OLA YpAI Eqyiito.5 ( Leckey ae Abad) 2s capella yy geal alana iY a ye Alsi sill ( ys jbl) Sany cay) pda dag gl pall BURN gb cya pall Uae gis ve pT Aig y gsc al y cgi Y Ale spats Jally Gi inall il) pSllay (61 41g 5am yl teb a al) al ge ce Vets ty dal Nae gle spas (Hb. cla ged BLD yb ded gic tay abi aithy +e ADS Ge Soy Aoybll .. Gall aay. Sb paliall aay. pall any dllia GLa pb. Ain gj Chua ceil ( Sipps Gully ) 48 A dpaisl) & Cage ay Tp A gpa y Ayala aL g AIAN cea y lll om plac) flay dubia plalally + Cala oy and Gf yell Ge — Libs — dia dS gis dubeat Ast .. Uyele day He J ol Loaloo a (PCR ) pl 4 Sizhlibeed Gent sbi, Leh — tling ale og pact upla ... ( paliall ye DLE ) pal ++ Uo cy y Cay pS DMA J gly oh) bia deal (gyri) boi, te) this pt Glee ( sli) 9 6 youll (Appl) AB 6 Gia gy ( diy dl hes! ob 5 ga gl ve Ay yal Plt oy cil ie gba plbaall) Asi gf cae Agia ely. ( gl tbls) oo} Aalst yeti! plutly MyiMbagdl) GUY) Ay dy sls ad ist, Uk ie capee ue (Fekan shy) coal ( hy) dnp ape Upc cl cba) Ah ae be is gly. ( ¢ gtgll Iga) We thy ( syle) Legh path (gL) al : ++ Plead y telWw Looloo www. dvddarab.com (PCR) gle 6 vs Gaul JSG 6b aS) dually aSl Anan! Le pt Cy glaull ods ee lly La jubltnall y Guhl Gy une dali (yt paaaily BS) gine Mie lS g) Uiyel YL. Aaclpeally Cibl gall y GB ad oiS! «pl Lgastny Gags ogi ata Vda Quay al Ge ee gil ya gh Y) Sy ginal Nn a eee JS agony (ad | giles9 ( Aceh hse) Adak) cual Qe Gly « Aglady ping isl By yuay GS juary Sy Nia. oat! oe Cy et) le a gn gi ol Cahill ol ¥ Ny! Leatag « cla gty ll Jy Gopal yy Ble JUilely JuGd aia vB clay ely tl gy Ay wee Ligne Lasctl Gel pall JS javony Aaitall Li 8) Lia). Quiledll ase Ral le 5 jewel ilascinall Lady .. (olaiay! Gblily Gee pee) i ool) lt) SiN «A poll (LH woe daly cg gine od = La is Jol — Gy kkk “Bd shy « neal Aa (pill ye pe) Ul Nia Caan peUbsy csitany « play lack aalay Yad Ogle s+ dab Shel etal ol ol eal a Ge GARY) qlLind (pil) yas) AB orig} Gully (yt oa is .. oe see Wea Oe take aah X SEU A jal) apply AB gaa hl Gale (P.CR) glu 8 lla Vani ols Bay eel Sal teall Up aly pple adaed Shall Lea igi (il Aad CaP. LALA ae Quality Y ye Sy Come Ay gly Le pa ae Gully Vy c Apallel) done) Lele CHAD) BN ggll land 3 jyeall Ay il) G yhgll alls os gay AUS) «las + A ek by gee OF BEY cygeblaty clase! Guy All alaj 68 gf lise, Atl) jaler gun pV 58 US. squall joludl Lac days Deal yar Gos lgelee ab ga e Lakhy aa (ple . anil sls AUD coat Jy Uahsy gf Ube Ay Gy all yl ve oy MS Cul Ayal). ads Guiles pte ociley (li fl aly : ig gines Tiley pads dle lL ih. pl jaiMS | quad pL)ll (AeoLatl aha) Aaalee ) ee ipl A pee ly OF ged py hee as Add ago Gel pall aa vo Qihaad) Sapanalls . gapalls gq die uw 6 gba! hy pal 2 gl 985 ol JE ve WOE Sa gl (gb lng ed pad lib Cy gSus . dle» ve ( gh yge cipcase ) Atul apa Jaa} .- pfladly gen Cpe all € lagy (piible Le GS). yen laa Js + ALAM JB hy Je oe GES pb tag jy ol ay Cet | geal» = Ch sal oe Ab See Cath od Ca Cy ood cel ote Wigy cad ot Gel Uy dite le Juail, a, these Na ed, Shey ed ed lly Ce Nged pte Y (il > —. «oe aS Vda al YG) iat Looloo Ba od ob paeddl e518 auch) (PCR) 5 10 ced Gf JLMLY Gad all ac 53 (95 elle 5 jal) 5b jana) Ege) Jady Meatball ig Sl) oo gh Aphiatl Cpkee JLURA 5 ya CaN 0 A aks Tale eos eal 3 agate chal. abil Ui. pelea) agit ge y apalail (2 + Colbie) Gale .. agaal al ysl oe GURY) gle tte 6p Stay UE Aisle (ad Like gi Baal) ste pall (Amb) pgm gyal piled ual ve Lape pliae daybed) .. Aisa ol) eG plied) 4a Sy asad) Wal ly (ula ls Syd pd Say GIS « AML al! 458 Gd GLY Gay "oh gle 4b f Aint) «thy gf «. CBU) ajLG 6 gual oe Ugnad alll Aa gl aay I Mpls Gis oo ay aj b Abas aah y .. 5 jae Ge deat lhe pL gf (Apecal) ) Abe Canal fli Adal yt Gye Ui yd Cab gl Hcg) 5 Bl ala Gall pL La G8) itl Last oy13 (Anal se) At) oo. cael Ay pee bly, Aga Cathe aga oo cally pssst) Alle pall 5a pd Cli ape AME Lc Sis ay gl a dol dag opps Al gn sll Ay gill publicly agilac) | pul Lasic «uae oo Copaling Cons crall GAUSS 1 9B pg dl pace. Cay peal OS roth col Gusta Vg Absa aN Cy gity p gill Ale gal Legh Apple chal og s AB eld Bi gilt Jeay Ide » YplS Ayla) Yy Anphee Cpatleill Ll 0 ot Ms Ste Anges calls Comat gah gs Sea oe Cag alll og pli Al ay al Cou gall ve Mah ogy ool gt Y sll ( Goal) clea atta) ye pUlaaatll (Labs) A) comand pall 48 ears gly cl Aula) goa ayy Le aty Al pened Byline AS ++ Ap asD oayualll Cillsgd ules Vad Epa 1 eB pS Ql od GS al alally WAG) PAD foe Ls ures a (ut) (P.CR) gn 12 ves apd, Cpe Aad pee lal aly Mill po cot » 9 Ge daily poe) li ol MiG ene igi dale cai 9) os Apts jatl Aaah ob aed cag ol 1 yale Volos Jil cus ay Gt Soy yg iSall y ilina GLoaiy gill Jota = «oe Aga a JSG Gi prats .. dle del Ul» re gle oS GI gallo = «Me ga as > aE ae cpl teh pe ool) Cig By Ab ll Ge cine Use vo Bas gll oe oh Vy) ya 4y cand yg gh yc cll kkk pina Ghie AD. The Cid ( gq) spud gual) gis Capel 9k al Catal A IS. Ui Lay oy Al Gana15 ( Aneta alae) Alaa). ual dy een Gil eee ol Rik eval Oe ve Gdliy dadaat cell e+ cS pAll glad] Ggad gl 5 slaall oF aeiticdsy «aly gb ella lab} 200 aly tag ja cls Ti Ls Ae oo GG pl AN Le gd Adee Gils Atle se pela > lp (8 bye Gd 4d old «o. Cilis Ley aes ol Yo. Gali alle cul » — Fg col JE. BURY) (ple Leen ty al All ay all ye : eae ce le bg jh dla. a lad a the of atl aj a > pd gis c cpillaiall shail) 5g) AAs Ug eal gf (ua pial He AAP GG as ald lst ol al ty. ayy cli oe ple Ga Ash aah i Shy lb Vl cee oy GLiy pill plate of Lijel al. Lae Ide yl MOBIOG fa aj) pe Ue Yio) as wwrwidvdderabcom (POR) si 14 Seal) glides lily ds Lik yo. ( gesgi sil) Apailti ced polls pls gay ( Lusaedle) .. VA) clas ty desi dob gb dl) pet Cb als gt ( il) 5 + Bega) cL ee pl ob lgalh Apln (y geclly | gilt SLELS glial Vag yy te hy Cypinagy « Adal) Salted cen gu). om he Sains Hyun oh Cem sigan gad Gea cibgla hy Gal Lily Kati Uglaladi gf cute) - em pall oll Lg ee SL ee Dall ppaey plane Aaa) ate dd!) john!) Utd dgoknad g} Sam gll pf Algal Gali ps Cay gSeagll Jslig SEY) Quan abled Gye + Saal glk dll17 ( Acat stoe) Ada) unl Aye cag mee a vee ADS Ba A AG Cus pay gf ee hy. Sa Al A Gyo lal) vey Lalla all Bat gh spt le ol ( La ty) accel) Li se oe gedang Alay yiball oY Gul ya pel gh Ob sy Leb poe alg! iby yt Une 55H Alaa cpg gl sy. Ab ghially Addon Yils quads oj o> Alloa Ugh pated tpg IA Coady lane GS Slap dat Uaglag « VRS Lilley eit) Abel) ( rhesus Glu) 548 gf Md all gb as Solel le ball cs ad ol No uly Gal + Alona Ugyle 5 playeall y fe giles thy Be AD AS malay yg Saal le pa ood alll (8 sel dG al OS «pala Up) Abe Qual I glgha 8 ciskeatl 3} cyan ple cb jd sai (ewes) Sty Nin. ( 61 padd bait ) (PCR ) gdb 16 Vee Sf gan «+ agli Lay agaalil ge Cpl al pd pelle ve coat 4S) ead ll Gag UA Sy gall Pptrinns Leg il ally + asl) Bly pb Anal 6 pill calls oo lS lls utara pis + Mull ogy vo Pugh 8 ate Ghys yle Gall pie a19) ( Avot alae) A). cual dy nes Ob) Se be GH ate ALT Ga gl paw ole Glee jg lill aie Samy cpl] ham ding) Yd dies All Cbg! gay « daniel ae ss oe ABS Cpa AST Ga chp fay placed aie ee os JANI Qu ya fay bd La (Boba!) Go ek ik al) 8 pe) ule ( ceil Sul ) Hiei} Gayaill ary 4) lb .. (ay pall Goals ele oll) ee Aggaall qildall Vas (g yal Las ca jill Ao jury pal pli pM ghd all & jp i Baty .. cig co Lal slay os fy pasey Lal ceily colgpualll ola gh) Sd clay (al e AGSLaN AG ply Ga aay Al pil Ui cls Caps pall isa ( jp) Anil 1iSiy mt gg — Vlas Geet g eae cole AM lH Clshg — Saal ok Lit kailly pg ¢ paseall (ys gael + fly Adne Ge Ayala! atl) Anes Looloo pete iis ) u iy iste a (P.C.R) ot Pee: cathy Lang ke ib 1 Gaal cr sy ul dum «(Ay Aeaagag) ga Caner Cade Lal Lanny Lao JeSs ghd ( cpeuse ) cells) Sala gs ogee DS Tos celthy gale aa gual) Giny JSG GS .. 54 jill 9a pala daca Jy 28 CR 6 hall cinl'y cyatd All gt +. all ce pe afi Ula Sl Alls Acar any «- Ane oof .. Sys) Ajaad cc g Saal) que Ale: Aly « il pplealy Aap} Jaa ll Jali ( cagtic ) J)580 decal Qesaadl ga Atte ah oJ a ceases sh gah ally. alli: JS ob ally yauty Lay elinal Ud Sd dy sally aah gS gb pill alah .. LSigMATLy cael il Ihe ; - Quail ya peg Ae hy Lay Ig Ao cindy) Cll ol oa gph ol day JB AIS. ga DE Gd GE ce Aaah glo Uylaty | 53 gldd) jae21 (Aselid she) Abaabes ) appl dy pat ily v= GAM a Ad a Nay AD yaad ol lina Ap ast ol. gy sl ood [ay GiGi Qe ua Lis ( DIC pitied pile gl alas) fie 5 yp nuall odigd yy a4) 1 led te Quigg ge ali Lil whic! ... aia, 29 SSM) Abs Cally gio y Ayyli ly Hes Vip Atyye das oda. Sol Cpaaall (gl lly AS Ay ppl) Ay sey ( palac) J «oe lb od la, ad ait Ls lel gt igh » ny J Ve Lk GS a a. dy cob pad Gl ge). Aad Magda Lt ay gl cleat «.. gi oo Mpg Qu Le igaad til altel y « Aisle ody Cag) lise cob ely be yal lye a ed JS) Ils pial yl Rants colt ce high ullis gh ot .. Shaal i gaya Mlle ++ git ll (PGR ) yb 20 oe gala coll Spt cob slbly (uly) oy cy lll dalle 5 Asch pS y) Ade quills al gh cca oltl ab ngs gst ie id pla Ul cis ceeds Chale glides ply Latio qui ga da GN Lice t Bm gh Cine «tl Egle > uy Sy Coal lb AGS (pany Bad Ce lS Leste Vje® gti .. aad ( Marburg goysts) ong d yi el Goa ed fb gd Lea ALA ( gy ) Aedalia Get pel ny Laghy oy Vy Gee Cees al lS. Lila ol Cet ce hy) len g lll Aaclh ol) ( Y gu) Jy ( Led) 1 oh gaa pale Dg Copal colts giles nt gga oot By phy coiled J23 ( Aveta 1364) Aedes)... cupadl Ay pene Obl 9) ctl Gobel JS) Sty ai gay. ele Gag hd dia» wheal) Cue SHG Gf igi Glug ad lia .. Glu! Yije «AS Aug) alle gl (5 lal GF Nae Vas Gal 8 gh yan GS layb Ges Lt oo Jay aa Ae apts Ay all Ge Guat CYL Gan oly . eS old gl oly chins gd y ( Auli ls) Shy slog dole obs bid Lia : dic deal Gh AY. sual span Ga Glug ad pad Lal — « .. Als Nia 8 GL kkk dagles Giang bal Ge Galil) 5 Audi gl 8 IAG, Jibs (gb BS chin .. Sina!) juga ww we thd Serre ESCH OS). cs piel) pauere (gh Ci bia Bas gll (P.CR) oe jd 4 a 3 ve lll Clue) (a ait. Asi yeaa AA dalell of ge diilie Jus! dia cals SSN y Ay gaall eile Adel ell! al By. Lele ij) le » Og BBA) She Sl bal) Gay 4a jad ae pl) Clty Oe ve HGS slardal ob 3 yigall Gd GLa)... pllball oe bs) Ge all ge Nga ob ADE Gils plinall aie Sead gall Gd GAS Gulls 8). istll Ge Gg) qed Saag we Aadd gy) dlikesy cil ESS (ye eal) Clay 2 dl Ake Gils gl > — «© Og peal perc dai Lig ala25 ( Anal ta Aa). pl Ay pee ly ta ooh (yeas Algal ooh isl « AYN) uaa LY ily Gb VSL} Mah lla 1a ob egy a gh ould aay ee oS Np catia gly hl 6 ike pit Ica! sy qgndiatill (pall og gaa T Top cpauale al (ut Ui Ja © Ghana Uplacle oof aT Ge Guat ( culiy) clay Laie vee Sites La ciel gil of Jake .. gill Raninws ysl al Coed lh and Ay gla Salad. al) Gli aL, UN poe Brel). cs Sib Ua yt oot dy didlal pltl oe dad 96s CP cole gil aye 1368. ys gh hy ag cial ves gaagally Causal ali) YSiya OS Luly Glole dia 9S al ay ony pelos Shae tA jm gd pel ly pial ( calc ) Looloo vy 4 gual (PCR ) lil 24 $ cyaalll ge al of AMS Le gh al Tel sgl ga Ga SS od Lindl ud ce cyllly ab jad ise la Js gle peidl (iy ute GIS CIS apy dS cody « Ary pall lel oy! ploggll Na gis ail. Ay gill col glee) Ratt Glill Cia oye Fabia eats cpa ( dui Ay) ol ceatlall Gray « Belisy yay «Bate Aas pam ode CIS gl. NXE gl a gall Qyallall daca! Baal gh Ui wakes gle 5 oi als Y Lil peal gl gad » Ugale LS ASG pe Ugh isd Be US od pe Ul gh da cal RO) ay ll ay a Gyn ye GE Chad Byall olla oh vv Shine gb Nay Vl psall ood w+ Egeagall Gye puadalll 6 jell ay Lia Sita) ily Aaldigl Ge pyncy Cale hd cy yS Laat: eee py Ls nj he gl eal «eed JS Shela AL ggetl ogy Cus pall GS. Ul ole us pay27 (Leet ae) dats) oes appl dy pcre culty cea) Sy ag ad. Lad Qual Yi dyla » = Cad ig ad Cig Cull Nips Gel] RNA Gu gyi Sel gill alt aad “ek ke Ved pyine foal) buat ¢ ty del of Guay Lia .. sll co) et) gle. gli ob dae alas 13 St al gl « Al a Batt of His Aligitl by. te pc deals 25 OS pl gt ia Byhd JS er ish ppl iss 635) Cae Lak Bb AA yt Ale Gag lll Jonas RNA i ( cat) Sl) lg ie DNA deg Go Cy Sa oi gh is 5g Laat. ( cy) Sl) algal Sta VHS oh ss ag al) Ab ay pel gag CLL Looioo - tial wrwedvdéarab.com (PCR) gta - 26 cot lay aad clog) (gd Capi gf Linked I. Gaye Ida > = cogadh. AS Y Njigldtly Alans cals Lat. gil aga Lgl) pj alka (pil Lal Aebes cy pie g aa A) Clea ub Ge oe GRAS be Vd a MB dag gs Legs plagll casuall coag plll Gigtey Ligue. cd pay Ud cals Cos tes hy) ub aul OS «Ata gle ya yg: Lay $ Lgeay Cpa Coaldys Calls gl M3Lad c dy tl) cya all en cost asl ll dy lb Le Ce jyidall cua [8a Saad ASS y Lalas 5 il Fld y 5 UE we Al y OLS Gaal ls hg pS Qual Abad (i) Sygate a) ey al. deal Cad Ups) cg gill Ah yal ayaa Cagle alla GAAS y « gp Licabll oe ASI Y dalja dae aigka ya) dats bid. fe digi Leste gis cays ¢ clay AaLesll cintsing Alle Cuong! fice UG pb swe dud) Jed oily. Spada te29 ( AeolBN se) Ade) on suppl Ay pene ably) aaa pe ie AS hal pncay Algal ogy .. sl si + PG LS Anaad ogy gill v1 ih § sal] gS Si eal pty Cilbzel) dal js Alias bisa Sead gf lisa .. Calg sal Quail eine iS Alan diss Baa and. yale hal Lay yall ¢ you ob dil a 5 yb pensll Lijas ) ald elie dled le. Ge uly cy cial ch gual! pa cue Ayal Yl I pty egll 9 (cel ppl (teal) | plain) Lk ode cil Ge. Cee) ple! ++ GAS ppnaliza Cay Ce pawl cs y gil heey pill pS ates gf lide .. dil Bpiy cat gf ulisy w+ Alida Coy yl AS ca Lan Le lst sal og meg + call Gea ht od Able agi ye PCR hid! vl Ve yf ytd Oe ( pyar) OSs ga LGR) Ne Gay le sb gl o goed dal .. bay cay lll kkk (PCR ) s Mh 28 © ggg peel Woe gas hig Fhe Mab pLadell ap, Cot NgeiSisd Lpames Igbo Lbs Ss ol pagal yy cele ipl AiLialy op sith Ades ye debe aa utils. Upand se PCR i cod See gil i pian ain Ai Ib IS gata ob Seis ) ash (st ce cs) pened GSI Ge Lol aa) calls J +1 Sa paal gall Aas whisl 5) gh ( Kary Mullis cyl gs ys JS) Ss ps allel eel, «1993 ple Sagi 5 jie Lyle JUiy 1984 ple Ai jail on mae mnitl pl ad 6 A mle Al 96 lye sus Jap lia CMD pl ALS Ligne GAS 1) Le pny 6 Aalll als ci ey WU Le gaia ge cya bb Malad Utbly shy (Taq jepcilyyl) ) Ane Cue py ji) fli Cop) a Mm lly fa obs Cutsalill Gay g gill (pannel ANB Jules yaold debi) Qubius Gee sy gd Shey ay ill - Polymerase Chain Reaction (+)31 (Asal aac) Abas ) oe. Guat Ay pace Ol gy Sy cYbaay) al de os gail silly Jy ill oh Gay wo Ugh ad cpl LES 9 jal Ges Oh VL gD Se Uy yo pen ply Lede ly be Gaigbladl alal Gully) aadany © Gas) alal duel gl pL) does Calb Laged aL OU Lede fs) Sasol 8 Jai Cys pH BS) Ve Ai pds Labs ue Lays Gila DIsll 1s are oak. Ligh Uae Aan ly p phy AL) papi 5 ie oda aged eed oyety dye 6 Ld allegs coll oh Bil Ugdily Cyl palee SL oda pie Jiaaiy « Ay idles Le Cage cg pSealls lean CUS Qf) ond Byhall ode .. Vyns pone gk Ape gs ile cus Cyc Fl Sem diol als G5 ve Aah ge AY ALY gl egal calc! ol) (bs 20) gill 5 he nif AS pat iy Lad co Cedig pill eine (ill CULL oe a) Galea y ¢ atu ww Looloo : san di (PCR ) sin 30 + PguaSll AGUA) BL ya9 ( ste) ol de DS e Glaay Coe OS is gi!) Geel) Gl cigad cul» eH gill (NG as GyS fill saad. ( aiglSgu) os Saag « ++ dy pal) Jl gle : aul gt RNA 699) yaeall ails sc) il A justly 4b ja pig -—-----—- co U jay 4d jay -------- Saul 5 gs G jah Al jayiy -------- Cal C jas Al jajiy -------- Cea gigas os Cetggalll Giles asd il) 5G Cig gh Quai Hae gf : Ja lie 38a) og ggill Ganaall an Ws AUCGAUAUAUAAUUAUAUAU a deel — Galtl Ge ALS etl lal ge — a iBS ( Anak whe) Aka)... cael Ay pee Nyy a4 vee Sad Leal) olay Jase coally «Jeet gb cath Gal il ge Ciuade elena) ood po ak alin of Gath Hcy. deny alli calls. Uy bat ad dad ailing alls cuhay lal) cad Yel (gle 5 ne » Ugdil Ge Ge sae OS SLuhaall oy ppley Ups amends ghg ( coiled) (ot dle : jal oe GAB YY. A Gigs. Yo BY. La i > — e+ Caw g lll cine cary Upland y Aoshi pally Upload Ca gS pall 1k. Cypplall tal aa Gye Le Dll ually lls a gf = Up 4g cuily Y Saas + SIs) Sy cl Nae | ghd gle Qua plies » — (hy oat Mot as LL PCR tlt ] (P.CR) jin 32 fo mt ag pell cb 6] gill QuS ab aad Giger » Ae uy CUily uae Gus iy agli lg. AIC pigt JS Gi al Sls gel By pleat odie aS Lay oT gy ce eg gual Spy oA Gg By yA. Ayla Ae slg sa ooh Un fac «ADA gl Anal Shy & igaaSll Ls ol) il Ul y call pc gs oll pts. de ju Nha Nya Gi gal » — «+ pitty) ald PARE yay! a ely Casal te coe Vik S35. AUB cay gi) ain sal Y >35 (Reet) tae) Alek) all A pee ON fae opty Ue anal gl aay Ola! ode Ga pla JS ols vs a gyallly Laclall b Ad Gye » GGA 3 os) Care ala si ACA = ppl Gaede ala sevseesesses Beg SS col yad a gatll ply (ya 3g da calls Alanine Looloo wor dvddorab.com (PCR ) 5 il. 34 ali) oa) pai... ( sy) L emi ol dg ++ AS jos oy gllnall SIE pi Uae (lS ole ty yal any he el Y yh iS HUH ae gga (gle Ld aul cis .. dial) CS oe ogd ippde ME (gud) Aad pd gd Cag nd Gls gt aul cabal Y sh elaslly alaal of Iii pining Y alll 8 liga cya OF deat of te Cans «sp gall ptuens Cid yy Cuda Le ABMS MA) Shag yl Yl a. day of dud Yaty yl Uta + see glad gi Lasie: Al gia Ist) oda 5 Ye cus os Vaaeles (gle ai) Lily alla ge cud Wada col le 95 pans «65 3.) aed ul palin iy Ligh Sky Gis. aute| ab Yate ed Aide Igaamy .. Y La. lal ob dead Ul pall oY pode Neo. ges Sty algal A gay phe l y pale Nia 9S Gh Gay Ms geil w+ cll gl37 ( AsehS) ahscY) Adaabs ) ... cual Ayan cil yy nen dia een a (8 cg al tel of Gs algelin clase) Sd pric Guage gall cally Apathy! Lasie egal caja) Gad spe al al ol dal Udy + Cag cms Es) pl Guy apae Fyed JS Cue | jodi (gf dle GL Sal) Ugist « allel) (68 pide aly cud .. adhe dain Wes al gh aga a Sil ghd aad gd pda Y gall ag ced gt a fl Salles ap gle od hl gl Aad pilose AS Sy sabe JS 5 FILE JS 9 OS) JS... (rity ve ALS od at Gh Ctl Vom Spins fhe des bs See Ip Ub lie ae dey a os glad gla il dye obs www dvddarab.com oe gil po GS | yp a dla 3639 ( Acct ats) Lads)... Guuell Ay pee GUI, ually gle gyal) gle US cualad quia Sl lel Qa Line Aula) pLal) cya UigS da cad Lada Ga GBM GIS. digi cal) JIS Ly a ys aah OS al ceataly aged Jalal Ge e+ Gall ob ABN Ay seal) URN Apts Gay cies) Lj Cuda Lay eLall cigs co} paul idl Jas ese vo Vas) Woladl Gt And) col glad .. cal glad) Gaus Lin Lila pal YE cul ds alll Ge syed od ge cad, JEG Cylall Aeuly Eg pl paws .. Lier ga slid Jsd dosti « Gee la oe LS) Geseed (ill 6 bail) oll allel! «oy ghd cle > — FAN hy Gadd de pews ig il gay pd pty Lena Lyall woe GHD cg SNA gb uit bs Apa yal (PONE dy ctl Quill gag! Guay Lis www dvddarab.com = Ags sai JB IAN ogy gd Si giles Abia) oy (P.CR ) dn 38 w+ VHS Uppal cals . cilia a cals kkk + cle cals Gye gh Gla ia Ciel Y yj ets aN (le Ayulsey) Aue pall 8 ll cats day Aa GY pil Cita hg «Ady ood ( Gin) dre cane Gy Gd pies gig al ial alts «Sad Aa Cuan Vey 6 peal) (gf 5 ulS i lac od Glee Ao Lal wg Ly cll Ghee) sty Hyg pag 6 ag ae cya Ny 5p) Aalal ily lS Chae oY Vasa a gull alld sii = BRN A ooh Ga slaal l say bal cuts gall co pttind Galil «pig JS Sigh ually (gia Sle ula 93 ie) ob as) ly Uy ti el ge Anke 5 ga o Golall Gat dee Gi yt Guy nol jl) ead BS OS! Gy eit IS aya. call ob a gall pinai Lis ve atl ot CALS allcoal 4s pene GL 9 Ge Say lhe lyad G haally 9 si J Le Gt ly + Le Ve ool Nay aly ale JS UB 8 Cispectilly 0 gl 5 yall ib igual Gheay Le Us Stab as gf Sad Qual) ga gS Sy g yall ge Vay A yaisudl Gad Yale ple Ys 1d tal oi ol pity : 4} old « dey = F gaa a El pla cass & 5g sh oli yaa play ob Stab af Aaa. Lad agit Y call Yul > os gl agag Y Ailes yt Es) ge cl st el penal Cla GLY ll » se pllall ood punt « ages 2, deta o 9) le Va elle G8) caine Se todipatian, dau pa JE cil glad 41 ( Asta) Jac du)... (PGR) s HL 40 ila GM glial) Legal. Giyel ¥ 8 Guat Gals Nala OS al BAS Gf) Ga dea... doll gd cal elie! dha gf vo Uickdae La Si ee Las. Guull ola cgi habs LS fle «Cale aks aL pall Gags itl le Leste y w+ oauall Le ppd al. dae ALL (6d gidey DU) GLELAN oe Habe gold ABs Alin ol cylin pall ch ja God clin) ys Lape tay al Vgd Sal Gaal pall Ut bY Gl pally cally J AS ool EAS Silay ly ll. pS lated ole J - eal yesh Ci gues ool Jib Aly pd oe (et) lpaad » — oe eb gic dad al. Aad Gla gles » + iby old} peal G8 Ao lle JS Ce ae ppt (eV phaae Cy ve he SS cial ob Lin Sly agit A. Ayana. Leiall43 ( Aceh hae) Aas). ut dy ae ly tb cab plas Ob al Ge call gs «oe Abe Ul. pated Gf gal» — 2 Up Gata quad of quay diy ead ok ys Hh col gtd aio I 1 plod Ui Upsscad Sapse pol) Gill. Lgaleia! Gldiay + Ugsage 26 ya iu) Lal C8 de ott odgy OS al auutly « Mie OS al ad — 2 Cll oll Ga cag lia) ue Acad) tL Ay ll) All pls Wil git Uglaw Le Ning .. Lgall SY g ley ae Ty 6 ils) gl Oe GAG Lal eg) cg tl Sana 5h) Sb a jal oc gus La jgey + pawl Gat phy ig) alld «f Beall lala» A oo Bit ol alae 2c Looloo wwurdvdjerangan, g (P.CR ) git 42 ve cgi gh A glne cod chy acu ald. aly lial yo cals Ge ge lst civel oS aly f call ca ot al co Ihe Ja Uglcod GY SLGh as alles (ci) dada! y « gacaill aac agalg sd oY 55S) JUS Aish: £ Ab abs Ide JS. bald Jean OSs ply - Nshints oF pgalls) cy coe de gel cry city ve Bets Lal) gf a ipl cabo Led. GURY) gle iy eo Cig Alb Lali Vw Ayan Ul cle Athen Cig sh 9d pili plilll any cei te) EY) al ysl al. dil of aul ¥ pnllly : ( Sle a5) ) Anei al ca the le gil Gl auf 9d Lbs de ols hy — ve FV Lago hs ua ¢ Lilt) Ce Mee, pf el ay aly all lla Gil Cais coe Vy SB Nhe yg oe pal al. ab) (gle geal aay aL Sl Glau Jihe (A cht Gaal hole alka ve Say andl) Judy goal gi aap dal A ca dg ve pag JS Uy gl Jat GS ol45 ( Mel hac) At). ll dy pee ally col Eakb o. og pall pall) lead yyy Le gl. Bua oe Upeatl ogle i all caus LY & yidage GIR gle Baill. Sad 5 le publ w+ Aah ge ge Ut AS 1 gl cll GS Vy pie Ge Y «. DY sy USN Saal gh qual (68 Ul y JSAM 6d Cah gg AY cull) ans Cul gin cilia) ge voves pla) lS dad Ailgig .. pel) Ags cals od # Uyay ay cid! so jf acl al «BSI Sail) plays ASDLa 48 iA G aly ol) cla, ail tot Nal uae age na hy ad 9) Glew lll 4 Saag ( Leball ) aed thy. pulall Guill gle gig (lh slain) pu : OF sty GS) .. Und aie acl y (P.CR) gun 44 HY Sas poet 4b (ped alle. ILS alle Nia » — oe Gama coll glint Vy Gulf a abet Gull .. placa oe Ud cpa Y ld ode... Mba ct 1). 2 gga gle lal Salud! cele dy cll «ss ae ue. dea yo Legal sgl ple cong sal pall Cas) Gan, aad cals Copa yal) pine Judy LS dna pea ug pal clay Uysly « Alle col Ade ph WE. Alig Quall Ugh Aad pall ey hl Spa wed Qua pil GSS al peal old (8. gyi) Alas yl bald Uplal of Gay .. Gai lag) (ple By gucthe culls y Jai CS) Natl abd. Baldy BLY Gu Lgeeny ol Lt oe 413 Cg Ob Cee mad Lays Slt + ppt G4 it Ot) Ladeic Lads apd Y Jalal .. aa Ag 5 ail concal als ve SL alles Sip OF a gamalls Gon lie cl) of lai e+ peal) (iluaat) .. Aco! pall .. cyl) . pall 5S. ¢y 52 jill)47 (AselSD aise) Adak). quell Ay pace Call yy 1 cule aa! Bally ada) yo. pis AS ML GS al 5 yall ode Liga) Ske Sh SU pic a yal culls. aya gael) Gul y +» Qual BalallS Gipla Ligh basin yg od Lg oy ol dg JOEY Cp ty all GILG Gee Lat Lal BIG dsl tay ay 2B Gf aby ALN Cue - ll ve GLAS Jaliai al oe Ul cabal 38) Gale aus all. Lgt lag 9} Bi std By AE (A Ul cule gi Lele Slant gd cult gi ya Es ell y Be Sa gael y Aa gll 8 Gagan» Lica) eo cgiailiy Wy 98 ais (giSt pall Shadi. Lids Jalai al laa Linton 9 Ga = Looloo www dvddorab.com .. Glgal (PCR) ¢ jie 46 = ae agi. forks) ae Hy Flaall aera) ol oal alall oy + agl bal y Vay cee cod ula Cus pline US 68 ill le esa € 3) oA Gueat) paul! de gll alld ds Jota y « cilia Qoibia Yg dallas Cau Y Ae g a) ye sid dia .a8tl ldla Ud Leg any cole ld ut cs (gil ol aul did 4d cal. 87 day call gu adel Gigusy.. lia ail dios Ji AGS gt iS $i gh yaeidll aay Gay Y .. iphagll ee Qaeddl Up i i Costes Lgl y el as IY SLi Jal ge a sf alls + Cugitl yal) Sb GES Gis alist « iba we Ones salah lis. [Se Jag) Agua Bid cas col Gilly pen cya giASll Nn cogs y Gah Chall ogcly Ud gue dg-3d Jb gt. Biieish sasappiihcs wi ailt aut fl49 ( Meth sae) Made) out da pees bly Malad ony of gi Lite JS ay Cis Ciel Vy. alsii al SHAM pod pad. BAM Ga NS Ab. LS oa Oe GS. aad pf gd BR. Ztas i gt a hy ally Ce SS chjal A gualy SLals thle Mall ols od Ui. ast Vm JS ep co) Cagle Ui CUBAN 03a cise all. Gy fas dg 95) coil aA Ga. Ab ay cuegy JS sill) 4S Je ial ol Ge gad ays dB gd Gl cy ve grip (pf MSG Vy Alga Atal a FY ot apace Legge pth cin). pie: Saaaeld AS ca ye gid Uy call SHS Ge 9S Gh gle Cea cellly Ups ll ch Spetinee Bagucl .. Ana pdall .g8 Lie 5 jhe CuilS Sauad LMS, vee Coll ee pill y Bally pauls Guially lyull, « . Alas .. Bua > ( P.C.R ) st 48 wa Glnall (ple Guanes US LOS Linda oul gl) ciel Y 7 Aig cin (cies litle By «S 4agil bla» — eTaly .. fee Usd cad... 423) cual » — Vie pd hay. % 98 gle coluas iil la dl | clad sty sped (te Lt alt 4 gal ol cau ble Wey 2 pS gd 4a Alay sony ME 2. Le Logg ay Cally Lidell Gand} Giger » — «oes al gel Ange tally Coane! id « f Ange al » — cow digi Via. Aealad) ob Aygit Lula » — « T Ausaigl gh Gl) 2uls clas gl likey » — ve Copal cg cS gl cpl. algel Mages sey diy Jala y» — «.. dil le51 (Acoli shacY) dads) 2. quell dy poe Cbl Ligly «quae a igiedad pil atl Sed ould yells Boge AY pS) Gl al Qed. LGN Gye ph all Gly Uaila dia Ya). Ak Ales Af aaa! gf Qe : eS yl cl od Ga gSiy bald gh gel Gay 2 cally ja cob Cant) opis pllall «1 yi US pts oa of Ula chia da > — 4 o Qgtlsde agil |g ye ai laa | gate! Gay = egdadll GaaS (pill Ausland call pals Billy Abial) oh ode. ol GuigSt Giga» — Ske Ags BY) (ined Yule gil cay a ib GIS Le any Lay laa .. hd 34 iy og fas IS .. 5 Looloa: www dvddorab.com (P.GR ) gin 50 Legale iw iil. ctl pf Anas (oi ya I gh Nn jab Gg) ally « Vis GSaudd ube Abb oblbsl Joli gi we gt sl Lab Updos cod alan Gilad ool GY lentes wives Atal Ups) colli Gaal gl woe pA Goa Sigh sal Gale ah Uly agi gf (le ols kkk ve iy cals LILA alah 8 prieall suey cwcigeall al gil claioe aya ally ail oi Shy seal ee GB i pl hal Lbs Laie «(pl goa dela gayi Glasi) dual stig Gila phd Lagi @ yi ai « 6 jill te ol ley AN jig) aad Lege Ga) ay (i Aka) ged bat) Aah) aides AN) Cemeall abel Cuatiguall sl'gh «foul... faa» — OF gid. Leedll Gls ably a! le ols adsl ual gi Lis = Bye AT Upe Upinas le (gle dash bya 58) 4alll p 9h ye Nl Upc pL) ayia ot iil eas pal cyl aay