and Embryology, ul. Chalubinskiego 6a, 50-368 Wroclaw, Poland
c
Department of Drug Chemistry, Wroclaw Medical University, ul. Borowska 211, 50-556 Wroclaw, Poland
d
Department of Hematology, Institute of Hematology and Transfusion Medicine, ul. Gandhi 14, 02-776 Warsaw, Poland

ARTICLE INFO ABSTRACT

Keywords: The idea of the use of anticancer drugs together with a chemosensitizer emerged as the strategy of reversal of
Cancer multidrug resistance multidrug resistance (MDR) of cancer cells expressing ABC proteins many years ago. The approaches relying on
Theobromine the use of a single chemosensitizer have never resulted in a clinical success. Therefore, the application of drug
Phenothiazine derivative combinations of two or more compounds with different mechanisms of action might be an alternative approach
Synergy
to increase the success rate. In the present study the cytotoxic and NF-κB inhibition potential of the phe-
ABCB1 (P-glycoprotein)
nothiazine derivative, MAE-TPR, was evaluated. MAE-TPR was demonstrated to be an effective doxorubicin-
NF-κB pathway
resistance modulator in human adenocarcinoma cell line LoVo/Dx. In the presence of MAE-TPR cytotoxicity of
doxorubicin was elevated, and its intracellular accumulation increased. Strong synergism occurred between
MAE-TPR and Dox. MAE-TPR diminished also the expression of ABCB1 transporter (P-glycoprotein) by affecting
NF-κB pathway. Theobromine, a phytochemical from cocoa, which was barely active itself, strongly augmented
MDR reversal potency of MAE-TPR. The effect of the combination of phenothiazine derivative with theobromine
on cancer cells was studied for the first time in the present work. It was concluded that the use of the proposed
combination of two modulators might be a promising strategy for MDR reversal since modulators could be used
in concentrations much lower than in case of their single application and in that way the risk of intolerable side-
effects could be reduced.

1. Introduction studies, able to re-establish sensitivity to anticancer drugs in resistant

Cancer cells often develop during treatment or possess intrinsically
the set of features known as multidrug resistance (MDR). Cells gain then
simultaneous resistance against the plenty of structurally and func-
tionally unrelated anticancer drugs. The over-expression of transmem-
brane protein transporters of wide substrate specificity, such as ABCB1
(P-glycoprotein, MDR1), is considered to be the major mechanism of
MDR (Szakacs et al., 2014).
Phenothiazines, apart from being antipsychotic drugs, constitute
one of the earliest recognized groups of MDR modulators (reviewed in
(Wesolowska, 2011)). Their anti-MDR properties have been known for
more than 35 years (Tsuruo et al., 1982). Many phenothiazines (e.g.,
trifluoperazine, fluphenazine (Ford et al., 1989), and thioridazine
(Csonka et al., 2013)) proved to be effective modulators in in vitro
cancer cells. The direct inhibition of ABCB1 transporter by phenothia-
zines is likely to be their main mechanism of action as MDR modulators
(Konya et al., 2006; Wesolowska et al., 2009). Additionally, new phe-
nothiazine derivatives with anti-cancer properties are being described
each year (Takacs et al., 2013; Wu et al., 2016; Morak-Mlodawska et al.,
2016)
Unfortunately, all clinical trials with the use of phenothiazines as
the resistance modulators brought negative results so far (reviewed in
Raderer and Scheithauer (1993)). This was mainly due to the failure to
reach plasma concentrations of phenothiazine (trifluoperazine) high
enough to achieve the desired effect, because high concentrations of
these compounds in patients’ plasma resulted in intolerable side effects,
such as neutropenia and extrapyramidal symptoms (Miller et al., 1988).
Therefore, the methods allowing for the reduction of phenothiazines’

⁎
Corresponding author.
E-mail address: kamila.sroda-pomianek@umed.wroc.pl (K. Środa-Pomianek).

https://doi.org/10.1016/j.ejphar.2019.01.061
Received 5 November 2018; Received in revised form 3 January 2019; Accepted 17 January 2019
Available online 02 February 2019
0014-2999/ © 2019 Elsevier B.V. All rights reserved.
K. Środa-Pomianek, et al.
concentrations needed to obtain favorable anti-MDR effects are in great
request. One of the possible strategies assumes the co-administration of
two modulators with different mechanisms of action. Additionally, this
approach allows for obtaining a desired effect and the reduction of
concentrations of each individual compound at the same time. Natural
products of low toxicity are being investigated by many researchers as
MDR modulators. For the present study theobromine was chosen as a
phytochemical and it was applied concomitantly with phenothiazine
derivative.
Theobromine (Thb) is the major xanthine alkaloid present in cocoa
(Theobroma cacao). The main sources of human consumption of Thb are
chocolate beverages and foods. Cocoa beans may contain up to 20 mg/g
of Thb that is reduced to c.a. 0.5–2 mg/g in commercially available
cocoa products (Apgar and Tarka, 1998). Thb appears to be non-toxic to
humans (Eteng et al., 1997). Together with caffeine, Thb acts as a
psychostimulant that is mainly attributed to their ability to inhibit
phosphodiesterases and to block of adenosine receptors (Martínez-
Pinilla et al., 2015). Bronchodilatory, diuretic and anti-inflammatory
properties of Thb were also reported (Martínez-Pinilla et al., 2015; Smit
et al., 2004). Additionally, Thb modulated anticancer effect of doxor-
ubicin (Dox) in Ehrlich ascites carcinoma cells (Sadzuka et al., 1995). In
the presence of Thb the reduced efflux of Dox in vitro was recorded,
increased antitumor effect of the drug as well as elevated concentration
of Dox in mouse tumors. However, the authors did not propose any
molecular mechanism explaining their observations.
In the present work the activity of the phenothiazine derivative,
MAE-TPR (alone and in combination with Thb) on doxorubicin-re-
sistance, expression and activity of ABCB1 transporter in human ade-
nocarcinoma cells LoVo/Dx was investigated. Cytotoxic potential,
apoptosis-induction ability, and reactive oxygen species generation
potency of this phenothiazine derivative have been previously studied
in the same cell line (Sroda-Pomianek et al., 2018). MAE-TPR in high
concentrations (100 μM) was demonstrated to be weak inductor of
apoptosis and autophagy. Additionally, the intracellular level of re-
active oxygen species was increased in the presence of this derivative.
In the present study, MAE-TPR, was recognized as the compound able
to reduce doxorubicin-resistance in LoVo/Dx cells. In the presence of
MAE-TPR cytotoxicity of doxorubicin (Dox) was augmented, and its
intracellular accumulation decreased. Moreover, simultaneous admin-
istration of MAE-TPR and Thb (barely active itself) resulted in sig-
nificantly stronger reversal of resistance to Dox as compared to the
effect of any of the modulators applied separately. Co-administration of
these modulators allowed for the reduction of MAE-TPR concentration
needed to obtain anti-MDR effect. Additionally, MAE-TPR reduced the
level of expression of ABCB1 transporter probably by affecting NF-κB
pathway. It was concluded that Thb acted as an effective amplifier of
MAE-TPR potency as resistance modulator in cancer cells.
2. Materials and methods
2.1. Chemicals
The structures of MAE-TPR: 10-[3-(N-2-hydroxyethyl-N-methyla-
mino)-2-hydroxypropyl]-2-trifluoromethylphenothiazine hydrochloride,
triflupromazine (TPR), and theobromine (Thb) are presented in Fig. 1.
The synthesis of MAE-TPR was described previously (Gasiorowski et al.,
2003). Theobromine, triflupromazine, sulforhodamine B (SRB), rhoda-
mine 123 (Rho123), and doxorubicin (Dox) were obtained from Sigma.
Both Rho123 and Dox were dissolved in water. Other compounds were
dissolved in DMSO.
2.2. Cell lines
The human colorectal adenocarcinoma cell line LoVo and its dox-
orubicin-resistant subline LoVo/Dx (Drewinko et al., 1976; Grandi
et al., 1986) were obtained from Institute of Immunology and
125
European Journal of Pharmacology 849 (2019) 124–134
Fig. 1. Chemical structure of the modulators.
Experimental Therapy of Polish Academy of Science (Wroclaw, Po-
land). The cells were cultured in F12 medium (Cytogen) supplemented
with 10% fetal bovine serum (Gibco), 1% antibiotic antimycotic solu-
tion (Sigma) and 1% glutamine (Prolabo). Dox (100 ng/ml) was added
to the medium to maintain drug resistance of LoVo/Dx cells after each
passage which was carried out twice a week.
Parental Martin-Darby Canine Kidney cells (MDCK) and MDCK cells
expressing human ABCB1 (MDCK-MDR1) (Pastan et al., 1988) were
purchased from Netherlands Cancer Institute (NKI-AVL, Amsterdam,
the Netherlands). The cells were cultured in DMEM medium (Gibco)
supplemented with 10% fetal bovine serum (Gibco), 1% penicillin-
streptomycin solution (Sigma) and 1% glutamine (Prolabo).
All cell lines were incubated in a humidified atmosphere (5% CO2,
95% air) at 37 °C. The adherent cancer cells were detached with non-
enzymatic cell dissociation solution (Sigma). The EVE Automatic Cell
Counter (NanoEnTek) was used to determine density of cells for each
experiment. All experimental procedures were carried out in log-phase
of cell growth.
2.3. Cell viability assay
The sulforhodamine B (SRB) assay (Skehan et al., 1990) with minor
modifications was used for the estimation of the effect of the studied
compounds on cell growth. Cells (30,000/well) were seeded in 96-well
flat-bottom microtiter plates in 75 μl of medium and allowed to attach
(60 min, 37 °C). Then, 75 μl of medium containing an appropriate
concentration of the studied compounds was added to each well, with
exception of the control wells, which contained medium only. The
culture plates were then incubated for 48 h at 37 °C. The further pro-
cedure was carried out as previously described (Palko-Łabuz et al.,
2017). Cytotoxicity of DMSO to LoVo and LoVo/Dx cells was found to
be negligible.
2.4. Isobolographic analysis
IC30, IC50, and IC70 represent the concentrations of a drug required
for 30%, 50%, and 70% inhibition of cell growth in vitro. The IC30, 50,
70 values for MAE-TPR and Dox were calculated from the cytotoxic
assays by means of the CompuSyn software (www.combosyn.com,
ComboSyn, Inc., Paramus, USA). Combination index (CI) values were
also calculated by the CompuSyn software according to the classic
median-effect equation as described by Chou and Martin (2005).
(D)1 (D ) 2
CI = +
(Dx )1 (Dx )2 (1)
where: (Dx)1 is the dose of drug 1 alone that inhibits a system by x%,
(Dx)2 is the dose of drug 2 alone that inhibits a system by x%, and (D)1
+ (D)2 are doses of drug 1 and 2 in combination that also inhibit a
system by x%. CI values below 1 represent synergism, CI values equal to
1 indicate additive effect (i.e., no interaction), and CI values above 1
point to antagonism. IC30, 50, 70 values of MAE-TPR and Dox have been
plotted, and the line connecting the appropriate IC values is the IC
additive line. Area on the right side of each IC additive line represents
antagonistic effect while the left side represents synergistic effect.
K. Środa-Pomianek, et al.
2.5. Intracellular accumulation of doxorubicin
LoVo and LoVo/Dx cells were cultivated on 8-well μ-Slide micro-
scopy chambers (Ibidi, Munich, Germany) for 48 h. For the experiment
a fresh portion of F12 medium was added containing 50 μM of Dox
(plus 50 μM of MAE-TPR in treated samples) and cells were incubated
for 60 min at 37 °C. After incubation the chambers were washed with
phosphate-buffered saline (PBS) and with serum- and phenol red-free
F12 medium. Nikon Eclipse TE2000-E microscope, equipped with a
PlanFluor 40x (0.60) objective was employed for image collection.
Fluorescence was excited in the range 528–553 nm, and collected in the
range 578–633 nm.
2.6. Polymerase chain reaction
Cells were seeded onto 6-well plates and allowed to attach onto the
plate surface (24 h, 37 °C). Subsequently, the studied compounds were
added at a suitable concentration and cells were incubated for further
48 h at 37 °C. RNA extraction and reverse transcription was performed
as described previously (Sroda-Pomianek et al., 2015). The obtained
cDNA was diluted 5, 50 and 100 times in order to perform semi-
quantitative PCR. The primers for ABCB1 and β-GUS (a reference gene)
were designed as presented in Table 1. In order to determine their
specificity and compare to the data from Genbank the program Blast
(www.ncbi.nlm.nih.gov) was used. All sequences were synthesized in
Institute of Biochemistry and Biophysics of Polish Academy of Science
(Warsaw). The multiplex amplification was carried out as described
previously (Sroda-Pomianek et al., 2015). Gel Documented System
KODAK MI v4.0.0. was used to visualize the separated fragments. The
relative level of ABCB1 expression normalized to the control was esti-
mated by detection of optical density of the bands on the electro-
phoregrams using Image J program.
2.7. Western Blot analysis
Cell lysates were prepared in ice-cold lysis buffer (1% Triton X-100,
50 mM Hepes, 150 mM NaCl, 1.5 mM MgCl2, 1 mM EGTA, 1 mM phe-
nylmethylsulfonyl fluoride (PMSF),100 mM NaF, 10 mM sodium pyr-
ophosphate, 10 μg/ml aprotinin, and 10% glycerol, pH 7.4). Next whole
cell lysates were centrifuged (13,000×g, 10 min, 4 °C) and the super-
natants were collected for analysis. The protein content was determined
using the standard method of Bradford reaction (Bradford, 1976). The
proteins were separated by SDS-PAGE, transferred onto polyvinylidene
difluoride (PVDF) membranes and detected using primary antibodies in
TBS-T buffer (0.1% Triton X-100, 50 mM Tris-HCl, 150 mM NaCl, 1, pH
7.4) containing 5% bovine serum albumin (BSA). The anti-ABCB1
mouse monoclonal primary antibodies (C494) (Alexis) were used at
dilution 1:1000. The level of β-glucuronidase (β-GUS) was also de-
termined as a reference protein (anti-glucuronidase mouse monoclonal
antibody, diluted 1:1000, Thermo Scientific). After incubation (over-
night at 4 °C), the membranes were washed in TBS-T and incubated
with rabbit anti-mouse IgG secondary antibody conjugated to horse
radish peroxidase (HRP) (dilution 1:1000, Thermo Scientific) for
30 min at 4 °C. The membranes were then washed with TBS-T and the
proteins were visualized. The relative level of protein normalized to the
control derived from non-treated-cells was determined. The Image J
Table 1
Primers used for RT-PCR.
Gene Sequence of primers 5′→39782
ABCB1 Forward AAGCTTAGTACCAAAGAGGCTCTG
Reverse GGCTAGAAACAATAGTGAAAACAA
β-GUS Forward CTGCCGCAGTTCTTCAACAACG
Reverse CTGCGGTGACTGTTCAGTCATG
126
European Journal of Pharmacology 849 (2019) 124–134
program was used to detect optical density of the bands on the elec-
trophoregrams.
In experiments on NF-κB expression the preparation of cellular ex-
tracts was done using NE-PER Nuclear and Cytoplasmic Extraction Kit
(Pierce Biotechnology) according to the manufacturer’s recommenda-
tions. After separation of 30 μg protein by SDS-PAGE, proteins were
transferred to a PVDF membrane. Western blotting was performed as
described above. Rabbit primary antibodies specific for p-IκBα and
IκBα (dilution 1:300, Cell Signaling), NF-κB p65 (dilution 1:400, Cell
Signaling) and β-actin (dilution 1:1000, Cell Signaling) were used. After
overnight incubation at 4 °C, membranes were washed in TBS-T buffer
and incubated for 1 h with horseradish peroxidase-conjugated mouse
anti-rabbit IgG secondary antibody (dilution 1/2500, Thermo
Scientific). After final wash with TBS-T buffer proteins were visualized
as described above.
2.8. Chromatin immunoprecipitation assay (ChIP)
ChIP assay was performed following the recommendations of the
manufacturer (SimpleChIP Enzymatic Chromatin IP Kit; Cell Signaling)
with some modifications. In brief, LoVo and LoVo/Dx cells were treated
with MAE-TPR (at 50 μM), Thb (at 10 μM), and both compounds in
combination for 48 h. Then the cells were cross-linked with for-
maldehyde (final concentration 1%) in culture medium (10 min, room
temperature) to preserve protein-DNA interactions and subjected to
enzymatic digestion by micrococcal nuclease. Next, cell lysates were
sonicated on ice with a Hielscher UP200S ultrasound sonicator (3 ×
50 s, amplitude 40%) to fragment DNA into 150–900 bp fragments.
Antibodies against NF-κB p65 subunit (Cell Signaling) were added to
precipitate protein-bound DNA fragments. The antibody-protein-DNA
complexes were purified using ChIP-grade protein G magnetic beads.
The immunocomplexes were further treated with DNase-and RNase-
free proteinase K, and DNA was then purified using DNA purification
columns. The final ChIP DNA fragments were used as templates for a
PCR assay. The primers for the human ABCB1 gene were as follows:
forward 5′-GCTGGGAAGATCGCTACTGA-3′ and reverse 5′-GGTACCTG
CAAACTCTGAGCA-3′. The PCR products were separated on a 4%
agarose gel and visualized with ethidium bromide. Gel Documented
System KODAK MI v4.0.0. was used to visualize the separated frag-
ments.
2.9. Accumulation of rhodamine 123 in cancer cells
In order to determine Rho123 accumulation, LoVo and Lovo/Dx or
MDCK and MDCK-MDR1 cells (200,000 cells/ml) were incubated with
the appropriate concentration of MAE-TPR and Thb (15 min; 37 °C).
Next, Rho123 (2 μM) was added and the cells were incubated for 60 min
at 37 °C. After centrifugation the samples were washed twice with ice-
cold phosphate-buffered saline (PBS). Flow cytometric analysis of
Rho123 fluorescence was carried out with the BD FACS Control Canto II
(Becton Dickinson) instrument equipped with a 488 nm argon laser.
Fluorescence was recorded via 530/30 nm band pass filter A total of
5000 events were acquired per sample and analyzed with the use of Cell
Quest® software (Becton Dickinson). On the basis of measured fluor-
escence intensity (FL) of the treated and control samples (without
modulator) the fluorescence intensity ratio (FIR) was calculated
GC [%] Length of product [bp]
45.8 243
33.3
54.6 558
54.6
K. Środa-Pomianek, et al. European Journal of Pharmacology 849 (2019) 124–134

according to the equation:

(FLLoVoDx or MDCK MDR1 treated) / (FLLoVoDx or MDCK MDR1 control)
FIR =
(FLLoVo or MDCK treated) / (FLLoVo or MDCK control)
(2)

2.10. Molecular modeling

Interaction energy in doxorubicin-theobromine dimer was calcu-

lated on the basis of supramolecular approach using the calculation
package SPARTAN '18 (Shao et al., 2006). The equilibrium conformer
(at lowest energy) of the Dox:Thb complex was found using MM/MMFF
method, and optimized geometry of this conformer was obtained using
semi-empirical method at PM3 calculation level. For optimized struc-
ture of Dox:Thb dimer the interaction energy was computed, using
single-point method with calculation level of DFT/M06/6–311+G**
for gaseous phase and CPCM/ DFT/M06/6–311+G** for aqueous
medium.

2.11. Data analysis

Data represent the mean ± standard deviation (S.D.) of at least

three replications. Student's t-test was applied and P-values less than
0.05 were considered to achieve statistical significance.
3. Results
3.1. Cytotoxicity of the modulators
In order to determine the effect of the phenothiazine derivatives,
MAE-TPR and TPR, on human adenocarcinoma cells its influence on
viability of these cells was examined by SRB assay (Fig. 2). The appli-
cation of MAE-TPR reduced the growth of doxorubicin-sensitive LoVo
and resistant LoVo/Dx cells to a similar extent (c.a. 49% and 53% of
growth inhibition in LoVo and LoVo/Dx cells, respectively, at the
highest concentration of MAE-TPR – 75 μM). The cytotoxicity of TPR,
Fig. 3. The changes in doxorubicin cytotoxicity (diamonds) in LoVo/Dx cells
caused by Thb at 10 μM (empty circles), MAE-TPR at 5 μM (full circles), and
MAE-TPR (at 5 μM) in combination with Thb (at 10 μM) (squares) (A) as well as
by Thb at 10 μM (empty circles), TPR at 5 μM (full circles), and TPR (at 5 μM) in
combination with Thb (at 10 μM) (squares) (B). Means of three
experiments ± S.D. are presented. Significant enhancement (P < 0.05) of Dox
cytotoxicity was recorded for both MAE-TPR and Thb applied separately, and
for MAE-TPR:Thb combination in the whole concentration range as determined
by Student’s t-test. Additionally, MAE-TPR:Thb combination significantly aug-
mented (P < 0.05, Student’s t-test) Dox cytotoxicity as compared the effect of
MAE-TPR and Thb applied separately.

Fig. 4. Isobolograms for the interaction of MAE-TPR with Dox in Lovo/Dx cells.
The isobolograms were constructed by connecting the IC30 (empty triangles),
IC50 (empty circles) and IC70 (empty squares) values of MAE-TPR with the
appropriate IC values of Dox. Lines indicate the theoretical lines of additivity.
Data points represent the actual concentrations of MAE-TPR and Dox combined
treatment that results in 30% (full triangle), 50% (full circle), and 70% (full
square) growth inhibition. For the sake of clarity the fragment of the main
figure is enlarged and presented in the inset.

that differs from MAE-TPR only by the substituent at nitrogen atom in

Fig. 2. Cytotoxicity of Thb (empty circles), TPR (triangles), MAE-TPR (full
circles), and MAE-TPR in combination with Thb (at 10 μM) (squares) to LoVo
(A) and LoVo/Dx cells (B). Means of three experiments ± S.D. are presented.
The difference in cytotoxicity between MAE-TPR and MAE-TPR:Thb combina-
tion was statistically significant (P < 0.05) in the whole concentration range as
determined by Student’s t-test.
the side chain, was similar. TPR affected the viability of both sensitive
and resistant cancer cells in a dose-dependent manner (at the highest
concentration of TPR – 75 μM c.a. 42% and 57% of growth inhibition in
LoVo and LoVo/Dx cells, respectively, was reached). On the other hand,
Thb had no effect on the growth of both LoVo and LoVo/Dx cells.
In the next step, the influence of the addition of Thb on cytotoxicity

127
K. Środa-Pomianek, et al. European Journal of Pharmacology 849 (2019) 124–134

Table 2 cytotoxicity (Fig. 2). On the other hand, Thb had no effect on cyto-
Combination of MAE-TPR and Thb with Dox against LoVo/Dx cell growth. toxicity of TPR to these cells (data not shown).
Concentration [μM] Ratio Combination index

Dox MAE-TPR Thb

3.2. Doxorubicin-resistance reversal

20 5 4:1 0.2261 Next, it was checked whether MAE-TPR or TPR alone and in com-
20 10 2:1 0.7865 bination with Thb were able to increase Dox cytotoxicity in LoVo/Dx
20 5 10 4:1:2 0.0362
5 10 1:2 0.5624
cells (Fig. 3). LoVo/Dx cells are partially doxorubicin-resistant (Dox
IC50 = 30 ± 3.7 μM), whereas parental LoVo cells are sensitive to this
anticancer agent (Dox IC50 = 4 ± 0.9 μM). Phenothiazine derivatives
of MAE-TPR and TPR to LoVo and LoVo/Dx cells was investigated. Thb and Thb were used in concentrations of 5 μM and 10 μM, respectively.
was used at 10 μM concentration. In both cell lines the addition of Thb This concentration of Thb did not produce significant cytotoxicity in
resulted in a statistically significant increase (P < 0.05) of MAE-TPR LoVo/Dx cells. MAE-TPR at 5 μM inhibited cell growth by c.a. 16%
whereas TPR by c.a. 12%. TPR alone and in combination with Thb was

Fig. 5. Fluorescence microscopy pictures illustrating doxorubicin accumulation in LoVo (A) and LoVo/Dx (B) cells treated with 50 μM of MAE-TPR (C and D for LoVo
and LoVo/Dx, respectively). Scale bar is 50 µm. Illumination conditions were the same for all images. Intracellular fluorescence intensity (measured by ImageJ
software) is presented as the mean values ± S.D. of 20 representative cells (E). The statistically significant difference (*P < 0.05) between untreated and MAE-TPR-
treated LoVo/Dx cells was determined using Student’s t-test.

128
K. Środa-Pomianek, et al. European Journal of Pharmacology 849 (2019) 124–134

(caption on next page)

129
K. Środa-Pomianek, et al. European Journal of Pharmacology 849 (2019) 124–134

Fig. 6. Analysis of ABCB1 gene expression (A) in LoVo and LoVo/Dx cells cultured with Thb (10 μM), MAE-TPR (50 μM), and MAE-TPR (50 μM) combined with Thb
(10 μM) for 48 h. The base pair lengths of the amplified products are indicated at the right side of the gel. β-GUS was used as a reference gene. The relative level of
ABCB1 expression (B) normalized to the control derived from non-treated LoVo and LoVo/Dx cells. The results of three experiments ± S.D. are presented. The
statistically significant differences from the untreated controls were determined using Student’s t-test (*P < 0.05). Analysis of ABCB1 protein expression (C) in LoVo
and LoVo/Dx cells cultured with Thb (10 μM), MAE-TPR (50 μM), and MAE-TPR (50 μM) in combination with Thb (10 μM) for 48 h. The molecular masses of the
proteins are indicated at the right side of the gel. β-GUS was used as a reference protein. The relative level of ABCB1 expression (D) normalized to the control derived
from non-treated LoVo and LoVo/Dx cells. The results of three experiments ± S.D. are presented. The statistically significant differences from the untreated controls
were determined using Student’s t-test (*P < 0.05).

not able to increase Dox cytotoxicity in LoVo/Dx cells (Fig. 3B). In case
of MAE-TPR and Thb significant enhancement of Dox cytotoxicity was
observed when compounds were applied separately (P < 0.05)
(Fig. 3A). Also, the combination of MAE-TPR and Thb significantly
augmented the cytotoxic activity of Dox (P < 0.05). When the influ-
ence of MAE-TPR:Thb mixture on Dox cytotoxicity was compared to the
effect exerted by each of the modulators separately, it was found that
the impact of the modulators’ combination was significantly greater
(P < 0.05) than the effects of MAE-TPR and Thb applied as single
agents.
Isobolographic analysis was employed to evaluate the effect of the
use of double combinations: Dox and MAE-TPR, Dox and Thb, MAE-
TPR and Thb, as well as all three compounds together on the viability of
LoVo/Dx cells. The combination of Dox with MAE-TPR produced sy-
nergy at any studied concentration ratios (see Fig. 4). Their cytotoxic
effects were strongly synergistic even at low Dox concentrations, as
demonstrated by combination index (CI) values well below 1. The value
of CI for one representative Dox:MAE-TPR concentration ratio 4:1 was
presented in Tab.2. Cytotoxic activity of Dox was slightly enhanced by
Thb itself however the CI value obtained for Dox:Thb concentration
ratio 2:1 was higher than in case of Dox:MAE-TPR combination
(Table 2). The values of CI were additionally determined for MAE-TPR
combined with Thb. Synergy between the two compounds was recorded
for concentration ratio 1:2 (Table 2). Finally, it was checked whether
the interactions between doxorubicin, MAE-TPR and Thb were sy-
nergistic when the triple combination was applied to LoVo/Dx cells.
Data for one representative concentration ratio Dox:MAE-TPR:Thb
(4:1:2) are presented in Table 2. CI value obtained in this case was one
order of magnitude lower than CI values obtained for any of the double
combinations that suggested the occurrence of strong synergy between
Dox, MAE-TPR and Thb.
Dose and effect data were obtained from the SRB assay (mean va-
lues of three experiments) and subjected to CompuSyn analysis. CI
values were generated by CompuSyn software. CI = 1 indicates ad-
ditive effect, CI < 1 – synergism, and CI > 1 – antagonism.
3.3. Doxorubicin accumulation
To further analyze the mechanism of reduction of drug resistance in
LoVo/Dx cells by MAE-TPR, its influence on intracellular Dox accu-
mulation was investigated by means of fluorescence microscopy. As
shown in Fig. 5 MAE-TPR at 50 μM concentration strongly increased
intracellular accumulation of Dox in resistant LoVo/Dx cells but only
weakly in sensitive LoVo cells. In drug sensitive LoVo cells the addition
of MAE-TPR at 50 μM concentration caused almost no difference in
signal intensity (Fig. 5C) as compared to the treatment with Dox alone
(Fig. 5A). The different image was observed during the incubation of
LoVo/Dx cells with MAE-TPR at the same concentration. This phe-
nothiazine derivative caused the strong increase of fluorescent signal
intensity within the cells (Fig. 5D). Moreover, in the presence of MAE-
TPR the fluorescent signal was observed mainly from the nuclear region
of the cells what suggested Dox accumulation inside the nuclei. In
contrast, when the resistant cells were incubated only in the presence of
Dox the signal came mainly from the perinuclear region of the cells
(Fig. 5B). that might be a consequence of the extrusion of Dox from the
nuclei by ABCB1 transporter overexpressed in LoVo/Dx cells.
3.4. ABCB1 expression
One of the mechanisms of MDR reversal can be the downregulation
of the expression of the transporters involved in this phenomenon. For
this reason, the influence of MAE-TPR on ABCB1 expression was in-
vestigated. As shown in Fig. 6A, mRNA of ABCB1 gene was highly ex-
pressed in LoVo/Dx cells. The addition of MAE-TPR at 50 μM con-
centration reduced the expression this transporter on both mRNA and
protein levels (Fig. 6). Thb itself (at 10 μM) had no noticeable effect of
on ABCB1 expression, nor it enhanced the effect of MAE-TPR when both
compounds were used in the combination.
3.5. NF-κB pathway
To understand the mechanism by which MAE-TPR decreased the
expression of ABCB1 transporter the effect of this compound on the
nuclear factor κB (NF-κB) was studied. It is well known that NF-κB can
activate the transcription of ABCB1 gene to up-regulate the expression
of ABCB1 transporter thus increasing resistance of cancer cells (Lin and
Karin, 2003; Bentires-Alj et al., 2003). Transcription factor NF-κB is
composed of p65 and p50 subunits. Inactive NF-κB is retained in the
cytoplasm by inhibitors of NF-κB (IκB) – the most plentiful of which are
IκBα and IκBβ. NF-κB can be activated and translocated to the nucleus
only after IκB phosphorylation that starts the process of IκB degrada-
tion.
Hence, Western blotting was performed to detect p65 subunit of NF-
κB in the nuclear fraction, as well as phosphorylated IκBα (p-IκΒα) and
IκBα in the cytoplasmic fraction. As shown in Fig. 7AB the treatment of
both cell lines with MAE-TPR (at 50 μM) and combination of MAE-TPR
(at 50 μM) and Thb (at 10 μM) induced significant decrease in the level
of p-IκBα. Consistently, the amount of the nuclear p65 subunit of NF-κB
was significantly decreased, too (Fig. 8AB). Thb applied alone (at
10 μM) did not significantly changed the levels of p-IκBα and p65 in
LoVo/Dx cells but caused small decreases in the amount of both pro-
teins in LoVo cells.
Chromatin immunoprecipitation assay (ChIP) assay was next per-
formed to check if the studied compound affected NF-κB binding to the
promoter of ABCB1 gene. As shown in Fig. 7C, the level of the PCR
product in LoVo and LoVo/Dx cells was markedly reduced, indicating
that MAE-TPR at 50 μM concentration inhibited NF-κB binding to the
gene promoter. The same effect was observed when the cells were
treated with the combination of MAE-TPR (at 50 μM) and Thb. (at
10 μM). On the other hand, Thb alone had no effect on the NF-κB
binding to the ABCB1 promoter in both cell lines.
3.6. Rhodamine 123 accumulation
Another mechanism of MDR reversal can be the direct inhibition of
ABCB1 transporter. Therefore, inhibitory potential of MAE-TPR to-
wards ABCB1 has been characterized. For this purpose Rho123, a
known substrate of ABCB1, was employed. As shown in Fig. 8A, MAE-
TPR significantly increased (P < 0.05) Rho123 accumulation in LoVo/
Dx cells in the whole concentration range. Thb alone produced no in-
crease of Rho123 accumulation. When MAE-TPR concentration was
increased, and Thb concentration was kept constant (10 μM) the re-
corded FIR values were higher by c.a. one unit as compared to FIR

130
K. Środa-Pomianek, et al. European Journal of Pharmacology 849 (2019) 124–134

Fig. 7. Influence of MAE-TPR (at 50 μM), Thb (10 at μM), and MAE-TPR:Thb (50 μM:10 μM) combined treatment (48 h) on NF-κB pathway in LoVo and LoVo/Dx
cells. (A) Western blot analysis. (B) The relative amount of NF-κB p65 subunit in nuclear fraction, p-IκΒα and IκBα in cytoplasmic fraction normalized to the control
derived from non-treated LoVo (grey bars) and LoVo/Dx cells (white bars). The results of three experiments ± S.D. are presented. The statistically significant
differences from the untreated controls were determined using Student’s t-test (*P < 0.05). (C) Chromatin immunoprecipitation assay on NF-κB binding to ABCB1
promoter. PCR analysis for the ABCB1 gene promoter region was performed on the samples immunoprecipitated with anti-NF-κB p65 antibody and with purified total
DNA (input) from LoVo and LoVo/Dx cells. Control samples were treated with no antibody, blank samples contained no input DNA.

values obtained during the treatment with MAE-TPR alone, however
statistical significance was obtained only for some MAE-TPR con-
centrations (for details see the legend for Fig. 8A). It can be easily
noticed that the addition of 10 μM of Thb reduced the concentration of
MAE-TPR needed to get the same effect on ABCB1 inhibition (defined as
obtaining the same FIR value).
Similar experiments were performed using parental MDCK cells and
their counterparts transfected with human ABCB1 gene (MDCK-MDR1).
As can be seen in Fig. 8B the results were qualitatively similar as ob-
tained in LoVo/Dx cells. Again MAE-TPR but not Thb turned out to be
the inhibitor of ABCB1 transporter. The combination of MAE-TPR with
Thb at 10 μM concentration resulted in the significant increase
(P < 0.05) of recorded FIR values as compared to the effect of MAE-
TPR alone. Higher FIR values were recorded in MDCK-MDR1 cells than

131
K. Środa-Pomianek, et al.
Fig. 8. The influence of Thb (empty circles), MAE-TPR (full circles), and MAE-
TPR in combination with Thb (at 10 μM) (squares) on rhodamine 123 accu-
mulation in LoVo/Dx (A) and MDCK-MDR1 cells (B). Means of three
experiments ± S.D. are presented. All FIR values for MAE-TPR, and MAE-
TPR:Thb mixture were found to be significantly higher (P < 0.05, Student’s t-
test) as compared to the control. FIR values for MAE-TPR:Thb mixture were
found to be significantly higher (P < 0.05, Student’s t-test) than FIR values for
MAE-TPR in LoVo/Dx cells at MAE-TPR concentrations 0.1, 2, 2.5, 10, 20, and
50 μM, while in MDCK-MDR1 cells in the whole MAE-TPR concentration range.
Fig. 9. Optimized structure of the stacking complex between Dox and Thb (tube
model) in aqueous medium.
in LoVo/Dx cells. It was most probably the result of the higher differ-
ence in ABCB1 expression level between parental MDCK and MDCK-
MDR1 cells than between LoVo and LoVo/Dx cells.
3.7. Molecular modeling
The possibility of formation of the non-covalent complex between
Dox and Thb was investigated using computational methods. The in-
teraction energy of Dox:Thb dimer was calculated for both gaseous and
aqueous phase. In both cases the formation of the complex was found to
be energetically favorable. The calculations yielded the values of
−22.05 kcal/mol and −13.06 kcal/mol for gaseous and aqueous
medium, respectively. The model of the optimized structure of Dox:Thb
132
European Journal of Pharmacology 849 (2019) 124–134
complex in aqueous medium is presented in Fig. 9.
4. Discussion
In the present work MAE-TPR has been identified as a new, effective
modulator of Dox resistance in human adenocarcinoma cells. MAE-TPR
at concentration 5 μM significantly increased Dox cytotoxicity to LoVo/
Dx cells. Moreover, a synergistic effect was observed to occur between
MAE-TPR and Dox. Intracellular accumulation of the anticancer drug in
the presence of MAE-TPR was also increased. What is interesting, TPR
despite its close structural similarity to MAE-TPR did not influence Dox
cytotoxicity in LoVo/Dx cells. MAE-TPR is likely to be an inhibitor of
transport activity of ABCB1 protein as judged by its effect on accumu-
lation of known ABCB1 substrate, Rho123. Similar MDR-reversing and
ABCB1-inhibitory activities have already been reported for many phe-
nothiazines in various cellular models (reviewed in (Wesolowska,
2011)). Newly-synthesized derivatives are constantly being added to
the list of phenothiazine type MDR modulators (Bisi et al., 2008;
Schmidt et al., 2008; Takacs et al., 2015).
Apart from direct inhibition of ABCB1 transporter, also the reduc-
tion of its expression might result in MDR reversal. It was demonstrated
that MAE-TPR diminished the expression of ABCB1 on both mRNA and
protein levels. Downregulation of ABCB1 protein and its mRNA ex-
pression by trifluoperazine was previously observed in Dox-resistant
mouse leukemia cells (Shin et al., 2006) as well as downregulation of
ABCB1 gene by promethazine in Dox-resistant human mammary car-
cinoma cells (Donmez et al., 2011). Considering that NF-κB is a tran-
scriptional factor that regulates ABCB1 expression (Katayama et al.,
2014; Seubwai et al., 2016) the influence of MAE-TPR on NF-κB
pathway was investigated. The amount of the nuclear p65 subunit of
NF-κB was significantly decreased in the presence of MAE-TPR that
indicated the inhibition of the NF-κB signaling pathway in both LoVo
and LoVo/Dx cells. Moreover, the studied compound inhibited NF-κB
binding to ABCB1 gene promoter as demonstrated by ChIP assay. To
our knowledge, this is the first report demonstrating the suppression
effect of phenothiazine derivative on ABCB1 gene expression through
inhibition of NF-κB pathway.
The other studied compound, Thb, which was itself non-toxic to
both Lovo and LoVo/Dx cells, strongly enhanced cytotoxic properties of
Dox. The use of Dox and Thb in LoVo/Dx cells produced a synergistic
effect. On the other hand, Thb had no inhibitory effect on transport
activity of ABCB1 protein as judged by the lack of Thb influence on
cellular uptake of Rho123. Thb has been previously observed to inhibit
Dox efflux in Ehrlich ascites carcinoma cells and to increase in-
tracellular Dox accumulation both in vitro and in vivo (Sadzuka et al.,
1995; Kakuyama and Sadzuka, 2001). Thb was also identified to be an
effective MDR modulator in Dox-resistant human uterine sarcoma cell
line (Angelini et al., 2015). Modulation of anticancer drug cytotoxicity
in various cellular models has been also reported for other methyl-
xanthines, such as caffeine and pentoxifylline (reviewed in (Sabisz and
Skladanowski, 2008; Evstigneev, 2013)). Apart from other possible
mechanisms the formation stacking complexes between methylxanthine
and aromatic anticancer drugs, such as Dox, was postulated to be re-
sponsible for changes in drug cytotoxicity. It is therefore possible that
the formation of Thb:Dox complex could be responsible, at least par-
tially, for Dox-resistance reduction observed in LoVo/Dx cells. The
formation of such complexes between Dox and caffeine, and Dox and
pentoxyfilline has been previously demonstrated by means of spectro-
photometric titration, isothermal titration calorimetry and molecular
modeling (Piosik et al., 2002; Golunski et al., 2016). It is therefore
likely that Thb could form complexes with anticancer drugs in similar
manner, however the direct experimental demonstration would be
hampered by relatively low solubility of Thb in water (J. Piosik, per-
sonal communication). Interaction energy of Thb and Dox yielded by
molecular modeling was found to be in a range comparable with the
values obtained by other groups for Dox and caffeine (Piosik et al.,
K. Środa-Pomianek, et al.
2002; Hill et al., 2011). Thb itself is not likely to be ABCB1 substrate
(Liu et al., 2006). However, by creation of a stacking complex with
aromatic ABCB1 substrates (e.g. Dox or Rho123) Thb could partially
reduce the accessibility of the substrates to the transporter in this way
leading to the increased cellular retention of ABCB1 substrates.
Thb itself had no noticeable effect neither on ABCB1 transporter
expression nor on NF-κB pathway. It had no effect on the NF-κB binding
to the ABCB1 promoter in both cell lines and did not significantly
change the levels of p-IκBα and p65 in LoVo/Dx cells, however the
slight reduction of NF-κB activity was observed in LoVo cells in the
presence of Thb. In human glioma cells Thb was formerly reported to
inhibit cell proliferation that was associated with NF-κB pathway in-
hibition (Sugimoto et al., 2014).
The idea of the use of anticancer drugs together with chemosensi-
tizers has emerged as the strategy of the reversal of the resistance of
cancer cells expressing ABC proteins soon after the discovery of MDR
phenomenon (Ford and Hait, 1990; Lehne, 2000; Krishna and Mayer,
2001). The approaches relying on the use of a single chemosensitizer
have never resulted in a clinical success mainly due to the intolerable
side effects of chemosensitizers, problems with reaching their adequate
plasma concentration, as well as the occurrence of unwanted inter-
ferences with other cellular targets (e.g., cytochromes) (Kathawala
et al., 2015). Therefore, the application of drug combinations of two or
more compounds with different mechanisms of action might be an al-
ternative approach to increase the success rate. The additional ad-
vantage of this strategy is the expected reduction of concentrations of
each individual drug needed to obtain a desired effect. Natural products
are promising sources of bioactive substances. For the present study
Thb, the major xanthine alkaloid of cocoa, was chosen due to its low
toxicity and well-documented history of human consumption.
In all the studies in which both MAE-TPR and Thb were applied in
combination the concentration of Thb was 10 μM as at this concentra-
tion Thb was non-toxic to human adenocarcinoma cells. The addition of
Thb increased the cytotoxicity of MAE-TPR to both sensitive LoVo and
Dox-resistant LoVo/Dx cells. Moreover, the combined use of MAE-TPR
and Thb resulted in a significantly stronger Dox-resistance reversal in
LoVo/Dx cells as compared to the effect of any of the modulators ap-
plied separately. Very strong synergy was observed (CI value below 0.1)
between Dox, MAE-TPR and Thb. Additionally, greater intracellular
Rho123 accumulation was observed in ABCB1-expressing cells when
MAE-TPR:Thb combination was used as compared to MAE-TPR alone.
The above observations suggested that Thb acted as an effective am-
plifier of MAE-TPR activity as resistance modulator in cancer cells.
Therefore, it could be expected that the addition of Thb might allow for
the reduction of MAE-TPR concentration required to obtain MDR
modulating effect. In this way Thb could contribute to the to the di-
minution of the potential side-effects caused by the use of high con-
centrations of phenothiazine derivative. According to our best knowl-
edge, the influence of combination of phenothiazines with Thb on
cancer cells has never been studied before. On the other hand, the oc-
currence of a synergistic effect of thioridazine in combination with
dietary phytochemical, curcumin, on inhibition of growth of the
spheroids of ovarian cancer cells has been previously suggested (Chan
et al., 2018).
When the effect on MAE-TPR on the expression of ABCB1 trans-
porter was studied it was observed that the addition of Thb did not
change the results obtained for MAE-TPR alone. Also, the influence of
Thb on the modulation of NF-κB pathway by MAE-TPR was found
negligible.
To sum up, MAE-TPR, the phenothiazine derivative, was demon-
strated to be an effective Dox-resistance modulator in human adeno-
carcinoma cell line LoVo/Dx. It also diminished the expression of
ABCB1 transporter by affecting NF-κB pathway. Additionally, it was
demonstrated that Thb strongly augmented the cytotoxic and resistance
reversal potency of MAE-TPR. The effect of the combination of phe-
nothiazine derivative with Thb on cancer cells was studied for the first
133
European Journal of Pharmacology 849 (2019) 124–134
time in the present work. It was concluded that the use of the proposed
combination of two modulators might be a promising strategy for MDR
reversal since modulators could be used in concentrations much lower
than in case of their single application.
Acknowledgements
The authors are grateful to Joanna Kopecka PhD. from Department
of Oncology, University of Torino for the assistance in ChIP assay. This
work was supported by Polish Ministry of Science and Higher Education
(funds for Wroclaw Medical University) and the research project for
young scientists from Wroclaw Medical University (PBmn78).
References
Angelini, A., Ciofani, G., Conti, P., 2015. Antipsychotics reverse P-glycoprotein-mediated
doxorubicin resistance in human uterine sarcoma MES-SA/Dx5 cells: a novel ap-
proach to cancer chemotherapy. J. Biol. Regul. Homeost. Agents 29, 357–365.
Apgar, J.L., Tarka Jr., S.M., 1998. Methylxanthine composition and consumption patterns
of cocoa and chocolate products. In: Spiller, G.A. (Ed.), Caffeine. CRC Press, Boca
Raton, pp. 163–193.
Bentires-Alj, M., Barbu, V., Fillet, M., Chariot, A., Relic, B., Jacobs, N., Gielen, J., Merville,
M.P., Bours, V., 2003. NF-kappaB transcription factor induces drug resistance
through MDR1 expression in cancer cells. Oncogene 22, 90–97. https://doi.org/10.
1038/sj.onc.1206056.
Bisi, A., Meli, M., Gobbi, S., Rampa, A., Tolomeo, M., Dusonchet, L., 2008. Multidrug
resistance reverting activity and antitumor profile of new phenothiazine derivatives.
Bioorg. Med. Chem. 16, 6474–6482. https://doi.org/10.1016/j.bmc.2008.05.040.
Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72,
248–254. https://doi.org/10.1016/0003-2697(76)90527-3.
Chan, M.M., Chen, R., Fong, D., 2018. Targeting cancer stem cells with dietary phyto-
chemical - repositioned drug combinations. Cancer Lett. 433, 53–64. https://doi.org/
10.1016/j.canlet.2018.06.034.
Chou, T.C., Martin, N., 2005. CompuSyn for Drug Combinations: PC Software and User’s
Guide: A Computer Program for Quantitation of Synergism and Antagonism in Drug
Combinations, and the Determination of IC50 and ED50 and LD50 Values. ComboSyn
Inc, Paramus, (NJ).
Csonka, A., Spengler, G., Martins, A., Ocsovszki, I., Christensen, J.B., Hendricks, O.,
Kristiansen, J.E., Amaral, L., Molnar, J., 2013. Effect of thioridazine stereoisomers on
the drug accumulation of mouse lymphoma and human prostate cancer cell lines in
vitro. In Vivo 27, 815–820. https://doi.org/10.21873/anticanres.11153.
Donmez, Y., Akhmetova, L., Iseri, O.D., Kars, M.D., Gunduz, U., 2011. Effect of MDR
modulators verapamil and promethazine on gene expression levels of MDR1 and
MRP1 in doxorubicin-resistant MCF-7 cells. Cancer Chemother. Pharmacol. 67,
823–828. https://doi.org/10.1007/s00280-010-1385-y.
Drewinko, B., Romsdahl, M.M., Yang, L.Y., Ahearn, M.J., Trujillo, J.M., 1976.
Establishment of a human carcinoembryonic antigen-producing colon adenocarci-
noma cell line. Cancer Res. 36, 467–475.
Eteng, M.U., Eyong, E.U., Akpanyung, E.O., Agiang, M.A., Aremu, C.Y., 1997. Recent
advances in caffeine and theobromine toxicities: a review. Plant Foods Hum. Nutr.
51, 231–243.
Evstigneev, M.P., 2013. Physicochemical mechanisms of synergistic biological action of
combinations of aromatic heterocyclic compounds. Org. Chem. Int. https://doi.org/
10.1155/2013/278143. (Article ID 278143).
Ford, J.A., Prozialeck, W.C., Hait, W.N., 1989. Structural features determining activity of
phenothiazines and related drugs for inhibition of cell growth and reversal of mul-
tidrug resistance. Mol. Pharmacol. 35, 105–115.
Ford, J.M., Hait, W.N., 1990. Pharmacology of drugs that alter multidrug resistance in
cancer. Pharmacol. Rev. 42, 155–199.
Gasiorowski, K., Malinka, W., Swiatek, P., Jaszczyszyn, A., 2003. Antimutagenic activity
of new analogues of fluphenazine. Cell. Mol. Biol. Lett. 8, 927–942.
Gołunski, G., Borowik, A., Derewonko, N., Kawiak, A., Rychlowski, M., Woziwodzka, A.,
Piosik, J., 2016. Pentoxifylline as a modulator of anticancer drug doxorubicin. Part II:
reduction of doxorubicin DNA binding and alleviation of its biological effects.
Biochimie 123, 95–102. https://doi.org/10.1016/j.biochi.2016.02.003.
Grandi, M., Geroni, C., Giuliani, F.C., 1986. Isolation and characterization of a human
colon adenocarcinoma cell line resistant to doxorubicin. Br. J. Cancer 54, 515–518.
Hill, G.M., Moriarity, D.M., Setzer, W.N., 2011. Attenuation of cytotoxic natural product
DNA intercalating agents by caffeine. Sci. Pharm. 79, 729–747. https://doi.org/10.
3797/scipharm.1107-19.
Kakuyama, A., Sadzuka, Y., 2001. Effect of methylxanthine derivatives on doxorubicin
transport and antitumor activity. Curr. Drug Metab. 2, 379–395.
Katayama, K., Noguchi, K., Sugimoto, Y., 2014. Regulations of P-glycoprotein/ABCB1/
MDR1 in human cancer cells. New J. Sci. https://doi.org/10.1155/2014/476974.
(Article ID 476974).
Kathawala, R.J., Gupta, P., Ashby Jr., C.R., Chen, Z.S., 2015. The modulation of ABC
transporter-mediated multidrug resistance in cancer: a review of the past decade.
Drug Resist. Updat. 18, 1–17. https://doi.org/10.1016/j.drup.2014.11.002.
Konya, A., Andor, A., Satorhelyi, P., Nemeth, K., Kurucz, I., 2006. Inhibition of the MDR1
transporter by new phenothiazine derivatives. Biochem. Biophys. Res. Commun. 346,
K. Środa-Pomianek, et al.
45–50. https://doi.org/10.1016/j.bbrc.2006.05.058.
Krishna, R., Mayer, L.D., 2001. Modulation of P-glycoprotein (PGP) mediated multidrug
resistance (MDR) using chemosensitizers: recent advances in the design of selective
MDR modulators. Curr. Med. Chem. Anticancer Agents 1, 163–174.
Lehne, G., 2000. P-glycoprotein as a drug target in the treatment of multidrug resistant
cancer. Curr. Drug Targets 1, 85–99. https://doi.org/10.2174/1389450003349443.
Lin, A., Karin, M., 2003. NF-kappaB in cancer: a marked target. Semin. Cancer Biol. 13,
107–114.
Liu, X., Smith, B.J., Chen, C., Callegari, E., Becker, S.L., Chen, X., Cianfrogna, J., Doran,
A.C., Doran, S.D., Gibbs, J.P., Hosea, N., Liu, J., Nelson, F.R., Szewc, M.A., Van
Deusen, J., 2006. Evaluation of cerebrospinal fluid concentration and plasma free
concentration as a surrogate measurement for brain free concentration. Drug Metab.
Dispos. 34, 1443–1447. https://doi.org/10.1124/dmd.105.008201.
Martínez-Pinilla, E., Oñatibia-Astibia, A., Franco, R., 2015. The relevance of theobromine
for the beneficial effects of cocoa consumption. Front. Pharmacol. 6, 30. https://doi.
org/10.3389/fphar.2015.00030.
Miller, R.L., Bukowski, R.M., Budd, G.T., Purvis, J., Weick, J.K., Shepard, K., Midha, K.K.,
Ganapathi, R., 1988. Clinical modulation of doxorubicin resistance by the calmodulin
inhibitor trifluoperazine: a Phase I/II trial. J. Clin. Oncol. 5, 880–888. https://doi.
org/10.1200/JCO.1988.6.5.880.
Morak-Mlodawska, B., Pluta, K., Latocha, M., Suwinska, K., Jelen, M., Kusmierz, D., 2016.
3,6-Diazaphenothiazines as potential lead molecules - synthesis, characterization and
anticancer activity. J. Enzym. Inhib. Med. Chem. 31, 1512–1519. https://doi.org/10.
3109/14756366.2016.1151014.
Palko-Łabuz, A., roda-Pomianek, K., Uryga, A., Kostrzewa-Susłow, E., Michalak, K., 2017.
Anticancer activity of baicalein and luteolin studied in colorectal adenocarcinoma
LoVo cells and in drug-resistant LoVo/Dx cells. Biomed. Pharmacother. 88, 232–241.
https://doi.org/10.1016/j.biopha.2017.01.053.
Pastan, I., Gottesman, M.M., Ueda, K., Lovelace, E., Rutherford, A.V., Willingham, M.C.,
1988. A retrovirus carrying an MDR1 cDNA confers multidrug resistance and po-
larized expression of P-glycoprotein in MDCK cells. Proc. Natl. Acad. Sci. USA 85,
4486–4490.
Piosik, J., Zdunek, M., Kapuscinski, J., 2002. The modulation by xanthines of the DNA-
damaging effect of polycyclic aromatic agents. Part II. The stacking complexes of
caffeine with doxorubicin and mitoxantrone. Biochem. Pharmacol. 63, 635–646.
https://doi.org/10.1016/S0006-2952(01)00903-0.
Raderer, M., Scheithauer, W., 1993. Clinical trials of agents that reverse multidrug re-
sistance. A literature review. Cancer 72, 3553–3563. https://doi.org/10.1002/1097-
0142(19931215)72:12<3553.
Sabisz, M., Skladanowski, A., 2008. Modulation of cellular response to anticancer treat-
ment by caffeine: inhibition of cell cycle checkpoints, DNA repair and more. Curr.
Pharm. Biotechnol. 9, 325–336.
Sadzuka, Y., Iwazaki, A., Miyagishima, A., Nozawa, Y., Hirota, S., 1995. Effects of me-
thylxanthine derivatives on adriamycin concentration and antitumor activity. Jpn. J.
Cancer Res. 86, 594–599.
Schmidt, M., Teitge, M., Castillo, M.E., Brandt, T., Dobner, B., Langner, A., 2008.
Synthesis and biochemical characterization of new phenothiazines and related drugs
as MDR reversal agents. Arch. Pharm. 341, 624–638. https://doi.org/10.1002/ardp.
200800115.
Seubwai, W., Vaeteewoottacharn, K., Kraiklang, R., Umezawa, K., Okada, S., Wongkham,
S., 2016. Inhibition of NF-κB activity enhances sensitivity to anticancer drugs in
cholangiocarcinoma cells. Oncol. Res. 23, 21–28. https://doi.org/10.3727/
096504015X14424348426071.
Shao, Y., Molnar, L.F., Jung, Y., Kussmann, J., Ochsenfeld, C., Brown, S.T., Gilbert, A.T.,
Slipchenko, L.V., Levchenko, S.V., O'Neill, D.P., DiStasio, R.A., Lochan, R.C., Wang,
T., Beran, G.J., Besley, N.A., Herbert, J.M., Lin, C.Y., Van Voorhis, T., Chien, S.H.,
Sodt, A., Steele, R.P., Rassolov, V.A., Maslen, P.E., Korambath, P.P., Adamson, R.D.,
Austin, B., Baker, J., Byrd, E.F., Dachsel, H., Doerksen, R.J., Dreuw, A., Dunietz, B.D.,
134
European Journal of Pharmacology 849 (2019) 124–134
Dutoi, A.D., Furlani, T.R., Gwaltney, S.R., Heyden, A., Hirata, S., Hsu, C.P., Kedziora,
G., Khalliulin, R.Z., Klunzinger, P., Lee, A.M., Lee, M.S., Liang, W., Lotan, I., Nair, N.,
Peters, B., Proynov, E.I., Pieniazek, P.A., Rhee, Y.M., Ritchie, J., Rosta, E., Sherrill,
C.D., Simmonett, A.C., Subotnik, J.E., Woodcock, H.L., Zhang, W., Bell, A.T.,
Chakraborty, A.K., Chipman, D.M., Keil, F.J., Warshel, A., Hehre, W.J., Schaefer,
H.F., Kong, J., Krylov, A.I., Gill, P.M., Head-Gordon, M., 2006. Advances in methods
and algorithms in a modern quantum chemistry program package. Phys. Chem.
Chem. Phys. 8, 3172–3191. https://doi.org/10.1039/b517914a.
Shin, S.Y., Choi, B.H., Kim, J.R., Kim, J.H., Lee, Y.H., 2006. Suppression of P-glycoprotein
expression by antipsychotics trifluoperazine in adriamycin-resistant L1210 mouse
leukemia cells. Eur. J. Pharm. Sci. 28, 300–306. https://doi.org/10.1016/j.ejps.2006.
03.002.
Skehan, P., Storeng, R., Scudiero, D., Monks, A., McMahon, J., Vistica, D., Warren, J.T.,
Bokesch, H., Kenney, S., Boyd, M.R., 1990. New colorimetric cytotoxicity assay for
anticancer-drug screening. J. Natl. Cancer Inst. 82, 1107–1112.
Smit, H.J., Gaffan, E.A., Rogers, P.J., 2004. Methylxanthines are the psycho-pharmaco-
logically active constituents of chocolate. Psychopharmacology 176, 412–419.
https://doi.org/10.1007/s00213-004-1898-3.
Sugimoto, N., Miwa, S., Hitomi, Y., Nakamura, H., Tsuchiya, H., Yachie, A., 2014.
Theobromine, the primary methylxanthine found in Theobroma cacao, prevents
malignant glioblastoma proliferation by negatively regulating phosphodiesterase-4,
extracellular signal-regulated kinase, Akt/mammalian target of rapamycin kinase,
and nuclear factor-kappa B. Nutr. Cancer 66, 419–423. https://doi.org/10.1080/
01635581.2013.877497.
Szakacs, G., Hall, M.D., Gottesman, M.M., Boumendjel, A., Kachadourian, R., Day, B.J.,
Baubichon-Cortay, H., Di Pietro, A., 2014. Targeting the Achilles heel of multidrug-
resistant cancer by exploiting the fitness cost of resistance. Chem. Rev. 114,
5753–5774. https://doi.org/10.1021/cr4006236.
Sroda-Pomianek, K., Michalak, K., Swiatek, P., Pola, A., Palko-Labuz, A., Wesolowska, O.,
2018. Increased lipid peroxidation, apoptosis and selective cytotoxicity in colon
cancer cell line LoVo and its doxorubicin-resistant subline LoVo/Dx in the presence of
newly synthesized phenothiazine derivatives. Biomed. Pharmacother. 106, 624–636.
https://doi.org/10.1016/j.biopha.2018.06.170.
Sroda-Pomianek, K., Wesolowska, O., Szczesniak-Siega, B., Pula, B., Dziegiel, P.,
Maniewska, J., Malinka, W., Palko-Labuz, A., Michalak, K., 2015. Effect of new
oxicam derivatives on efflux pumps overexpressed in resistant a human colorectal
adenocarcinoma cell line. Anticancer Res. 35, 2835–2840.
Takacs, D., Egyed, O., Drahos, L., Szabo, P., Jemnitz, K., Szabo, M., Veres, Z., Visy, J.,
Molnar, J., Riedl, Z., Hajos, G., 2013. Synthesis and pharmacological investigation of
new N-hydroxyalkyl-2-aminophenothiazines exhibiting marked MDR inhibitory ef-
fect. Bioorg. Med. Chem. 21, 3760–3779. https://doi.org/10.1016/j.bmc.2013.04.
034.
Takacs, D., Csonka, A., Horvath, A., Windt, T., Gajdacs, M., Riedl, Z., Hajos, G., Amaral,
L., Molnar, J., Spengler, G., 2015. Reversal of ABCB1-related multidrug resistance of
colonic adenocarcinoma cells by phenothiazines. Anticancer Res. 35, 3245–3251.
Tsuruo, T., Iida, H., Tsukagoshi, S., Sakurai, Y., 1982. Increased accumulation of vin-
cristine and adriamycin in drug-resistant P388 tumor cells following incubation with
calcium antagonists and calmodulin inhibitors. Cancer Res. 42, 4730–4733.
Wesolowska, O., 2011. Interaction of phenothiazines, stilbenes and flavonoids with
multidrug resistance-associated transporters, P-glycoprotein and MRP1. Acta
Biochim. Pol. 58, 433–448.
Wesolowska, O., Molnar, J., Ocsovszki, I., Michalak, K., 2009. Differential effect of
phenothiazines on MRP1 and P-glycoprotein activity. In Vivo 23, 943–947.
Wu, C.H., Bai, L.Y., Tsai, M.H., Chu, P.C., Chiu, C.F., Chen, M.Y., Chiu, S.J., Chiang, J.H.,
Weng, J.R., 2016. Pharmacological exploitation of the phenothiazine antipsychotics
to develop novel antitumor agents-A drug repurposing strategy. Sci. Rep. 6, 27540.
https://doi.org/10.1038/srep27540.