International Journal of Food Microbiology 127 (2008) 26–31

Contents lists available at ScienceDirect

International Journal of Food Microbiology

j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i j f o o d m i c r o

Characterization of EprA, a major extracellular protein of Oenococcus oeni with

protease activity
Patrice Folio, Jean-François Ritt, Hervé Alexandre, Fabienne Remize ⁎
Laboratoire Recherche en Vigne et Vin, Institut Universitaire de la Vigne et du Vin (IUVV) Jules Guyot, Rue Claude Ladrey, Université de Bourgogne, F-21000 Dijon, France

A R T I C L E I N F O A B S T R A C T

Article history: Extracellular proteins from Oenococcus oeni, a wine-making bacterium, were isolated during growth on
Received 18 January 2008 media differing by their nitrogen content. Analysis by two-dimensional electrophoresis revealed a low
Received in revised form 27 May 2008 number of protein signals. Among the main spots, one signal corresponded to a single protein, which
Accepted 27 May 2008
contained a lysine repeat domain characteristic of cell-wall hydrolases. We demonstrated that this major
protein, named EprA, was able to hydrolyse several proteins. The heterologous production of this protein in
Keywords:
Oenococcus
Escherichia coli confirmed the protease activity of EprA. With a MW of 21.3 kDa and a pI of 5.3, EprA presents
Wine optimal activity at pH 7.0 and 45 °C. This O. oeni protease differs from all lactic acid bacteria proteases so far
Nitrogen assimilation identified, and thus this bacterium possesses at least three proteases for wine protein hydrolysis.
Extracellular protein © 2008 Elsevier B.V. All rights reserved.
Neutral protease
Enzyme characterization

1. Introduction
Typically, wine contains between 100 and 600 mg/l of nitrogen. It
is mainly composed of two compounds, peptides and free amino
acids, but proteins may account for up to 2% of total nitrogen (Feuillat
et al., 1998). Wine proteins are essentially glycosylated and they come
from grapes and yeast (Moreno-Arribas et al., 2002; Caridi, 2006;
Flamini and De Rosso, 2006). Indeed, polysaccharides and cell-wall
proteins are liberated in the extracellular medium by S. cerevisiae
during alcoholic fermentation and wine aging. Wine nitrogen
composition is thought to be a key element for the growth of Oeno-
coccus oeni and consequently for the initiation of malolactic
fermentation generally performed by this bacterium (Alexandre
et al., 2004). Malolactic fermentation is beneficial for red wines and
most white wines since it reduces acidity and improves the sensorial
profile of wines. Most of the time, it occurs after alcoholic
fermentation, but is often inhibited or delayed because the environ-
ment existing in the wine is unfavorable for bacterial growth. The
presence of several amino acids in the medium is essential for the
development of O. oeni due to its numerous auxotrophies (Garvie,
1967; Fourcassie et al., 1992; Remize et al., 2006). This bacterium is
able to use small peptides of up to eight amino acid residues (Aredes
Fernandez et al., 2004; Ritt et al., 2008). It has been demonstrated
that oligopeptides of two to five residues are actively internalized. In
addition, the intracellular peptidase system is potent for peptide
⁎ Corresponding author. Tel.: +33 685 19 91 48; fax: +33 380 39 66 40.
E-mail address: fremize@u-bourgogne.fr (F. Remize).
assimilation (Ritt et al., 2007). In parallel, there is some evidence that
the bacterium is able to hydrolyse wine proteins via extracellular
enzyme activity. Firstly, yeast mannoproteins can be used by O. oeni
as a unique source of nitrogen (Guilloux-Benatier et al., 1993). Sec-
ondly, O. oeni is able to hydrolyse peptides and glycosylated proteins
from grape and yeast lees thanks to the activity of extracellular
enzymes (Rollan et al., 1993; Manca de Nadra et al., 1997, 1999;
Guilloux-Benatier et al., 2000). More generally, lysis of the cellular
components of yeast by O. oeni requires the production of proteases,
peptidases and glycosidases (Grimaldi et al., 2000; Guilloux-Benatier
et al., 2000).
Two distinct extracellular proteases with activity on grape juice
proteins have already been described (Rollan et al., 1993, 1995). One is
produced in the early growth phase on a rich medium, while the other
is produced at the end of the growing phase. Culture pH and incubation
temperature affected the production of these proteases in a strain-
dependent way. Moreover, it has been shown that complete starvation
greatly increases proteases production, as does the presence of ethanol
or sulphur dioxide in the medium (Farias et al., 1996; Rollan et al., 1998;
Manca de Nadra et al., 2005). One exoprotease has been partially
purified and characterized (Farias and Manca de Nadra, 2000). This was
an aspartic protease composed of two subunits of 17 kDa and
exhibiting a maximal in vitro activity at pH 4.5 and 25 °C. In addition,
Remize et al. (2005) confirmed the presence of extracellular pro-
tease activity evidenced during the growth phase on a poor-nitrogen
medium.
Here we report the analysis of extracellular proteins from O. oeni
ATCC BAA-1163 cultured in two different nitrogen environments. One
major protein was identified as a protease and named EprA.

0168-1605/$ – see front matter © 2008 Elsevier B.V. All rights reserved.
doi:10.1016/j.ijfoodmicro.2008.05.039
 P. Folio et al. / International Journal of Food Microbiology 127 (2008) 26–31
2. Materials and methods
2.1. Strains and growth conditions
The reference strain O. oeni ATCC BAA-1163 was used for all
experiments. The bacteria were grown either in a rich-nitrogen
culture medium, reference FT80 medium (Cavin et al., 1989) or in a
poor-nitrogen medium named FT-A (Remize et al., 2005). The pH of
both media was adjusted to 5.3. FT80 was used without Tween 80 and
contained both yeast and meat extract with a total nitrogen content of
approximately 700 mg/l. FT-A differed from FT80 by its nitrogen
content and composition. The carbon base was supplemented with
the yeast extract A (Remize et al., 2005) and total nitrogen was set at
100 mg/l. After an acclimation step of 24 h at 30 °C in FT80 medium,
the bacteria were cultured on either FT80 or FT-A medium in non-
agitated 80%-filled tubes at 30 °C. The cultures were inoculated to an
OD600 of 0.1. Growth was monitored by measuring the absorbance at
600 nm (OD600). O. oeni culture supernatants were collected at
different times by centrifugation at 5000 ×g for 10 min and then stored
at 4 °C for further biochemical studies.
For expression studies, Escherichia coli Novagen® Novablue and
BL21(DE3) strains were used. They were cultivated in agitated flasks
containing LB medium plus, if necessary, kanamycin 30 µg/ml. TB
medium was used to grow E. coli before mini-preparation of the
plasmid.
2.2. Collection of O. oeni extracellular proteins
All cells and debris were removed from supernatants by filtration
on 0.22 µm sterilization units (Amicon, Millipore, Molsheim, France).
The supernatants were then subjected to ultrafiltration using a 50 ml
Stirred Cell equipped with a cellulose acetate membrane with a cut-off
of 10 kDa (Millipore). The retentate was washed once with ultrapure
water to remove small molecules. Alternatively, a dialysis step against
ultrapure water was performed with a cut-off at 10 kDa. The
concentrate obtained was used for the measurement of protease
activity and protein determination. The remaining concentrate was
subjected to acetone precipitation before electrophoresis.
2.3. Protein determination and SDS-PAGE
Protein content was measured according to the Bradford method
(Bradford, 1976). Reagent was purchased from Bio-Rad and the protein
standard was bovine serum albumin. SDS-PAGE of protein samples
was performed as described previously (Remize et al., 2005).
2.4. Analysis of O. oeni extracellular proteins by two-dimensional
electrophoresis (2-DE)
2-DE was essentially performed according to the principles of
O'Farrell (1975), but with a number of adaptations. The protein pellet
was dispersed in rehydration buffer, which contained 7 M urea, 2 M
thiourea, 2% CHAPS and traces of bromophenol blue. Final concentra-
tions of 0.4% v/v ampholyte 3–10 solution (Bio-Rad, Marnes-la-
Coquette, France) and 2 mM tributylphosphine (TBP) were added
prior to isoelectric focusing (IEF).
First dimension focalisation was performed on Bio-Rad 7 cm
Immobilized pH 3.0–10.0 gradient (IPG) strips, previously passively
rehydrated with the sample in appropriate trays. Proteins were
separated using the Bio-Rad Protean IEF Cell System. IEF was conducted
with a maximum setting of 3500 V at a focusing temperature of 19 °C for
a total of 8000 Vhs per strip. Prior to the second dimension, focused IPG
strips were equilibrated twice under gentle agitation for 15 min in an
equilibration solution (50 mM Tris–HCl, pH 8.8; 6 M urea; 2% w/v SDS;
30% v/v glycerol) containing 5 mM TBP for the first step or 2.5% w/v
iodoacetamide and trace of bromophenol blue for the second step. The
27
second dimension (SDS-PAGE) was carried out with 12.5% T, 3.3% C
polyacrylamide gels in the Mini-Protean 3 Dodeca™ cell system (Biorad)
apparatus. The gels were stained using colloidal Coomassie blue
(Neuhoff et al., 1988).
2.5. Zymography
Zymography was performed according to Leber and Balkwill
(1997) with some modifications. After mixing with an equal volume
of 2× loading buffer [125 mM Tris–HCl pH 6.8, 20% (v/v) glycerol, 2%
(w/v) SDS and 0.02% (w/v) bromophenol blue], the samples were
loaded onto a 12.5% (w/v) acrylamide/bis minigel co-polymerized
with 0.12% (w/v) Hammarsten casein, gelatine or mannoproteins.
After electrophoresis and brief washing in ultra pure water, the gel
was washed for 2 h on a rotary shaker with Triton X-100 2.5% in
zymogram reaction buffer [50 mM Tris–HCl pH 7.8, 5 mM CaCl2] to
allow the proteins to refold. The gel was washed twice with reaction
buffer to remove Triton X-100 and then incubated overnight at room
temperature in zymogram reaction buffer. The gel was stained with
0.5% (w/v) Coomassie blue R250 for at least 2 h, then destained. The
digested bands were visualized as the non-stained regions of the
zymogram gel.
2.6. Determination of sequences
Selected protein spots were excised from 2D gels. MALDI-TOF MS
and MS/MS analyses were performed at the Institut National de la
Recherche Agronomique (INRA), Domaine de Vilvert, Jouy-en-Josas,
France and at INRA, Plate forme protéomique, Centre Clermont-
Ferrand/Theix, France. The resulting peptide masses were processed
against the NCBI nr database and significant matches with O. oeni
were considered preferentially.
Genome Express sequencing services were used for DNA sequen-
cing with universal primers. Each primer was used on the same PCR
product matrix.
2.7. Cloning and expression of eprA in E. coli BL21
A 552 bp fragment corresponding to the eprA coding sequence was
amplified from genomic DNA. The forward primer GACGACGACAA-
GATGGATACAACCTATACTGTAAAATC contains 12 nucleotides from the
cloning vector (underlined), followed by an initiation codon (bold),
and then by 23 nucleotides, which hybridise to the eprA gene
immediately after the end of the predicted signal peptide. The reverse
primer, GAGGAGAAGCCCGGTTTACCAACCACCGGTTGTTG, is comple-
mentary to the last 20 nucleotides of the eprA coding sequence,
including its termination codon (bold) and, later on, to the cloning
vector (underlined). PCR was performed using Taq DNA polymerase
from Qbiogene-MP Biomedicals (Illkirch, France) according to the
manufacturer's instructions with the following program: 94 °C, 2 min,
then 30 cycles of 94 °C, 30 s; 51 °C, 30 s and 72 °C, 1 min, ended by a
final elongation step of 2 min at 72 °C. The amplification product was
purified with the GenElute™ PCR purification kit (Sigma Aldrich, St
Quentin Fallavier, France) and checked before cloning by electrophor-
esis on 1% agarose in TAE buffer.
The pET-30 Ek/Lic cloning kit (Novagen, VWR International S.A.S,
Fontenay sous Bois, France) was used according to the manufacturer's
instructions. This cloning vector is dedicated to the expression of His-
tagged proteins, under the control of T7 promoter. The resulting
plasmid, pET-eprA, was prepared with GenElute™ Plasmid Miniprep
Kit (Sigma), and 10 ng were was used to transform the E. coli BL21
(DE3) strain. Plasmid sequence was checked with the universal
primers T7 promoter and T7 terminator.
A BL21(DE3)/pET-eprA clone was inoculated into LB plus kanamy-
cin (30 µg/ml) and grown overnight. A fresh medium was then
inoculated at an initial OD600 of 0.1. When the OD600 of the culture
28 P. Folio et al. / International Journal of Food Microbiology 127 (2008) 26–31
reached 0.8, the medium was divided into two sterile flasks and
0.1 mM IPTG were was added to one of them. Non-induced and
induced cells were maintained at 18 °C for 14 h and then collected by
centrifugation at 4500 ×g for 5 min for protein preparation.
2.8. Recombinant E. coli protein preparation
All steps were performed at 4 °C and samples were kept on ice. E.
coli cells were washed in phosphate buffer 100 mM, pH 7.0 and an
aliquot fraction of the pellet was frozen for SDS-PAGE analysis (total
protein sample). The remaining pellet was then broken up using glass
beads (Ø 50–100 µm) in the same buffer with a FastPrep instrument
(MP Biomedicals, Illkirch, France) by two steps of maximal agitation
lasting 30 s each, separated by a 5-minute cooling step on ice. A
centrifugation step at 9700 ×g lasting 3 min was used to extract the
intracellular protein as the supernatant.
EprA protein was purified from the protein extract using its N-
terminal His-TAG. Ni-NTA agarose (Qiagen, Courtaboeuf, France),
previously washed with sodium phosphate 50 mM pH 8.0 buffer, was
gently mixed with 500 µl of the protein extract for 5 min at room
temperature. 200 µl fractions were collected after successive cen-
trifugations for 3 min at 9700 ×g by increasing imidazole concentra-
tion from 10 mM (non-retained fraction) to 100 mM (totally eluted
fraction) in 100 mM sodium phosphate pH 7.0 buffer. From analysis by
SDS-PAGE, the protein was essentially recovered in the 40 mM
imidazole fraction.
2.9. Proteolytic activity measurement
A protein substrate, the Universal Protease Substrate (UPS) from
Roche Diagnostics (Meylan, France), which consists of resorufin-
labeled casein, was used. Resorufin-labeled peptides were released
from casein by treatment with protease. After protein precipitation
by trichloroacetic acid (TCA), free labeled peptides remained in the
Fig. 1. Zymography (A, B) and non-reducing SDS-PAGE (C, D) analyses of the time-course experiment with extracellular protein samples from ATCC BAA-1163 cultures. A and C
correspond to FT-A medium, and B and D to FT80. med: sterile FT80 medium.
supernatant and could be detected by fluorimetry with excitation and
emission wavelengths of 574 and 588 nm, respectively. Proteolytic
activity was measured according to the manufacturer's instructions
except for incubation, which was performed at 30, 37 or 45 °C for 4 or
6 h. The addition of protein extract to the reaction buffer [50 mM Tris–
HCl pH 7.2, 7.4 or 7.8 and 5 mM CaCl2] containing 0.1% of substrate
initiated the reaction. Alternatively, a 50 mM citrate-phosphate buffer
plus 5 mM CaCl2 was used for pH values of 4.5, 5.7, 6.8 and 7.4.
Peptide substrates were amino-acyl-para-nitroanilide (X(X)-
pNA) (Bachem Feinchemicalien AG, Bubendorf, Switzerland). Activ-
ity was measured with 2 mM lys-pNA, ala-pro-pNA or pro-pNA. In
this case, a citrate–phosphate 100 mM buffer was used. Color
development was monitored by spectrophotometry at 405 nm for
30 min. Kinetic constant values were determined from data
acquired at 37 °C and pH 7.0 according to NIH (National Institute
of Health, http://www.ncgc.nih.gov/guidance/section4.html) guide-
lines by non-linear regression analysis using a rectangular hyper-
bola model.
The following protease inhibitors were tested at 45 °C in citrate-
phosphate buffer pH 7.0: pefabloc 1 mM, pepstatin A 1 µM alone or
with bestatin hydrochloride 1 µM, E64 (N-(N-(l-3-Transcarboxirane-2-
carbonyl)-L-leucyl)-agmatine) 10 µM, EDTA 10 mM and 1,10-phenan-
throlin 10 mM.
3. Results
3.1. Detection of extracellular proteolytic activity by zymography
The ATCC BAA-1163 O. oeni strain was cultured on two media with
different nitrogen content and composition: either 100 mg/l nitrogen
from A yeast extract, or approximately 700 mg/l from a mixture of
yeast and meat extract. Growth was followed during both cultures,
and experiments were repeated at least three times. Bacteria grown in
both media exhibited similar specific growth rates, but the stationary
 P. Folio et al. / International Journal of Food Microbiology 127 (2008) 26–31 29

Fig. 2. 2-DE extracellular protein profiles obtained from ATCC BAA-1163 cultures. Profile A corresponds to non-inoculated control FT80 medium. Profiles B were obtained after 8 h,
16 h and 22 h of culture in FT80 medium. Profiles C were obtained after 2 h, 8 h and 16 h of culture in FT-A.

phase OD600 differed. Variation in OD600 between inoculation time Analysis of 2D protein profiles during a time-course experiment
and after 22 h of growth was 0.57 ± 0.07 and 1.85 ± 0.2 for the FT-A and showed similarities between the two media (Fig. 2B and C). Several
FT80 medium, respectively. The limited nitrogen content in FT-A me- spots with an apparent MW close to 60 kDa, and ranging between a pI
dium was shown to be responsible of growth yield reduction, com- of 5.0 and 8.0 appeared on both media and their intensity increased
pared to the rich-nitrogen FT80 medium (Remize et al., 2005). during the cultures.
A zymography experiment was conducted to identify extracellular Three main spots were differentially detected on FT-A and FT80
proteases. On casein substrate, a hydrolysis zone was obtained for a supernatants. They corresponded to (i) an 80 kDa, pI 5.0 protein
MW of 21–24 kDa with proteins collected from the FT-A supernatants clearly visible after 16 h on FT-A, (ii) a 35 kDa, pI 7.5 signal detected
after 8, 16 or 22 h of culture (Fig. 1A). The same hydrolysis band was
seen for FT80 supernatant proteins collected after 16 or 22 h of culture,
but not earlier (Fig. 1B). Similar results were obtained with a gelatine
substrate. However, the intensity was lower, and zymography revealed
no lysis with mannoproteins. The same protein signal was found after
protein electrophoresis under non-denaturing conditions (Fig. 1C
and D): it corresponded to a monomeric protein of ca. 21 kDa.

3.2. 2D analysis of extracellular protein produced

Extracellular proteins from the media and those produced by ATCC

BAA-1163 were subjected to two-dimensional electrophoresis. From
non-inoculated media analysis, it appeared that proteins with a MW
over 10 kDa were not detected from FT-A medium (data not shown).
This result was in accordance with previously published analysis of
the A yeast extract, which showed that proteins of N10 kDa accounted
for less than 5% of nitrogen of the extract (Remize et al., 2005). In
contrast, FT80 non-inoculated control medium gave a smear of protein Fig. 3. Time course of pNA release obtained from the three substrates pro-pNA (white
signals in the region of 55–66 kDa and pI 3.0–5.0 (Fig. 2A). Diffuse circle), ala-pro-pNA (black square) and lys-pNA (black triangle) during 240 min at 37 °C
signals were also present elsewhere on the gel. in citrate–phosphate 100 mM buffer pH 7.0.
30 P. Folio et al. / International Journal of Food Microbiology 127 (2008) 26–31
early, (iii) a strongly detected signal after 2 h on FT-A, which cor-
responded to a MW of 21.3 kDa and a pI of 5.3. By its size, this last
signal could match the protease activity detected by zymography. The
21.3 kDa signal was much stronger on FT-A than on FT80. This
correlates with the delay between the detection of protease activity in
the two culture conditions.
3.3. Identification of the major 21.3 kDa extracellular protein
N-terminal sequencing of the protein signal revealed at 21.3 kDa
resulted in the unambiguous identification of a single gene described at
AAUV01000060 locus OENOO_65067. The 555 bp gene encodes a protein
with a signal peptide ending at position 28, followed by a lysine repeat
motif from amino acid 31 to 75. This region, described as potentially
involved in peptidoglycan binding, is present in many enzymes, especially
cell-wall degradation enzymes. Other much less conserved domains were
identified and were related either to transglycosidases, such as lysozym,
or peptidases/proteases, but no clear protease signature was identified. In
silico estimation of MW and pI resulted in values of respectively 19 and
4.9, which are in the same range as the experimental values.
3.4. Characterization of purified EprA
The first assays for activity measurements were performed with
UPS at 45 °C during 4 h of incubation. Activity was detected at all pH
values and all temperatures tested but reproducibility of the
determination was unsatisfactory. Then, X-(X-) pNA substrates were
tested (Fig. 3). A hydrolytic activity was obtained with the three
substrates, but the level was 56 and 97 times higher with lys-pNA than
with ala-pro-pNA and pro-pNA respectively. Lys-pNA was then chosen
for further determinations. The obtained kinetic constant values were
a Km of 0.41 ± 0.07 mM, a Vmax of 6.9 ± 0.4 10-11 mM/min and a catalytic
constant kcat of 34.4±2.1 pmol/(min.µg). Activity measurements at
various temperatures indicated that the purified protease was active
between 20 and 50 °C, but maximal activity was observed at 45 °C
(Fig. 4). The pH effect was marked with an optimum at 7.0, but when
the pH was below 4.6, relative activity was below 20% of the maximum.
The EprA protease was then identified as a neutral protease, with
endoprotease and aminopeptidase activities. Lastly, protease inhi-
bitors were tested. E64, an inhibitor of only cystein proteases, and
pefabloc which inhibits serine proteases did not significantly reduce
activity (N90% residual). The addition of EDTA did affect activity (83%
residual). Activity was inhibited by 64% when 1,10-phenanthrolin,
another chelating agent was used. Pepstatin A, which inhibits aspartic
Fig. 4. Effect of pH and temperature on the specific activity of protease. The activity was
measured with lys-pNA as substrate in citrate phosphate 100mM buffer. Temperature
assays were performed at pH 7.0, while pH assays were done at 45 °C.
(acid) proteases, was tested alone and with bestatin, specific to
aminopeptidases and other exoproteases, and residual 100% and 77%
activity were respectively obtained. Consequently, EprA was assumed
to be a metalloprotease exhibiting both endo- and amino-protease
activities.
4. Discussion
A model for the proteolytic system of lactic acid bacteria was
proposed ten years ago essentially from Lactococcus lactis data (Kunji
et al., 1996). In particular, one cell-envelope associated serine protease
named PrtP was identified as a key element for casein assimilation (de
Vos et al., 1989; Juillard et al., 1995a,b). This cell-wall-anchored
proteinase is widely distributed among dairy lactic acid bacteria
(Gilbert et al., 1996; Fernandez-Espla et al., 2000). However, though
genomic data available from O. oeni (Klaenhammer et al., 2002; Mills
et al., 2005) enabled identification of genes encoding putative pepti-
dases and peptide transporters by similarity searches, searching the
databases to identify a prtP homologue was fruitless. This was not
really surprising because, O. oeni evolves in a natural environment
containing a variety of proteins and peptides that are diverse in size
and composition (Desportes et al., 2000; Martinez-Rodriguez and Polo,
2000; Alexandre et al., 2001; Martinez-Rodriguez et al., 2001;
Goncalves et al., 2002; Guilloux-Benatier and Chassagne, 2003). This
is extremely different from milk, which is characterized by a constant
casein composition. In addition, examination of the 1398 coding
sequences from the O. oeni genome revealed the presence of 191
deduced proteins with a signal peptide. As about half of these se-
quences could potentially encode a hydrolase, it was thought that it
would not be worthwhile to use a functional genomic approach to
identify O. oeni extracellular proteases.
Previous studies concerning the extracellular proteolytic equip-
ment of O. oeni highlighted several features: the proteolytic activity is
not due to a single protein (Rollán et al., 1995), and the activity, though
weak, was observed on several substrates: proteins and polypeptides
of white and red wines (Manca de Nadra et al., 1997, 1999), yeast
mannoproteins (Remize et al., 2005), and grape juice (Farias and
Manca de Nadra, 2000).
The EprA protease described in this study is a neutral protease of
low molecular weight. By its size and its catalytic optima, this enzyme
was identified as a novel extracellular protease of Oenococcus. Despite
the wide distribution of homologous proteins among bacteria, and
especially phylogenetically close bacteria such as lactic acid bacteria,
this protein was poorly characterized and no homology to character-
ized proteases was found. EprA hydrolyses several substrates, from
proteins like casein and gelatine, with an endopeptidase activity as
visualized on the zymogram, to peptides with an aminopeptidase
activity which preferentially hydrolyses the basic residue lysine. This
activity revealed the ability of EprA to release free amino acids and
short peptides which are necessary to the growth of the bacterium.
These characteristics are relevant to the diversity of wine proteins.
However, under the conditions we used to determine proteolytic
activity, mannoproteins were not hydrolysed (data not shown). We
suppose that the high degree of glycosylation of these proteins may
make them less accessible to the enzyme. Future experiments will
have to focus on the proteolytic activity of EprA toward wine proteins,
which are natural substrates, and under wine-making conditions,
especially at pH 3.0–3.5 and temperatures of 16–18 °C. However, the
low production of EprA by O. oeni combined to the low in vitro activity
which were already observed under laboratory conditions suggests
EprA activity to be hardly detectable in wine. Nevertheless such a
weak activity could provide enough peptides to O. oeni since the
quantitative needs of this bacteria are low and taking into account that
malolactic fermentation in wine lasts up to several weeks.
Stress conditions enhance O. oeni extracellular proteases produc-
tion (Rollan et al., 1998). In our study, a poor-nitrogen content and the
 P. Folio et al. / International Journal of Food Microbiology 127 (2008) 26–31
entrance of the cells into the stationary phase constitute stress
conditions and are related to an increased production of EprA. Such a
situation could occur in wine since nitrogen composition was chosen
to be close to that observed in certain wines, like Merlot or Shiraz
wines. As the catalytic constant of the enzyme is low, the increasing
level of EprA during culture might be essential to allow the hydrolysis
of a sufficient amount of wine proteins. In the same way, it will be
essential to evaluate the stability of the enzyme in wine with regard to
the duration of malolactic fermentation.
References
Alexandre, H., Costello, P.J., Remize, F., Guzzo, J., Guilloux-Benatier, M., 2004. Sacchar-
omyces cerevisiae–Oenococcus oeni interactions in wine: current knowledge and
perspectives. Int. J. Food Microbiol. 93, 141–154.
Alexandre, H., Heintz, D., Chassagne, D., Guilloux-Benatier, M., Charpentier, C., Feuillat,
M., 2001. Protease A activity and nitrogen fractions released during alcoholic
fermentation and autolysis in enological conditions. J. Ind. Microbiol., Biotechnol.
26, 235–240.
Aredes Fernandez, P.A., Saguir, F.M., Manca de Nadra, M.C., 2004. Effect of dipeptides on
the growth of Oenococcus oeni in synthetic medium deprived of amino acids. Curr.
Microbiol. 49, 361–365.
Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem.
72, 248–254.
Caridi, A., 2006. Enological functions of parietal yeast mannoproteins. Antonie Van
Leeuwenhoek 89, 417–422.
Cavin, J., Prevost, H.J.L., Schmitt, P., Divies, C., 1989. Medium for screening Leuconostoc oenos
strains defective in malolactic fermentation. Appl. Environ. Microbiol. 55, 751–753.
de Vos, W.M., Vos, P., de Haard, H., Boerrigter, I., 1989. Cloning and expression of the
Lactococcus lactis subsp. cremoris SK11 gene encoding an extracellular serine
proteinase. Gene 85, 169–176.
Desportes, C., Charpentier, M., Duteurtre, B., Maujean, A., Duchiron, F., 2000. Liquid
chromatographic fractionation of small peptides from wine. J. Chromatogr. A 893,
281–291.
Farias, M.E., Manca de Nadra, M.C., 2000. Purification and partial characterization of
Oenococcus oeni exoprotease. FEMS Microbiol. Lett. 185, 263–266.
Farias, M.E., Rollan, G.C., Manca de Nadra, M.C., 1996. Influence of nutritional factors on
the protease production by Leuconostoc oenos from wine. J. Appl. Bacteriol. 81,
398–402.
Fernandez-Espla, M.D., Garault, P., Monnet, V., Rul, F., 2000. Streptococcus thermophilus
cell wall-anchored proteinase: release, purification, and biochemical and genetic
characterization. Appl. Environ. Microbiol. 66, 4772–4778.
Feuillat, M., Charpentier, C., Maujean, A., 1998. Les composés azotés. In: Flanzy, C. (Ed.),
Oenologie: fondements scientifiques et techniques. Lavoisier, Paris, pp. 94–116.
Flamini, R., De Rosso, M., 2006. Mass spectrometry in the analysis of grape and wine
proteins. Expert Rev. proteomics 3, 321–331.
Fourcassie, P., Makaga-Kabinda-Massard, A., Belarbi, A., Maujean, A., 1992. Growth,
D-glucose utilization and malolactic fermentation by Leuconostoc oenos strains in
18 media deficient in one amino acid. J. Appl. Bacteriol. 73, 489–496.
Garvie, E., 1967. The growth factor and amino acid requirements of species of the genus
Leuconostoc, including Leuconostoc paramesenteroides (sp.nov.) and Leuconostoc
oenos. J. Gen. Microbiol. 48, 439–447.
Gilbert, C., Atlan, D., Blanc, B., Portailer, R., Germond, J.E., Lapierre, L., Mollet, B., 1996. A
new cell surface proteinase: sequencing and analysis of the prtB gene from Lacto-
bacillus delbruekii subsp. bulgaricus. J. Bacteriol. 178, 3059–3065.
Goncalves, F., Heyraud, A., de Pinho, M.N., Rinaudo, M., 2002. Characterization of white
wine mannoproteins. J. Agric. Food Chem. 50, 6097–6101.
Grimaldi, A., McLean, H., Jiranek, V., 2000. Identification and partial characterization of
glycosidic activities of commercial strains of the lactic acid bacterium, Oenococcus
oeni. Am. J. Enol. Vitic. 51, 362–369.
31
Guilloux-Benatier, M., Chassagne, D., 2003. Comparison of components released by
fermented or active dried yeasts after aging on lees in a model wine. J. Agric. Food
Chem. 51, 746–751.
Guilloux-Benatier, M., Son, H., Bouhier, S., Feuillat, M., 1993. Activités enzymatiques:
glycosidases et peptidase chez Leuconostoc oenos au cours de la croissance
bactérienne. Influence des macromolécules de levures. Vitis 32, 51–57.
Guilloux-Benatier, M., Pageault, O., Man, A., Feuillat, M., 2000. Lysis of yeast cells by
Oenococcus oeni enzymes. J. Ind. Microbiol. Biotechnol. 25, 193–197.
Juillard, V., Laan, H., Kunji, E.R., Jeronimus-Stratingh, C.M., Bruins, A.P., Konings, W.N.,1995a.
The extracellular PI-type proteinase of Lactococcus lactis hydrolyzes beta-casein into
more than one hundred different oligopeptides. J. Bacteriol. 177, 3472–3478.
Juillard, V., Le Bars, D., Kunji, E.R., Konings, W.N., Gripon, J.C., Richard, J., 1995b.
Oligopeptides are the main source of nitrogen for Lactococcus lactis during growth
in milk. Appl. Environ. Microbiol. 61, 3024–3030.
Klaenhammer, T., Altermann, E., Arigoni, F., et al., 2002. Discovering lactic acid bacteria
by genomics. Antonie Van Leeuwenhoek 82, 29–58.
Kunji, E.R., Mierau, I., Hagting, A., Poolman, B., Konings, W.N., 1996. The proteolytic
systems of lactic acid bacteria. Antonie Van Leeuwenhoek 70, 187–221.
Leber, T.M., Balkwill, F.R., 1997. Zymography: a single-step staining method for
quantitation of proteolytic activity on substrate gels. Anal. Biochem. 249, 24–28.
Manca de Nadra, M.C., Farias, M.E., Pueyo, E., Polo, M.C., 2005. Protease activity of
Oenococcus oeni viable cells on red wine nitrogenous macromolecular fraction in
presence of SO2 and ethanol. Food Control 16, 851–854.
Manca de Nadra, M.C., Farias, M.E., Moreno-Arribas, M.V., Pueyo, E., Polo, M.C., 1997.
Proteolytic activity of Leuconostoc oenos. Effect on proteins and polypeptides from
white wine. FEMS Microbiol. Lett. 150, 135–139.
Manca de Nadra, M.C., Farias, M.E., Moreno-Arribas, V., Pueyo, E., Polo, M.C., 1999. A
proteolytic effect of Oenococcus oeni on the nitrogenous macromolecular fraction of
red wine. FEMS Microbiol. Lett. 174, 41–47.
Martinez-Rodriguez, A.J., Polo, M.C., 2000. Characterization of the nitrogen compounds
released during yeast autolysis in a model wine system. J. Agric. Food Chem. 48,
1081–1085.
Martinez-Rodriguez, A.J., Carrascosa, A.V., Polo, M.C., 2001. Release of nitrogen
compounds to the extracellular medium by three strains of Saccharomyces cerevisiae
during induced autolysis in a model wine system. Int. J. Food Microbiol. 68, 155–160.
Mills, D.A., Rawsthorne, H., Parker, C., Tamir, D., Makarova, K., 2005. Genomic analysis of
Oenococcus oeni PSU-1 and its relevance to winemaking. FEMS Microbiol. Rev. 29,
465–475.
Moreno-Arribas, M.V., Pueyo, E., Polo, M.C., 2002. Analytical methods for the
characterization of proteins and peptides in wines. Anal. Chim. Acta 458, 63–75.
Neuhoff, V., Arold, N., Taube, D., Ehrhardt, W., 1988. Improved staining of proteins in
polyacrylamide gels including isoelectric focusing gels with clear background at
nanogram sensitivity using Coomassie Brilliant Blue G-250 and R-250. Electro-
phoresis 9, 255–262.
O'Farrell, P.H., 1975. High resolution two-dimensional electrophoresis of proteins. J. Biol.
Chem. 250, 4007–4021.
Remize, F., Augagneur, Y., Guilloux-Benatier, M., Guzzo, J., 2005. Effect of nitrogen
limitation and nature of the feed upon Oenococcus oeni metabolism and
extracellular protein production. J. Appl. Microbiol. 98, 652–661.
Remize, F., Gaudin, A., Kong, Y., Guzzo, J., Alexandre, H., Krieger, S., Guilloux-Benatier, M.,
2006. Oenococcus oeni preference for peptides: qualitative and quantitative analysis
of nitrogen assimilation. Arch. Microbiol. 185, 459–469.
Ritt, J.-F., Remize, F., Alexandre, H., 2007. Le systeme peptidasique de O. oeni, une clé
dans l'adaptation au milieu vin. In qOeno 2007, 8ème Symposium International
d'Œnologieq. Faculté d'Oenologie, Bordeaux, Bordeaux, Fance.
Ritt, J.-F., Guilloux-Benatier, M., Guzzo, J., Alexandre, H., Remize, F., 2008. Oligopep-
tide assimilation and transport by Oenococcus oeni. J. Appl. Microbiol. 104, 573–580.
Rollan, G., Farias, M.E., Strasser de Saad, A.M., Manca de Nadra, M.C., 1998. Exoprotease
activity of Leuconostoc oenos in stress conditions. J. Appl. Microbiol. 85, 219–223.
Rollan, G.C., Farias, M.E., Manca de Nadra, M.C., 1993. Protease production by Leuconostos
oenos strains isolated from wine. World J. Microbiol. Biotechnol. 9, 587–589.
Rollán, G.C., Farías, M.E., Manca de Nadra, M.C., 1995. Characterization of two
extracellular proteases from Leuconostoc oenos. World J. of Microbiol. Biotechnol.
11, 153–155.