Current Medical Science 40(5):900-909,2020

900 Current Medical Science 40(5):2020

DOI https://doi.org/10.1007/s11596-020-2249-2

Regulation of IL12B Expression in Human Macrophages by TALEN-

mediated Epigenome Editing*

Meng CHEN1, 2, Hua ZHU1, 2, Yu-juan MAO1, 2, Nan CAO1, 2, Ya-li YU1, 2, Lian-yun LI3, Qiu ZHAO1, 2, Min WU3, Mei YE3#
1
Department of Gastroenterology, Zhongnan Hospital, Wuhan University, Wuhan 430071, China
2
Hubei Clinical Center and Key Lab of Intestinal and Colorectal Diseases, Wuhan 430071, China
3
College of Life Sciences, Wuhan University, Wuhan 430072, China

Huazhong University of Science and Technology 2020

Summary: Although the exact etiology of inflammatory bowel disease (IBD) remains unclear,
exaggerated immune response in genetically predisposed individuals has been reported. Th1 and
Th17 cells mediate IBD development. Macrophages produce IL-12 and IL-23 that share p40
subunit encoded by IL12B gene as heteromer partner to drive Th1 and Th17 differentiation. The
available animal and human data strongly support the pathogenic role of IL-12/IL-23 in IBD
development and suggest that blocking p40 might be the potential strategy for IBD treatment.
Furthermore, aberrant alteration of some cytokines expression via epigenetic mechanisms is
involved in pathogenesis of IBD. In this study, we analyzed core promoter region of IL12B
gene and investigated whether IL12B expression could be regulated through targeted epigenetic
modification with gene editing technology. Transcription activator-like effectors (TALEs) are
widely used in the field of genome editing and can specifically target DNA sequence in the host
genome. We synthesized the TALE DNA-binding domains that target the promoter of human IL12B
gene and fused it with the functional catalytic domains of epigenetic enzymes. Transient expression
of these engineered enzymes demonstrated that the TALE-DNMT3A targeted the selected IL12B
promoter region, induced loci-specific DNA methylation, and down-regulated IL-12B expression in
various human cell lines. Collectively, our data suggested that epigenetic editing of IL12B through
methylating DNA on its promoter might be developed as a potential therapeutic strategy for IBD
treatment.
Key words: transcription activator-like effectors; epigenome editing; DNA methylation; cytokine;
IL12B; inflammatory bowel disease

Inflammatory bowel disease (IBD) is a chronic
inflammatory condition of the gastrointestinal tract
encompassing two major forms: Crohn’s disease (CD)
and ulcerative colitis (UC). Although the etiology
remains to be elucidated, accumulating evidence
suggests immune cells, such as macrophages and
CD4+ T cells, particular Th1 and Th17 cells are closely
associated with development of IBD[1–3]. Macrophages
can kill extraneous pathogens by phagocytosis and
innate immune response; on the other hand, as a kind of
antigen presenting cell (APC), macrophages can drive
and strengthen adaptive immune response through
secreting proinflammatory cytokines including IL-12
and IL-23[2]. In addition, CD is mainly mediated by
Th1 and Th17 cells[4, 5]. Differentiated Th1 and Th17
cells produce a large number of cytokines which in
Meng CHEN, E-mail: 1101998157@qq.com
#
Corresponding author, E-mail: wumeiye08@163.com
*
The study was supported by the National Natural Science
Foundation of China (No. 81270468).
turn amplify immune response to induce and sustain
the pathologic process of intestine, aggravating
the disease[6]. To our knowledge, IL-12 can induce
differentiation of Th1 cells to produce great amounts of
IFN-γ and IL-23 which are required for expansion and
survival for Th17 cells to make immune response[4, 7].
Meanwhile, IL-12 and IL-23 significantly increase in
inflamed mucosa from IBD patients and mice with
colitis[8]. Since IL-12 and IL-23 both play key roles in
the pathogenesis of IBD and they form heterodimer,
sharing p40 subunit, p40 restraining might disturb
both of Th1/IL-12 and Th17/IL-23 axis and alleviate
immune response[9, 10]. In fact, this concept has been
verified by ustekinumab, the monoclonal antibody
against p40 subunit, which is effective in inducing a
clinical response for moderately to severely active
IBD patients[11, 12]. However, till now, most biologic
agents including anti-TNF-α agents exhibited primary
nonresponse, loss of response or developed resistance
with the progress[13, 14]. Therefore, exploring new
methods to inhibit pro-inflammatory cytokines
Current Medical Science 40(5):2020
production and subsequently immune response has
always been of importance.
In current dogma, pathogenesis of IBD is attributed
to dysregulated mucosal immune responses to gut
flora in genetically susceptible individuals. Genome
Wide Association Study (GWAS) has identified over
163 IBD susceptibility loci[15]. However, the known
variants only take account for 20% IBD incidence[16].
Beyond that, increasing evidence has suggested that
epigenetic mechanisms, consisting of short interfering
RNA, histone modifications, and DNA methylation, are
greatly involved in the etiology of IBD[17, 18]. Epigenetics
has been generally defined as the gene expression
alteration and eventually leads to phenotypic change
without DNA sequence variation[19]. So far, there are
several reports about regulating the expression of
cytokines in IBD by epigenetic mechanisms. Histone-
lysine N-methyltransferase enzyme EZH2 deficiency
could potentiate the expression of TRAF2/5 genes to
enhance TNF-α-induced NF-κB signaling, leading to
uncontrolled inflammation[20]. The representative of
commensal probiotics B. breve might diminish the LPS-
induced expression of IL-17, IL-23, CD40 and exert
their anti-inflammatory effects in the gut associated
with epigenetic processes involving the inhibition of
histone acetylation and the optimal enhancement of
DNA methylation[21]. In addition, the differences in
positional distribution of the expression-permissive
chromatin marks H3K4me3 and H3K9ac further
delineated the transcriptional competency of IL-17A
and IL-17F in HuT-102 cells. While IL-17A revealed
a classical robust promoter-proximal enrichment of
H3K4me3 and H3K9ac, IL-17F exhibited a significant
enrichment for H3K27me3, suggesting epigenetic
differences between the IL-17A and IL-17F loci that
were consistent with their distinct expression profile
in HuT-102 and primary Th17 cells[22]. Moreover,
the down-regulation of lysine acetyltransferase 2B
(KAT2B) was related to reduced level of H4K5ac
and IL-10 in a dose-dependent manner. Knockdown
of KAT2B reduced the IL-10 promoter occupancy
of KAT2B and H4K5ac, resulting in transcriptional
silencing[18]. Altogether, epigenetic mediator might
modulate cytokines expression and consequently
disrupt the innate and adaptive inflammatory responses
in the development of IBD.
Given that epigenetic mechanism involves the
pathogenesis of IBD, therapies have been developed
and DNA methylation inhibitor 5-azacytidine and
HDAC inhibitor valproic acid have been chosen
in handling epigenetic modifications in laboratory
research and clinical protocols benefitting the patients[23,
24]
. However, these non-specific approaches would
change epigenetic events ubiquitously and influence
extensively, side effects were inevitable. Therefore,
it is of significant importance to explore more
901
specific methods to manipulate directly targeted gene
expression through altering epigenetic modifications.
Transcription activator-like effectors (TALEs), isolated
from bacterial plant pathogens, are DNA-binding
proteins with easier assembly. Since it was identified
in 2009, great progress has been made for it to be a
better choice for gene editing[25]. TALE nucleases
(TALENs) can introduce genetic modifications such
as gene knockouts and additions, by selective genomic
cleavage[26, 27]. Previous studies suggested that TALEs
could make a cut at a particular site of the genome by
fusing the Fok I nuclease with an artificial TALE to
create a specific TALEN. More importantly, several
studies have reported that regulation of specific gene
expression has been achieved in cancer cells or induced
pluripotent stem cells (iPS) by combining engineered
TALE with epigenetically active domains. Maeder et
al verified that TALE-TET1, a fusion protein with a
DNA demethylase domain, could directly activate
the expression of KLF4, RHOXF2 and HBB[28].
Furthermore, designed TALE-LSD1 fusion protein
was capable of demethylating enhancer-associated
chromatin modifications[29]. In addition, directed DNA
methylation by TALE-DNMT targeting the CDKN2A
locus decreased CDKN2A expression and increased
replication of primary human fibroblasts[30]. Therefore,
TALEs might become a powerful tool to manipulate the
gene expression via epigenetic mechanism. Although
there is no report on whether epigenetic alteration of
IL12B gene promoter is one of key factors causing IBD,
previous studies revealed that p40 subunit of human
IL-12 and IL-23 exactly had been involved in the
pathogenesis of IBD, which has been further confirmed
by anti-IL12/23p40 antibody ustekinumab that has
been approved for treatment of IBD patients. Besides,
a recent study revealed that methylation level of IL12B
promoter in genomic DNA isolated from PBMCs of
coronary artery disease patients was lower than that
in healthy control[31]. Moreover, hypomethylation
of IL12B gene promoter has been detected in apical
periodontitis lesions other than in control[32]. These
studies suggested that the promoter methylation status
of IL-12B gene might contribute to the inflammation
development.
In the current study, we sought to target DNA
methylation on the human IL-12B gene encoding p40
subunit through TALE-epigenetic mediator fusion
protein to repress gene expression. Simultaneously, we
screened several different types of epigenetic enzymes
fused with the TALE and investigated whether the
construct could suppress IL-12B expression. We
demonstrated that the TALE-DNMT3A fusion protein
is most efficient among all constructs to downregulate
p40 expression via increasing the methylation
specially on the promoter of IL12B. Here we show
that epigenetic targeting single locus indeed can alter
902 Current Medical Science 40(5):2020

gene expression. Our study provides a new therapeutic
target for developing novel strategy of managing IBD
through epigenetic-based gene-targeted technology.
1 MATERIALS AND METHODS
1.1 Plasmids Construction and In Vitro CpG
Methylation
Based on an IL12B core promoter predicted
with Proscan (http://www bimas.cit.nih.gov/molbio/
proscan), one IL12B promoter region, referred to
as IL12B (−1506/+1) (fig. 1B), was amplified from
genomic DNA of HEK293 cells using specific primer
(forward1 TTTTTAAGCTTCAAGGACTCATCTGT
GGTGGTGCA and forward2 TTTTTAAGCTTCTG
AGCTGGATGTAAGGTCTCCA and reverse TTTTT
GGCGCGCCCACACATCTTGCTCTGGGCAGGAC
GGAGAGT). The PCR products were cloned into the
pCpGL-Luc2P (Promega) vector with HindⅢ-AscⅠ
to construct the reporters pCpGL-IL12B.
All reporters were treated with non-specific CpG
methyltransferase M.SssI (http://NEB.com) according
to the manufacturer’s instructions and the methylation
was confirmed by HaeⅡ digestion (http://NEB.com).
Based on a variety of criteria such as CpG
distribution, distance from core promoter and
transcription start site, preferred range of epigenomic
modification, TALE binding requirements, and minimal
homology to human genome sequence, two sequences,
22 bp (TCCACTTCTCCATCCCTGCTCT in antisense)
and 25 bp (TACTAAACCCTTTGCCCTTCATCTC)
standing for IL12B1 and IL12B2, respectively, were
selected for dTALE targeting (fig. 1A, 1B). Then, a gene
encoding a TALE DNA-binding domain consisting

A
Human (NM_002187)
TCTGAGCTGGATGTAAGGTCTCCACCCACGGCCAGAGCACAAGGTCGGATAACCAGTGGGCCTGCCGGCTTGG
CTGCCTGGGCCCTCCCCTGCCGAGACAAACGGCTGGAGGGAGGAAGTGTGCGGCTGGGAAGCTCCGCTGCTC
TGGCCCGGGTTTCCCATTTCCCCCTTCCCGCGCTGAGACGGCGAGGAAAGTTAGCCCGGAAATCTGCGCCCGC
CTAAAACCCGGCCTGGTCCCAGCCACCGCCCCAGGAACTTCCCCCACCGCAGGGGCGGAGGTCGAGAGCAGG
GATGGAGAAGTGGACCTGCGCGGGTGGACTCCGGGGCGCGGGTGGACTCCGGGGCGCGGGGGGACTCCGAG
GAGCGGGTGGACTGTGGGGCGCGGGTACCGTCTCGCAGCGACCTCTGTCGGCGGCTCTGGGGATGGCCCGCA
TCTGTCTGCGTGTACCTGGTATACGTGCAGGTACATGTTCCTGTTCACGTGCAGACTGGGCGGGGGATGGGGGG
GTCCACACCGGTGTACACCTTTGCATACCTCTTAGCAACTTGAAATTCCACCACGAGAGATATCTTTATTCCGCTAT
TCCTGTGCATCTGCACGGAGCCCCTAGGGCCATAGATTTGTGTGCAAATGAAATGAGGATGTAGTCTGGGTGCCC
AAGGGGGGGTGCCTTGAGTGTGGTTGTCTGTATGCCTCCCTGAGGGTATTTCACTTTCTGCTCCCATCCGCCCCT
ATGAGCGAGTACCTATGAGCACAGGATGTGCACATATTTGAGTCTTATTAGTGGTACACGCAGTTTTATCATCTCCC
CAGGTCTGTGTCTGTATGAAATGTGCATGGGTGTGTGTGTGCACGCGTGTGTTCCCACTCGGGGAATGTGGGGA
GAGGTGCATGGAGCCAAGATGGGTGGTAAATAGTATGTTTCTGAAATTAAAGGACTAATGTGGAGGAAGGCGCCC
CAGATGTACTAAACCCTTTGCCCTTCATCTCATCCTCTCTGACTTGGGAAGGAACCAGGATTTTGTTTTTAAGCCCTT
GGGCATACAGTTGTTCCATCCCGACATGAACTCAGCCTCCCGTCTGACCGCCCCTTGGCCTTCCTTCTTCCTCGA
TCTGTGGAACCCAGGGAATCTGCCTAGTGCTGTCTCCAAGCACCTTGGCCATGATGTAAACCCAGAGAAATTAGC
ATCTCCATCTCCTTCCTTATTCCCCACCCAAAAGTCATTTCCTCTTAGTTCATTACCTGGGATTTTGATGTCTATGTT
CCCTCCTCGTTATTGATACACACACAGAGAGAGACAAACAAAAAAGGAACTTCTTGAAATTCCCCCAGAAGGTTTT
GAGAGTTGTTTTCAATGTTGCAACAAGTCAGTTTCTAGTTTAAGTTTCCATCAGAAAGGAGTAGAGTATATAAGTTC
CAGTACCAGCAACAGCAGCAGAAGAAACAACATCTGTTTCAGGGCCATTGGACTCTCCGTCCTGCCCAGAGCAA
GATGTGT
B C
(fold change over background)

60 mCpG
Relative luciferase activity

CpG
TCCACTTCTCCATCCCTGCTCT (IL12B-)
TAL target sequence 1 (-22nt) 40
+1
IL12B-Luc
-1506
20
-1213 -1192 -531 -505
Human IL12B promoter IL12B-Luc reporter 0
pCpGLcontrol pCpGLIL12p40

Fig. 1 Regulation of IL12B promoter activity by CpG modification

(A) Promoter regions of human IL12B genes. Orange and underlined, exon; highlighted in red, start codon; highlighted in green,
CpG sites; highlighted in pink, proposed TAL targeting sequences of IL12B1 and IL12B2 for human. (B) human IL12B-Luc
reporter in pCpGL reporter vectors. (C) Luciferase activity of human IL12B reporter pCpGL pre-treated with (mCpG) or without
M.SssI (CpG) in HEK293 cells.
Current Medical Science 40(5):2020
of a truncated N-terminal with a nuclear localization
signal (NLS), a middle tandem repeat domain, and a
C-terminal linker was commercially synthesized by
http://GenScript.com with genetic codons optimized for
mammalian cell expression (fig. 2A). The RVD codes
used for nucleotides A, C, G, and T were amino acids
NI, HD, NN, and NG, respectively. The synthetic TALE
DNA-binding domain was then fused to transcription
activation domain vp64, the catalytic domain of
human methyltransferase DNMT3A (598–912 aa),
demethylase Tet1 (1612–2136 aa), histone deacetylases
HDAC8/11 and CRMP3D/4D to generate IL12B1-
TAL-vp64, IL12B2-TAL-vp64, IL12B1-TAL-3Ac1,
IL12B2-TAL-3Ac1, IL12B1-TAL-Tet1c, IL12B2-
TAL-Tet1c, IL12B1-TAL-HDAC8/11, IL12B1-TAL-
CRMP3D/4D in pCpGL vector, respectively.
1.2 Cell Lines and Stimulation
The human metastatic CRPC cell line PC3,
HEK293, and THP-1 cells, were obtained from
the ATCC and cultured according to the supplier’s
instructions. For stimulation of THP-1 cells, THP-1
cells were transfected with IL12B-3Ac1 with Viromer
Red transfection reagent (Lipocalyx, Germany), and
then pre-treated 4 h later with 100 ng/mL PMA. After
48 h, the cells were washed 3 times and cultured in fresh
medium overnight. The cells were then stimulated with
1 µg/mL LPS for 24 h. The cells were utilized for total
RNA purification.
Firstly, we needed to explore if human IL12B
reporter pCpGL could be regulated by DNA
methylation’s alteration on its promoter, thus, we
chose HEK293 cells which could express endogenous
IL12B and activate IL12B reporter natively. Secondly,
we need to screen a better TALE construct through
detecting luciferase activity from only IL12B-TAL-
vp64 rather than endogenous IL12B transcription
activation complex, as PC3 cells did not express
endogenous IL12B as detected with RT-PCR assay (data
not shown) and it’s an ideal model for this purpose.
Moreover, we explored the regulatory mechanism of
A B
NLS TAL target DNA sequence
N-95 Catalytic domain
TACTAAACCCTTTGCCCTTCATCTC IL12B2 (25nt)
NLS TAL target DNA sequence
N-95 Catalytic domain
TCCACTTCTCCATCCCTGCTCT IL12B1 (22nt)
Fig. 2 Schematic diagram of IL12B-TALE-enzymes construct targeted successfully IL12B to regulate the expression by DNA methy-
lation on gene promoter
(A) illustration of human IL12B1-TALE-enzymes and IL12B2-TALE-enzymes construction, proposed TALE targeting
sequences of IL12B1 and IL12B2 for human; (B) activation of human IL12B gene reporter expression in PC3 prostate cancer
cells. *P<0.05 vs. empty vector group
903
IL12B gene expression and IL-12 was mostly produced
by macrophage. THP-1 cell line is a human leukemia
monocytic cell line and is the common model to study
macrophage-related physiological processes and
activities with LPS stimulation following PMA pre-
treatment[33]. Therefore, we chose PC3, HEK293, and
THP-1 cells in current study.
1.3 Delivery Procedures
Transfection of single and multiple plasmids in
specified cells were carried out using Lipofectamine
2000 (Invitrogen, USA) according to the manufacturer’s
instructions. For PC3, HEK293 cells and THP-1 cells,
500 ng/mL Gentamicin (G418, Life Technologies,
USA) was added for 7 or 10 days to select the
transfectants.
For locus-specific CpG modifications of the
IL12B-pCpGL reporter, subsequent co-transfection
of the reporters and dTALEs after G418 treatment
for 10 days was performed to minimize the reporter
expression prior to dTALE expression. In other words,
dTALEs should have already been expressed before
the expression of the IL12B-pCpGL reporter. About 24
h after the transfection, the luciferase activities were
assayed, using a Dual Glo luciferase kit (Promega,
USA), in specified cells that were co-transfected
with dual luciferase reporters alone or together with
dTALEs, following the manufacturer’s instructions.
All data were normalized as relative firefly luciferase
light/renilla units.
1.4 Quantitative Real-time Reverse Transcription-
PCR
Cells were harvested on the indicated days and
total RNA isolated using the RNeasy Mini kit (Qiagen,
Germany) according to the manufacturer’s instructions.
Reverse transcription was carried out using 500 ng
of RNA and the QuantiTect Reverse Transcription
kit (Qiagen, Germany) following the manufacturer’s
instructions. For the quantitative RT-PCR analysis,
50 ng of cDNA were used with the TaqMan Gene
Expression Master Mix (Thermo Fisher Scientific,
25 mCpG
CpG
(fold change over background)
*
Relative luciferase activity
20 *
15
Fluorescin
10 *
*
5
Fluorescin 0
Empty vector IL12B1-vp64 IL12B2-vp64
904
USA). RT-PCR was performed with IL12B forward
primer, CCAGCAGTTGGTCATCTCTTGG; IL12B
reverse primer, CATCTTCTTCAGGGGTGTCACAG.
PCR products were 161 bp. Analysis was performed
in triplicate using the StepOnePlus Real-Time PCR
System (Applied Biosystems, USA). Gene expression
was calculated using the 2-∆∆Ct method normalized to
the GAPDH and expressed relative to control samples.
1.5 ELISA
The IL-12B protein contents in culture
supernatants of sorted THP-1cells were measured with
a kit from R&D system (DP400). According to the
manufacturer’s instructions, the minimum detectable
p40 concentration was 15 pg/mL.
1.6 Bisulfite Conversion of Genomic DNA Followed
by Sanger Sequencing
Genomic DNA from THP-1 cells expressing or not
expressing IL12B-3Ac1 was purified and pretreated with
bisulfite conversation. The bisulfite-treated DNAs were
sequenced for CpG methylation detection. Six samples
were sequenced for each group. Bisulfite PCR primers:
IL12B-F: TTGAGTTGGATGTAAGGTTTTTATTTA;
IL12B-R: CAAATTACTAAAAAATATACAAAAAT-
ATACACC. For cells expressing IL12B-3Ac1, the
sequences with >3 unmethylated CpG between position
5 and 38 were excluded since these sequences likely
reflected the unsuccessfully transfected cells (30%–
40% transfection efficiency).
1.7 Statistical Analysis
One-way ANOVA was used to analyze the
difference among IL12B promoter-driven luciferase
reporters designated. Independent continuous
samples were compared using the Student’s t-test;
otherwise, the Sum rank tests were employed for non-
continuous variables. A double-sided P value < 0.05
was considered statistically significant. All statistical
analyses were performed using SPSS 22.0.0.0 software
package (SPSS, USA).
2 RESULTS
2.1 Human pCpGL-IL12B Reporter Construction
and IL12B Gene Expression Regulation via DNA
Methylation
We firstly investigated whether epigenetic
modification such as DNA methylation could
influence IL12B gene expression. According to the
gene information (NM_002187) from NCBI (fig.
1A), we designed and constructed human pCpGL-
IL12B reporter plasmid (fig. 1B), and pre-treated
it with (mCpG) or without M.SssI (CpG), a CpG
methyltransferase, followed by transfecting them into
HEK293 cells, which express endogenous IL-12.
Luciferase activity of human IL12B reporter pCpGL in
HEK293 cells showed that M.SssI treatment induced
non-specific methylation of CpG on the promoter
Current Medical Science 40(5):2020
of IL12B gene and significantly down-regulated the
luciferase activity, implicating that DNA methylation
on the promoter of IL12B gene could repress its
expression (fig. 1C).
2.2 Human IL12B-TALE-enzymes Construct
Targets IL12B Promoter and Regulates the Gene
Transcription in PC3 Cells
Subsequently, we designed two different target
sequences for TALE on the promoter of IL12B and
constructed two IL12B-TALE-enzymes plasmids,
respectively (fig. 1A, 1B), to verify whether the IL12B-
TALE could target specifically human IL12B gene and
screened more efficient sequence. We designed IL12B-
reporter plasmid and constructed the IL12B-TALE-
vp64 (a kind of transcription activator) plasmid (fig.
2A), followed by co-transfecting the both plasmids into
PC3 prostate cancer cells without endogenous IL-12
expression as detected with RT-PCR assay. The IL12B-
reporter plasmid was pre-treated with (mCpG) or
without M.SssI (CpG) before transfection. Compared to
the empty vector, IL12B-TALE-vp64 plasmid targeted
and combined successfully to the IL12B gene sequence
and induced the reporter gene transcription. Luciferase
activity of both plasmids without M.SssI pre-treatment
was higher than those with M.SssI treatment, while
IL12B1-TALE-vp64 activated much higher signal
than IL12B2-TALE-vp64, suggesting IL12B1-TALE-
vp64 was more efficient. The results implicated in
PC3 cells, IL12B-TALE-enzymes constructor targeted
specifically IL12B gene sequence and the IL12B1
sequence has higher efficiency (fig. 2B).
2.3 Exogenous IL12B-TALE-enzymes Target IL12B
Reporter Gene and Alter the DNA Methylation
Status at the Promoter of IL12B Reporter Gene in
HEK293 Cells
Previously we verified that IL12B-TALE-
enzymes construct could target specifically IL12B
gene sequence. Then we further investigated whether
exogenous IL12B-TALE-enzymes could target IL12B
reporter gene and alter the DNA methylation status and
transcription. Tet1c is the catalytic domain of Homo
sapiens tet methylcytosine dioxygenase 1 (TET1,
NM_030625) and can activate gene expression by
DNA demethylation. Meanwhile, 3Ac1 is the catalytic
domain of Homo sapiens DNA methyltransferase 3
alpha (DNMT3A, NM_175629) and can repress the
transcription by DNA methylation. We constructed
human IL12B reporter plasmids, IL12B1-TALE-
Tet1c, IL12B2-TALE-Tet1c, IL12B1-TALE-3Ac1 and
IL12B2-TALE-3Ac1, respectively. Reporter plasmid
was pre-treated with or without M.SssI, followed by
cotransfection into HEK293 cells with four constructs
above, respectively. IL12B reporter gene transcription
in the cells, which was pre-treated without M.SssI and
co-transfected together with IL12B1-TALE-3Ac1,
was depressed significantly compared to the cells
Current Medical Science 40(5):2020 905
with empty vector, suggesting this construct could constructs could regulate the IL12B gene expression
depress the transcription (fig 3). However, IL12B2- in HEK293 cells as well. HDAC8 (NM_018486)
TALE-3Ac1 didn’t show much impact. In contrast, and HDAC11 (NM_024827) are both human histone
after co-transfecting IL12B reporter gene pre-treated deacetylase and repress gene expression, and CRMP3D
with M.SssI (mCpG) together with IL12B-TALE- (NM_006426) and CRMP4D (NM_001387) are
Tet1c, the transcription was up-regulated significantly homo sapiens dihydropyrimidinase like 4 (DPYSL4)
compared to that with empty vector. Our data and like 3 (DPYSL4), which all could repress gene
verified these constructs targeted IL12B reporter gene transcription. However, we didn’t find these constructs
successfully, and 3Ac1 and Tet1c most likely altered exerted any effect on the IL12B mRNA expression in
the transcription through modifying DNA methylation HEK293 cells as expected (fig. 4).
on the promoter. Simultaneously, both IL12B1-TALE-
150 48 h 72 h
Tet1c and IL12B1-TALE-3Ac1 were much more

IL12B mRNA transcription

efficient to regulate the reporter gene transcription * ns ns ns ns

than target IL12B2 sequence (fig. 3). These findings

(% of control)
100
suggested that exogenous IL12B-TALE-enzymes ns
could not only target IL12B reporter gene specifically,
but also most likely modify the DNA methylation 50
status at the promoter and regulate the transcription in
HEK293 cells. Since previous experiments showed the
0
IL12B1-TALE-enzymes were much more efficient, we

et

c1

C8

D
C1

P3

P4
yP
used this for further study.

3A

M
B-

D
B-

D
H

CR

CR
12

H
12

B-
IL

B-

B-

B-
IL

12

12
60 mCpG

12

12
(fold change over background)

IL

IL

IL

IL
Relative luciferase activity

CpG
Fig. 4 Inhibition of endogenous IL12B gene transcription at
*
40 48 h and 72 h respectively after transfection of IL12B-
TALE-enzymes into HEK293 cells. *P<0.05

20
* *
2.5 Inhibition of IL12B mRNA Transcription and
Protein Expression Due to CpG Methylation of
0
IL12B Gene Promoter Region in PMA-treated
or

1c

1c

c1

c1
ct

et

et

THP1 Cells with LPS Stimulation

ve

-T

-T

-3

-3
B1

B2
B1

B2
y
pt

Previous findings showed that IL12B1-TALE-

12

12
12

12
Em

IL

IL
IL

IL

3Ac1 inhibited mRNA expression in HEK293 cell. Then

Fig. 3 The epigentic mediators and the better TALE sequence we explored the effect in THP-1 cell, which is a human
were screened by assaying the luciferase activity of monocytic cell line derived from an acute monocytic
human IL12B gene reporter expression in HEK293 cells.
leukemia patient and resembles the characteristic of
*
P<0.05 vs. empty vector group
human macrophage after PMA-treatment. The results
exhibited that IL12B1-TALE-3Ac1 significantly
2.4 Exogenous IL12B-TALE-enzymes Target inhibited the mRNA and protein expression in THP-1
Endogenous IL12B Gene and Alter Gene Expression cells when compared to the empty control. Subsequently
in HEK293 Cells we analyzed the methylation status of IL12B promoter
We verified exogenous IL12B-TALE-enzymes in THP-1 cells transfected with or without IL12B-3Ac1
could target IL12B reporter gene and altered the plasmid by BSP method. The result revealed that CpG
expression. Then we further investigated whether islands exhibited hypermethylation at the promoter of
IL12B-TALE-enzymes could target endogenous IL12B IL12B in the cells with IL12B-3Ac1 while compared
gene in HEK293 cells. IL12B1-TALE-3Ac1 was to that without IL12B-3Ac1, suggesting that IL12B1-
transfected into HEK293 cells, with IL12B1-yPet as TALE-3Ac1 could not only target endogenous IL12B
control (empty vector), and the IL12B mRNA assayed successfully but also alter gene expression by inducing
48 h and 72 h after transfection, respectively. The result the CpG methylation on the promoter of the gene (fig.
showed that IL12B gene mRNA expression in HEK293 5A–5C).
cells was decreased significantly at 48 h and 72 h,
respectively. Simultaneously, we further designed and 3 DISCUSSION
constructed the IL12B-TALE-HDAC8, IL12B-TALE-
HDAC11, IL12B-TALE-CRMP3D and IL12B-TALE- To our knowledge, Th1/IL-12 and Th17/IL-23
CRMP4D plasmids and investigated whether these pathway make a great contribution in the pathogenesis
906 Current Medical Science 40(5):2020

A Control B Control C
* LPS * LPS
IL12B mRNA (fold change)

300 ** 500

IL12B protein (pg/mL)

**
a 10 20 30 40
400
200
300
200 b 10 20 30 40
100
100
0 0
Empty vector IL12B1-3Ac1 Empty vector IL12B1-3Ac1

Fig. 5 IL12B gene expression was down-regulated through promoting DNA methylation on the promoter by IL12B1-TALE-3Ac1
Inhibition of IL12B mRNA (A) and protein (B) transcription in PMA-treated THP-1 cells after stimulating with LPS for 24 h; (C)
CpG methylation of IL12B promoter region in THP-1 cells transfected without (a) and with (b) IL12B-3Ac1 plasmid. *P<0.05;
**
P<0.01

of IBD[2, 34]. Thus, inhibiting subunit p40 shared by IL- construct could target specifically and precisely human
12 and IL-23 has been becoming an alternative strategy IL12B gene sequence and inhibit the gene expression
to rectify immune disorders of intestine and alleviate on transcription and protein level by alteration of the
enteritis. Till now, a monoclonal antibody against promoter methylation status in THP-1 cells. Consistent
p40 ustekinumab has been approved for treatment of to our findings, Li et al applied TALE-DNMT3A
patients with moderate to severe CD[11, 35]. Although it fusion protein for locus-targeted CpG methylation of
has exerted a good initial effect, there are still some the CRMP4 (a metastasis suppressor gene) promoter
potential challenges. Thus, exploring other approaches in non-metastatic PC3 cells turning metastasis in vitro
to inhibit p40 is always of significance. In this study, and in vivo[38]. In addition, we screened some other
we applied an epigenetic editing technique TALEs epigenetic mediator enzymes domain conjugated with
to directly change the epigenetic modifications at TALE. However, these constructs didn’t show impact
specific gene loci and consequently regulate the gene on altering the expression of IL12B such as HDACs
expression. Our data suggested that the expression of and CRMPs, both involved histone deacetylation. It’s
IL12B gene could be manipulated by DNA methylation probable that epigenetic catalytic enzyme is gene- and
modification, in agreement to previous studies in cell-specific and is indispensable for gene-editing
other kinds of cells. For instance, expression of the technology to identify the gene-specific modifying
five previously identified radioresistance-related enzyme.
genes (TOPO2A, PLXDC2, ETNK2, GFI1, and Except TALE nucleases (TALEN), zinc finger
IL12B) altered significantly partly through promoter- proteins (ZFs) and clustered regularly interspaced short
CpG islands methylation of these genes[36]. In T-cell palindromic repeat (CRISPR)/CRISPR-associated
leukemia cell lines, nine genes identified including protein 9 (Cas9) are also very important for gene-editing
IL12B were significantly hypermethylated to induce techniques. Among them, the biggest differences are
all of these genes silence[37]. Consistent with these the technique itself for targeting specific genes. Zinc
reports, here we showed that IL12B-TALE-DNMT3A finger is one of the earliest examples of designed DNA-
fusion protein could suppress IL12B gene expression binding proteins, is reorganized from a superfamily of
to a large extent by increasing DNA methylation on the eukaryotic transcription factors[39]. Previous studies
promoter, consistently, we constructed IL12B-TALE- verified that ZFs could regulate expression of genes
TET1 to confirm that demethylation could restore successfully by the locus-specific modifications of
the gene activity but suppress the gene transcription the epigenome by fusing engineered DNA-binding
due to promoter hypermethylation. These findings domains with several kinds of epigenetic enzymes such
further have been verified strongly by inhibition of the as DNMT3A, HMTs and TETs in some kinds of human
endogenous IL12B gene mRNA expression in HEK293 cells[40–42]. Although it had achieved a considerable
cells by IL12B-TALE-DNMT3A. Another study also progress, one major obstacle for ZFs remains the high
showed that engineered TALE-DNMTs successfully possibility of off-target effects because of binding
and directly suppress CDKN2A mRNA expression[30], promiscuity, which restricted extremely application
suggesting TALE-DNMTs fusing protein could become widely[43]. Thus, TALEs subsequently have largely
an effective tool for gene-editing through epigenetic substituted ZFs since it’s more modular and easier to
modification. assemble. Interestingly, recent CRISPR/Cas9 system
Then we further performed BSP assay and showed has been developing rapidly in all the gene editing
remarkable methylation on the promoter of IL12B gene. field as the Cas9 nuclease can be directly conducted
Thus, our data suggested that IL12B-TALE-DNMT3A to target DNA sequences by 20-bp small guide RNAs
Current Medical Science 40(5):2020
instead of domain of DNA-binding protein, which
should be required for both ZFs and TALEs[44–46].
Since the identification of CRISPR/Cas9 system, the
much advance has been made and it replaced ZFs and
TALE technique because it is significantly easier and
cheaper to design, construct, validate, multiplex and
run high-throughput studies with novel sgRNAs[47].
In addition, as an emerging technique, CRISPR/
Cas9 also rapidly adapt to regulate gene expression
via epigenome editing. Multiple guide RNAs could
direct the nuclease-deficient Cas9 (dCas9)-DNMT3A
construct to DNA methylation of a wider promoter
region of the target loci IL6ST and BACH2 gene and
subsequently decrease their expression in HEK293
cells[48]. Thus previous reports and our study revealed
that both of CRISPR/Cas9 and TALE techniques could
target specifically gene and successfully alter gene
expression by connecting to epigenetic mediators.
Moreover, Amabile et al compared both techniques
and demonstrated that transfection of TALE based
on triple combination of KRAB, DNMT3A, and
DNMT3L effectors into HEK293 cells simultaneously
could successfully suppress B2M gene expression
and the efficiency was comparable to CRISPR-based
epigenome editors targeting B2M gene in K562
cells, and the impact on targeted gene silencing was
inheritable. The study implicated the efficiency of the
two techniques was comparable when manipulating
epigenetic modification[49]. Furthermore, very recently,
a novel TALE-based gene-editing technique by
designing the high specificity of KRAB-TALE-
DNMT3A-DNMT3L fusion protein named designer
epigenome modifier (DEM) has been established and
exhibited higher efficiency and more stability for
silencing targeted genes expression in primary T cells,
as compared with conventional TALE system[50]. Thus,
as an epigenome editing technique, both of TALEN
and CRISPR/Cas9 system displayed the comparable
efficiency and still need to be further improved.
Although CRISPR/Cas9 technique has made
a great advance, and it’s more efficient and more
convenient than TALE, it can’t displace TALE system
completely, since with great progress and application
extensively, CRISPR/Cas9 has shown several defects
and TALE still has a unique advantage in some fields.
For instance, in CRISPR/Cas9 system, the sgRNA
targeting DNA is usually 20 bp in length, which is very
short so that it has lower stability than protein binding
to DNA, and may have off-target effects[51]. Besides
this, the specificity of sgRNA has remained elusive for
long time. Moreover, it has been shown that Cas9 tends
to survey the whole genome for a protospacer adjacent
motif (PAM) sequence and subsequently may cause
quite a number of off-targeting sites. For comparison,
artificial TALEN protein directly binds to the designed
sequence, which may have much less off-targeting
907
effects. Since the high-frequency off-target mutagenesis
induced by CRISPR/Cas9 nucleases had been detected
by a couple of studies in 2013[51–53], a large number of
measures had been adopted to improve target specificity
mainly including designing more specific sgRNA or
Cas9 and exploring more effective Cas9 inhibitors[54–56].
However, even though advanced and evolved Cas9 has
been developed, very recently Lin et al have generated
CRISPR-guided DNA methyltransferases by fusing
the catalytic domain of DNMT3A or DNMT3B to the
C terminus of the dCas9 protein to prove that there
was significant off-target methylation through whole
genome bisulfite sequencing (WGBS), indicating that
further improvement on off-target of CRISPR/dCas9
based DNA methylation modifiers is required[57]. In
addition, for the CRISPR/Cas9 system for genome
editing, PAM, the trinucleotide NGG (where N is
any nucleotide), is present at the target site, which is
prerequisite. Although the discovery of evolved xCas9
variants improves this weakness to a large extent by
recognizing a broad range of PAM including NG,
GAA and GAT, a lot of target sequences still remain
inaccessible[55]. Moreover, some primary cells, such as
T lymphocytes, can’t tolerate DNA transfection. The
delivery of epigenetic regulators based on the CRISPR-
dCas9 platform is still challenging[48]. These defects
restrict the application of CRISPR/dCas9 system and
it’s required to choose the appropriate technique based
on the target cells.
In addition, Ke et al had successfully applied
TALEN technology to generate the first MUCPH1
mutant cynomolgus monkey for studying human
microcephaly disease without detectable off-target
effect in monkey embryos[58]. Besides, in 2015, it had
been reported that transfection of TALE and DNA
methyltransferase or DNA demethylase fusion protein
to prostate cancer cell indeed affected cancer cells
metastasis both in vitro and in vivo[38]. What’s more,
TALE-DEM based construct had been successfully
delivered into primary hematopoietic stem cells or
T lymphocytes in vitro and permanently changed
target gene expression with remarkable specificity[50].
However, so far, it has not been reported that TALEN
can target specific normal mature cells in vivo,
the effect of in vivo and in vitro regulation of gene
expression may not be consistent. Here we only made a
preliminary study and provide the clue for manipulating
gene expression via epigenetic mechanism by TALE
technique. The biggest hurdle of this technology is
how to successfully target specific cells in vivo. Once
it has been resolved, we believe it is more efficient and
precise along with little side effects when compared
with biological agents which need to stick to long-term
expensive medication and have many side effects said
above.
In summary, in the current study, we demonstrated
908
the utility of TALE-directed DNA methylation as a
strategy for altering the epigenetic status in a targeted,
locus-specific fashion. As a proof-of-concept, we
transfected IL12B-TALE-DNMT3A fusion protein
vector into THP-1 cells, subsequently suppressing
both mRNA and protein of IL12B successfully via
inducing the methylation on the gene promoter. We
also shed light on the specificity of TALE-mediated
epigenetic targeting, which is an ongoing area of
future investigation. This study might have widespread
implications for investigating gene regulation, and in
developing novel therapeutic strategies for correcting
aberrant cytokine gene expression in IBD disease.
Conflict of Interest Statement
The authors declare that there is no conflict of interest
with any financial organization or corporation or individual
that can inappropriately influence this work.
REFERENCES
1 Baumgart DC, Sandborn WJ. Crohn’s disease. Lancet,
2012,380(9853):1590-1605
2 Campos N, Magro F, Castro AR, et al. Macrophages from
IBD patients exhibit defective tumour necrosis factor-
alpha secretion but otherwise normal or augmented pro-
inflammatory responses to infection. Immunobiology,
2011,216(8):961-970
3 Hibi T, Ogata H. Novel pathophysiological concepts
of inflammatory bowel disease. J Gastroenterol, 2006,
41(1):10-16
4 Parronchi P, Romagnani P, Annunziato F, et al. Type
1 T-helper cell predominance and interleukin-12
expression in the gut of patients with Crohn’s disease.
Am J Pathol, 1997,150(3):823-832
5 Sakuraba A, Sato T, Kamada N, et al. Th1/Th17 Immune
Response Is Induced by Mesenteric Lymph Node
Dendritic Cells in Crohn’s Disease. Gastroenterology,
2009,137(5):1736-1745
6 Strober W, Fuss IJ. Proinflammatory Cytokines in
the Pathogenesis of Inflammatory Bowel Diseases.
Gastroenterology, 2011,140(6):1756-1767
7 Mcgeachy MJ, Cua DJ. Th17 cell differentiation: the
long and winding road. Immunity, 2008,28(4):445-453
8 Schmidt C, Giese T, Ludwig B, et al. Expression
of interleukin-12-related cytokine transcripts in
inflammatory bowel disease: elevated interleukin-
23p19 and interleukin-27p28 in Crohn’s disease but not
in ulcerative colitis. Inflamm Bowel Dis, 2005,11(1):16-
23
9 Rovedatti L, Kudo T, Biancheri P, et al. Differential
regulation of interleukin 17 and interferon gamma
production in inflammatory bowel disease. Gut, 2009,
58(12):1629-1636
10 Mcgovern D, Powrie F. The IL23 axis plays a key role in
the pathogenesis of IBD. Gut, 2007,56(10):1333-1336
11 Feagan BG, Sandborn WJ, Gasink C, et al. Ustekinumab
as Induction and Maintenance Therapy for Crohn’s
Disease. N Engl J Med, 2016,375(20):1946-1960
12 Lamb YN, Duggan ST. Ustekinumab: A Review in
Moderate to Severe Crohn’s Disease. Drugs, 2017,
Current Medical Science 40(5):2020
77(10):1105-1114
13 Tighe D, Hall B, Jeyarajah SK, et al. One-Year Clinical
Outcomes in an IBD Cohort Who Have Previously Had
Anti-TNFa Trough and Antibody Levels Assessed.
Inflamm Bowel Dis, 2017,23(7):1154-1159
14 Amiot A, Serrero M, Peyrin-Biroulet L, et al. One-year
effectiveness and safety of vedolizumab therapy for
inflammatory bowel disease: a prospective multicentre
cohort study. Aliment Pharmacol Ther, 2017,46(3):310-
321
15 Jostins L, Ripke S, Weersma RK, et al. Host-microbe
interactions have shaped the genetic architecture of
inflammatory bowel disease. Nature, 2012,491(7422):
119-124
16 Ellinghaus D, Bethune J, Petersen BS, et al. The genetics
of Crohn’s disease and ulcerative colitis--status quo and
beyond. Scand J Gastroenterol, 2015,50(1):13-23
17 Gonsky R, Fleshner P, Deem RL, et al. Association of
Ribonuclease T2 Gene Polymorphisms with Decreased
Expression and Clinical Characteristics of Severity in
Crohn’s Disease. Gastroenterology, 2017,153(1):219-
232
18 Bai AH, Wu WK, Xu L, et al. Dysregulated Lysine
Acetyltransferase 2B Promotes Inflammatory Bowel
Disease Pathogenesis Through Transcriptional Repre-
ssion of Interleukin-10. J Crohns Colitis, 2016, 10(6):
726-734
19 Dawson MA, Kouzarides T. Cancer epigenetics: from
mechanism to therapy. Cell, 2012,150(1):12-27
20 Liu Y, Peng J, Sun T, et al. Epithelial EZH2 serves
as an epigenetic determinant in experimental colitis
by inhibiting TNFalpha-mediated inflammation and
apoptosis. Proc Natl Acad Sci USA, 2017,114(19):
E3796-E3805
21 Ghadimi D, Helwig U, Schrezenmeir J, et al. Epigenetic
imprinting by commensal probiotics inhibits the IL-23/
IL-17 axis in an in vitro model of the intestinal mucosal
immune system. J Leukoc Biol, 2012,92(4):895-911
22 Adamik J, Henkel M, Ray A, et al. The IL17A and
IL17F loci have divergent histone modifications and
are differentially regulated by prostaglandin E2 in Th17
cells. Cytokine, 2013,64(1):404-412
23 Pfister SX, Ashworth A. Marked for death: targeting
epigenetic changes in cancer. Nat Rev Drug Discov,
2017,16(4):241-263
24 Heerboth S, Lapinska K, Snyder N, et al. Use of
epigenetic drugs in disease: an overview. Genet
Epigenet, 2014,6:9-19
25 Moscou MJ, Bogdanove AJ. A simple cipher governs
DNA recognition by TAL effectors. Science, 2009,
326(5959):1501
26 Kim Y, Kweon J, Kim A, et al. A library of TAL effector
nucleases spanning the human genome. Nat Biotechnol,
2013,31(3):251-258
27 Miller JC, Tan S, Qiao G, et al. A TALE nuclease
architecture for efficient genome editing. Nat
Biotechnol, 2011,29(2):143-148
28 Maeder ML, Angstman JF, Richardson ME, et al.
Targeted DNA demethylation and activation of
endogenous genes using programmable TALE-TET1
fusion proteins. Nat Biotechnol, 2013,31(12):1137-
1142
Current Medical Science 40(5):2020
29 Mendenhall EM, Williamson KE, Reyon D, et al. Locus-
specific editing of histone modifications at endogenous
enhancers. Nat Biotechnol, 2013,31(12):1133-1136
30 Bernstein DL, Le Lay JE, Ruano EG, et al. TALE-
mediated epigenetic suppression of CDKN2A increases
replication in human fibroblasts. J Clin Invest, 2015,
125(5):1998-2006
31 Bakshi C, Vijayvergiya R, Dhawan V. Aberrant DNA
methylation of M1-macrophage genes in coronary
artery disease. Sci Rep, 2019,9(1):1429
32 Wichnieski C, Maheshwari K, Souza LC, et al. DNA
methylation profiles of immune response-related genes
in apical periodontitis. Int Endod J, 2019,52(1):5-12
33 Chanput W, Mes JJ, Wichers HJ. THP-1 cell line: an in
vitro cell model for immune modulation approach. Int
Immunopharmacol, 2014,23(1):37-45
34 Kobayashi T, Okamoto S, Hisamatsu T, et al. IL23
differentially regulates the Th1/Th17 balance in
ulcerative colitis and Crohn’s disease. Gut, 2008,57(12):
1682-1689
35 Rutgeerts P, Gasink C, Chan D, et al. Efficacy of
Ustekinumab for Inducing Endoscopic Healing in
Patients With Crohn’s Disease. Gastroenterology,
2018,155(4):1045-1058
36 Kim JS, Kim SY, Lee M, et al. Radioresistance in a human
laryngeal squamous cell carcinoma cell line is associated
with DNA methylation changes and topoisomerase II
alpha. Cancer Biol Ther, 2015,16(4):558-566
37 Kim SY, Shin DY, Kim SM, et al. Aberrant DNA
methylation-induced gene inactivation is associated
with the diagnosis and/or therapy of T-cell leukemias.
Leuk Res, 2016,47:116-122
38 Li K, Pang J, Cheng H, et al. Manipulation of prostate
cancer metastasis by locus-specific modification of
the CRMP4 promoter region using chimeric TALE
DNA methyltransferase and demethylase. Oncotarget,
2015,6(12):10030-10044
39 Kim YG, Cha J, Chandrasegaran S. Hybrid restriction
enzymes: zinc finger fusions to Fok I cleavage domain.
Proc Natl Acad Sci USA, 1996,93(3):1156-1160
40 Snowden AW, Gregory PD, Case CC, et al. Gene-specific
targeting of H3K9 methylation is sufficient for initiating
repression in vivo. Curr Biol, 2002,12(24):2159-2166
41 Chen H, Kazemier HG, de Groote ML, et al. Induced
DNA demethylation by targeting Ten-Eleven
Translocation 2 to the human ICAM-1 promoter.
Nucleic Acids Res, 2014,42(3):1563-1574
42 Siddique AN, Nunna S, Rajavelu A, et al. Targeted
methylation and gene silencing of VEGF-A in human
cells by using a designed Dnmt3a-Dnmt3L single-chain
fusion protein with increased DNA methylation activity.
J Mol Biol, 2013,425(3):479-491
909
43 Grimmer MR, Stolzenburg S, Ford E, et al. Analysis
of an artificial zinc finger epigenetic modulator:
widespread binding but limited regulation. Nucleic
Acids Res, 2014,42(16):10856-10868
44 Jinek M, Chylinski K, Fonfara I, et al. A programmable
dual-RNA-guided DNA endonuclease in adaptive
bacterial immunity. Science, 2012,337(6096):816-821
45 Persikov AV, Osada R, Singh M. Predicting DNA
recognition by Cys2His2 zinc finger proteins.
Bioinformatics, 2009,25(1):22-29
46 Zhang M, Wang F, Li S, et al. TALE: a tale of genome
editing. Prog Biophys Mol Biol, 2014,114(1):25-32
47 Vora S, Tuttle M, Cheng J, et al. Next stop for the
CRISPR revolution: RNA-guided epigenetic regulators.
Febs J, 2016,283(17):3181-3193
48 Vojta A, Dobrinic P, Tadic V, et al. Repurposing the
CRISPR-Cas9 system for targeted DNA methylation.
Nucleic Acids Res, 2016,44(12):5615-5628
49 Amabile A, Migliara A, Capasso P, et al. Inheritable
Silencing of Endogenous Genes by Hit-and-Run
Targeted Epigenetic Editing. Cell, 2016,167(1):219-232
50 Mlambo T, Nitsch S, Hildenbeutel M, et al. Designer
epigenome modifiers enable robust and sustained gene
silencing in clinically relevant human cells. Nucleic
Acids Res, 2018,46(9):4456-4468
51 Pattanayak V, Lin S, Guilinger JP, et al. High-throughput
profiling of off-target DNA cleavage reveals RNA-
programmed Cas9 nuclease specificity. Nat Biotechnol,
2013,31(9):839-843
52 Wu Y, Liang D, Wang Y, et al. Correction of a genetic
disease in mouse via use of CRISPR-Cas9. Cell Stem
Cell, 2013,13(6):659-662
53 Fu Y, Foden JA, Khayter C, et al. High-frequency off-
target mutagenesis induced by CRISPR-Cas nucleases
in human cells. Nat Biotechnol, 2013,31(9):822-826
54 Shin J, Jiang F, Liu JJ, et al. Disabling Cas9 by an anti-
CRISPR DNA mimic. Sci Adv, 2017,3(7):e1701620
55 Hu JH, Miller SM, Geurts MH, et al. Evolved Cas9
variants with broad PAM compatibility and high DNA
specificity. Nature, 2018,556(7699):57-63
56 Fu Y, Sander JD, Reyon D, et al. Improving CRISPR-
Cas nuclease specificity using truncated guide RNAs.
Nat Biotechnol, 2014,32(3):279-284
57 Lin L, Liu Y, Xu F, et al. Genome-wide determination
of on-target and off-target characteristics for RNA-
guided DNA methylation by dCas9 methyltransferases.
Gigascience, 2018,7(3):1-19
58 Ke Q, Li W, Lai X, et al. TALEN-based generation
of a cynomolgus monkey disease model for human
microcephaly. Cell Res, 2016,26(9):1048-1061
(Received Nov. 30, 2019; accepted June 22, 2020)