Indian J Microbiol

https://doi.org/10.1007/s12088-018-0721-5

ORIGINAL RESEARCH ARTICLE

First Report of a New Isolate of Metarhizium rileyi from Maize

Fields of Quivicán, Cuba
Sandra Pérez Álvarez1 • Amaury Méndez Guerrero2 •
Bernardo Nayar Débora Duarte1 • Marco Antonio Magallanes Tapia1 •

Jesús Alicia Chávez Medina1 • Yoannis Domı́nguez Rodrı́guez3

Received: 6 December 2017 / Accepted: 8 March 2018

Ó Association of Microbiologists of India 2018

Abstract Metarhizium rileyi (Farlow) Samson is an
important entomopathogenic fungus of more than 30 spe-
cies of Lepidoptera larvae. The aim of this research was to
characterize isolate of M. rileyi from Quivicán, Cuba on the
basis of morphological and molecular approaches. The
fungus was isolated from samples of S. frugiperda larvae
collected from maize fields of Quivicán municipality,
Mayabeque province, Cuba, and it was cultured on
PDA ? Ampicillin solid media for morphological charac-
terization. The DNA was isolated using CTAB method and
internal transcribed spacer (ITS1, ITS4) were used as the
primers for the amplification. The amplified products of
1335 bp were purified and sequenced at CINVESTAV-IPN
in both the directions using the above primers. A consensus
sequence was obtained by alignment of the forward and
reverse sequences for this region and deposited in GenBank
(MG637450). The fungus produced slightly cottony colony
of pale green color and dispersed conidia and septal
mycelium were observed under the optical microscope.
A BLAST search of the sequence in GenBank revealed a
99% of identity with several strains of N. rileyi (e.g.,
AF368501.1, AB268359.1 and EU553337.1) and M. rileyi
(e.g., KY436756.1). This is the first report of M. rileyi
& Sandra Pérez Álvarez
perezalvarezsandra2015@gmail.com
1
Depto. de Biotecnologı́a Agrı́cola, Instituto Politécnico
Nacional, CIIDIR Unidad Sinaloa, Blvd. Juan de Dios Bátiz
Paredes 250, CP 81101 Guasave, Sinaloa, Mexico
2
Empresa Bioagricultura Aplicada AMG, Calle Santos
Degollado entre Guillermo Nelson y Cuauhtemoc, Colonia
Centro, CP 81000 Guasave, Sinaloa, Mexico
3 Morphologically M. rileyi is an imperfect and dimorphic
Instituto de Biociências, Universidade Estadual Paulista
(UNESP), Câmpus São Vicente, Praça Infante Dom Henrique
s/n, Parque Bitaru, São Vicente, SP CEP 11380-972, Brazil
isolate from maize fields of Quivicán in Cuba and this is
important for biodiversity studies and is another possibility
for Integrated Pest Management.
Keywords Metarhizium rileyi
Entomopathogen fungi

Biological control
Lepidoptera
Introduction
Spodoptera frugiperda (Smith) is a pathogen of many
important crops like maize (Zea mays L.), which has a
great economic importance for being the third most culti-
vated cereal in the world and the basic food of several
hundred million people. This pathogen produce loses from
13 to 60% in maize according to Clark et al. [1] and
chemical pesticides are used often for its control. Among
the chemical pesticides that have been used for the control
of S. frugiperda are phosphorates, pyrethroids and carba-
mates, which present toxicological categories I and II and
are toxic for the environment, animal and human health [2].
Biological control is a friendly option for the control of this
important pathogen and Metarhizium rileyi (Farlow)
Samson, previously known as Nomuraea rileyi Farlow [3],
is an example because it can regulate caterpillar popula-
tions in various crops. M. rileyi is a cosmopolitan species
than can infect numerous noctuids such as S. frugiperda, S.
litura, Helicoverpa armigera, Trichoplusia ni (Hübner),
Anticarsia gemmatalis, Pseudoplusiasp. [4]. This
microorganism is distributed in wide agroecosystems and it
frequently can induce natural epizootics on many Lepi-
doptera species [5].
fungus in its development and the color of the colony
ranges from white-green pale to green intense according to

123

the progress of the colony [6, 7]. The hyphae measure
between 2 and 3 lm in diameter, septate, hyaline to
slightly pigmented and conidiophores are erect and septate;
the conidia form divergent chains are smooth, ellipsoidal,
and sometimes cylindrical with a pale green color [8].
At present, little is known about molecular identification
and characterization of M. rileyi isolates and strains. Pre-
vious research has shown that RAPD (Randomly Amplified
Polymorphic DNA) study can be used to confirm the spe-
cies level of isolates [9] and also with this analysis some
strain have been grouped with a similarity coefficient of
0.76% [10]. Similarly, Boucias et al. [6] with RAPD,
internal transcribed spacer (ITS) sequence analysis,
amplified fragment length polymorphism (AFLP), and
telomeric fingerprinting methods, identified genotypes and
as a result ITS-5.8S and 28S regions of N. rileyi isolates
suggested that this species was more closely related to
Metarhizium anisopliae and M. flavoviride than to Nomu-
raea atypicola and N. anemonoides. More recently Patil
et al. [11] used rDNA-ITS sequencing to identity N. rileyi
isolate and also clarifying the taxonomic relationships
showing differences in nucleotide sequences of all the
species or isolates analyzed. The results from molecular
study in this specie may establish a molecular background
for further taxonomic, phylogenetic and biological inves-
tigations including the use of the fungus in Integrated Pest
Management (IPM), also in Cuba there is not any molec-
ular study of this particular specie, for all these reason the
aim of this research was to characterize isolate of M. rileyi
from maize fields of Quivicán, Cuba.
Materials and Methods
Isolation of Entomopathogenic Fungus
Dead infected larvae of S. frugiperda were collected from
maize fields of Quivicán municipality, Mayabeque pro-
vince, Cuba. Cadavers showed the symptoms of infection
described for the fungus M. rileyi like mycelial growth on
the surface of the body that were sterilized with 0.5%
sodium hypochlorite solution for two minutes and washed
with sterile distilled water to remove the traces of sodium
hypochlorite. The fungus was isolate by the technique
described by Goettel and Inglis [12].
Morphological Characterization
The morphological identification was carried out by
recognition of characteristic structures seen in culture, such
as, the colony appearance (plate culture), morphology,
hyphae color and spore color. A piece of diseased sterilized
larvae was transferred to potato dextrose agar medium
123
Indian J Microbiol
(PDA) and incubated for 20 days at 28 °C for the mor-
phological characterization. Once the fungal structures
were developed, microcultures were performed on slides
with 2% water agar, which were placed in an incubator at
25 °C and after 48–72 h, slides were observed with an
optical microscope (Leica model DM500) (4009 magni-
fication). The isolates were identified using the codes and
descriptions of genera and species of entomopathogenic
fungi of Samson et al. [13] and Humber [14].
Molecular Characterization
DNA extraction from the isolate was performed from the
mycelium of the strain by the method developed by
Rajendrakumar et al. [15]. Extracted DNA was visualized
in agarose gel at 1% stained with ethidium bromide and
stored at - 20 °C for further use.
Amplification of the internal transcribed spacer region
(700–1400 bp) was performed using the ITS-1
(TCCGTAGGTGAACCTGCGG)/ITS-4
(TCCTCCGCTTATTGATATGC) primer pair [16]. Poly-
merase chain reaction (PCR) was performed in a thermo-
cycler (BioRad, CA, USA), with 25 lL of the reaction
mixture containing 0.2 mM dNTPs, 2 mM MgCl2, 0.5 lM
each primer, 1.25 of recombinant Taq DNA polymerase
(Invitrogen) and the amplification program comprised one
cycle at 95 °C for 4 min, 30 cycles at 95 °C for 1 min,
60 °C for 60 min and 72 °C by 2 min, finally one cycle at
72 °C for 5 min. The amplified fragments were visualized
by electrophoresis on 1% agarose gel to determine the
degree of amplification.
The PCR product was purified with a Wizard SV Gel Kit
and PCR Clean-Up System (Promega) and sequenced at the
Chemistry DNA laboratory of CINVESTAV-IPN Unit
Irapuato using a kit Dye Terminator Cycle Sequencing,
Ready Reaction, in an ABI PRISM 377 PERKIN-ELMER
(Cetus, Norwalk, CT) sequencer. Forward and reverse
sequences were checked and aligned in BioEdit 7.0.9 [17]
and ClustalW [18] respectively in order to obtain a con-
sensus sequence for further analyses.
The ITS sequence obtained (AMGSPA) was compared
with selected sequences of M. rileyi (accession numbers:
AB268359.1 (Japan), AF368501.1 (China), AY646390.1
(China), AY646392.1 (China), EU553337.1 (Brasil),
KJ728726.1 (India), KY436756.1 (India) available at
GenBankÒ database [19] and using ITS sequences of
Cordyceps sp. (EF495097.1), Metacordyceps chlamy-
dosporia (KC403963.1) and Paecilomyces sp.
(KU141150.1) as outgroup, all the sequences analysed at
the gene bank were reported form different countries, but
no report from Cuba was found. Sequences was aligned
with ClustalW and the final matrix containing 605 bp was
used for a distance analysis performed in PAUP* 4.0b10
Indian J Microbiol
[20] using the neighbor-joining method (NJ) [21]. Boot-
strap [22] with 1000 replications was performed using 100
random addition cycles each, to evaluate internal branch
support. The tree was edited in FigTree 1.4.3 [23].
Results
Morphological Characteristics
One isolate was obtained from the infected larvae of S.
frugiperda. The colonies on PDA medium grew slowly. In
the early stages of their growth they acquired a velvety
appearance of white color with irregular borders that turned
from pale green to malachite green with sporulation and in
the back colonies were pale yellow (Fig. 1).
Fig. 1 Colony of the fungal
isolate. a Mycelium of the
fungus; b sporulated colony
Fig. 2 Microscopic structures of the fungal isolate: a conidiogenic cells (910); b conidia (940)
The vegetative and reproductive structures observed
under the microscope had the following characteristics:
hyaline hyphae to slightly pigmented, conidiophores with
smooth, straight and septate walls. The branches, which
formed near the septa, developed in clusters on the same
point, with 2–4 phalids, short and rounded, thickened at the
base and with a short neck or without it, from which were
inserted the conidia, which were smooth, in chains, ellip-
soidal and pale green (Fig. 2).
The morphological characteristics of the isolate were
similar to those reported for the specie N. rileyi [7, 13, 14].
Molecular Characterization
The amplification process with primers ITS-1 and ITS-4
showed a fragment of 1335 pb as discernible in Fig. 3.
123

Fig. 3 Amplification of ITS of the fungal isolates PCR. (-): negative
control; (?) positive control; (1 kb): 1 Kb marker; (1, 2): isolate
fragment
A consensus sequence was obtained by alignment of the
forward and reverse sequences for this region and depos-
ited in GenBank with the accession number MG637450.
Molecular characterization of fungal isolate supported
with morphological studies allows researchers to identified
not only new species but also new isolates and this is
especially relevant to generate new knowledge concerning
the genetic diversity.
Studies about molecular characterization of N. rileyi
isolates mostly include molecular marker to determine
genetic variability. Swetha and Manjula [24] analyzed 7
isolates of this species using RAPD-PCR and revealed
genetic differences and similarities which resulted in three
groups of isolates. On the other hand, using b-tubulin gene
and ISSR as markers, has been possible to elucidate the
phyletic relationships between members of genus
Fig. 4 Neighbor-joining tree of
M. rileyi (= N. rileyi) and M.
flavoviride accessions based on
ITS sequences. The position of
the new strain is indicated
(arrow). Sequences of
Cordyceps sp., Paecilomyces
clone and Metacordyceps
chlamidosporia were used as
outgroup. Numbers above
branches indicate bootstrap
support ([ 90%). Scale bar
indicates nucleotide
substitutions per site
123
Indian J Microbiol
Nomuraea, with an emphasis on N. rileyi [25]. Vargas et al.
[10] carried out the characterization of five strains of N.
rileyi, and they found a high degree of homology among
them, independently their place of origin and host where
they were isolated. Patil et al. [11] compared N. rileyi IOF1
isolate with another four isolates where two of them were
similar to IOF1 after sequence using ITS region, however a
phylogenetic tree constructed using ITS sequences clearly
distinguished those isolates from N. rileyi IOF1 isolate.
Other filamentous fungi, like M. flavoviride, M. anisopliae
and Paecilomyces fumosoroseus, have been used to dis-
tinguish between different isolates [26–28].
Two groups can be seen in Fig. 4. According to the
phylogenetic analysis, the new isolate forms a mono-
phyletic group (99% bootstrap support) with other acces-
sions of M. rileyi available at GenBank database, which
confirms its identification based on molecular data. The
new isolate was named Metharhizium rileyi-Cuba-AMG-
SPA. All the accessions reported at GenBank are from
several countries around the world but none is from Cuba.
According to the phylogenetic tree made in this study
(Fig. 4), the isolate Metharhizium rileyi-Cuba-AMGSPA
shares phylogenetic relationship with N. rileyi and M.
rileyi, sowing high homology (99%) with N. rileyi (e.g.,
AF368501.1, AB268359.1 and EU553337.1) and M. rileyi
(e.g., KY436756.1).
A homology dendograma of various entomopathogenic
fungi demonstrated that the Cuba isolate (AMGSPA) are
closely related to M. rileyi (N. rileyi) (Fig. 4) with 99% of
homology. The isolate AY646392.1 and AY646390.1
classified as M. flavoviride showed 89 and 90% of
homology with Cuban isolate respectively. This result
Indian J Microbiol
demonstrated the high similarity between M. rileyi (N.
rileyi) strains independently of the region or the host from
which they were isolated [29]. Bidochka et al. [26] found
similar results working with M. flavoviride and M.
anisopliae.
The results of this research demonstrate that, under the
natural conditions of Quivicán municipality, Mayabeque
province, it is possible to obtain isolates of autochthonous
fungi from M. rileyi, pathogenic to S. frugiperda. This is
the first report of M. rileyi isolate in Cuba. This can help in
the development of massive productions based on these
isolates, as well as their introduction in biological control
strategies for the management of lepidoptera larvae of
agricultural importance.
References
1. Clark PL, Molina-Ochoa J, Martinelli S, Skoda SR, Isenhour DJ,
Lee DJ, Krumm JT, Foster JE (2007) Population variation of the
fall armyworm Spodoptera frugiperda in Western Hemisphere.
J Insect Sci 7:1–10. https://doi.org/10.1673/031.007.0501
2. Garcı́a I, Del Pozo E (1999) Aislamiento y producción de coni-
dios de Nomuraea rileyi (Farlow) Samson y su virulencia en
larvas de Spodoptera frugiperda (J.E. Smith). Rev Prot Veg
14:95–100
3. Kepler RM, Humber RA, Bischoff JF, Rehner SA (2014) Clari-
fication of generic and species boundaries for Metarhizium and
related fungi through multigene phylogenetics. Mycologia
106:811–829. https://doi.org/10.3852/13-319
4. Namasivayam KR, Bharani RSA, Ansari MR (2013) Natural
occurrence of potential fungal biopesticide Nomuraea rileyi
(Farlow) Samson associated with agriculture fields of Tamil
Nadu, India and its compatibility with metallic nanoparticles.
J Biofertil Biopestic 4:132. https://doi.org/10.4172/2155-6202.
1000132
5. Rı́os-Velasco E, Chávez S, Gallegos G (2010) Natural epizootic
of the entomopathogenic fungus Nomuraea rileyi (Farlow)
Samson infecting Spodoptera frugiperda (Lepidoptera: Noctu-
idae) in Coahuila México. J Res Lepid 43:7–8
6. Boucias DG, Tigano MS, Sosa-Gomez DR, Glare TR, Inglis PW
(2000) Genotypic properties of the entomopathogenic fungus
Nomuraea rileyi. Biol Control 19:124–138. https://doi.org/10.
1006/bcon.2000.0857
7. Nandish MS, Suchitha Y, Shivaprakash MK (2016) Collection,
characterization and screening of entomopathogenic fungi against
field bean pod borer (Helicoverpa armigera, Hubner). Int J
Recent Sci Res 7:10713–10717
8. Ignoffo CM (1981) The fungus Nomuraea rileyi as a microbial
insecticide. In: Burges HD (ed) Microbial control of pest and
plant diseases. Academic Press, Londres, pp 513–538
9. Takur R, Sandhu SS (2010) Species confirmation of fungal iso-
lates by molecular analysis. Indian J Microbiol 50:280–291.
https://doi.org/10.1007/s12088-010-0062-5
10. Vargas LRB, Rossato M, da Silva RTR, de Barros NM (2003)
Characterization of Nomuraea rileyi strain using polymorphic
DNA, virulence and enzyme activity. Braz Arch Biol Technol
46:13–18. https://doi.org/10.1590/S1516-89132003000100003
11. Patil RK, Bhagat YS, Halappa B, Bhat RS (2014) Evaluation of
entomopathogenic fungus, Nomuraea rileyi (Farlow) Samson for
the control of groundnut Spodoptera litura (F.) and its compati-
bility with synthetic and botanical pesticides. J Biopestic
7:106–115
12. Goettel MS, Inglis GD (1997) Fungi: hyphomycetes. In: Lacey
LA (ed) Manual of techniques in insect pathology. Academic
Press, San Diego, pp 213–249
13. Samson RA, Evans HC, Latgé JP (1988) Atlas of ento-
mopathogenic fungi. Springer, Berlin, pp 1–187
14. Humber RA (1998) Entomopathogenic fungal identification.
APS/ESA Joint Meeting 8–12 November 1998, Las Vegas, NV
15. Rajendrakumar P, Sujatha K, Rao KS, Nataraj Kumar P, Virak-
tamath BC, Balachandran SM, Biswal AK, Sundaram RM (2006)
A protocol for isolation of DNA suitable for rapid seed and grain
purity assessments in rice. Rice Genet Newsl 23:92–95
16. White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and
direct sequencing of fungal ribosomal RNA genes for phyloge-
netics. In: Innis M, Gelfand D, Sninsky J, White T (eds) PCR
protocols: a guide to methods and applications. Academic Press,
San Diego, pp 315–322
17. Hall TA (1999) BioEdit: a user-friendly biological sequence
alignment editor and analysis program for Windows 95/98/NT.
Nucleic Acids Symp Ser 41:95–98
18. Thompson JD, Higgins DG, Gibson TJ (1994) ClustalW:
improving the sensivity of progressive multiple sequence align-
ment through sequence weighting, position specific gap penalties
and weight matrix choice. Nucleic Acids Res 22:4673–4680
19. Benson DA, Cavanaugh M, Clark K, Karsch-Mizrachi I, Lipman
DJ, Ostell J, Sayers EW (2013) Genbank. Nucleic Acid Res
41:D36–D42
20. Swofford DL (2001) PAUP*. Phylogenetic analysis using parsi-
mony (*and others methods). Sinauer Associates Inc., Sunderland
21. Saitou N, Nei M (1987) The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Mol Biol Evol
4:406–425
22. Felsenstein J (1985) Confidence intervals on phylogenies: an
approach using the bootstrap. Evolution 39:783–791
23. Rambaut A (2016) FigTree v 1.4.3. http://tree.bio.ed.ac.uk/soft
ware/figtree/
24. Swetha K, Manjula K (2014) Survey and molecular characteri-
zation of Nomuraea rileyi isolates. Int J Plant Prot 7:482–485.
https://doi.org/10.15740/HAS/IJPP/7.2/482-485
25. Han Q, Inglis GD, Hausner G (2002) Phylogenetic relationships
among strains of the entomopathogenic fungus, Nomurea rileyi,
as revealed by partial b-tubulin sequences and inter-simple
sequence repeat (ISSR) analysis. Lett Appl Microbiol
34:376–383
26. Bidochka MJ, McDonald MA, St Leger RJ, Roberts DW (1994)
Differentiation of species and strains of entomopathogenic fungi
by random amplification by polymorphic DNA. Curr Genet
25:107–113
27. Leal SC, Bertioli DJ, Butt TM, Peberdy JF (1994) Characteri-
zation of isolates of entomopathogenic fungus by RAPD-PCR.
Mycol Res 98:1077–1081
28. Cantone FA, Vandenberg JD (1998) Intraspecific diversity in
Paecilomyces fumosoroseus. Mycol Res 102:209–215
29. Bertholdo VLR, Rossato M, da Silva RTR, Monteiro NB (2003)
Characterization of Noumoraea rileyi strains using polymorphic
DNA, virulence and enzyme activity. Braz Arch Biol Technol
46:13–18. https://doi.org/10.1590/S1516-89132003000100003
123