Eur J Appl Physiol (2013) 113:951–963
DOI 10.1007/s00421-012-2504-8
ORIGINAL ARTICLE
Exercise with low glycogen increases PGC-1a gene expression
in human skeletal muscle
Niklas Psilander • Per Frank • Mikael Flockhart
Kent Sahlin
Received: 2 April 2012 / Accepted: 17 September 2012 / Published online: 2 October 2012
Ó Springer-Verlag Berlin Heidelberg 2012
Abstract Recent studies suggest that carbohydrate
restriction can improve the training-induced adaptation of
muscle oxidative capacity. However, the importance of low
muscle glycogen on the molecular signaling of mitochon-
drial biogenesis remains unclear. Here, we compare the
effects of exercise with low (LG) and normal (NG) gly-
cogen on different molecular factors involved in the reg-
ulation of mitochondrial biogenesis. Ten highly trained
cyclists (VO2max 65 ± 1 ml/kg/min, Wmax 387 ± 8 W)
exercised for 60 min at approximately 64 % VO2max with
either low [166 ± 21 mmol/kg dry weight (dw)] or normal
(478 ± 33 mmol/kg dw) muscle glycogen levels achieved
by prior exercise/diet intervention. Muscle biopsies were
taken before, and 3 h after, exercise. The mRNA of per-
oxisome proliferator-activated receptor-c coactivator-1 was
enhanced to a greater extent when exercise was performed
with low compared with normal glycogen levels (8.1-fold
vs. 2.5-fold increase). Cytochrome c oxidase subunit I and
pyruvate dehydrogenase kinase isozyme 4 mRNA were
increased after LG (1.3- and 114-fold increase, respec-
tively), but not after NG. Phosphorylation of AMP-acti-
vated protein kinase, p38 mitogen-activated protein kinases
and acetyl-CoA carboxylase was not changed 3 h post-
Communicated by Martin Flueck.
N. Psilander and P. Frank contributed equally to this work.
N. Psilander (&)
P. Frank
M. Flockhart
K. Sahlin
The Åstrand Laboratory of Work Physiology, GIH,
The Swedish School of Sport and Health Sciences,
Box 5626, 114 86 Stockholm, Sweden
e-mail: niklas.psilander@gih.se
N. Psilander
P. Frank
K. Sahlin
Department of Physiology and Pharmacology,
Karolinska Institutet, Stockholm, Sweden
•
exercise. Mitochondrial reactive oxygen species production
and glutathione oxidative status tended to be reduced 3 h
post-exercise. We conclude that exercise with low glyco-
gen levels amplifies the expression of the major genetic
marker for mitochondrial biogenesis in highly trained
cyclists. The results suggest that low glycogen exercise
may be beneficial for improving muscle oxidative capacity.
Keywords Train low
Carbohydrate restriction

Gene expression
PGC-1a
Oxidative stress
Introduction
Muscle glycogen is an essential fuel during intensive
exercise, and muscle fatigue is closely related to depleted
glycogen stores (Bergstrom et al. 1967). In contrast, recent
studies suggest that restricted carbohydrate (CHO) avail-
ability may enhance the adaptative response to endurance
training (Baar and McGee 2008; Burke et al. 2011; Hansen
et al. 2005; Hulston et al. 2010) giving rise to the expres-
sion ‘‘train low–compete high’’. However, it remains
unclear whether the mechanism for the enhanced training
response is related to exercise with low muscle glycogen or
to other metabolic or exercise-related factors.
The initial study within this area used an experimental
model where subjects trained every day with one leg and
twice every second day with the other leg. Muscle glyco-
gen was reduced during the second bout of exercise in the
leg training twice every second day and after 10 weeks of
training this leg had both greater citrate synthase (CS)
activity and endurance performance (one leg knee exten-
sion exercise, 20 vs. 12 min) compared with the leg that
trained once daily (Hansen et al. 2005). Following studies,
that used a whole body training approach, confirmed that
123
952
mitochondrial markers, such as CS (Yeo et al. 2008) and
succinate dehydrogenase (Morton et al. 2009) are induced
to a greater extent when training twice every second day.
The difference in glycogen between the once-per-day and
twice-every-second day groups were, however, relatively
small (Morton et al. 2009; Yeo et al. 2008) and it remains
unclear if the observed increase in mitochondrial biogen-
esis is related to exercise with low muscle glycogen or to
other factors related to the timing of exercise sessions.
Understanding of the molecular signaling involved in
the muscle adaptive response has increased considerably
during the last decade. Peroxisome proliferator-activated
receptor-c coactivator-1 (PGC-1a) is considered to be the
master regulator of mitochondrial gene expression (Lin
et al. 2005). PGC-1a is a transcriptional coactivator that
activates numerous mitochondrial transcription factors
such as the nuclear respiratory factors (NRF-1 and -2) and
the mitochondrial transcription factor A (Tfam) (Gleyzer
et al. 2005; Jager et al. 2007). PGC-1a is also involved in
the regulation of fuel selection and can enhance fat
metabolism by inducing the expression of pyruvate dehy-
drogenase kinase, isozyme 4 (PDK4) (Olesen et al. 2010).
Other potential genes involved in the regulation of mito-
chondrial biogenesis are PGC-1-related coactivator (PRC),
peroxisome proliferator-activated receptor d (PPARd) and
the cytochrome c oxidase subunits (COX I–IV). AMP-
activated protein kinase (AMPK) and p38 mitogen-acti-
vated protein kinases (MAPK) are up-stream proteins that
have been identified as major regulators of PGC-1a and
mitochondrial biogenesis. Recent studies have also asso-
ciated reactive oxygen species (ROS) with mitochondrial
biogenesis and increased PGC-1a expression (Kang et al.
2009; Powers et al. 2011), possibly mediated by AMPK
activation (Irrcher et al. 2009; Katz 2007).
Several studies have shown that restricted CHO supply
affects the acute molecular response to exercise. In one
study restricted CHO intake post-exercise prolonged the
expression of PGC-1a and other genes regulating mito-
chondrial biogenesis (Pilegaard et al. 2005) and in another
study, where exercise was performed with reduced muscle
glycogen content, there was an increased expression of
genes related to lipid metabolism (Pilegaard et al. 2002).
Restricted CHO availability during or after exercise has
also been shown to augment phosphorylation of (i.e. acti-
vate) MAPK (Cochran et al. 2010) and AMPK (Yeo et al.
2010). Although these studies suggest that the signaling
response to exercise is affected by CHO supply, it remains
unclear whether exercise in a glycogen-depleted state can
enhance the adaptive signaling response for mitochondrial
biogenesis.
The purpose of the present investigation was twofold:
(1) to determine if exercise in a glycogen-depleted state
enhances expression of PGC-1a and other genes related to
123
Eur J Appl Physiol (2013) 113:951–963
mitochondrial biogenesis and CHO metabolism, and (2) to
investigate the role of oxidative stress and/or other poten-
tial signaling pathways. We hypothesized that low glyco-
gen exercise would enhance the expression of genes
regulating mitochondrial biogenesis and that this effect is
mediated in part by increased ROS production.
Materials and methods
Subjects
Ten highly trained male cyclists volunteered to participate
in the study. They were all competing at the national level
or had been competing at the national elite level during the
preceding years in road or mountain biking. Average
[mean ± standard error (SE)] age, body weight, height,
and VO2max were 27.8 ± 1.6 years, 74.7 ± 2.0 kg, 183 ±
2 cm, and 4.9 ± 0.1 l/min or 65.4 ± 0.9 ml/kg/min. Sub-
jects were informed about the possible risks and discom-
forts involved in the experiment prior to giving their
written consent to participate in the study. The study design
was approved by the Regional Ethics Committee of
Stockholm, Sweden.
Preliminary testing
Preliminary testing was performed at least 1 week before
the first trial with a Monark 839E ergometer (Monark
Exercise, Varberg, Sweden). The seat and handlebar height
were adjusted to fit each subject and were maintained
during all the following experimental sessions. VO2max was
determined with a standardized two stage incremental
exercise protocol (Wang et al. 2009). The first part (4 min
exercise at 5 submaximal intensities) was used to establish
the relation between VO2 and work rate (W) and to get a
rough estimate of the work rate corresponding to VO2max.
After 4 min active rest, the work rate was increased rapidly
until voluntary exhaustion with a protocol designed to elicit
VO2max after 7–8 min. VO2max was defined as the highest
recorded oxygen uptake during 60 consecutive seconds.
Experimental protocol
Subjects participated in two experimental sessions sepa-
rated by at least 1 week in a crossover design with ran-
domized order (Fig. 1). In one of the sessions, subjects had
a high CHO (NG) diet and in the other a low CHO (LG)
diet (see below for details). Both sessions included two
exercise tests separated by about 14 h. The purpose of the
first exercise was to deplete muscle glycogen (depletion
exercise) and the second exercise to test the influence of
low muscle glycogen on the signaling response (test
Eur J Appl Physiol (2013) 113:951–963
exercise). Subjects were instructed to refrain from exhaus-
tive exercise and alcohol during the 2 days prior to the
experiment. Subjects arrived to the laboratory in the after-
noon (approximately 15:00) and a blood sample was taken
from an arm vein and a muscle biopsy sample was obtained
from the middle portion of the vastus lateralis muscle of one
leg. The depletion exercise started with 45 min cycling at
75 % VO2max followed by eight intervals at 88 % VO2max
(duty cycle 4 min exercise and 4 min active rest at 100 W),
and ended with an additional 45 min at 70 % VO2max. The
test exercise was performed the following morning, about
14 h after the depletion exercise, and included six intervals
of 10 min cycling with 4 min active rest (100 W) between
intervals. The first interval was at 72.5 % VO2max after
which the work rate was reduced 2.5 % during each interval
(last interval 60 % VO2max). Capillary blood samples were
collected from fingertips before test exercise and during the
last seconds of intervals 2, 4, and 6 and were analyzed for
lactate and glucose. Venous blood samples and muscle
biopsies were obtained approximately 15 min before and
3 h after the test exercise.
Dietary intervention
Subjects recorded their food intake during the 24-h period
preceding the first experiment and were instructed to
duplicate this prior to the second experiment. During and
after the glycogen depletion exercise on day 1 and the
following test exercise on day 2, subjects either consumed
a high CHO (NG) or low CHO (LG) diet as shown in
Fig. 1. The NG diet included two high CHO meals [dinner
(pasta with meat sauce and lemonade): 1.83 g CHO, 0.53 g
protein and 0.14 g fat/kg body weight (bw); breakfast (oat
meal and orange juice): 1.54 g CHO, 0.31 g protein and
0.12 g fat/kg bw] and eight high CHO beverages [50/50 %
maltodextrin-dextrose powder (Carbo 136, Dalblads,
~2.5 h ~14 h
Depletion exercise:
45 min at 75 % +
8x4 min at 88 % separated
by 4 min at 100 W+
45 min at 70 % of VO2max
B B B B
Meal
~21:30
S1
(~ 15:45 PM)
Fig. 1 Schematic illustration of the experimental design. B beverages
containing CHO (NG normal glycogen) or only water (LG low
glycogen). Meals contained either high (NG) or low CHO (LG).
Beverages and meals post-exercise were separated by *1 h intervals
and the beverages served during exercise were consumed ad libitum.
953
Sweden) dissolved in water: 1.0 g CHO/kg bw]. A banana
was served together with beverage nr. 3, 5, 7 and 8 adding
an additional of 0.31 g CHO, 0.01 g protein and 0.01 g fat/
kg bw. The NG diet provided a total of 12.6 g CHO, 0.9 g
protein and 0.3 g fat/kg bw (approximately 57 kcal/kg bw
*4,275 kcal). The LG diet included two low CHO meals
[dinner and breakfast (egg and bacon):\0.02 g CHO, 0.6 g
protein and 0.8 g fat/kg bw] and provided a total of
\0.04 g CHO, 1.2 g protein and 1.6 g fat/kg bw (approx-
imately 19 kcal/kg bw *1,425 kcal). The energy content
of the two meals was similar in NG and LG. NG provided
88 % of total energy intake from CHO, 6 % from protein
and 6 % from fat while LG provided less than 1 % of total
energy intake from CHO, 22 % from protein, and 77 %
from fat. Water was consumed ad libitum during the
exercise sessions in the first trial and the same volume was
consumed during the second trial.
Analysis of blood samples
Blood (4 ml) was sampled from an antecubital vein and
centrifuged at 1,500 g at 4 °C for 10 min. Plasma was
stored at -20 °C for later analysis of free fatty acids (FFA)
and glucose. A commercially available colorimetric enzy-
matic procedure (NEFA C test kit; Wako Chemicals
GmbH, Neuss, Germany) was used for determining plasma
FFA concentration. Blood samples were analyzed for lac-
tate and glucose concentration with an automated analyzer
(Biosen 5140, EKF Diagnostics, Barleben, Germany).
Muscle biopsies
Muscle samples were obtained from the middle portion of
the vastus lateralis muscle through an incision made
through the skin and fascia at one-third the distance
between the patella and anterior superior iliac spine, using
~1.5 h ~3 h
Test exercise:
6x10 min at
~64% of VO2max
separated by
4 min at 100 W
B B B B
Meal
~6:30
S2 S3
(~ 8:15 AM) (~ 12:45 PM)
Muscle biopsies and venous blood samples were obtained approxi-
mately 15 min before the depletion (S1) and test exercise (S2) as well
as 3 h after the test exercise (S3). See ‘‘Materials and methods’’ for
more details
123
954
the percutaneous needle biopsy technique with suction
(Bergstrom 1975). Muscle samples were separated into two:
one part for mitochondrial respiration analysis and the other
rapidly frozen in liquid nitrogen and stored at -80 °C.
Muscle biopsy samples contain a variable amount of non-
muscle constituents (connective tissue, blood and fat),
which would add variability in the reference base used for
glycogen (muscle weight). Presence of blood and fat may
also interfere with the biochemical analysis e.g. glutathione
status. The frozen samples were therefore freeze-dried,
powdered, dissected free of blood, fat and connective tissue,
and stored at -80 °C for later determination of glycogen
and mRNA content, as well as protein phosphorylation
levels and glutathione status.
Glycogen and mRNA analysis
Glycogen was analyzed in 1–2 mg freeze-dried muscle
according to the method previously described by Harris
et al. (1974), which includes enzymatic hydrolysis of gly-
cogen followed by enzymatic analysis of glucose. For
mRNA analysis, total RNA was extracted from 2–5 mg
freeze-dried muscle tissue using a Polytron PT 1600 E
homogenizer (Kinematica, Lucerne, Switzerland) and a
PureZOL RNA isolation kit according to the manufacturer’s
instructions (Bio-Rad Laboratories AB, Sundbyberg, Swe-
den). The yield and quality of extracted RNA were esti-
mated by spectrometry and micro-gel electrophoresis
(Experion, Bio-Rad). The 260/280 absorbance ratios were
within 1.9–2.1 (in Tris–EDTA buffer, pH 8.0) and the RNA
quality indicator values (RQI) were greater than 0.7. RNA
(1 lg) was reverse transcribed to cDNA (20 ll) using the
iScript cDNA synthesis kit (Bio-Rad). Real-time RT-PCR
was performed with an iCycler (Bio-Rad) in a mixture
containing 12.5 ll 29 SYBR Green Supermix (Bio-Rad),
0.5 ll of both the forward and reverse primers (final con-
centrations 10 lM), and 11.5 ll template cDNA. All reac-
tions were performed in triplicate with GAPDH as reference
gene (Livak and Schmittgen 2001). The nucleotide
sequences of the primers are presented in Table 1. The
melting curves of the PCR product showed only one peak,
demonstrating specificity of the primers and absence of
contamination. The cDNA concentration, annealing tem-
perature and thermocycling conditions were optimized for
each primer pair, and assay sensitivity was high for all PCR
products (RSq [0.99, and efficiency [90 %). The com-
parative critical threshold (CT) method could therefore be
used to calculate changes in mRNA levels.
Mitochondrial respiration and ROS generation
Mitochondrial respiration and ROS emission were measured
in permeabilized muscle fiber bundles. Permeabilization was
123
Eur J Appl Physiol (2013) 113:951–963
achieved by adding the muscle sample (10–25 mg wet
weight) into ice-cold permeabilization solution (in mM):
CaK2EGTA (2.8), K2EGTA (7.2), Na2ATP (5.8), MgCl2
(6.6), taurine (20), Na2phosphocreatine (15), imidazole (20),
dithiothreitol (0.5) and MES (50). The pH was adjusted to
7.1. The specimen was split into 2–5 mg fiber bundles and
each bundle was mechanically separated using surgical
needles into a network formation to expose fiber membranes
to the surrounding medium. The bundles were incubated with
saponin (50 lg/ml), washed twice, and put in storage med-
ium (in mM): EGTA (0.5), MgCl2 (3), K-lactobionate (60),
taurine (20), KH2PO4 (10), HEPES (20), sucrose (110) and
bovine serum albumin (BSA 1 g/l), adjusted to pH 7.1.
Mitochondrial respiration was measured with a Clark-type
electrode (Hansatech instruments, Kings Lynn, England) in a
water-jacketed glass chamber at 25 °C. Permeabilized mus-
cle fiber bundles (n = 8) were added to the storage medium
supplemented with benzyltoluene sulfonamide (45 lM) to
prevent fiber contraction. The oxygen consumption was
measured after sequential additions of: octanoyl-carnitine
(1.5 mM), ADP (5 mM), pyruvate (20 mM), glutamate
(5 mM), succinate (5 mM), and cytochrome c (10 lM). The
rate of mitochondrial H2O2 production was measured with
Amplex red (Invitrogen, Eugene, OR, USA), which, in the
presence of peroxidase enzyme, reacts with H2O2 and pro-
duces the red fluorescent compound Resorufin. Permeabili-
zed fiber bundles (n = 8) were added to the measuring
medium (in mM): mannitol (225), sucrose (75), Tris-base
(10), K2HPO4 (10), EDTA (0.1), MgCl2 (0.08), BSA (2 g/l),
horseradish peroxidase (13.5 U/ml), benzyltoluene sulfon-
amide (45 lM) and superoxide dismutase (SOD; 45 U/ml)
adjusted to pH 7.1 and kept at 30 °C. The change in fluo-
rescence was recorded on a Hitachi f-2500 fluorescence
spectrophotometer equipped with a magnetic stirrer (Tokyo,
Japan) after subsequent additions of: octanoyl-carnitine
(1.5 mM), pyruvate (5 mM), succinate (5 mM) and rotenone
(0.5 lM). Due to limited material in some muscle samples,
mitochondrial respiration and H2O2 production analysis was
only performed in eight of the ten subjects.
Western immunoblot analysis
Western blot analysis was performed in freeze-dried muscle
tissue. The samples were homogenized using glass homog-
enizers in ice-cold buffer (80 ll/mg tissue; in mM): HEPES
(2), EDTA (1), EGTA (5), MgCl2 (10), b-glycerophosphate
(50), Triton X-100 (1 %), Na3VO4 (1), dithiothreitol (2),
leupeptin (20 lg/ml), aprotinin (50 lg/ml), phosphatase
inhibitor cocktail (1 %; Sigma, St Louis, MO, USA), PMSF
(40 lg/ll). The homogenate was centrifuged at 10,000 g for
10 min to pellet the insoluble debris and the supernatant was
stored at -80 °C. The protein concentration of the super-
natant was determined with the bicinchoninic acid assay
Eur J Appl Physiol (2013) 113:951–963 955

Table 1 Details of primers used for RT-qPCR

Gene General description of Forward Reverse Genebank
protein

PGC-1a Transcriptional CAAGCCAAACCAACAACTTTATCTCT CACACTTAAGGTGCGTTCAATAGTC NM_013261

coactivator involved in
mitochondrial
biogenesis
PRC Transcriptional GCTGAAACAGAGGTTCTCCG AAAGTCTTCCCGGTTGGAGT AF325193
coactivator involved in
mitochondrial
biogenesis
PPARd Transcription factor ATGGAGCAGCCACAGGAGGAAGCC GCATGAGGCCCCGTCACAGC NM_006238
involved in metabolism
PDK4 Promotes lipid oxidation TCCACTGCACCAACGCCT TGGCAAGCCGTAACCAAAA NM_002612
by inhibiting pyruvate
dehydrogenase
COX I Subunit of a CTATACCTATTATTCGGCGCATGA CAGCTCGGCTCGAATAAGGA NC_012920
transmembrane protein
in the electron transport
chain
Tfam Transcription factor AGATTCCAAGAAGCTAAGGGTGATT TTTCAGAGTCAGACAGATTTTTCCA NM_003201
involved in
mitochondrial
biogenesis
NRF2 Transcription factor AAATTGAGATTGATGGAACAGAGAA TATGGCCTGGCTTACACATTCA EU159453
involved in
mitochondrial
biogenesis
Sirt1 NAD-dependent TACGACGAAGACGACGACGA AAGGTTATCTCGGTACCCAATCG NM_012238
deacetylase that
promotes the activation
of transcription factors
such as PGC-1a
CS Promotes the formation GACTACATCTGGAACACACTCAACTCA CGCGGATCAGTCTTCCTTAGTAC NM_004077
of citrate from acetyl
coenzyme A and
oxaloacetat in the citric
acid cycle
GAPDH Promotes the formation AACCTGCCAAATATGATGAC TCATACCAGGAAATGAGCTT NM_002046
of 1,3-
bisphosphoglycerate
from glyceraldehyde
3-phosphate in the
glycolysis pathway
PGC-1a peroxisome proliferative-activated receptor-c coactivator 1a, PRC PGC-1-related coactivator, PPARd peroxisome proliferator-activated
receptors d, PDK4 pyruvate dehydrogenase kinase isozyme 4, COX I cytochrome c oxidase subunit I, Tfam mitochondrial transcription factor A,
NRF2 nuclear respiratory factor 2, Sirt1 silent mating-type information regulator 2 homolog 1, CS citrate synthase, GAPDH glyceraldehyde
3-phosphate dehydrogenase

(Pierce Biotechnology, Rockford, IL, USA) by measuring
the absorbance at 560 nm with a Tecan infinite F200 pro
plate reader (Männedorf, Switzerland). The samples were
diluted with Laemmli sample buffer (Bio-Rad, Richmond,
CA, USA) and homogenizing buffer (1:1) to 1.5 lg/ll final
protein concentration and heated to 95 °C for 5 min to
denature proteins. The diluted samples were stored at
-20 °C. The proteins in the diluted samples were separated
by SDS-PAGE (Criterion cell gradient gels, Bio-Rad) for 2 h
at 200 V on ice and then transferred to polyvinylidene
fluoride membranes (Bio-Rad) for 3 h at 300 mA on ice. The
amount of protein loaded to the membranes (30 lg) was kept
constant for all samples and was verified by staining with
MemCode Reversible Protein Stain Kit (ThermoScientific,
Rockford, IL, USA). After blocking for 1 h at room tem-
perature in 5 % non-fat milk, the membranes were incubated
overnight with primary antibodies: Malondialde-
hyde (MDA; 1:500; Nordic BioSite, Täby, Sweden),
p-AMPKThr172 (1:1,000), p-acetyl-CoA carboxylase
(ACCS79; 1:1,000) p-pMAPKTT180/Y182 (1:1000), and

123
956
b-tubulin (1:1000, Cell Signalling, Beverly, MA, USA).
This was followed by 1 h incubation with anti-rabbit HRP
(1:10,000) as secondary antibody. The antibodies were
visualized by chemiluminescent detection on a Molecular
Imager ChemiDoc XRS system and the bands were analyzed
using Quantity One version 4.6.3 software (Bio-Rad). Evi-
dence of the specificity of the primary antibodies used in this
study has been provided by the producer (Cell Signalling,
Beverly, MA, USA).
Glutathione analysis
Glutathione in reduced (GSH) and oxidized (GSSG) form
were determined with the Bioxytech GSH/GSSG-412 assay
(Oxis Research, Foster City, CA, USA). The freeze-dried
muscle tissue was divided into two aliquots and homogenized
using glass homogenizers in ice-cold buffer (80 ll/mg)
containing (in mM): Tris buffer (10), EDTA (1), EGTA (1),
Na-orthovanadate (2), Na-pyrophosphate (2), NaF (5) and
protease inhibitor cocktail, with or without 1-methyl-2-vi-
nylpyridinium trifluoromethanesulfonate (M2VP), a scav-
enger of reduced GSH. Following 5 min incubation with 1 %
Triton X-100 (room temperature for M2VP aliquot and ice
cold for the M2VP free aliquot), 5 % metaphosphoric acid
was added and the aliquots were centrifuged at 13,000 g for
10 min. The supernatant (5 ll) was diluted 1:20 with
homogenization buffer and 100 ll chromogen, glutathione
reductase and NADPH was added, followed by spectropho-
tometric measurement of the change in absorbance at 412 nm
over 3 min. Reduced GSH was calculated from the mea-
surements of total GSH (without M2VP in homogenate) and
GSSG (with M2VP in homogenate). Due to lack of muscle
material, GSSG and GSH analyses were performed in only
five of the ten subjects. GSSG values are expressed in GSH
units, i.e. 1 GSSG = 2 GSH.
Statistical analysis
All data are expressed as the mean ± SE and analyzed by
two-way repeated measures ANOVA (time and dietary
intervention). When a significant primary effect or inter-
action was observed, post hoc analyses (Fisher LSD) were
performed to locate the differences. Statistical significance
was accepted at a P level less than 0.05.
Results
Physiological and metabolic responses to exercise
To deplete muscle glycogen stores, subjects performed an
exercise session 14 h prior to the test exercise. The average
power output of the depletion exercise was 273 ± 23 W
123
Eur J Appl Physiol (2013) 113:951–963
(74.3 ± 3.1 % VO2max) and the duration was 122 min. Cor-
responding values of test exercise were 226 ± 20 W (63.6 ±
4.3 % VO2max) and 60 min. Power output was adjusted during
the second session to match the power and duration of the first
session. However, two subjects with NG in the first session
were not able to repeat test exercise in the second session with
LG, and the work rate was therefore reduced.
Muscle glycogen content was reduced 14 h after the
depletion exercise to 27 % (LG) and 74 % (NG) of the initial
level, respectively (P \ 0.01, LG vs. NG), but was not
further reduced by the subsequent test exercise (Table 2).
FFA, measured in blood samples obtained *15 min before
the muscle biopsies, were unchanged in NG but increased in
LG (P \ 0.01 LG vs. NG, Table 2). In the same samples,
blood glucose was slightly reduced in both NG and LG, with
no difference between conditions, and insulin was reduced
in LG and slightly elevated in NG (P \ 0.01 LG vs. NG,
Table 2). Lactate, measured in capillary blood samples
before, during and immediately after test exercise, remained
at a low level during both NG (\2.7 mmol/l) and LG
(\1.4 mmol/l). Glucose, measured in the same samples,
decreased immediately after test exercise in both NG (from
5.0 ± 0.2 to 4.3 ± 0.2 mmol/l) and LG (from 4.1 ± 0.1 to
2.5 ± 0.2 mmol/l) and was significantly higher in NG vs.
LG at all time points (P \ 0.01).
Gene expression and protein phosphorylation
The mRNA content of the master regulator of mitochondrial
biogenesis (PGC-1a) was not changed 14 h after depletion
exercise (pre-test exercise) but was significantly increased
3 h after the test exercise in both conditions (Fig. 2). The
increase was, however, much more pronounced in LG than
in NG (8.1-fold vs. 2.5-fold, P \ 0.01). The mRNA content
of two other regulators of mitochondrial biogenesis (PRC
and Tfam) also increased significantly but with no difference
between conditions (time-dependent effect, P \ 0.01;
Fig. 2). The mRNA content of genes for oxidative metab-
olism enzymes (PDK4 and COX I) only increased after LG
with a significant difference between the two conditions
(P \ 0.01; Fig. 3). The mRNA content of CS, Sirt1, NRF1
and PPARd did not change under any conditions (Table 3).
In addition, phosphorylation of proteins involved in the
upstream signaling pathways of mitochondrial biogenesis
(p-AMPKThr172, p-p38MAPKT180/Y182) and the downstream
target of AMPK (ACCS79) did not change significantly 3 h
after test exercise in any of the conditions (Table 4; Fig. 4).
Mitochondrial respiration and markers for oxidative
stress
Mitochondrial respiration, measured after sequential addi-
tions of ADP and substrates, was similar before and after
Eur J Appl Physiol (2013) 113:951–963
Table 2 Effect of exercise and diet on muscle glycogen, plasma FFA, glucose and insulin
Pre-depletion exercise
Gly
LG 623 ± 57
NG 645 ± 42
FFA
LG 0.31 ± 0.07
NG 0.23 ± 0.04
Glu
LG 6.0 ± 0.4
NG 5.8 ± 0.3
Ins
LG 13.4 ± 3.3
NG 11.3 ± 2.3
Muscle and blood samples were obtained before the depletion exercise on day 1 (pre-depletion exercise), before the test exercise on day 2 (pre-
test exercise) and 3 h after the test exercise on day 2 (post-test exercise)
Gly muscle glycogen (mmol/kg dw), FFA venous plasma free fatty acids (mmol/l), Glu venous plasma glucose (mmol/l), Ins venues plasma
insulin (mU/l), LG low glycogen, NG normal glycogen
Values are reported as mean ± SE from 10 subjects
  
* P \ 0.05 and ** P \ 0.01 versus pre-depletion exercise;
exercise, without any difference between LG and NG (data
not shown). Mitochondrial H2O2 production, measured with
a cocktail of substrates (octanoyl-carnitine, pyruvate and
succinate), tended to be reduced (P = 0.053), 3 h after the
test exercise (Fig. 5). Glutathione status after test exercise
also indicated reduced oxidative stress, as the GSSG/GSH
ratio tended to be lower (P = 0.076; Fig. 5). There were no
differences in mitochondrial H2O2 production and glutathi-
one status between LG and NG. MDA, a marker for lipid
peroxidation (expressed as arbitrary units relative to
b-tubulin), was in the pre-depletion exercise: 0.17 ± 0.03
(LG) and 0.17 ± 0.02 (NG) and in the post-test exercise:
0.19 ± 0.03 (LG) and 0.18 ± 0.02 (NG). There were no
differences between time points or conditions.
Discussion
By combining exercise with dietary intervention, we pro-
duced two conditions with substantial differences in mus-
cle glycogen prior to a standardized test exercise. The
major new finding in this study was that exercise with low
muscle glycogen enhanced the expression of genetic
markers of mitochondrial biogenesis (PGC-1a and COX I).
Only one previous study used an experimental design
similar to the present study to investigate the effects of
CHO restriction on the acute regulation of mitochondrial
biogenesis (Cochran et al. 2010). However, reduced CHO
availability had no effect on PGC-1a or COX IV expres-
sion in that study. This discrepancy can be explained by
957
Pre-test exercise Post-test exercise
166 ± 21**,## 130 ± 17**,##
478 ± 33** 477 ± 31**
0.66 ± 0.05**,## 1.21 ± 0.18**,##,  
0.10 ± 0.02 0.03 ± 0.01
5.0 ± 0.1** 4.3 ± 0.2**
5.1 ± 0.1 5.0 ± 0.3*
5.3 ± 0.7*,# 1.4 ± 0.5**,##
13.0 ± 2.1 18.2 ± 3.8*
# ##
P \ 0.01 versus pre-test exercise; P \ 0.05 and P \ 0.01 LG versus NG
differences in the experimental protocols. In contrast to the
present study where muscle glycogen was threefold higher
for NG than for LG, muscle glycogen was similar between
conditions in the study by Cochran et al. (2010), most
likely due to the short recovery period (3 vs. 14 h in the
present study). Secondly, muscle biopsies were taken
immediately after the test exercise (Cochran et al. 2010)
whereas muscle biopsies in the present study were taken
3 h after the test exercise. It is well established that the
exercise-induced increase of PGC-1a mRNA occurs with a
delay of several hours, and differences in expression are
therefore not expected to occur that early in the recovery
period.
Previous studies have shown that the exercise-induced
increase in PGC-1a mRNA is not affected by CHO
restriction during the first 2–5 h of recovery (Cluberton
et al. 2005; Cochran et al. 2010; Mathai et al. 2008;
Pilegaard et al. 2005). The augmented PGC-1a expression
observed 3 h after the test exercise in LG (Fig. 2) can
therefore not be explained by CHO restriction during the
recovery period, but most likely by exercise with low
glycogen. Muscle glycogen was reduced prior to test
exercise both during LG (from 623 to 166 mmol/kg dw)
and NG (from 645 to 478 mmol/kg dw), but the increase in
PGC-1a mRNA after test exercise was more than fourfold
higher in LG than after NG. This supports the idea that the
activation of metabolic genes by exercise might be sensi-
tive to a critically low ‘‘threshold’’ level of glycogen
(Pilegaard et al. 2002) and that this threshold is somewhere
between 478 and 133 mmol/kg dw. Further evidence for
123
958 Eur J Appl Physiol (2013) 113:951–963

7 NG ## 6 ##
NG
6 LG ** 5 LG ## **
**
PGC1α mRNA (AU)

PDK4 mRNA (AU)

5
4
4
3
3

2 * 2

1
1

0 0
Pre-depletion Pre-test Post-test Pre-depletion Pre-test Post-test
exercise exercise exercise exercise exercise exercise

6 §§ 3 ##

5
* *

COX I mRNA (AU)

PRC mRNA (AU)

4 2

2 1

0 0
Pre-depletion Pre-test Post-test Pre-depletion Pre-test Post-test
exercise exercise exercise exercise exercise exercise

Fig. 3 Effect of exercise on PDK4 and COX I mRNA levels. Muscle

5
§§ samples were obtained before the depletion exercise on day 1 (pre-
§§ depletion exercise), before the test exercise on day 2 (pre-test
4 exercise) and 3 h after the test exercise on day 2 (post-test exercise).
Tfam mRNA (AU)

Values are expressed in arbitrary units (AU) related to the reference

gene GAPDH, and are reported as the mean ± SE, n = 10. For
3 abbreviations of genes see Table 1 legend. LG low glycogen, NG
normal glycogen. *P \ 0.05 and **P \ 0.01 versus Pre-depletion
exercise; ##P \ 0.01 LG versus NG
2

this idea is found in the study by Mathai et al. (2008) where

1
0
Pre-depletion Pre-test Post-test
exercise exercise exercise
Fig. 2 Effect of exercise on markers of mitochondrial biogenesis.
Muscle samples were obtained before the depletion exercise on day 1
(pre-depletion exercise), before the test exercise on day 2 (pre-test
exercise) and 3 h after the test exercise on day 2 (post-test exercise).
Values are expressed in arbitrary units (AU) related to the reference
gene GAPDH, and are reported as the mean ± SE, n = 10. For
abbreviations of genes see Table 1 legend. LG low glycogen, NG
normal glycogen. *P \ 0.05 and **P \ 0.01 vs. pre-depletion
exercise; ##P \ 0.01 LG versus NG; §§P \ 0.01 versus pre-depletion
exercise (time-dependent effect)
a large glycogen reduction during exercise was associated
with a large increase in PGC-1a protein abundance. An
interesting finding in the present study was that muscle
glycogen did not decrease further during the test exercise,
probably due to the low exercise intensity (64 % of
VO2max) and the high aerobic training status of the subjects.
The stimulus for augmented PGC-1a expression in LG is
thus not exercise leading to glycogen depletion but rather
exercise with low muscle glycogen stores. Furthermore, the
finding that PGC-1a mRNA was not elevated 14 h after
depletion exercise despite markedly reduced muscle gly-
cogen demonstrates that low muscle glycogen per se is not
sufficient to enhance the signaling pathway.

123
Eur J Appl Physiol (2013) 113:951–963 959

Table 3 Expression of genes related to mitochondrial biogenesis

Pre-depletion exercise Pre-test exercise Post-test exercise

CS
LG 2.80 ± 0.29 3.09 ± 0.28 3.24 ± 0.35
NG 2.69 ± 0.39 3.39 ± 0.33 2.95 ± 0.30
Sirt1
LG 0.93 ± 0.24 0.88 ± 0.24 1.00 ± 0.24
NG 0.88 ± 0.21 0.80 ± 0.19 1.02 ± 0.22
NRF2
LG 1.86 ± 0.35 2.27 ± 0.49 1.75 ± 0.27
NG 1.78 ± 0.28 1.96 ± 0.33 1.93 ± 0.36
PPARd
LG 1.47 ± 0.43 1.13 ± 0.24 1.03 ± 0.20
NG 1.07 ± 0.30 1.06 ± 0.26 1.26 ± 0.26
Values of mRNA are expressed in arbitrary units with GAPDH as the reference gene
Muscle samples were obtained before the depletion exercise on day 1 (pre-depletion exercise), before the test exercise on day 2 (pre-test exercise)
and 3 h after the test exercise on day 2 (post-test exercise)
Values are reported as the mean ± SE, n = 10
For gene abbreviations see Table 1 legend

Table 4 Phosphorylation of proteins involved in upstream signaling

expression is reversed somewhere between 8 and 14 h
for mitochondrial biogenesis post-exercise, even during conditions of CHO restriction.
PDK4 is also affected by CHO availability but somewhat
Pre-depletion exercise Post-test exercise
different than PGC-1a. It has been shown that PDK4
Thr 172
p-AMPK expression is blunted by exogenous CHO supply already
LG 0.81 ± 0.11 0.82 ± 0.16 4 h post-exercise (Cluberton et al. 2005). We confirmed
NG 0.70 ± 0.17 1.22 ± 0.17# this finding by showing that PDK4 expression remained
S79
p-ACC unchanged in NG 3 h post-test exercise. We also showed
LG 1.06 ± 0.17 0.99 ± 0.19 that the increased PDK4 mRNA in LG was independent of
NG 1.04 ± 0.25 1.33 ± 0.26 exercise, which indicates that the gene is controlled by
p-p38 MAPKT180/Y182 substrate availability rather than exercise per se.
LG 0.91 ± 0.07 1.02 ± 0.07 To the best of our knowledge, this is the first study to
NG 1.12 ± 0.07 1.36 ± 0.10 measure Tfam and PRC expression after exercise with
reduced muscle glycogen. Tfam mRNA was elevated 14 h
Muscle samples were obtained before the depletion exercise on day 1
(pre-depletion exercise) and 3 h after the test exercise on day 2 (post- after the depletion exercise and 3 h after the test exercise,
test exercise) while PRC mRNA was only elevated after the test exercise.
Values are expressed in arbitrary units relative to b-tubulin and are The present study confirms previous findings that both
reported as mean ± SE (n = 10) Tfam and PRC expression are up-regulated by exercise
LG low glycogen, NG normal glycogen (Pilegaard et al. 2003; Psilander et al. 2010). However,
#
P = 0.058 LG versus NG there was no difference in Tfam and PRC expression
between LG and NG. Tfam is regulated by PGC-1a, and its
expression might peak at a later time point than PGC-1a.
Although the magnitude of exercise-induced transcrip- Therefore, it is possible that a difference in Tfam expres-
tion seems to be independent of dietary CHO supply, there sion between LG and NG occurs more than 3 h after the
is evidence that CHO restriction can prolong mRNA test exercise. PRC, on the other hand, belongs to the same
expression of specific genes. For example, PGC-1a mRNA family of transcription factors as PGC-1a and, therefore,
levels are elevated for at least 8 h post-exercise when CHO should have a similar expression pattern. The data therefore
intake is restricted but reversed to basal levels during suggests that PRC expression is independent of glycogen
conditions with CHO intake (Pilegaard et al. 2005). The status.
low level of PGC-1a mRNA 14 h after depletion exercise Most genes activated downstream of PGC-1a were not
(Fig. 2) suggests that the effect of exercise on PGC-1a affected by exercise in the present study (Table 3). The

123
960 Eur J Appl Physiol (2013) 113:951–963

NG pre-depletion ex
12

LG pre-depletion ex
NG

Mitochondrial H2O2 production

LG

NG post-test ex

LG post-test ex
10 (§)

(pmol H2O2 min-1 mg-1)

8

6
p-AMPK Thr 172 (62 kDa)
4
p-ACCS79 (280 kDa)
2
p-p38 MAPK T180/Y182 (43 kDa)
0
β -tubulin (55 kDa) Pre-depletion Post-test
exercise exercise
Fig. 4 Representative western blots of proteins involved in upstream
signaling for mitochondrial biogenesis
0.06

mRNA expression curves for these genes are not well 0.05
examined but studies indicate that they peak later than 3 h
after exercise (Leick et al. 2010; Norrbom et al. 2004; 0.04 (§)
Pilegaard et al. 2003). GSSG/GSH
The mechanisms by which exercise with low muscle 0.03
glycogen stimulates markers of mitochondrial biogenesis
may relate to increased energetic stress, with reduced 0.02
levels of high energy phosphates and elevated AMP (as
indicated by the increased rate of AMP deamination) 0.01
(Broberg and Sahlin 1989). Increased AMP/ATP, as well
as reduced creatine phosphate content, activates AMPK, 0.00
which has several metabolic functions including activation Pre-depletion Post-test
of PGC-1a (Jager et al. 2007). The phosphorylation of exercise exercise
AMPK and its downstream target ACC was not altered 3 h Fig. 5 Effect of exercise on muscle parameters related to oxidative
post-exercise (Table 4), but it seems likely that any stress. Muscle samples were obtained before the depletion exercise on
potential effect of exercise was reversed at this time. day 1 (pre-depletion exercise) and 3 h after the test exercise on day 2
Studies in humans have shown that exercise with low ini- (post-test exercise). Values are reported as the mean ± SE from 8
(mitochondrial H2O2 production) and 5 (GSSG/GSH ratio) subjects.
tial muscle glycogen results in greater activation (i.e. LG low glycogen, NG normal glycogen. §Non-significant trend versus
phosphorylation) of AMPK compared with exercise with pre-depletion exercise (time-dependent effect); P = 0.053 (mito-
normal or elevated initial glycogen (Wojtaszewski et al. chondrial H2O2 production) and P = 0.076 (GSSG/GSH ratio)
2003; Yeo et al. 2010) but that AMPK activity is back to
basal levels 2–3 h post-exercise (Wang et al. 2011; expression (Tsintzas et al. 2006). The subjects in the
Wojtaszewski et al. 2003). Previous studies have also present study were only partially calorie restricted and the
shown that ACC activity returns to baseline within 3 h duration was less than 21 h and it therefore seems unlikely
after exercise (Wang et al. 2011). Phosphorylation of that differences in caloric intake would have influenced the
MAPK was not changed in this study, but, again, the timing observed results.
of the muscle biopsies was not optimal to detect possible Insulin levels were higher in NG compared with LG
changes for this protein. (Table 2) and studies on insulin resistant subjects indicate
The total caloric intake was lower in LG (1,425 kcal) that there might be a link between insulin and PGC-1a
than in NG (4,275 kcal) and might be a confounding factor. expression (Lira et al. 2010). However, differences in
Some (Civitarese et al. 2007; Finley et al. 2012) but not all insulin levels does not influence PGC-1a expression 2–5 h
(Hancock et al. 2011) studies have shown that mitochon- after exercise (Cluberton et al. 2005; Pilegaard et al. 2005)
drial biogenesis and PGC-1a gene expression are elevated and a direct link for how insulin can regulate PGC-1a
after long-term calorie restriction but there is no evidence expression and mitochondrial biogenesis has to our
that short-term calorie restriction (\24 h) affects PGC-1a knowledge not been established.

123
Eur J Appl Physiol (2013) 113:951–963
FFA levels were elevated during LG (Table 2) and it has
been suggested that FFA are involved in the regulation of
mitochondrial biogenesis (Holloszy 2008). FFA regulates
the activity of the peroxisome proliferator activator
receptor (PPAR) family of transcription factors. Raising
FFA levels enhances mitochondrial biogenesis in mouse
muscle by activating PPARb/d (Garcia-Roves et al. 2007).
PPARd interacts with AMPK in a transcriptional complex,
and this complex enhances the stimulating effect of AMPK
on PGC-1a expression (Narkar et al. 2008). However,
human studies do not support these observations. In fact, in
humans, elevated FFA levels are not associated with the
acute activation of genes regulating mitochondrial bio-
genesis (Russell et al. 2005; Watt et al. 2004), and one
study even showed that FFA suppressed PPAR and PGC-
1a expression (Hoeks et al. 2006). PPARd expression did
not change in this study, and it is unlikely that the increased
plasma FFA during LG can trigger the increased PGC-1a
transcription.
We hypothesized that low glycogen exercise should
increase ROS generation and elicit increased PGC-1a
expression. In contrast, both mitochondrial ROS formation
and the ratio of oxidized to reduced glutathione (GSSG/
GSH) decreased 3 h post-exercise, with no significant
difference between groups. The observed trend towards
reduced oxidative stress is consistent with the findings of
decreased mitochondrial ROS production in rats 48 h fol-
lowing an acute downhill running exercise (Molnar et al.
2006) and the findings of attenuated ROS generation during
the later stage of exercise correlating with increased UCP3
protein levels (Jiang et al. 2009). Considering the high
reactivity of ROS and the instability of redox balance, the
redox status observed 3 h post-exercise in this study is not
necessarily representative of the conditions during or
immediately following exercise. Increased free radical
formation during exercise can trigger the induction of
endogenous antioxidant systems like SOD, catalase, glu-
tathione reductase and glutathione peroxidase (Ji 1993),
which can scavenge H2O2 and thus reduce GSSG.
Although the present findings of reduced oxidative stress
3 h post-exercise do not exclude increased ROS generation
during exercise, the lack of a significant difference between
LG and NG suggests that the increased PGC-1a expression
after glycogen-depleted exercise is not caused by ROS. The
lack of changes in muscle levels of MDA, a marker for
lipid oxidation, reinforces this conclusion.
Physiological and practical implications
High intensity exercise is a strong stimulator of mito-
chondrial biogenesis (Little et al. 2010; Psilander et al.
2010) and intensity seems to be more important than
duration for the acute up-regulation of mitochondrial
961
markers (Egan et al. 2010; Nordsborg et al. 2010). Exercise
with low muscle glycogen content is not possible to per-
form at high intensity and might therefore limit the use of
such an exercise protocol. However, despite the fact that
subjects in this study cycled at a moderate intensity during
the test exercise (approximately 64 % VO2max), LG
induced a more pronounced increase in PGC-1a expression
(eightfold) than studies using high intensity protocols (two-
to sevenfold) (Gibala et al. 2009; Nordsborg et al. 2010;
Psilander et al. 2010). The present study show that very
low glycogen levels are needed to obtain a strong PGC-1a
response and exercising with profoundly reduced glycogen
levels might therefore be a beneficial training strategy for
well-trained cyclists to promote muscle oxidative potential.
Longitudinal studies examining protein levels and perfor-
mance are required to confirm this conclusion.
Acknowledgments The study was supported by grants from the
Swedish National Centre for Research in Sports, the Swedish
Research Council and the Swedish School of Sport and Health Sci-
ences, Stockholm, Sweden. We thank all the participants for their
time and effort. We also gratefully acknowledge Marjan Pontén for
her excellent technical assistance. No conflicts of interest, financial or
otherwise, are declared by the authors.
References
Baar K, McGee S (2008) Optimizing training adaptations by
manipulating glycogen. Eur J Sport Sci 8:97–106
Bergstrom J (1975) Percutaneous needle biopsy of skeletal muscle in
physiological and clinical research. Scand J Clin Lab Invest
35:609–616
Bergstrom J, Hermansen L, Hultman E, Saltin B (1967) Diet, muscle
glycogen and physical performance. Acta Physiol Scand
71:140–150
Broberg S, Sahlin K (1989) Adenine nucleotide degradation in human
skeletal muscle during prolonged exercise. J Appl Physiol
67:116–122
Burke LM, Hawley JA, Wong SH, Jeukendrup AE (2011) Carbohy-
drates for training and competition. J Sports Sci 29(Suppl
1):S17–S27
Civitarese AE, Carling S, Heilbronn LK, Hulver MH, Ukropcova B,
Deutsch WA, Smith SR, Ravussin E (2007) Calorie restriction
increases muscle mitochondrial biogenesis in healthy humans.
PLoS Med 4:e76
Cluberton LJ, McGee SL, Murphy RM, Hargreaves M (2005) Effect
of carbohydrate ingestion on exercise-induced alterations in
metabolic gene expression. J Appl Physiol 99:1359–1363
Cochran AJ, Little JP, Tarnopolsky MA, Gibala MJ (2010) Carbo-
hydrate feeding during recovery alters the skeletal muscle
metabolic response to repeated sessions of high-intensity interval
exercise in humans. J Appl Physiol 108:628–636
Egan B, Carson BP, Garcia-Roves PM, Chibalin AV, Sarsfield FM,
Barron N, McCaffrey N, Moyna NM, Zierath JR, O’Gorman DJ
(2010) Exercise intensity-dependent regulation of peroxisome
proliferator-activated receptor coactivator-1 mRNA abundance
is associated with differential activation of upstream signalling
kinases in human skeletal muscle. J Physiol 588:1779–1790
Finley LW, Lee J, Souza A, Desquiret-Dumas V, Bullock K, Rowe
GC, Procaccio V, Clish CB, Arany Z, Haigis MC (2012) Skeletal
123
962
muscle transcriptional coactivator PGC-1alpha mediates mito-
chondrial, but not metabolic, changes during calorie restriction.
Proc Natl Acad Sci USA 109:2931–2936
Garcia-Roves P, Huss JM, Han DH, Hancock CR, Iglesias-Gutierrez
E, Chen M, Holloszy JO (2007) Raising plasma fatty acid
concentration induces increased biogenesis of mitochondria in
skeletal muscle. Proc Natl Acad Sci USA 104:10709–10713
Gibala MJ, McGee SL, Garnham AP, Howlett KF, Snow RJ,
Hargreaves M (2009) Brief intense interval exercise activates
AMPK and p38 MAPK signaling and increases the expression of
PGC-1alpha in human skeletal muscle. J Appl Physiol
106:929–934
Gleyzer N, Vercauteren K, Scarpulla RC (2005) Control of
mitochondrial transcription specificity factors (TFB1M and
TFB2M) by nuclear respiratory factors (NRF-1 and NRF-2)
and PGC-1 family coactivators. Mol Cell Biol 25:1354–1366
Hancock CR, Han DH, Higashida K, Kim SH, Holloszy JO (2011)
Does calorie restriction induce mitochondrial biogenesis? A
reevaluation. FASEB J 25:785–791
Hansen AK, Fischer CP, Plomgaard P, Andersen JL, Saltin B,
Pedersen BK (2005) Skeletal muscle adaptation: training twice
every second day vs. training once daily. J Appl Physiol 98:93–99
Harris RC, Hultman E, Nordesjo LO (1974) Glycogen, glycolytic
intermediates and high-energy phosphates determined in biopsy
samples of musculus quadriceps femoris of man at rest. Methods
and variance of values. Scand J Clin Lab Invest 33:109–120
Hoeks J, Hesselink MK, Russell AP, Mensink M, Saris WH, Mensink
RP, Schrauwen P (2006) Peroxisome proliferator-activated
receptor-gamma coactivator-1 and insulin resistance: acute
effect of fatty acids. Diabetologia 49:2419–2426
Holloszy JO (2008) Regulation by exercise of skeletal muscle content
of mitochondria and GLUT4. J Physiol Pharmacol 59(Suppl
7):5–18
Hulston CJ, Venables MC, Mann CH, Martin C, Philp A, Baar K,
Jeukendrup AE (2010) Training with low muscle glycogen
enhances fat metabolism in well-trained cyclists. Med Sci Sports
Exerc 42:2046–2055
Irrcher I, Ljubicic V, Hood DA (2009) Interactions between ROS and
AMP kinase activity in the regulation of PGC-1alpha transcrip-
tion in skeletal muscle cells. Am J Physiol Cell Physiol
296:C116–C123
Jager S, Handschin C, St-Pierre J, Spiegelman BM (2007) AMP-
activated protein kinase (AMPK) action in skeletal muscle via
direct phosphorylation of PGC-1alpha. Proc Natl Acad Sci USA
104:12017–12022
Ji LL (1993) Antioxidant enzyme response to exercise and aging.
Med Sci Sports Exerc 25:225–231
Jiang N, Zhang G, Bo H, Qu J, Ma G, Cao D, Wen L, Liu S, Ji LL,
Zhang Y (2009) Upregulation of uncoupling protein-3 in skeletal
muscle during exercise: a potential antioxidant function. Free
Radic Biol Med 46:138–145
Kang C, O’Moore KM, Dickman JR, Ji LL (2009) Exercise activation
of muscle peroxisome proliferator-activated receptor-gamma
coactivator-1alpha signaling is redox sensitive. Free Radic Biol
Med 47:1394–1400
Katz A (2007) Modulation of glucose transport in skeletal muscle by
reactive oxygen species. J Appl Physiol 102:1671–1676
Leick L, Plomgaard P, Gronlokke L, Al-Abaiji F, Wojtaszewski JF,
Pilegaard H (2010) Endurance exercise induces mRNA expres-
sion of oxidative enzymes in human skeletal muscle late in
recovery. Scand J Med Sci Sports 20:593–599
Lin J, Handschin C, Spiegelman BM (2005) Metabolic control
through the PGC-1 family of transcription coactivators. Cell
Metab 1:361–370
Lira VA, Benton CR, Yan Z, Bonen A (2010) PGC-1alpha regulation
by exercise training and its influences on muscle function and
123
Eur J Appl Physiol (2013) 113:951–963
insulin sensitivity. Am J Physiol Endocrinol Metab 299:E145–
E161
Little JP, Safdar A, Cermak N, Tarnopolsky MA, Gibala MJ (2010)
Acute endurance exercise increases the nuclear abundance of
PGC-1alpha in trained human skeletal muscle. Am J Physiol
Regul Integr Comp Physiol 298:R912–R917
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression
data using real-time quantitative PCR and the 2(-Delta Delta
C(T)) Method. Methods 25:402–408
Mathai AS, Bonen A, Benton CR, Robinson DL, Graham TE (2008)
Rapid exercise-induced changes in PGC-1alpha mRNA and
protein in human skeletal muscle. J Appl Physiol 105:1098–1105
Molnar AM, Servais S, Guichardant M, Lagarde M, Macedo DV,
Pereira-Da-Silva L, Sibille B, Favier R (2006) Mitochondrial
H2O2 production is reduced with acute and chronic eccentric
exercise in rat skeletal muscle. Antioxid Redox Signal
8:548–558
Morton JP, Croft L, Bartlett JD, Maclaren DP, Reilly T, Evans L,
McArdle A, Drust B (2009) Reduced carbohydrate availability
does not modulate training-induced heat shock protein adapta-
tions but does upregulate oxidative enzyme activity in human
skeletal muscle. J Appl Physiol 106:1513–1521
Narkar VA, Downes M, Yu RT, Embler E, Wang YX, Banayo E,
Mihaylova MM, Nelson MC, Zou Y, Juguilon H, Kang H, Shaw
RJ, Evans RM (2008) AMPK and PPARdelta agonists are
exercise mimetics. Cell 134:405–415
Nordsborg NB, Lundby C, Leick L, Pilegaard H (2010) Relative
workload determines exercise-induced increases in PGC-1alpha
mRNA. Med Sci Sports Exerc 42:1477–1484
Norrbom J, Sundberg CJ, Ameln H, Kraus WE, Jansson E, Gustafsson
T (2004) PGC-1alpha mRNA expression is influenced by
metabolic perturbation in exercising human skeletal muscle.
J Appl Physiol 96:189–194
Olesen J, Kiilerich K, Pilegaard H (2010) PGC-1alpha-mediated
adaptations in skeletal muscle. Pflugers Arch 460:153–162
Pilegaard H, Keller C, Steensberg A, Helge JW, Pedersen BK, Saltin
B, Neufer Section Sign PD (2002) Influence of pre-exercise
muscle glycogen content on exercise-induced transcriptional
regulation of metabolic genes. J Physiol 541:261–271
Pilegaard H, Saltin B, Neufer PD (2003) Exercise induces transient
transcriptional activation of the PGC-1alpha gene in human
skeletal muscle. J Physiol 546:851–858
Pilegaard H, Osada T, Andersen LT, Helge JW, Saltin B, Neufer PD
(2005) Substrate availability and transcriptional regulation of
metabolic genes in human skeletal muscle during recovery from
exercise. Metabolism 54:1048–1055
Powers SK, Nelson WB, Hudson MB (2011) Exercise-induced
oxidative stress in humans: cause and consequences. Free Radic
Biol Med 51:942–950
Psilander N, Wang L, Westergren J, Tonkonogi M, Sahlin K (2010)
Mitochondrial gene expression in elite cyclists: effects of high-
intensity interval exercise. Eur J Appl Physiol 110:597–606
Russell AP, Hesselink MK, Lo SK, Schrauwen P (2005) Regulation
of metabolic transcriptional co-activators and transcription
factors with acute exercise. FASEB J 19:986–988
Tsintzas K, Jewell K, Kamran M, Laithwaite D, Boonsong T,
Littlewood J, Macdonald I, Bennett A (2006) Differential
regulation of metabolic genes in skeletal muscle during starva-
tion and refeeding in humans. J Physiol 575:291–303
Wang L, Psilander N, Tonkonogi M, Ding S, Sahlin K (2009) Similar
expression of oxidative genes after interval and continuous
exercise. Med Sci Sports Exerc 41:2136–2144
Wang L, Mascher H, Psilander N, Blomstrand E, Sahlin K (2011)
Resistance exercise enhances the molecular signaling of mito-
chondrial biogenesis induced by endurance exercise in human
skeletal muscle. J Appl Physiol 111(5):1335–1344
Eur J Appl Physiol (2013) 113:951–963
Watt MJ, Southgate RJ, Holmes AG, Febbraio MA (2004) Suppres-
sion of plasma free fatty acids upregulates peroxisome prolif-
erator-activated receptor (PPAR) alpha and delta and PPAR
coactivator 1alpha in human skeletal muscle, but not lipid
regulatory genes. J Mol Endocrinol 33:533–544
Wojtaszewski JF, MacDonald C, Nielsen JN, Hellsten Y, Hardie DG,
Kemp BE, Kiens B, Richter EA (2003) Regulation of 5’AMP-
activated protein kinase activity and substrate utilization in
exercising human skeletal muscle. Am J Physiol Endocrinol
Metab 284:E813–E822
963
Yeo WK, Paton CD, Garnham AP, Burke LM, Carey AL, Hawley JA
(2008) Skeletal muscle adaptation and performance responses to
once a day versus twice every second day endurance training
regimens. J Appl Physiol 105:1462–1470
Yeo WK, McGee SL, Carey AL, Paton CD, Garnham AP, Hargreaves
M, Hawley JA (2010) Acute signalling responses to intense
endurance training commenced with low or normal muscle
glycogen. Exp Physiol 95:351–358
123