Ocular Findings in Infants with Congenital

Toxoplasmosis after a Toxoplasmosis

Outbreak
Aline Reetz Conceição, MD,1 Deisi Nara Belucik, MD,1 Lilian Missio, MD,1 Luiz Gustavo Brenner, MSc,1
Matheus Henrique Monteiro, MD,1 Kleber Silva Ribeiro, PhD,2 Deise Fialho Costa, PhD,2,3
Maria Clara da Silva Valadão, MD, PhD,1 Alessandra Gonçalves Commodaro, PhD,2
João Rafael de Oliveira Dias, MD, PhD,2 Rubens Belfort, Jr., MD, PhD2,3

Purpose: We investigated the prevalence of ocular abnormalities in infants vertically exposed to Toxoplasma
gondii infection during an outbreak in Santa Maria City, Brazil.
Design: Consecutive case series.
Participants: A total of 187 infants were included.
Methods: The infants were recruited from January 2018 to November 2019. All mothers were screened for
syphilis and human immunodeficiency virus before delivery. Toxoplasmosis infection was confirmed in all
mothers and infants based on the presence of serum antieT. gondii immunoglobulin G (IgG) and immunoglobulin
M (IgM) antibodies. All infants underwent an ophthalmologic examination; ocular abnormalities were documented
using a wide-field digital imaging system. Neonatal cranial sonography or head computed tomography was
performed in 181 infants, and the cerebrospinal fluid (CSF) was screened for antieT. gondii IgG and IgM anti-
bodies in 159 infants. Peripheral blood samples from 9 infants and their mothers were analyzed for the presence
of T. gondii DNA by real-time polymerase chain reaction.
Main Outcome Measures: Ocular abnormalities associated with congenital toxoplasmosis.
Results: A total of 187 infants were examined. Twenty-nine infants (15.5%) had congenital toxoplasmosis, of
whom 19 (10.2%) had ocular abnormalities, including retinochoroiditis in 29 of 38 eyes (76.3%), optic nerve
abnormalities in 5 eyes (13.2%), microphthalmia in 1 eye (2.6%), and cataract in 2 eyes (5.3%). Bilateral retinal
choroidal lesions were found in 10 of 19 infants (52.6%). Nine eyes of 6 infants had active lesions, with retinal
choroidal cellular infiltrates at the first examination. Thirteen (7.2%) of 181 infants screened presented with ce-
rebral calcifications. Eighty-three percent of the screened infants were positive for antieT. gondii IgG and
negative for IgM antibodies in the CSF. Congenital toxoplasmosis was higher in mothers infected during the third
pregnancy trimester, and maternal treatment during pregnancy was not associated with a lower rate of congenital
toxoplasmosis.
Conclusions: High prevalence rates of clinical manifestations were observed in infants with congenital toxo-
plasmosis after a waterborne toxoplasmosis outbreak, the largest yet described. Cerebral calcifications were higher
in infants with ocular abnormalities, and maternal infection during the third pregnancy trimester was associated with
a higher rate of congenital toxoplasmosis independent of maternal treatment. Ophthalmology 2021;128:1346-
1355 ª 2021 by the American Academy of Ophthalmology

Toxoplasma gondii is a zoonotic protozoan parasite of
global importance that can infect warm-blooded animals,
including humans.1 Although generally asymptomatic in
humans, T. gondii infection is potentially serious when
acquired during pregnancy because of the risk of fetal
transmission.2 Spontaneous abortion and fetal death after
toxoplasmosis infection during pregnancy are usually seen
in first or second trimester infections. Congenital
toxoplasmosis, which includes neurologic and ocular
abnormalities in the newborn as a result of transplacental
infection with bradyzoites, is mostly associated with third
trimester infections.3 Factors associated with T. gondii
transmission from mothers to fetuses include the trimester
of infection, maternal immune status, antepartum
treatment, embryo gestational age (GA), and the amount
and virulence of the parasites.4-6
Retinochoroiditis, the most common ocular finding in
congenital toxoplasmosis, which has a proclivity for the
posterior pole of the eye, has been reported in 75% to 80%
of newborns with congenital toxoplasmosis and in 85% of
infants with congenital toxoplasmosis.7 Structural macular
changes in congenital toxoplasmosis include retinal
thinning, retinal pigment epithelial hyperreflectivity,
choroidal excavation, intraretinal cysts, and fibrosis.8
Typical congenital toxoplasmic retinochoroiditis consists
of a wagon wheeleshaped retinal scar.9 These lesions

1346 ª 2021 by the American Academy of Ophthalmology https://doi.org/10.1016/j.ophtha.2021.03.009

Published by Elsevier Inc. ISSN 0161-6420/21
 Conceição et al 
Ocular Findings after Toxoplasmosis Outbreak
usually have a central area composed of glial and pigmented
material connected by strands to a peripheral ring at the
center of the lesions.9
Several outbreaks of toxoplasmosis affecting humans
have been described worldwide, and meat and water have
been identified as the sources of infection. In Brazil, water
has been considered an important source for disseminating
human toxoplasmosis.10,11 From March to November 2018,
an unprecedented large outbreak of toxoplasmosis was
reported in Santa Maria, southern Brazil, with the peak of
reported cases occurring between March and April 2018.11
The water was the most suspected vehicle of this
outbreak.11,12 The Santa Maria City Hall reported 931
confirmed cases of acute T. gondii infection in 2018;
among these were 146 pregnant women, 3 fetal deaths, 10
abortions, and 29 live births with congenital
toxoplasmosis. A total of 304 other cases remained under
investigation, including 210 pregnant women, 21 infants
with congenital toxoplasmosis, and 3 abortions.12
Furthermore, the Santa Maria City Hall and the state
government communicated that by September 2018, 39 of
41 neighborhoods of Santa Maria City, mainly in the west
part of the town, as well as neighboring cities, presented
an increase in the number of confirmed cases of acute
toxoplasmosis. Eighty-six percent of patients with a
confirmed diagnosis had headaches, followed by fever and
myalgia (80%), and lymphadenomegaly (76%). Further-
more, 8.3% of the patients were admitted to the hospital and
32 had ocular lesions.13
We retrospectively investigated the ocular findings in the
infants exposed to T. gondii infection during pregnancy
during and after an outbreak in Santa Maria City, southern
Brazil. The infants’ serologic, neurologic, and cerebrospinal
fluid (CSF) abnormalities are described.
Methods
Patients
A total of 187 infants were recruited and evaluated at the Santa
Maria University Hospital, Santa Maria City, Rio Grande do Sul,
southern Brazil, from January 2018 to November 2019. Detailed
clinical histories with prenatal and postnatal information were
obtained. All mothers had been tested during pregnancy at least
once for antieT. gondii immunoglobulin G (IgG) and immuno-
globulin M (IgM) serologies (ELISA HALF test, Abbott Di-
agnostics AxSYM). Laboratory reference values for antieT. gondii
IgG antibodies were (1) negative: <1 IU/ml; (2) indeterminate:
1
and <3 IU/ml; (3) positive: 3 IU/ml. The laboratorial reference
values for antieT. gondii IgM antibodies were (1) negative: <0.8
IU/ml; (2) indeterminate:
0.8 and <1 IU/ml; (3) positive: 1 IU/
ml. All mothers were also tested for human immunodeficiency
virus (HIV) and syphilis. The venereal disease research laboratory
test (Wiener lab. 2000, Rosario, Argentina) was used for the
screening of syphilis. If the venereal disease research laboratory
result was positive, it was confirmed by a Rapid Test for Syphilis
(Alere Determine Syphilis). Only the infants whose mothers tested
positive for HIV or syphilis were submitted to serological in-
vestigations for these diseases.
All infants were tested for toxoplasmosis (ELISA HALF test,
Abbott Diagnostics AxSYM). An ophthalmologist specialist in
pediatric retinal diseases (A.R.C.) and a pediatric infectious disease
specialist (M.C.V.) evaluated the infants. All infants with
congenital toxoplasmosis were referred for neurologic evaluation.
A total of 181 infants (96.8%) underwent neonatal cranial sonog-
raphy or head computed tomography (CT) without contrast, and
159 infants (85%) had their CSF screened for T. gondii IgG and
IgM serologies.
The diagnosis of congenital toxoplasmosis was based on the
infant neurologic evaluation, neonatal cranial sonography, head CT
results, CSF results, ophthalmologic examination, and the presence
of serum T. gondii IgG and IgM antibodies. Infants were diagnosed
with congenital toxoplasmosis if they had a positive antieT. gondii
IgM in the peripheral blood, typical toxoplasmic retinochoroiditis,
or cerebral abnormalities, including hydrocephalus, microcephaly,
and calcifications.4
Infants included were those born in Santa Maria, Rio Grande do
Sul State, southern Brazil (latitude 29 41’ 29’’ south, longitude
53 48’ 3’’ west), or in cities up to 150 km from Santa Maria
whose mothers confirmed visiting Santa Maria during pregnancy;
infants whose mothers had positive toxoplasmosis IgM during
pregnancy; infants whose mothers were negative for toxoplasmosis
IgG early in pregnancy and showed IgG positivity at delivery; and
infants of mothers who had <50 IU/ml levels of toxoplasmosis IgG
antibodies during pregnancy and presented a 4-fold increase in IgG
antibody titer in sera during the gestational course.14
Infants excluded were those whose mothers were negative for
toxoplasmosis IgM and positive for toxoplasmosis IgG without a
documented increase in toxoplasmosis IgG levels during preg-
nancy and infants whose mothers presented positive T. gondii IgG
and had an inconclusive IgM result.
The treatment chosen for the mothers was based on the
trimester of infection. When an acute maternal infection was
diagnosed before the 18th week of pregnancy, treatment with oral
spiramycin was initiated. After the 18th week of pregnancy when
fetal infection was confirmed or highly suspicious because of a
positive polymerase chain reaction (PCR) analysis of the amniotic
fluid or abnormalities on obstetric ultrasound, spiramycin was
suspended and treatment with pyrimethamine, sulfadiazine, and
folinic acid was instituted.15
Infants with congenital toxoplasmosis with or without ocular
lesions were treated with oral sulfadiazine 100 mg/kg/day twice
daily (bid), pyrimethamine (loading dose, 2 mg/kg/day bid for 2
days; treatment dose, 1 mg/kg/day daily), and folinic acid (10 mg
every 3 days) continuously throughout the first year of life.16 In the
presence of active retinochoroiditis or high CSF protein
concentrations, oral prednisolone (1 mg/kg/day bid) tapered over
4 to 6 weeks was also administered.16,17 All parents were
advised to bring their children for follow-up every 3 months dur-
ing the first year of life and every 6 months from 1 to 2 years of
age.
All mothers diagnosed with syphilis or HIV were treated ac-
cording to standard protocols. In addition, HIV-infected pregnant
women received a peripartum azidothymidine (AZT) regimen
during labor or at least 3 hours before cesarean section and
maintained until cord clamping. Oral AZT (2 mg/kg/dose, every 6
hours) was instituted to the newborn for 6 weeks and breastfeeding
was contraindicated. In the sixth week of life, AZT was suspended,
and an oral combination of sulfamethoxazole and trimethoprim
was instituted until 12 months. Infants whose mothers tested pos-
itive for syphilis were treated with intravenous benzylpenicillin for
10 days.18
A parent or legal guardian of each infant provided informed
consent. The ethics committee Institutional Review Boards (IRBs)
of the Federal University of Santa Maria (IRB Number 3.109.150)
and the co-participant institution (Vision Institute), Invitare
1347
 Ophthalmology Volume 128, Number 9, September 2021
Clinical Research Auditing and Consulting Ltda. (IRB Number
3.113.294), approved the study, which was performed in accor-
dance with the tenets of the Declaration of Helsinki and complied
with the Health Insurance Portability and Accountability Act
of 1996.
Ocular Examination
The ophthalmologic examination consisted of external ocular
assessment and indirect ophthalmoscopy after mydriasis with 0.5%
tropicamide and 2.5% phenylephrine eye drops. Two ophthal-
mologists (A.R.C. and J.R.O.D.) recorded the optic disc, retinal,
and choroidal abnormalities using a wide-field digital imaging
system (RetCam Portable, Clarity Medical Systems). The wide-
field digital imaging system became available at the study site in
October 2019, and all children who presented positive ocular
findings were imaged with this device at this same period.
Focal active retinochoroiditis characterized by white retinal
choroidal lesions with or without vitreous cellular infiltrate and
focal retinal choroidal scars were considered diagnostic of ocular
toxoplasmosis. The retinal choroidal scars were subdivided as
follows: type I, well-defined limits with a hyperpigmented halo and
area of central retinal choroidal atrophy; type II, lesions with a
hypopigmented halo and a hyperpigmented central area; and type
III, hyperpigmented or hypopigmented lesions suggestive of hy-
perplasia or atrophy of the retinal pigment epithelium.19 The retinal
surface was divided into zones 1, 2, and 3 based on the
Classification of Retinopathy of Prematurity.20
DNA Extraction and Real-Time Quantitative PCR
Analysis
Deoxyribonucleic acid was extracted from the peripheral blood of
9 mothers and their infants (n ¼ 18) using the QIAamp DNA
Blood Mini Kit (Qiagen) following the manufacturer’s instructions.
After the extractions, the DNA samples were stored at 20 C until
quantitative PCR (qPCR) was performed.
The presence of T. gondii DNA in the peripheral blood of
mothers and infants was investigated by qPCR. SYBR Green PCR
Master Mix (PE Applied Biosystems) was used to target the
T. gondii B1 gene (forward: AGAGACACCGGAATGCGATCT,
and reverse: TTCGTCCAAGCCTCCGACT).21 Briefly, we used
10 ml of SYBR Green Master Mix, 0.4 ml forward and 0.4 ml
reverse (primer concentration, 10 mm), 7.2 ml of nuclease- and
DEPC-free water (Invitrogen), and 2 ml of DNA, with a total re-
action volume of 20 ml. Genomic DNA from the T. gondii RH
strain was used as a positive control and molecular grade water as a
negative control. Amplification and data analysis were performed
on an ABI Prism 7500 DNA sequence detection system.
Statistical Analysis
Statistical analysis was performed using STATA software
(STATA/SE version 12.0). The Student t test was used to compare
maternal ages for samples with different variances. In both cases, a
previous test of equality of variances was performed. The chi-
square test was used for all other comparisons.
Results
Serologic Maternal Characteristics
A total of 184 pregnant women who gave birth to 187 live infants
were included (Table 1). A total of 181 mothers had singleton
pregnancies, and 3 mothers had twin pregnancies. One mother
had a twin pregnancy, but 1 fetus died at 24 weeks of
1348
pregnancy, and she gave birth to a deceased fetus and a child
with congenital toxoplasmosis at 29 weeks of GA.
Of the 184 mothers, 149 (81%) had positive antieT. gondii IgG
and IgM serologies during pregnancy; 28 (15.2%) had no
antieT. gondii IgM and IgG antibodies during early pregnancy and
became IgG positive during the gestational course; 4 (2.2%) had no
antieT. gondii IgM antibodies and low levels of IgG, which
increased during pregnancy; 2 (1.1%) had no antieT. gondii IgG
antibodies and presented with positive T. gondii IgM; and 1 (0.5
%) had positive antieT. gondii IgM and inconclusive IgG. In
addition, 4 mothers tested positive for syphilis, and 3 tested posi-
tive for HIV; these women and their infants were not excluded
from analysis.
Of the 184 mothers diagnosed with acute toxoplasmosis
infection during pregnancy, 36 (19.6%) were diagnosed during the
first trimester, 48 (26.1%) during the second trimester, and 100
(54.3%) during the third trimester; among the last group, 71 (71%)
presented with positive antieT. gondii IgM titers, 25 (25%) had
negative IgG levels early in pregnancy and were IgG positive at
delivery, and 4 (4%) had <50 IU/ml levels of antieT. gondii IgG
antibodies during pregnancy and presented 650 UI/ml during the
gestational course.14 Sixty-eight (68%) of these 100 mothers were
diagnosed at the last examination, when they were admitted to the
hospital to give birth. When the maternal acute infection occurred
during the third trimester of pregnancy, it was associated signifi-
cantly (P ¼ 0.002) with a higher rate of congenital toxoplasmosis
in the newborns.
A total of 102 mothers (55.4%) underwent toxoplasmosis
treatment during pregnancy. Sixty-eight mothers (37%) did not
receive treatment because they were diagnosed with acute
toxoplasmosis infection days before delivery. Fourteen mothers
did not receive treatment because they presented with high
toxoplasmosis IgG avidity in the first or second trimesters or
because they were tested only 15 days before delivery. Treat-
ment during pregnancy was not associated significantly with a
lower rate of congenital toxoplasmosis in the newborn (P ¼
0.770) or with a lower rate of ocular abnormalities in the
newborn (P ¼ 0.516).
Clinical and Serologic Characteristics of the
Infants
Twenty-nine children (15.5%) were diagnosed with congenital
toxoplasmosis. Twenty-one had positive serum antieT. gondii
IgG and IgM titers, and 8 had positive antieT. gondii IgG and
negative IgM titers. The infants’ mean age at examination was
7.5  31.0 days, and 96 of 187 infants (51.3%) were female
(Table 1). Twenty-seven infants (14.4%) were preterm and 160
infants (85.6%) were at term. One infant tested positive for
syphilis and none tested positive for HIV in the 12-month
follow-up.
Fourteen of 181 infants (7.7%) who underwent cranial sonog-
raphy or CT presented with central nervous system abnormalities,
including cerebral calcifications in 13 infants (7.2%) (Tables 1 and
2), hydrocephalus in 3 infants, microcephaly in 2 infants, and
suture overlap in 1 infant. Cerebral calcifications were more
frequent in infants with ocular abnormalities (P < 0.001) (Table 1).
A total of 159 infants had their CSF screened for antieT. gondii
IgG and IgM serologies. A total of 132 infants (83%) were positive
for antieT. gondii IgG and negative for IgM in the CSF, 21 infants
(13.2%) were negative for IgG and IgM serologies, 5 infants
(3.1%) had inconclusive IgG and negative IgM test results, and 1
infant (0.6%) had inconclusive IgG and positive IgM test results.
Nine infants (5.7%) had high CSF protein concentrations, 5 of
whom had congenital toxoplasmosis.
 Conceição et al 
Ocular Findings after Toxoplasmosis Outbreak
Table 1. Demographics and Pregnancy History of Infants Exposed to Toxoplasmosis During Pregnancy
Characteristics With (n ¼ 19)
Age at examination, mean (SD) (range, days) 30.4 (92.2%)
Sex (female) 12 (63.2%)
Maternal treatment at pregnancy* 11 (57.89%)
Labor
Preterm 5 (26.3%)
At term 14 (73.7%)
Serum antieToxoplasma gondii IgM positivity 12 (63.2%)y
CSF antieT. gondii IgG positivity 12 (85.7%)y
Cerebral calcifications 12 (63.2%)
CI ¼ confidence interval; CSF ¼ cerebrospinal fluid; IgM ¼ immunoglobulin M; IgG ¼ immunoglobulin G; SD ¼ standard deviation.
*Mothers infected before the 18th week of pregnancy were treated with oral spiramycin. After the 18th week of pregnancy, spiramycin was suspended and
treatment with oral pyrimethamine, sulfadiazine, and folinic acid was initiated.
y
Despite both having 12 positive cases, there was a difference in the percentage because of the inconclusive cases of antieT. gondii IgG in the CSF.
Ocular Findings in Infants
Of 29 infants with congenital toxoplasmosis, 19 (65.5%) had
ocular abnormalities (Tables 2 and 3). The posterior segment
abnormalities included retinal choroidal lesions in 29 of 38 eyes
(76.3%) of children with ocular toxoplasmosis and optic disc
abnormalities in 5 eyes (13.2%). One infant with congenital
toxoplasmosis had positive serologies for syphilis and
toxoplasmosis but did not have ocular abnormalities. No infants
whose mothers tested positive for syphilis or HIV had ocular
abnormalities.
Anterior segment abnormalities were seen in 1 infant, who
presented with microphthalmia in the right eye and bilateral cata-
racts. A fundus examination was impossible in the right eye;
fundus examination of the left eye showed an optic disc coloboma
and multiple retinal choroidal lesions cellular infiltrates. A vitreous
strand between the optic disc and macula was also seen in the left
eye. This infant also had microcephaly, bronchopulmonary
dysplasia, and hepatosplenomegaly and died 4 months after birth.
Bilateral retinal choroidal lesions were found in 10 infants (20
eyes) (Figs 1e3), and unilateral lesions were seen in 9 infants (9
eyes). The posterior segment abnormalities included toxoplasmic
retinochoroiditis in 29 (76.3%) of 38 eyes (Figs 1e3), optic disc
pallor in 4 eyes (10.5%) (Fig. 1A), and optic disc coloboma in 1
eye (2.6%) (data not shown).
The retinal choroidal lesions showed signs of activity during the
first ophthalmologic examination in 9 eyes of 6 infants. Three eyes
of 2 infants (infants 1 and 18) had 3þ vitritis (Table 3), and 6 eyes
of 4 infants (infants 6, 13, 15, and 17) had 1þ vitritis (Table 3). All
infants with active retinal choroidal lesions were treated with oral
sulfadiazine, pyrimethamine, folinic acid, and prednisolone (1
mg/kg/bid) tapered according to decrease of inflammation.16,17
Regarding the location of the retinal choroidal lesions in the 29
eyes with retinochoroiditis, in 13 eyes (44.8%) the lesions were
only in zone 1, and in 5 (17.2%) eyes only in zone 2; no eyes had
retinal choroidal lesions only in zone 3. The lesions were found in
zones 1 and 2 in 9 eyes (31%) and in zones 1 to 3 in 2 eyes (6.9%).
In 1 eye (infant 18), a fundus examination of the right eye was
impossible because of microphthalmia and cataract (Table 3).
qPCR Analysis in the Peripheral Blood of Infants
and Mothers
Peripheral blood was collected from 9 infants and their mothers for
qPCR analyses using the B1 marker, including 3 infants with
Fundus Abnormalities
95% CI Without (n ¼ 168) 95% CI P Value
[0.00e74.85] 4.9 (9.5) [3.5e6.4] 0.244
e 84 (50.0%) e 0.277
93 (55.4%) e 0.833
e 22 (13.1%) e 0.120
e 146 (86.9%) e
e 9 (5.36%) e <0.001
e 120 (86.3%) e 0.949
e 1 (0.6 %) e <0.001
congenital toxoplasmosis without ocular disease, 4 infants with
congenital toxoplasmosis and ocular disease, and 2 infants who
were seronegative for T. gondii infection. All 9 mothers tested
positive for antieT. gondii IgG and IgM antibodies, and 6 mothers
were treated for toxoplasmosis during pregnancy.
All infants with congenital toxoplasmosis and ocular abnor-
malities were qPCR negative in the peripheral blood. The qPCR at
the B1 gene was positive in the peripheral blood in 1 of 2 infants
(50%) with congenital toxoplasmosis and without ocular lesions.
His mother was qPCR negative, even though she was untreated
during pregnancy. One (11.1%) of 9 mothers with toxoplasmosis
was qPCR positive for T. gondii infection in the peripheral blood,
even though she was treated during pregnancy. Moreover, her in-
fant with congenital toxoplasmosis was qPCR negative (data not
shown).
Discussion
In 2018, Santa Maria City in southern Brazil experienced
the largest human toxoplasmosis outbreak worldwide, with
931 confirmed cases. Not surprisingly, a recent study
showed that contaminated water may have caused this
outbreak.11 In the current study, we investigated the
prevalence of ocular abnormalities in infants with
congenital toxoplasmosis born during and months after a
waterborne outbreak. We included infants born between
January 2018 and November 2019, because the number of
patients born with congenital toxoplasmosis in 2018 and
2019 was higher than in previous years.12
Waterborne outbreaks in Brazil have been described.10,11
In 2001, a large human toxoplasmosis outbreak was
described in Santa Isabel do Ivaí, southern Brazil. In that
outbreak, T. gondii infection occurred in 426 people and
approximately 10% developed ocular toxoplasmosis,
including 4.4% with necrotizing retinal lesions.10,22 Ten
pregnant women presented with seroconversion, and
among the 5 newborns diagnosed with reactive
antieT. gondii IgG and IgM, 1 had severe congenital
anomalies and died 9 months later. Three patients with
congenital toxoplasmosis had ocular lesions, and only 1
patient had no ocular impairment.22
1349
 Ophthalmology Volume 128, Number 9, September 2021

Table 2. Gestational Characteristics of Infants with Congenital Toxoplasmosis and Ocular Abnormalities

T. gondii Maternal Cerebral

Patient Age (Days) Sex Trimester* Treatment (Trimester) GA at Birth Serum Toxoplasmosis Serology CSF Serology Calcifications
1 3 F 3 No Preterm IgG -, IgM þ IgG þ, IgM - Yes
2 30 M 3 No Preterm IgG þ, IgM þ N/A Yes
3 1 F 3 3 Term IgG þ, IGM - IgG þ, IgM þ Yes
4 4 M 3 3 Term IgG þ, IgM - IgG þ, IgM - Yes
5 4 M 3 3 Term IgG þ, IgM - IgG þ, IgM - Yes
6 2 F 3 No Preterm IgG þ, IgM þ IgG þ, IgM - Yes
7 5 F 2 2 Term IgG þ, IgM - IgG -, IgM - Yes
8 2 F 3 3 Term IgG þ, IgM þ IgG þ, IgM - No
9 2 F 3 No Term IgG þ, IgM þ IgG þ, IgM - No
10 1 F 3 3 Term IgG þ, IgM þ IgG þ, IgM - Yes
11 8 M 3 No Term IgG þ, IgM þ IgG þ, IgM - No
12 404 F 3 No Term IgG þ, IgM þ N/A No
13 7 F 3 3 Term IgG þ, IgM þ IgG þ, IgM - Yes
14y 77 F 3 No Preterm IgG þ, IgM - IgG þ, IgM - Yes
15 1 F 2 2 Term IgG þ, IgM - IgG þ, IgM - Yes
16 3 M 2 No Term IgG þ, IgM þ IgG þ, IgM - No
17 17 M 1 1 Term IgG þ, IgM þ N/A No
18z 4 F 2 2 Preterm IgG þ, IgM - N/A Yes
19 3 M 3 No Term IgG þ, IgM þ IgG þ, IgM - No

CSF ¼ cerebrospinal fluid; F ¼ female; GA ¼ gestational age; IgG ¼ immunoglobulin G; IgM ¼ immunoglobulin M; M ¼ male; N/A ¼ not applicable.
*Trimester of maternal infection.
y
Twin pregnancy in which 1 fetus died.
z
Deceased at 4 months.

A study isolated and genotyped T. gondii from the results in PCR and bioassay, and all the genotypes were
placenta of 5 pregnant women who miscarried during the equal, suggesting the same source of infection. Notably, a
Santa Maria outbreak. All pregnant women showed positive sludge sample from a water tank and 2 pork samples were

Table 3. Ocular Findings of Infants with Congenital Toxoplasmosis

Patient, Optic Disc Eyes with Ocular Zones with Retinal Zones with Retinal Retinal Choroidal
No. Pallor Retinochoroiditis Findings OD Ocular Findings OS Choroidal Lesion OD Choroidal Lesion OS Lesion Findings
1 OD OU VH 3þ VH 3þ 1 1, 2 A
2 OU OU VS No 1, 2 1 H
3 No OU No No 1, 2 1, 2 H
4 No OU No No 1, 2, 3 1, 2, 3 H
5 OS OD No No 1, 2 No H
6 No OU VH 1þ VH 1þ 2 1, 2 A
7 No OU No No 1 1 H
8 No OU No No 1 1, 2 H
9* No OS No No No 2 H
10 No OD No No 1, 2 No H
11* No OD No No 1 No H
12 No OU No No 1 1 H
13 No OD VH 1þ No 1 No A
14 No OU No No 1 2 H
15 No OS No VH 1þ No 1 A
16 No OS No No No 1 H
17 No OU VH 1þ VH 1þ 2 2 A
18y No OS MO, CA CA, ODC, VS VH 3þ N/A 1, 2 A
19 No OD No No 1 No H

A ¼ active lesions; CA ¼ cataract; H ¼ healed lesions; MO ¼ microphthalmia; N/A ¼ not available; OD ¼ right eye; ODC ¼ optic disc coloboma; OS ¼
left eye; OU ¼ both eyes; VH ¼ vitreous haze; VS ¼ vitreous strand.
*These infants had a normal fundus at the first ophthalmologic examination and presented with retinochoroiditis during follow-up. Patient 9 was diagnosed
with retinochoroiditis in a follow-up examination performed 8 months and 9 days after birth; patient 11 was diagnosed with retinochoroiditis at a follow-up
examination performed 13 months and 6 days after birth.
y
Deceased at 4 months.

1350
 Conceição et al 
Ocular Findings after Toxoplasmosis Outbreak

Figure 1. Fundus photographs of patient 1, a 1-year 3-month-old girl with congenital toxoplasmosis. A, The right eye has a pale optic disc and a central
macular retinal choroidal scar. B, The left eye has nasal and central macular retinal choroidal scars. This eye also has a nasal superior retinal choroidal scar in
zone 2 (not shown).

positive for PCR, but the genotypes were different from the
placental isolates.23 In another study, piglets were given
potentially contaminated water for 21 days and all the
animals seroconverted to T. gondii.11 Furthermore, a case-
control study associated the risk of infection with the
ingestion of tap water and raw vegetables.13
Acute toxoplasmosis infection during pregnancy can lead
to abortion or fetal death.9,24 In the first months of
pregnancy, toxoplasmosis transmission in the newborn is
relatively low and may be associated with spontaneous
abortion. In early pregnancy, the placental barrier reaches
a thickness of 50 to 100 mm and progressively decreases
to 2.5 to 5 mm at the end of pregnancy, allowing parasites
to more easily invade trophoblasts by the end of the
gestational course.25 Furthermore, the internal
cytotrophoblast layer is discontinuous, with its cell
number decreasing during the gestational period.25 On the
other hand, infection early in gestation is severe, because
reduced expression of toll-like receptors in trophoblast
cells during the first trimester of pregnancy may indicate a
reduced ability of early placental cells to engage the immune
response to intrauterine infection.25 The current results
showed a fetal death during a twin pregnancy and an
infant who was born with congenital toxoplasmosis.
Postnatal deaths also may occur in patients with severe
neurologic sequelae, usually related to pneumonia.26 In
the current study, an infant presented with severe
neurologic sequelae due to congenital toxoplasmosis and
died of pneumonia at 4 months of age.
Congenital toxoplasmosis is associated with a higher risk
of ocular involvement compared with postnatally acquired
infections.27 Retinochoroiditis, strabismus, nystagmus,
amblyopia, optic disc atrophy, retinal detachment, cataract,
neovascular glaucoma, and choroidal neovascularization
are associated with congenital ocular toxoplasmosis.22
Severe central nervous system abnormalities in congenital
toxoplasmosis include hydrocephalus, microcephaly, and
intracranial calcifications.28
Retinochoroiditis is the most common ophthalmologic
clinical finding in congenital toxoplasmosis, and the retinal
choroidal lesions usually are in the posterior pole.29 The
current study found that 15.5% of infants had congenital
toxoplasmosis, and, among them, 65.5% had ocular
abnormalities. In most cases, the lesions were quiescent
scars at the time of detection, which agrees with other
studies.7,9,24 Anterior segment abnormalities are more
common in viral congenital disorders, including congenital
rubella and congenital Zika syndrome.30,31 However, we

Figure 2. Fundus photographs of patient 2, a 1-year 4-month-old boy with congenital toxoplasmosis. A, The right eye has retinal choroidal scars (nasal,
inferior, and central macula). B, The left eye has nasal and central macular retinal choroidal scars.

1351
 Ophthalmology Volume 128, Number 9, September 2021
Figure 3. Fundus photographs of patient 3, a 1-year 2-month-old girl with congenital toxoplasmosis. A, The right eye has a nasal inferior retinal choroidal
scar. This eye also has a temporal retinal choroidal scar located in zone 3 (not shown). B, The left eye has nasal and inferior retinal choroidal scars.
found anterior segment abnormalities in 1 infant with
congenital toxoplasmosis who presented with unilateral
microphthalmia, bilateral cataracts, gross cerebral
calcifications, and hydrocephalus.
In the Santa Isabel do Ivaí toxoplasmosis outbreak, the
toxoplasmic congenital ocular lesions were mostly in zones
1 and 2, which agreed with our findings.22 We also observed
that 31% of the eyes with retinochoroiditis presented with
active lesions, including cellular infiltrates in vitreous,
retina, and choroid, in the first ophthalmologic
examination, a higher rate than reported by Melamed
et al.9 A possible explanation for our higher rate of active
lesions could be that we included younger infants. We
believe that fundus images showing the active lesions
would be interesting to illustrate the early manifestations
of toxoplasmic retinochoroiditis. However, the wide-field
digital imaging system only became available at the study
site by the end of 2019, when all ocular lesions had already
been treated and were healed.
Infants with severe eye abnormalities also present with
severe neurologic involvement including cerebral calcifica-
tions.32 The current study found a higher rate of cerebral
calcifications in infants with ocular abnormalities. Forty-
five percent of the infants with congenital toxoplasmosis
had cerebral calcifications, and 65.5% had ocular abnor-
malities. Another disease that causes cerebral calcifications
in the newborn is congenital cytomegalovirus. However, in
congenital toxoplasmosis, the cerebral calcifications are
more diffuse compared with the intracranial calcifications in
congenital cytomegalovirus, which are located
periventricularly.27
In Brazil, the prevalence and severity of ocular toxo-
plasmosis are higher than in the United States and
Europe.10,33 Studies have suggested that the risk of ocular
involvement in infected people is due to the higher
prevalence of atypical T. gondii strains.34,35 The findings
from the Santa Isabel do Ivaí outbreak supported the
concept that people infected with atypical strains are at
increased risk of ocular disease.10 In the current study, we
did not isolate the T. gondii strains, but we found a high
prevalence of severe ocular manifestations in infants with
congenital toxoplasmosis. Recently, a new atypical
1352
T. gondii strain was isolated from the placenta of 2
pregnant women with acute toxoplasmosis during the
outbreak in Santa Maria City. This T. gondii strain was
lethal to mice.36
Several groups have reported the use of real-time PCR as
a tool for diagnosing congenital toxoplasmosis and ocular
toxoplasmosis in neonates.37,38 We detected T. gondii DNA
in the peripheral blood of 50% of infants with congenital
toxoplasmosis and no ocular disease who were tested by
qPCR. No positive results were observed in the samples
from infants with congenital toxoplasmosis and ocular
disease. In contrast, a study showed that T. gondii qPCR
positivity was higher in infants with active ocular lesions.38
In Brazil, toxoplasmosis, syphilis, and HIV screenings
are mandatory during pregnancy and are offered free of
charge by Brazil’s Unified Health System. Testing for
antieT. gondii IgG and IgM antibodies is routinely per-
formed at the beginning of the first trimester. In case of
negative antieT. gondii IgG and IgM antibodies, these se-
rologies are repeated in the second and third trimesters. In
patients with positive antieT. gondii IgG and IgM anti-
bodies, other examinations including IgG avidity test, PCR
analysis of the amniotic fluid, and monthly obstetric ultra-
sounds are usually required.39 Furthermore, at the Santa
Maria University Hospital, testing for antieT. gondii IgG
and IgM antibodies is performed for every woman at the
moment she is admitted to the hospital for delivery.15
Some infants diagnosed with congenital toxoplasmosis
did not have IgM antibodies at birth, only maternal IgG
antibodies. Notably, no infants whose mothers had an in-
crease in toxoplasmosis IgG antibodies during pregnancy
had congenital toxoplasmosis; therefore, we hypothesized
that increased IgG may not be a major risk factor for
congenital toxoplasmosis.
In the current study, maternal infection during the third
trimester of pregnancy was associated with a higher rate of
congenital toxoplasmosis, which agrees with the literature.40
Infected placentas are observed at a higher frequency during
the later stages of pregnancy, which has been correlated
with the phagocytic efficiency of macrophages in placental
tissue.41 The risk of T. gondii vertical transmission
increases steeply with the GA of the fetus when maternal
 Conceição et al 
Ocular Findings after Toxoplasmosis Outbreak
infection occurs, with a probability of 15% at 13 weeks GA,
44% at 26 weeks GA, 71% at 36 weeks GA, and up to 90%
during the last weeks of pregnancy.42 During the last
trimester of pregnancy, the transmission rates are
associated with approximately 85% of fetal infection and a
high rate of ocular abnormalities, possibly due to the
gradual improvement of the fetal immune system and a
highest resistance to infection.40
Furthermore, 37% of the mothers were tested for toxo-
plasmosis only when they were admitted to the hospital,
therefore making it difficult to determine when the fetus was
exposed during pregnancy. Although prenatal toxoplasmosis
serological screening tests are routinely recommended and
available in Brazil, it is not uncommon that low-income
pregnant women, especially the younger ones, have irreg-
ular or absent prenatal care, leaving gaps for serological
testing and postponing early maternal infection recognition.43
The current study did not find a lower rate of congenital
toxoplasmosis and ocular lesions in infants whose mothers
were treated for toxoplasmosis during pregnancy. However,
we believe the study may have been underpowered to detect
the maternal treatment efficacy. As extensively described in
the literature, maternal treatment is highly indicated to avoid
life- and vision-threatening outcomes in newborns.44
Our study has some limitations. Santa Maria City faced
an outbreak of large proportions in 2018 that overwhelmed
the city public health system. Our research team also needed
to quickly start a research protocol to investigate the great
number of pregnant women infected with toxoplasmosis and
of infants born with congenital toxoplasmosis. Notably,
some infants vertically exposed to toxoplasmosis could have
been missed, including those born at home from mothers
without prenatal screening and those whose mothers had a
recent infection and tested negative.43
After the Santa Maria outbreak, the development of a
Clinical Protocol and Guidelines for Gestational and
Footnotes and Disclosures
Originally received: November 26, 2020.
Final revision: February 28, 2021.
Accepted: March 5, 2021.
Available online: March 10, 2021. Manuscript no. D-20-03015.
1
Federal University of Santa Maria, Santa Maria, RS, Brazil.
2 Valadão, Commodaro, de Oliveira Dias, Belfort
Department of Ophthalmology, Federal University of São Paulo, Paulista
Medical School, São Paulo, SP, Brazil.
3
Vision Institute, São Paulo, SP, Brazil.
Disclosure(s):
All authors have completed and submitted the ICMJE disclosures form.
The author(s) have no proprietary or commercial interest in any materials
discussed in this article. The study received support for travel and hotel
expenses from the Vision Institute for two participants from São Paulo.
HUMAN SUBJECTS: The ethics committee Institutional Review Boards
(IRBs) of the Federal University of Santa Maria (IRB Number 3.109.150)
and the co-participant institution (Vision Institute), Invitare Clinical
Research Auditing and Consulting Ltda. (IRB Number 3.113.294)
approved the study, which was performed in accordance with the tenets of
the Declaration of Helsinki and complied with the Health Insurance
Portability and Accountability Act of 1996. A parent or legal guardian of
each infant provided informed consent.
Congenital Toxoplasmosis was initiated to implement inte-
grated surveillance. However, the protocol was not
concluded to date. Until its publication, the Brazilian Min-
istry of Health recommends the compulsory notification of
acute gestational and congenital cases. Notably, outbreaks in
Rio Grande do Sul state are investigated by the State Center
of Health Surveillance. In Santa Maria City, a protocol also
recommends specific measures during outbreaks, including
(1) monthly serologic investigation for all pregnant women;
(2) ophthalmological referral independently of symptoms;
(3) absolute preventive measures until identification of the
infection source; and (4) recommendation that women with
or without the disease avoid pregnancy at least 6 months
after the outbreaks.45
The current findings showed a high prevalence of
congenital toxoplasmosis and severe clinical manifestations
in infants born during the largest toxoplasmosis outbreak in
the world. Our study showed that maternal infection during
the third trimester of pregnancy was associated with a higher
rate of congenital infections independent of maternal treat-
ment. Toxoplasmosis outbreaks have a dramatic impact on
public health, because the ophthalmological and maternal-
fetal consequences may be dramatic and include mis-
carriages, fetal deaths, and newborns with congenital toxo-
plasmosis. Finally, the need for surveillance and early
treatment is necessary in any toxoplasmosis outbreak
context, especially to cover susceptible pregnant women in
high-risk regions.
Acknowledgments
The authors thank Andréia Souza Passos and Fernanda Morales de
Sá from Advance Vision for the loan of the wide-field fundus
camera and help with fundus photograph acquisition, respectively.
This study was self-funded and received support from the Vision
Institute. Vision Institute had no role in the design or conduct of
this research.
No animal subjects were used in the study.
Author Contributions:
Conception and design: Conceição, Valadão, Commodaro, de Oliveira
Dias, Belfort
Data collection: Conceição, Missio, Belucik, Reetz, Leber, Ribeiro, Costa,
Analysis and interpretation: Conceição, Missio, Belucik, Reetz, Leber,
Ribeiro, Costa, Valadão, Commodaro, de Oliveira Dias, Belfort
Obtained funding: N/A; Study was performed as part of regular employ-
ment duties at the Santa Maria University Hospital, Santa Maria, RS, Brazil.
No additional fundings was provided.
Overall responsibility: Conceição, Missio, Belucik, Reetz, Leber, Ribeiro,
Costa, Valadão, Commodaro,de Oliveira Dias, Belfort
Abbreviations and Acronyms:
AZT ¼ azidothymidine; bid ¼ twice daily; CSF ¼ cerebrospinal fluid;
CT ¼ computed tomography; DNA ¼ deoxyribonucleic acid;
GA ¼ gestational age; HIV ¼ human immunodeficiency virus;
IgG ¼ immunoglobulin G; IgM ¼ immunoglobulin M; IRB ¼ Institutional
Review Board; PCR ¼ polymerase chain reaction; qPCR ¼ quantitative
polymerase chain reaction; VDRL ¼ venereal disease research laboratory.
1353
 Ophthalmology Volume 128, Number 9, September 2021
Keywords:
Congenital toxoplasmosis, Outbreak, Retinochoroiditis, Toxoplasma
gondii.
References
1. Dubey JP. The history of Toxoplasma gondii–the first 100
years. J Eukaryot Microbiol. 2008;55:467e475.
2. Robert-Gangneux F, Dupretz P, Yvenou C, et al. Clinical
relevance of placenta examination for the diagnosis of
congenital toxoplasmosis. Pediatr Infect Dis J. 2010;29:
33e38.
3. Hampton MM. Congenital toxoplasmosis: a review. Neonatal
Netw. 2015;34:274e278.
4. SYROCOT (Systematic Review on Congenital Toxoplas-
mosis) study group. Effectiveness of prenatal treatment for
congenital toxoplasmosis: a meta-analysis of individual pa-
tients’ data. Lancet. 2007;369:115e122.
5. Wallon M, Peyron F, Cornu C, et al. Congenital toxoplasma
infection: monthly prenatal screening decreases transmission
rate and improves clinical outcome at age 3 years. Clin Infect
Dis. 2013;56:1223e1231.
6. Halonen SK, Weiss LM. Toxoplasmosis. Handb Clin Neurol.
2013;114:125e145.
7. Mets MB, Holfels E, Boyer KM, et al. Eye manifestations of
congenital toxoplasmosis. Am J Ophthalmol. 1996;122:
309e324.
8. Garg S, Mets MB, Bearelly S, Mets R. Imaging of congenital
toxoplasmosis macular scars with optical coherence tomogra-
phy. Retina. 2009;29:631e637.
9. Melamed J, Eckert GU, Spadoni VS, et al. Ocular manifesta-
tions of congenital toxoplasmosis. Eye (Lond). 2010;24:
528e534.
10. Vaudaux JD, Muccioli C, James ER, et al. Identification of an
atypical strain of toxoplasma gondii as the cause of a water-
borne outbreak of toxoplasmosis in Santa Isabel do Ivai,
Brazil. J Infect Dis. 2010;202:1226e1233.
11. Minuzzi CE, Fernandes FD, Portella LP, et al. Contaminated
water confirmed as source of infection by bioassay in an
outbreak of toxoplasmosis in south Brazil. Transbound Emerg
Dis. 2020;00:1e6.
12. Prefeitura Municipal de Santa Maria. Relatórios anuais de
gestão 2020. https://www.santamaria.rs.gov.br/saude/658-
relatorios-anuais-de-gestao. Accessed May 12, 2020.
13. Menegolla IA, Difante CM, Ramos L, et al. Investigação de surto
de toxoplasmose em Santa Maria/RS, 2018. IV Simpósio Brasi-
leiro de Toxoplasmose. Treinamento em Vigilância Integrada
para Toxoplasmose Gestacional e Congênita. 2018. Available at:
http://bvsms.saude.gov.br/bvs/publicacoes/simposio_tox-
oplasmose_resumos.pdf; Accessed March 29, 2021.
14. Montoya JG. Laboratory diagnosis of Toxoplasma gondii
infection and toxoplasmosis. J Infect Dis. 2002;185:S73eS82.
15. Mitsuka-Breganó R, Lopes-Mori FMR, Navarro IT. Toxo-
plasmose Adquirida na Gestação e Congênita: Vigilância em
Saúde, Diagnóstico, Tratamento e Condutas. Londrina:
EDUEL; 2010:1e62.
16. da Saúde Ministério. Atenção à Saúde do Recém-Nascido.
Guia Para os Profissionais de Saúde. Intervenções Comuns.
Icterícia e Infecções; 2011. http://bvsms.saude.gov.br/bvs/
publicacoes/atencao_recem_nascido_%20guia_profissionais
_saude_v2.pdf. Accessed November 26, 2020.
17. McLeod R, Boyer K, Karrison T, et al. Outcome of treatment
for congenital toxoplasmosis, 1981-2004: the National
1354
Correspondence:
João Rafael de Oliveira Dias, MD, PhD, Rua Marechal Bormann, 243-E.
Chapecó, SC, Brazil 89802-120. E-mail: dias_joaor@yahoo.com.br.
Collaborative Chicago-Based, Congenital Toxoplasmosis
Study. Clin Infect Dis. 2006;42:1383e1394.
18. da Saúde Ministério. Secretaria de Vigilância em Saúde.
Programa Nacional de DST e AIDS. Protocolo para pre-
venção de transmissão vertical de HIV e sífilis. http://bvsms.
saude.gov.br/bvs/publicacoes/protocolo_prevencao_transmissao_
verticalhivsifilis_manualbolso.pdf; 2007. January 30, 2021.
19. Oréfice F. Uveíte Clínica e Cirúrgica: Texto e Atlas. Rio de
Janeiro, Brazil: Editora Cultura Médica; 2005;1:703-704.
20. An international classification of retinopathy of prematurity.
The Committee for the Classification of Retinopathy of Pre-
maturity. Arch Ophthalmol. 1984;102:1130e1134.
21. Fekkar A, Bodaghi B, Touafek F, et al. Comparison of
immunoblotting, calculation of the Goldmann-Witmer coeffi-
cient, and real-time PCR using aqueous humor samples for
diagnosis of ocular toxoplasmosis. J Clin Microbiol. 2008;46:
1965e1967.
22. Sanders AP, Santos T, Felipe CKK, et al. Ocular lesions in
congenital toxoplasmosis in Santa Isabel do Ivaí, Paraná,
Brazil. Pediatr Infect Dis J. 2017;36:817e820.
23. Pinto-Ferreira F, Nino BSL, Martins FDC, et al. Isolation,
genetic and immunohistochemical identification of Toxo-
plasma gondii from human placenta in a large toxoplasmosis
outbreak in southern Brazil, 2018. Infect Genet Evol. 2020;85:
104589.
24. Gilbert RE, Freeman K, Lago EG, et al. Ocular sequelae of
congenital toxoplasmosis in Brazil compared with Europe.
PLoS Negl Trop Dis. 2008;2:e277.
25. Blaszkowska J, Goralska K. Parasites and fungi as a threat for
prenatal and postnatal human development. Ann Parasitol.
2014;60:225e234.
26. Goldenberg RL, Thompson C. The infectious origins of still-
birth. Am J Obstet Gynecol. 2003;189:861e873.
27. Barton LL, Mets MB. Congenital lymphocytic choriome-
ningitis virus infection: decade of rediscovery. Clin Infect Dis.
2001;33:370e374.
28. Benenson MW, Takafuji ET, Lemon SM, et al. Oocyst-
transmitted toxoplasmosis associated with ingestion of
contaminated water. N Engl J Med. 1982;307:666e669.
29. Dubey JP, Lago EG, Gennari SM, et al. Toxoplasmosis in
humans and animals in Brazil: high prevalence, high burden of
disease, and epidemiology. Parasitology. 2012;139:
1375e1424.
30. Arnold J. Ocular manifestations of congenital rubella. Curr
Opin Ophthalmol. 1995;6:45e50.
31. de Paula Freitas B, de Oliveira Dias JR, Prazeres J, et al.
Ocular findings in infants with microcephaly associated with
presumed Zika virus congenital infection in Salvador, Brazil.
JAMA Ophthalmol. 2016;134:529e535.
32. McAuley J, Boyer KM, Patel D, et al. Early and longitudinal
evaluations of treated infants and children and untreated his-
torical patients with congenital toxoplasmosis: the Chicago
Collaborative Treatment Trial. Clin Infect Dis. 1994;18:
38e72.
33. Silveira C, Belfort Jr R, Muccioli C, et al. A follow-up study of
Toxoplasma gondii infection in southern Brazil. Am J Oph-
thalmol. 2001;131:351e355.
 Conceição et al 
Ocular Findings after Toxoplasmosis Outbreak

34. Bottós J, Miller RH, Belfort RN, et al. Bilateral retinochor-
oiditis caused by an atypical strain of Toxoplasma gondii. Br J
Ophthalmol. 2009;93:1546e1550.
35. Cortés DA, Aguilar MC, Ríos HA, et al. Severe acute
multi-systemic failure with bilateral ocular toxoplasmosis
in immunocompetent patients from urban settings in
Colombia: case reports. Am J Ophthalmol Case Rep.
2020;18:100661.
36. Minuzzi CE, Portella LP, Bräunig P, et al. Isolation and mo-
lecular characterization of Toxoplasma gondii from placental
tissues of pregnant women who received toxoplasmosis
treatment during an outbreak in southern Brazil. PLoS One.
2020;15:e0228442.
37. Stajner T, Bobic B, Klun I, et al. Prenatal and early postnatal
diagnosis of congenital toxoplasmosis in a setting with no
systematic screening in pregnancy. Medicine. 2016;95:e2979.
38. Costa JGL, Carneiro ACAV, Tavares AT, et al. Real-time
PCR as a prognostic tool for human congenital toxoplasmosis.
J Clin Microbiol. 2013;51:2766e2768.
39. da Saúde Ministério. Secretaria de Atenção à Saúde. Depar-
tamento de Ações Programáticas Estratégicas. Gestação de
Alto Risco - Manual Técnico. http://bvsms.saude.gov.br/bvs/
publicacoes/manual_tecnico_gestacao_alto_risco.pdf; 2010.
Accessed November 26, 2020.
40. Ortiz-Alegria LB, Caballero-Ortega H, Cañedo-Solares I, et al.
Congenital toxoplasmosis: candidate host immune genes
relevant for vertical transmission and pathogenesis. Genes
Immun. 2010;11:363e373.
41. Wujcicka W, Wilczynski J, Nowakowska D. Do the placental
barrier, parasite genotype and Toll-like receptor poly-
morphisms contribute to the course of primary infection with
various Toxoplasma gondii genotypes in pregnant women?
Eur J Clin Microbiol Infect Dis. 2014;33:703e709.
42. Bollani L, Strocchio L, Stronati M. Congenital toxoplasmosis.
Early Hum Dev. 2013;89:70e72.
43. Andreucci CB, Cecatti JG. Desempenho de indicadores de
processo do Programa de Humanização do Pré-Natal e Nas-
cimento no Brasil: uma revisão sistemática. Cad Saúde Púb-
lica. 2011;27:1053e1064.
44. Khan K, Khan W. Congenital toxoplasmosis: an overview of
the neurological and ocular manifestations. Parasitol Int.
2018;67:715e721.
45. da Saúde Ministério. Secretaria de Vigilância em Saúde.
Departamento de Vigilância das Doenças Transmissíveis. Pro-
tocolo de notificação e investigação: Toxoplasmose gestacional e
congênita. https://bvsms.saude.gov.br/bvs/publicacoes/proto-
colo_notificacao_investigacao_toxoplasmose_gestacional_cong
enita.pdf; 2018. Accessed January 30, 2021.

Pictures & Perspectives

Choroidal Effusions and Posterior Scleritis in Idiopathic Orbital Inflammation

A 67-year-old woman presented with 1 week of progressive left orbital pain and swelling. Her vision was normal. Her left eye had
restriction of abduction and inferoduction, prominent periorbital edema, chemosis, and posterior choroidal folds and detachments (Fig A).
Neuroimaging demonstrated a hyperintense enhancing lesion in the inferotemporal orbit (arrowhead) with surrounding fat stranding, scleral
and choroidal thickening, enhancement, and circumferential effusions (Fig B). No sinusitis was noted. The patient was treated empirically
with 24 hours of antibiotics. Orbital inflammatory work up and blood cultures were unrevealing. Consequently, idiopathic orbital
inflammation was diagnosed, antibiotics discontinued, and clinical improvement followed steroids (Magnified version of Fig A-B is
available online at www.aaojournal.org).
DAVID J. DOOBIN, MD, PHD
ANN Q. TRAN, MD
MICHAEL KAZIM, MD
Department of Ophthalmology, Columbia University, New York, New York

1355