Grade 11-12 IB DP: Laboratory Manual For HL Biology

2021-2022 Edition
Grade 11-12 IB DP
Laboratory Manual for HL Biology
Student name:
Table of Contents
Topic 1: Cell Biology
Size of Cells Using a Stage Micrometer PRESCRIBED PRACTICAL 1
Membrane Permeability of Plant Leaf Tissue 3
Solute concentration of Potato Tissue PRESCRIBED PRACTICAL 5
Coacervate Formation, Characteristics, and pH 8
Topic 2: Molecular Biology

Strength of Hydrogen Bonds 10
Properties of Proteins, Lipids, and Carbohydrates 12
Ethanoic Acid and Amylase Starch Metabolism PRESCRIBED PRACTICAL 15
Rate of Cellular Respiration in Mung Beans 17
Thin Layer Chromatography of Vegetable Pigments PRESCRIBED PRACTICAL 22
Photosynthesis and Respiration in Plants 25
Topic 3: Genetics
Identifying Gametes with Oil Immersion Microscopy 27
Human Traits 29
Constructing and Analyzing a Karyogram 32
DNA Profiling SIMULATION 33
Genes and Disease DATABASE 36
The E. coli Insulin Factory SIMULATION 43
Topic 4: Ecology
Yeast Population and Bicarbonate Concentration: IA Introduction 46
Sustainability in a Winogradsky Mesocosm PRESCRIBED PRACTICAL 50
Pitfall Traps DATABASE 53
Topic 5: Evolution and Biodiversity

Hominid Skulls 55
Comparing Amino Acid Sequences of Cytochrome C 58
DNA Sequence Analysis of the Great Apes 62
DNA Sequence Alignment and Phylogenetic Reconstruction DATABASE 64
Natural Selection in Rabbits SIMULATION 66
Topic 6: Human Physiology

Absorption of Carbohydrates 67
Heart Dissection 69
Physiology of the Circulatory System 72
Breathing and Mild Exercise PRESCRIBED PRACTICAL 78
Hormonal Control of the Female Reproductive System DATABASE 81
Internal Assessment
Rubric 87
Format and Guide 89
Additional Higher Level
Topic 7: Nucleic Acids
Extracting DNA 92
DNA Barcoding DATABASE 94
Topic 8: Metabolism, Cell Respiration, and Photosynthesis

Evaluating Metabolism and Health DATABASE 98
Inhibition of Catechol Oxidase in Bananas by Heavy Metals 100
Topic 9: Plant Biology

Germination Rate and Salinity 103
Transpiration of a Plant Using a Potometer PRESCRIBED PRACTICAL 105
Topic 10: Genetics and Evolution

Gene Linkage in Sordaria 108
Hardy-Weinberg Equilibrium MATHMATICAL MODEL 110
Topic 11: Animal Physiology

Kidney Dissection 119
Chicken Arm Dissection 120
Correlates of Immunization Rate DATABASE 124
Size of Cells Using a Stage Micrometer
A stage micrometer has lines on it which are exactly 0.01 mm (10 m) apart. It is used to determine
the absolute size of microscopic objects.
Methods
1. Place a micrometer on the stage of your microscope. View the lines under both low power
and high power to determine the diameters of the low power and high power fields in
micrometers.
Micrometer
Field of View
Draw the micrometer on –

Low Power (100x) High Power (400x)
2. Convert your measurements to the following units.

Metric conversions
1 meter (m) = 100 centimeters (cm) = 1000 millimeters (mm) = 1,000,000 micrometers (m)
a. Diameter of the low power field in millimeters (mm): _________________
b. Diameter of the low power field in micrometers (m): _________________
c. Diameter of the high power field in micrometers (m): _________________
3. In the above circles, make an appropriately sized scale bar based upon your results.
1
Drawing Cells
1. All drawings should be done in pencil.
2. Lines should be thin, sharp, and clean. Do not shade or color.
3. Do not draw dirt, cracks in glass, or optical distortions.
4. Always title drawing and indicate total magnification that was used.
5. Draw cells from the available slides. Add a scale bar to each drawing and calculate size.
2
Membrane Permeability in Plant Leaf Tissue
Leaf cells contain pigments. If these pigments leave the cell, they must pass through the cell
membrane. In this laboratory investigation, we will investigate the effects of temperature,
hydrochloric acid, sodium hydroxide, and ethanol on the permeability of leaf cell membranes.
Substances that increase the permeability of leaf cell membranes will produce more pigment in their
solution, coloring the solutions. The degree of coloring will be quantified using a colorimeter.
Materials
• 95% ethanol
• 0.1M hydrochloric acid
• 0.1M sodium hydroxide
• distilled water
• test tubes
• test tube rack
• timer
• 250 cm3 beaker
• dropping pipettes
• thermometer
• hot plate
• colorimeter
• tea leaves
Methods
1. Label test tubes 1 - 7
2. Into test tube 1 put 10 cm3 distilled water and 0.50 g of tea leaves
3. Set the test tube aside and record its temperature
4. Place 0.50 g of tea leaves into each of test tubes 2 - 4
5. To test tube 2 add 10 cm3 ethanol
6. To test tube 3 add 10 cm3 hydrochloric acid
7. To test tube 4 add 10 cm3 sodium hydroxide
8. Leave test tubes 1 - 4 for 10 minutes
9. Place 0.50 g of tea leaves into each of test tubes 5 - 7 with 10 cm3 distilled water.
10. Place them in the 250 cm3 beaker of tap water (half fuIl)
11. Place the thermometer in the beaker and heat on high
12. When the water is at 40 °C, remove test tube 5. Leave it for 20 minutes.
13. Continue to heat the water to 65°C. Remove test tube 6. Leave it for 20 minutes.
14. Continue to heat to 90°C. Remove test tube 7. Leave it for 20 minutes.
15. After having left each test tube for 20 minutes, record the appearance of each liquid in the
test tubes I - 7 and then measure its light transmission with the colorimeter.
16. Create a data table record your results.
Results
Qualitative observations
________________________________________________________________________________
________________________________________________________________________________
________________________________________________________________________________
________________________________________________________________________________
________________________________________________________________________________
3
Quantitative data
Conclusion
Describe how the independent variables in this experiment affected the permeability of plant tissue.
________________________________________________________________________________
________________________________________________________________________________
________________________________________________________________________________
________________________________________________________________________________
________________________________________________________________________________
4
Solute Concentration of Potato (Solanum tuberosum) Tissue
Osmosis is the movement of water across a membrane from an area of lower solute concentration to
an area of higher solute concentration. Cells tend to lose water (their solvent) in hypertonic
solutions and gain water in hypotonic solution. When solute concentrations are the same on both
sides of the cell, there is no net water movement, and the cell is said to be in an isotonic solution. In
this lab we will test samples of potato tissue to see how much water they absorb or release in
solutions of varying concentrations to determine the solute concentration of potato tissue.
Materials
• balance
• table salt
• potatoes
• corkborer
• timer
Technique review
Scientists commonly express concentration of a solution in percent concentration. To make
an X percent solution, a scientist would add X grams of solid to make up 100.0 cm3 of
solution.
Example: 10.00 g of NaCl 50.0 cm3 of solution = 20.0% NaCl solution.
Methods
1. Working in groups, prepare 50.0 cm3 of each of the following solutions
a. 0.00, 0.50, 1.00, 1.50, and 2.00% NaCl
2. Make five potato cores of the same length and diameter. Blot them dry on a paper towel.
3. Find the mass each to the nearest 0.01 grams and record as initial mass.
4. Add a potato slice to each of the 7 solutions and start the stop clock.
5. Leave the potato slices in each of the salt solutions for an equal time interval, but it should be
at least 15 minutes.
6. Remove the slices, blot them dry on a paper towel, and find final mass. Record in the data
table.
Results
Qualitative observations
________________________________________________________________________________
________________________________________________________________________________
________________________________________________________________________________
________________________________________________________________________________
________________________________________________________________________________
5
Quantitative data
Mass
Solution % NaCl Initial Mass/g Final Mass/g
Change/%
1- Graph the data with Excel

to show % change in
mass of the potato slices
in the different solutions.
Your graph should be like
the graph on the right.
Print and glue your graph
on this page.
Analysis
The point where the line crosses the x-axis is the solute concentration of the potato cells. Determine
this value, including units, to the correct number of significant figures.
Potato cell solute concentration = _________________________

6
Evaluation
How confident are you in your data?
________________________________________________________________________________
________________________________________________________________________________
What methods or equipment used were reliable? Explain.
________________________________________________________________________________
________________________________________________________________________________
What sources of error were present in this experiment?
________________________________________________________________________________
________________________________________________________________________________
________________________________________________________________________________
How important were these errors?
________________________________________________________________________________
________________________________________________________________________________
How could this experiment be improved?
________________________________________________________________________________
________________________________________________________________________________
Going further
Saltwater fish are hypotonic to their surroundings while freshwater fish are hypertonic to their
surroundings. What must each fish do to compensate for the difference in salinity between the body
and the surrounding environment?
________________________________________________________________________________
________________________________________________________________________________
________________________________________________________________________________
________________________________________________________________________________
________________________________________________________________________________
________________________________________________________________________________
________________________________________________________________________________
________________________________________________________________________________
________________________________________________________________________________
________________________________________________________________________________
7
Coacervate Formation, Characteristics, and pH
Evolution of life and the origin of life are not the same process. Life began billions of years ago, left
little evidence of the process, and has not taken place since. In contrast, evolution has left fossil
evidence of past changes, can be observed occurring today, and will continue into the future.
Under certain conditions, proteins, carbohydrates and other materials in a solution can come
together to form irregular volumes bounded by a membrane-like interface to the surrounding
medium. These organized clusters of droplets are called coacervates, and they have some of the
properties of living cells. These structures represent one of the early stages in the origin of life. In
this activity, you can produce coacervates, study the conditions under which they form, and observe
some of their life-like properties.
Materials
• compound microscope
• slides
• cover slips
• test tube rack and tubes
• droppers
• 0.1 M HCl solution
• pH paper
• stains
• 50- cm3 beaker with pre-coacervate mixture (5 parts of % gelatin + 3 parts % gum Arabic)
Methods
1. Prepare the pre-coacervate mixture.
a. Half fill a test tube with the pre-coacervate mixture. Note that the mix is relatively clear;
there should be no coacervates.
2. Using short thin straw, transfer a tiny drop to pH paper, record this initial pH in a table.
3. Carefully add drops of acid (0.1 M HCl) from a dropping bottle. Cover the mouth of the test tube
with a stopper and turn it upside down so the acid mixes gently with the "Mix". If it doesn't get
cloudy, continue adding acid. Cloudiness indicates presence of coacervates.
4. When cloudy transfer one drop to pH paper and one drop to a clean microscope slide. Read and
record pH in a table.
5. Place a cover slip on the drop and observe under the microscope. Look for coacervates.
6. When you find good coacervates, draw them.
7. Stain the coacervates with methylene blue. 8
8. Add another drop of acid to mix in test tube, turn it upside down to mix it in, and repeat until the
cloudiness disappears. When this happens, check and record the pH. Observe and record if
coacervates are present.
Results
Drawings
Unstained Coacervates Stained Coacervates
Create a data table below in which you record: 1) the drops of HCl added, 2) the pH of the mixture,
3) the appearance of the mixture, and 4) if coacervates are present.
Analysis
1. What is the optimal pH for coacervate formation?
________________________________________________________________________________
________________________________________________________________________________
2. What characteristics of life do coacervates exhibit?
________________________________________________________________________________
________________________________________________________________________________
9
Strength of Hydrogen Bonds
How does dish and hand soap affect the strength of the hydrogen bonds between water and
glass? To determine this, we will perform an experiment using microscope slides, water,
soap, and the Vernier® Dual Range Force Sensor system.
Methods
1. Work under the foam mats, to avoid breaking too many slides.
a. Some breakage may happen and is no big deal, but you must put broken glass
goes in broken glass bucket!
2. Wet a microscope slide with tap water and place another slide on top of this. They
should stick together.
3. Position the slides so that exactly 50 mm of the length of the slides are in contact.
b. Use a ruler and market to measure and indicate this point.
4. Set up the Vernier® Dual Range Force Sensor system.
5. Record the maximum force that can be exerted the lower slide until it gives way. Repeat
for five trials.
6. Add liquid dish soap to the slide and repeat experiment.
7. Add hand soap to the slide and repeat experiment. Record data below. Calculate average
and standard deviation.
Results
Liquid Bond strength/ N 12.5 cm-2 Average SD
Water
Dish soap
Hand soap
Data processing
Determine the % difference between each soap treatment and water. Show your calculations.
Dish soap- Hand soap-
Graph the data below. Graph the average as the point or top of the bar and the range as
the error bars from the average.
10
Analysis
1. Identify the independent variable in this experiment.
______________________________________________________________________________
2. Identify the dependent variable in this experiment.
______________________________________________________________________________
3. Identify the controls in this experiment.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
4. Describe the effect of the soaps on hydrogen bond strength between water and glass.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
5. Explain these results in terms of intermolecular forces.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
11
Properties of Proteins, Lipids, and Carbohydrates
Proteins, lipids, and carbohydrates are three categories of biologically important molecules. In this
lab activity, we will perform a series of tests that will allow us to observe some of the physical and
chemical characteristics of these molecules.
Methods
Safety and environmental care
• Some of these chemicals are poisonous if ingested. Never taste any of the chemicals.
Wash your hands before eating lunch.
• Some of these chemicals are caustic and will irritate or burn your skin and eyes. Wash
your hands immediately if you contact the chemicals. Wear eye protection at all times.
• Work deliberately and carefully at all times.
Carbohydrates Station
These experiments will test three different carbohydrates. 1) Starch, 2) Glucose, and 3) Sucrose.
A fourth test tube of water will be used to serve as a control.
Experiment 1- Iodine test for polysaccharides
1. Add a small scoop of each carbohydrate to a different test tube. Add about 10 cm3 of
water to make a solution.
2. Add 1/3rd of your solution to a different test tube. Save the other 2/3rd of the solution.
3. Add 2 to 3 drops of Iodine solution to each carbohydrate.
4. A dark blue or purple color is a positive result for polysaccharides.
5. Record results in a data table.
6. Dispose of test tube contents in sink.
Experiment 2- Benedict’s test for reducing carbohydrates

1. Place half of your remaining solution in a different test tube and add 10 drops of
Benedict’s reagent.
2. Place the test tubes in a boiling water bath for 3-5 minutes.
3. Remove and observe color. A red, yellow, or green precipitate indicates the presence of
reducing sugars. Record results.
Lipids Station
These experiments will examine the properties of 1) Glycerol, 2) Olive oil, and 3) Vegetable oil.
Experiment 1- Solubility
1. Obtain seven test tubes and add to each 5 drops of lipid and 10 drops of solvent.
Record the relative solubility in the table below.
Lipid Solvent Relative solubility

1. Glycerol Water ______________
2. Glycerol Paraffin ______________
3. Olive oil Water ______________
4. Olive oil Paraffin ______________
5. Vegetable oil Water ______________
6. Vegetable oil Methanol ______________
7. Vegetable oil Paraffin ______________
12
Experiment 2- Emulsification of Olive Oil
1. Obtain four test tubes and add 5 cm3 of olive oil to:
1. 25 cm3 of water
2. 23 cm3 of water with 2 cm3 of liquid soap solution
3. 25 cm3 of water and a small scoop of sodium chloride
4. 23 cm3 of water and 2 cm3 of detergent solution
2. Add a stopper and shake vigorously for 30 seconds and note the results after standing.
3. Add 15 drops of paraffin to each tube and shake. Record your results.
Experiment 3- Iodine absorption test for saturated fatty acids

1. Obtain three test tubes and add 5 drops of each lipid.
2. Add 15 drops of paraffin then 3 or 4 drops of Iodine.
3. Unsaturated fats will decolorize the iodine. Saturated fats will not.
4. Record results
Experiment 4- Sudan III test

1. Place 10 drops of each lipid in a separate test tube.
2. Add 3 drops of the Sudan III solution and shake each test tube.
3. After settling, record the appearance and location of the stain.
Proteins Station
These experiments will examine the properties of 1) Albumin powder, 2) Egg whites, and 2)
Gelatin.
Experiment 1- Denaturing by heat

1. Make solutions of both powders by adding a small scoop of the protein powder to 50 cm3 of
water. Stir. Add some water to the egg white until it is runny and not thick.
2. Add about 10 cm3 of protein solution to separate test tubes.
3. Place the solutions in a boiled water bath and record the time at which the solution appears
to coagulate.
Experiment 2- Effect of Acetone

1. Add about 10 cm3 of protein solution to new, separate test tubes.
2. Using a pipette, slowly add acetone to these solutions, drop by drop, mixing constantly.
3. Record the number of drops required to cause precipitation.
Experiment 3- Biuret Test

1. Add 5 drops of Biuret reagent to about 10 cm3 of each protein solution in new, separate test
tubes.
2. Biuret reagent is normally blue. When Biuret reagent is in the presence of protein, a pink or
purple color results. Pink indicates small protein chains while purple indicates large protein
strands.
3. Record results.
13
Results
14
Ethanoic Acid and Amylase Starch Metabolism
Under your tongue are the salivary glands. These glands produce saliva. In saliva there is an
enzyme called amylase. Amylase breaks down starch into sugar. Your pancreas also releases
amylase into your small intestine. In this lab, we aim to determine the rate that amylase will break
down starch and to determine the effect of the addition of vinegar (ethanoic acid) on that rate.
Methods
Wear safety goggles at all time
The chemicals can be disposed of down the drain as they are not harmful to the environment.
In this lab, you are to use the knowledge gained from the previous labs and your own intuition to
create the specific methods that will be used. The diagram below and this YouTube link,
https://www.youtube.com/watch?v=zsOs3v8Z-P4 , should be enough of a hint to allow you to
complete the lab.
Starch Solution Amylase
Results
15
Data processing example- Suppose the mixture took 2.0 minutes until the starch was all broken
down by the enzyme, so that the iodine stopped changing color. You can calculate the rate of the
reaction by dividing the volume of the starch by the time: Time for 5.0 cm3 to be used up = 2.0
min
Rate = 5.0 cm3 ÷ 2.0 min = 2.5 cm3 min-1
16
Rate of Cellular Respiration in Mung Beans (Vigna radiata)
In this lab, we will measure the rate of respiration and examine how an independent variable
effects this rate. In theory, we could measure:
- the consumption of oxygen gas
- the production of carbon dioxide gas
- the temperature rise (since this reaction is exothermic)
For this investigation, we will measure the volume of oxygen consumed.
The organism
Due to the IB’s animal experimentation policy, we will be using plants
for this study. Germinating seeds do not photosynthesize; they respire
stored organic compounds, just like you and I, making them ideal for
this purpose.
The respirometer
The carbon dioxide produced by the respiring seeds will be removed by KOH (potassium
hydroxide) on a cotton ball and turned into solid potassium carbonate. As the seeds respire and
remove oxygen from the inside of the vial, the air pressure inside the respirometer will fall. This
pulls water down the little calibrated pipette toward the vial where the seeds are. We will read the
water level in the pipette at different time intervals, as the seeds inside consume oxygen, allowing a
calculation of respiration rate.
This is explained by the general gas law-
P = pressure of a gas
V = volume of gas
PV = nRT n = moles of gas
R = the gas constant
T = temperature in K
This law implies that if temperature and volume are

held constant, pressure of a gas is directly proportional to the number of moles of the gas. The air
pressure in the respirometer falls because oxygen molecules are being consumed.
Of course, conditions may change during the course of the experiment, depending on the weather,
so we set up control respirometers containing glass beads instead of seeds.
Pre-lab Questions:
1. Why is it necessary to correct the readings of the respirometers containing seeds with the
readings taken from respirometers containing only glass beads? (Reference the general gas law)
2. What happens to the volume of the gas being measured (O 2 consumption or CO2 production)
when the temperature or pressure increases during the experiment?
3. If pressure and temperature remain constant, what will the volume of gas in the respirometer?
Methods
In Part 1 of the lab, you will be comparing the respiration of germinating seeds (which have been
soaked in water) vs. dormant (non-germinating) seeds (dry – out of the package). You will be
calculating respiration rate in cm3 oxygen consumed per min.
In Part 2 of the lab, you will have the opportunity to design and conduct your own experiment.
17
You must wear safety goggles/glasses and aprons during the investigations because KOH is
caustic. Follow your teacher’s instructions when using the hot glue gun to seal microrespirometers
(if you are asked to make them). Do not work in the laboratory without your teacher’s supervision.
Dispose of waste in the designated waste container.
Materials
• water bath
• Masking tape
• 3 respirometers
• dye
• thermometer
• 3 weights
• ice
• timer
• parafilm or Vaseline
For respirometer assembly:

• absorbent cotton
• 15% KOH
• dropper
• nonabsorbent cotton
• glass vial
• stopper with pipette
• 1000 cm3 beaker
Part I
Procedure for respirometer assembly:
Respirometers 1,2,3 is one set – they will be placed at 25 ºC.
GOAL: Compare respiration in 20 germinating peas with 20 non-germinating dry peas and 20
glass beads. A problem is that their volumes will be different. The first part of the procedure is
designed to correct and compensate for this problem.
VOLUME EQUALIZATION BETWEEN EXPERIMENTAL AND CONTROL SETUPS:
1. Estimating the density of non-germinating (dry) peas: Weigh 100 non-germinating peas (class
set) using an electronic scale.
Weight of 100 non-germinating peas = g
2. Take a 100 cm3 glass measuring cylinder. Add 50 cm3 water to it. Place the 100 non-
germinating peas in the cylinder.
Record the volume in the cylinder after adding peas = cm3.
Calculate the volume of the peas = ________________ cm3 (Final vol of cylinder – initial vol)
Calculate the density of the peas = _____________ g cm-3 (mass ÷ volume of peas)
18
3. Take 20 germinating peas and place them on a paper towel. Fill a smaller graduated cylinder
to the 20.0 cm3 mark with tap water ACCURATELY. Add the germinating peas to the tube and
record the volume below:
Volume of germinating peas = (_____cm3 – 20.0 cm3) =_____ cm3
Place the germinating seeds on a paper towel and label them.
4. Re-fill the graduated cylinder to the 20.0 cm3 mark. Add glass beads (a control) to the tube until
the volume in this tube is equal to the volume in the germinating pea tube in step 3:
Number of glass beads needed = _____
Place the glass beads separately on a paper towel and label them.
5. Use the calculated density of the non-germinating seeds (step 2) and figure out the needed
mass of (dry peas and glass beads) that you need to amount to the same volume as
germinating peas.
Known density = (from step 2)
Desired volume = (as calculated in step 3)
Therefore, the mass of the dry peas needs to be = g (volume x density).
6. Count out 20 of your wet, non-germinating pea seeds and place them on a weighing boat and
record weight. Add glass beads until you record the total mass as in step 5 above (this way the
volume in the dry peas vial and germinating peas vial will be the same).
a. Tips:
i. Look back at your calculated mass in step 1 for 100 peas.
ii. Estimate what the approximate mass would be for 20 peas based on this
number.
iii. You can search for dry peas that will give you your desired weight, but you can
still only use 20 peas.
20 dry non-germinating peas weight =
Did you have to add any glass beads? How many? _____________
SETTING UP RESPIROMETERS
7. To assemble respirometers, obtain 3 glass vials for EACH run at a particular temperature, each
with an attached stopper and pipette. Number the vials 1 through 3. Place a small wad of
absorbent cotton (read label) in the bottom of each vial and, using a dropper, saturate the cotton
with 15% KOH (potassium hydroxide; corrosive – wear goggles and wash your hands if you
contact the solution). This means the cotton ball needs to just appear wet. It is important that the
same amount of KOH and cotton be used for each respirometer. DO NOT GET KOH on the sides
of the glass vial – your respirometer.
8. Place a small wad of dry, nonabsorbent cotton on top of the saturated cotton.
19
9. Place the contents on the paper towels labeled from 1 – 3 in the correct Respirometers over the
cotton. Check Table 1 if you have questions about what to place in them. Insert the stopper with
the calibrated pipette. Seal the set-up with parafilm or Vaseline – very, very important to get a
good seal. Place a weighted collar on each end of the vial. Several washers around the pipette
make good weights.
10. Prepare the room-temperature bath (approx. 25 ºC)
11. Make a sling of masking tape attached to each side of

the water baths. This will hold the ends of the pipettes out of
the water during an equilibration period of 7 minutes. Place
the respirometers on the sling and time this equilibrium
period.
12. Add a small drop of colored dye to the end tip of the respirometer. This will help you to see the
oxygen as it moves up the respirometer. Place respirometer glass vials 1,2,3 in room temp. bath
very, very gently. A little water should enter the pipettes and then stop. If the water continues to
enter the pipette, check for leaks in the respirometer. Look for a small bubble that should be on the
top end of your pipette. Finding the bubble is the most crucial part of this setup! You have 3 min.
to find the bubbles.
RECORDING DATA AND MAINTAINING TEMPERATURE
13. After you have allowed the respirometers to equilibrate for these 3 minutes, record the initial
position of the water in each pipette to the nearest 0.01 cm3 (time 0). Check the temperature in the
bath and record. Record the water level in the pipettes every 2 minutes for 14 minutes. Student
monitoring temperature should keep the water baths at the desired temp throughout the 14 min. of
recording ‘bubble position’. Bubble position indicates volume of oxygen consumed by peas.
Results
Table 1: Measurements of O2 Consumption
Temp/ Time/ Glass Beads Dry Peas (and glass
oC Germinating Peas
min Alone beads)
Room Readin Diff* Readin Diff* Correc Readin Diff* Correc

g at g at ted g at ted
time X time X Diff. ^ time X Diff ^
Initial 0
0-2
2- 4
4 -6
6-8
8-10
10-12
12-14
* Difference = (initial reading at time 0) - (reading at time X)

^ Corrected Difference = (pea reading at time X) - (Beads reading at time X)
20
Table 2: Rate of Oxygen Consumption per minute
Condition Show Calculations Here Rate/ cm3 O2 min-1
Germinating peas (Room

Temp.)
Dry Peas (Room Temp.)
Part II
Designing and Conducting Your Own Investigation:

Think about the process of cellular respiration.
• When does it occur? Are there any situations when living cells are not respiring?
• Why might some living cells respire more than others?
• Are there differences between major groups of organisms and how they respire?
• Does the temperature of germinating seeds affect the rate of cellular respiration?
• Do germinating seeds just starting to germinate consume oxygen at a greater rate than
seeds that have been germinating for several days (age dependence)?
Design an experiment to investigate one of your own questions about cellular respiration or of the
questions above.
When identifying your design, be sure to address the following:

• What is the research question being addressed?
• What assumptions are made about the questions being addressed? Can those
assumptions be verified?
• Will the measurements you choose to make provide the necessary data to answer the
question under study?
• What are possible sources of error in the experiment?
3. Make a prediction about the effect of the factor you chose to investigate on the rate of cellular
respiration.
4. Conduct your experiment and record data and any answers to your questions.
5. Graph the results to show the effect of the factors you investigated on the rate of cellular
respiration.
6. Calculate the rate of cellular respiration.
7. Perform statistical analysis of your data, comparing results of the experimental variable to the
control. You should at least express the uncertainty of your results with error bars.
21
Thin Layer Chromatography of Vegetable Pigments
Thin layer chromatography (TLC) is a type of chromatography, in which the stationary phase is a
thin layer of adsorbent particles attached to a solid plate. A small amount of sample is applied
(spotted) near the bottom of the plate, and the plate is placed in the solvent, which is the mobile
phase. This solvent is drawn up by capillary action. Separation occurs as each component, being
different in chemical and physical properties, interacts with the stationary and mobile phases to a
different degree, creating the individual bands on the plate. The R f value is used to characterize
and compare components of various samples.
Rf value = distance from origin to component spot
distance from origin to solvent front
The pigments in vegetables, flowers, and leaves can be separated and identified by using thin-
layer chromatography. Green pigments, known as chlorophylls, serve as the main photoreceptor
molecules of plants. Carotenoids, yellow pigments, aid the plant in the photosynthesis process. In
addition, xanthophylls are contained in the chloroplasts which can be isolated and identified using
chromatographic techniques.
Pigment Color Rf value

carotene yellow-orange 0.91
pheophytin a grey 0.75
pheophytin b grey (may not be visible) 0.63-0.75
chlorophyll a blue-green 0.63
chlorophyll b green 0.58
xanthophylls yellow 0.53
The fluorescence of chlorophyll can be observed in spinach extract. Under normal biological
conditions the energy gained from light is transferred to an electron by chlorophyll and converted
to chemical energy via an extensive chain of electron receptors. In the extract, vital parts of this
electron transport chain are missing, but chlorophyll’s electrons are still excited by the incident
light. Some of the energy absorbed is lost as heat, but the rest is emitted as light. Since this light
has a lower energy, it has a longer wavelength and appears red. This phenomenon is known as
fluorescence.
Materials
• TLC silica gel plates
• capillary tubes
• developing chambers (jars)
• 70:30 hexane-acetone solvent
• spinach
• mortar/ pestle
• shredded carrot
• hexane
• disposable Pasteur pipets
• acetone
• test tube/rack
• UV light
22
• Always wear safety glasses in the laboratory
• Complete activity outside or in the fume hood
• Pour solvents back into their container after use. Do not pour down the drain.
Methods
1. Obtain a spinach leaf or shredded carrots and tear the sample into small pieces. Place the
pieces in a mortar.
2. Add approximately 5 cm3 of acetone and carefully grind the sample and acetone together with
the pestle. Continue grinding until the acetone becomes dark in color. More acetone may be
added to compensate for evaporation.
3. Using a disposable Pasteur pipet, extract the acetone and place it in a small test tube. Be
careful not to extract the small pieces of vegetable.
4. If the test tube is not approximately 2/3 full, repeat steps 2 and 3 using the same vegetable
remaining in the mortar.
5. Shine a UV light on the test tube to observe the red fluorescence in any spinach extract.
6. Add approximately 2 cm3 of hexane to the acetone extract.
7. Mix the contents of the test tube by using a clean disposable Pasteur pipet to repeatedly
withdraw a sample and then immediately dispensing the sample back into the test tube. Be
careful not to let the test tube overflow.
8. Allow the two layers to separate.
9. With a pencil, draw a line approximately 1 cm from the
short edge of the TLC plate. Be careful not to scrape
the coating of the plate. Mark the line with two tic marks
approximately 1/3 from either side. See diagram.
10. With a capillary tube, draw up a sample of the upper
hexane layer from the test tube containing the sample
and spot the sample on one of the tic marks on the TLC
plate. Be sure to label the spot at the bottom of the TLC
plate.
11. Allow the sample to dry. Reapply the sample to the
same place at least 3 times, allowing it to dry in
between, or until the spot is clearly visible.
12. Repeat steps 10 and 11 using a standard, such as
chlorophyll a, chlorophyll b, β-carotene, or xanthophyll.
13. Fill the developing chamber to a depth of approximately
0.5 cm with the 70:30 hexane-acetone mobile phase.
(Invert the bottle several times before pouring into the
developing chamber.)
14. Place the TLC plate in the chromatography chamber
with the sample spot toward the bottom. Be sure the
sample spot is above the level of the solvent. Close the
chamber.
15. Allow the plate to remain undisturbed until the solvent reaches to within 1 cm of the top.
16. Remove the plate from the chamber and immediately mark the solvent front using a pencil.
Trace around the edge of all visible spots.
17. Measure and record the distance from the spotting line (origin) to the center of each spot and
from the spotting line to the solvent front.
18. Identify each component (spot).
23
Results
Distance solvent moved from the spotting line (origin) __________________________
Type of Sample:________________________________________________________
Color of spot Distance moved Rf value Identity
Standard:______________________________________________________________
Color of spot Distance moved Rf value Identity
Analysis
1. Explain the color of the vegetable based on the results of the chromatography.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
2. Which pigments, if any, were present in both vegetables? Explain.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
3. Why was acetone used?
______________________________________________________________________________
______________________________________________________________________________
4. Why was a standard used?
______________________________________________________________________________
______________________________________________________________________________
24
Photosynthesis and Respiration in Plants
In this experiment, you will
1) Use an O2 Gas Sensor to measure the amount of oxygen gas consumed or
produced by a plant during respiration and photosynthesis.
2) Use a CO2 Gas Sensor to measure the amount of carbon dioxide consumed or
produced by a plant during respiration and photosynthesis.
3) Determine the rate of respiration and photosynthesis of a plant.
Materials
• plant leaves
• 500 cm3 tissue culture flask
• Logger Pro lamp
• Neulog O2 Gas Sensor
• aluminum foil
• Neulog CO2 Gas Sensor
• forceps
• BioChamber 250
Methods
1. If your CO2 Gas Sensor has a switch, set it to the Low (0–10,000 ppm) setting. Connect
the CO2 Gas Sensor to Channel 1 and the O2 Gas to Channel 2.
2. Obtain several leaves from the resource table and blot them dry, if damp, between two
pieces of paper towel.
3. Place the leaves into the BioChamber 250, using forceps if necessary. Wrap the
respiration chamber in aluminum foil so that no light reaches the leaves.
4. Place the O2 Gas Sensor into the BioChamber 250. Insert the sensor snugly into the
grommet. The O2 Gas Sensor should remain vertical throughout the experiment.
5. Place the CO2 Gas Sensor into the neck of the respiration chamber. Wait 10 minutes
before proceeding to Step 6.
6. Click to begin data collection. Collect data for fifteen minutes and click .
7. When data collection has finished, determine the rate of respiration:
a. Click anywhere on the CO2 graph. Move the mouse pointer to the point where the
data values begin to increase. Hold down the left mouse button. Drag the pointer to
the point where the data ceases to increase and release the mouse button.
b. Click on the Linear Fit button, , to perform a linear regression. A floating box will
appear with the formula for a best fit line.
c. Record the slope of the line, m, as the rate of respiration in Table 1.
d. Close the linear regression floating box.
e. Repeat Steps 7a–d for the O2 graph. However, you will need to move the mouse
pointer to the point where the data values begin to decrease. Hold down the mouse
button and drag to the point where the data ceases to decrease.
8. Move your data to a stored run. To do this, choose Store Latest Run from the Experiment
menu.
9. Remove the aluminum foil from around the respiration chamber. 10)Fill the tissue
culture flask with water (not the respiration chamber) and
place it between the lamp and the respiration chamber. The flask will act as a heat shield
to protect the plant leaves.
10. Turn the lamp on. Place the lamp as close to the leaves as reasonable.
Do not let the lamp touch the tissue culture flask. Note the time. The lamp should be on
for 5 minutes prior to beginning data collection.
11. After the five-minute time period is up, click to begin data collection.
Collect data for 15 minutes and click .
25
12. When data collection has finished, determine the rate of photosynthesis:
a. Click anywhere on the CO2 graph. Move the mouse pointer to the point where the data
values begin to decrease. Hold down the left mouse button. Drag the pointer to the
point where the data ceases to decrease and release the mouse button.
b. Click on the Linear Fit button, , to perform a linear regression. Choose “Latest
CO2” and a floating box will appear with the formula for a best-fit line.
c. Record the slope of the line, m, as the rate of photosynthesis in Table 1.
d. Close the linear regression floating box.
e. Repeat steps 13a–d for the O2 graph. However, you will need to move the mouse
pointer to the point where the data values begin to increase, hold down the mouse
button and drag to the point where the data ceases to increase.
13. Print a graph showing your photosynthesis and respiration data.
a. Label each curve by choosing Text Annotation from the Analyze menu. Enter
“Photosynthesis” in the edit box. Repeat to create an annotation for the “Respiration”
data. Drag each box to a position near its respective curve. Adjust the position of the
arrow heads.
14. Print a copy of the graph, with both data sets displayed. Enter your name(s) and the
number of copies of the graph you want.
15. Remove the plant leaves from the respiration chamber, using forceps if necessary.
Clean and dry the respiration chamber.
Results
1. Was either of the rate values for CO2 a positive number? If so, what is the biological
significance of this?
______________________________________________________________________________
______________________________________________________________________________
2. Was either of the rate values for O2 a negative number? If so, what is the biological
significance of this?
______________________________________________________________________________
______________________________________________________________________________
3. List five factors that might influence the rate of oxygen production or consumption in
leaves.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
26
Identifying Gametes Using Oil Immersion Microscopy
Methods
Take notes as your instructor demonstrates the oil immersion technique
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Biological grade drawings

1. Line drawings, using pencils, in which lines are only used to outline distinct structures.
2. Contrast and texture are added using stipples -- shading is not allowed.
3. Drawing must be labeled using lines that do not cross and just touch the object to be
indicated.
4. Letters should be used to note the title of the image, the staining (if any), and the
magnification used.
5. Scale bar, with units, must be drawn.
Example
Use the prepared slides of and make drawings of cells in different stages of meiosis or gamete
formation.
27
Analysis
Evaluate the use of oil immersion technique to identify cells.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Identify the stage of meiosis shown in the cells in image below.
28
Human Traits
Humans have many traits that are determined by genes that we inherit from our parents. The
appearance of these traits is called the phenotype. The combination of genes that control a trait is
called the genotype.
Methods
1. In the results section, make a data table that will record the phenotypes of yourself
and each of your classmates for each trait in the table below.
2. Record the phenotype of each trait for yourself and each classmate.
3. Perform a Chi-squared test to determine if any of the traits are linked.
Trait Dominant Hybrid Recessive
Shape
of face
Cleft in
chin
Hair
Widow’
s peak
Spacing
of eyes
Position
of eyes
29
Trait Dominant Hybrid Recessive
Eyelash
length
Size of
nose
Shape
of lips
Freckle
s
Dimples
Tongue
rolling
30
Results
Analysis
31
Constructing and Analyzing a Karyogram
Your instructor will give you a paper containing photographs of chromosomes. Cut them out and
glue them in the appropriate location below, based on the banding pattern, centromere location,
and size.
Analysis
1. What would be the sex of the individual in your karyogram?
______________________________________________________________________________
2. Are there any abnormalities present? If so, describe them.
______________________________________________________________________________
______________________________________________________________________________
32
DNA Fingerprinting SIMULATION
This lab activity is a simulation of RFLP analysis. RFLP (pronounced rif-lip) analysis is commonly
called DNA fingerprinting. This technology uses three restriction enzymes- Ecor1, HindIII, and
BamH1. In this activity, we will use features of Word© to simulate cutting of the DNA sequence by
these restriction enzymes.
Methods
Here is the original sequence of DNA. (It will also be emailed to you)
AGCTACGAGAATTCGGATCCTCGAAGCTTACTGAGAATTCCTAGCTACGATCGATCGACTGAC
TAGCTACGAAGCTAGCAAAGCTTTCGATCGAGAATTCGGATCCCTAGCTAGCATCGATCGACT
AGCAAGCTTATCGATCGATGAATTCCGACTGACTACGAGGATCCTCGATCGACTAGCTACGAT
CGACTAAGCTTGACTAGCTACGATCGAATTCGACCACTCGCATACCGAGAGTGGATCAAGGG
ATCCAATTCGAAGGGCCTTCGATCGCCTGCAAAGCCTTCGATCCCTTCCTAGCTAGCTAGC
1. Make FIVE RANDOM changes to the original DNA sequence. Use the notation below to
indicate your changes. These changes can be
a) Substitutions (switch A for G). Use BOLD to indicate SUBSTITUTIONS.
b) Additions (AA becomes ACA). Use Italics to indicate ADDITIONS.
c) Deletions (CGA becomes CA). Use UNDERLINE OF BASES ON EITHER SIDE OF
DELETIONS
2. Type “(your name) ORIGINAL SEQUENCE” at the top of the sequence.
3. Select the whole sequence and copy and paste so you will have a new copy of your individual
DNA.
4. First simulate cutting your DNA with Ecor1. Ecor1 recognizes and cuts DNA at GAATTC.
Select the sequence and use the REPLACE command (Home tab, Editing button) to find
“GAATTC” and replace with “G AATTC”. Notice that there are five spaces between G and
AATTC. Label this sequence as ”Ecor1 cuts DNA of (your name) at GAATTC”.
5. Copy “(your name) ORIGINAL SEQUENCE” and paste at the bottom of the document.
6. Next, simulate the effects of the restriction enzyme BamH1. This enzyme cuts at the sequence
GGATCC. Select the sequence and use the REPLACE command to find “GGATCC” and replace
with “G GATCC”. Label this third sequence as “BamH1 cuts DNA of (your name) at GGATCC”.
7. Repeat step 5.
8. Finally, simulate the effects of the restriction enzyme HindIII, which cuts at the sequence
AAGCTT. Using your unique and uncut copy of DNA, use the REPLACE command to find
“AAGCTT” and replace with “A AGCTT”, label this fourth sequence as “HindIII cuts DNA of
(your name) at AAGCTT”.
9. Now find each cut for each restriction enzyme and press enter twice at the end of the fragment
so that each fragment is on its own line in the document. Be aware that some fragments will be
longer than one line.
10. Highlight each fragment then click on the word count in the bottom left of the screen. The
number of characters equals the number of 1,000 base-pairs in the fragment, record this number
in the table below.
33
11. Obtain data from at two other classmates. Process and display the data on the following
graph. The graph should be made to resemble an electrophoresis, with the largest fragments near
the top and the smallest near the bottom. (Optional) The distance DNA moves in a gel is a
function of the logarithm of its molecular weight. In our simulation, the number of letters equals
1kbp (1,000 base-pairs), which is our unit of molecular weight. On the X-axis are your and three
classmate’s names. The Y-axis is the logarithm of its molecular weight in kbp.
Results
My DNA
Fragment size/kb
Ecor1 BamH1 HindIII
Classmate 1 DNA
Fragment size/kb
Ecor1 Ecor1 Ecor1
Classmate 2 DNA
Fragment size/kb
Ecor1 Ecor1 Ecor1
34
Simulated stained gel electrophoresis of three “suspects”
1 2 3
Suspects
35
Genes and Disease DATABASE
Part A: Genetic basis of disease
1. What is the difference between a gene that causes a disease and a gene that predisposes
someone for a higher risk of a disease? Give examples.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Part B: Genome sequencing is awesome and cheap(er)
1. Go to genome.gov/sequencingcosts/ - click on the plot with the orange lines titled “Cost per
Genome”.
2. What was the cost of sequencing the human genome-
a. In October 2001?____________________________
b. In October 2005? ____________________________
c. In October 2010? ____________________________
d. Today? ____________________________
Part C: Find a disease gene via OMIM
Name of disease _________________________________
1. Go to omim.org (OMIM = Online Mendelian Inheritance in Man) and search for your
disease.
2. Click the top result that starts with a “%” or “#” - this means the result is a phenotype and
will give you a list of possible genotypes.
36
3. Scroll down to Phenotype Gene Relationships and pick a gene to explore.
4. Write down the gene you chose:

______________________________________________________________________
Part D: Explore gene function via GeneCards

D.1 - GeneCards: Searching and Summaries
1. Go to genecards.org and search for your gene at the top. Click on the top hit for your gene.
Make sure the “Symbol” matches the name of your gene.
2. Scroll down to “Summaries for ____ gene” on the left and “Entrez Gene summary for ____”
3. In 1-2 sentences, what is function of the protein coded by this gene? Does it perform some
specific chemical reaction?
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
37
4. What biological process does it govern? (e.g. DNA Damage for BRCA2)
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
5. What diseases are associated with this gene? (Including, but not limited to, the disease
you’re exploring)
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
D.2 - GeneCards: Proteins
On the left, open up the “Jump to Section...” drop down menu and choose “Proteins”
1. Under “UniProtKB/Swiss-Prot”, bullet point “Subunit”, what molecules and proteins does
your protein interact with? Are there special conditions for any of the interactions?
a. Size of your protein: _______ amino acids __________ Daltons
2. Is your protein part of a complex? If so, what other subunits are in the complex?
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
3. Scroll down a bit until you see “Gene Ontology (GO)”.
4. What is the top GO term for the cellular location of your gene? Does that make sense with
its biological function?
______________________________________________________________________________
______________________________________________________________________________
38
D.3 - GeneCards: Genomic Views
In “Jump to Section...”, chose “Genomic Views.”
6. Where is this gene located in the genome? The “address” is described by the “cytogenic
band,” which looks like this: 9q23.3
______________________________________________________________________________
______________________________________________________________________________
7. In a new tab or window, go to ghr.nlm.nih.gov/handbook/howgeneswork/genelocation
a. What chromosome is your gene on? ________________________
b. Which arm? (circle one) long / short
c. Which position? _________________________
8. Go back to the GeneCards tab. How many base pairs (bp) are in your gene? ________
Go to: “GeneLoc gene densities for chromosome ___” (under the chromosome diagram)
9. How many genes are on this chromosome? __________________________________
39
Part E: cDNA transcript analysis via Ensembl
Scroll up to the top and click the Ensembl ID, which will look like this: “ENSG00000141510” (this
opens in a new tab/window) You should get a page that looks like this:
You’ll explore two transcripts from your gene. You’ll do the first transcript under “Transcript ID” and
then another one that you choose--anyone you like!
First transcript ID: Transcript ID you chose:
How many exons does this transcript have? How many exons does this transcript have?
Click “Exons” on the left (you have to be viewing a transcript to see this option). The green letter
sequence is the upstream sequence of the gene, the purple letters are the untranslated region, the
black is the exon gene sequence, and the blue is the intron sequence. Note: This is cDNA, a
reverse complement copy of the mRNA that this came from.
What are the first three letters of the gene sequence?
What do these three letters represent?
What are the first two letters of each intron?
Last two letters of each intron?
How long is the longest intron (in bp)?

Shortest intron (in bp)?
How long is the longest exon (in bp)?

Shortest exon (in bp)?
Which are longer in general, introns or exons?
40
Part F: Genomic views via UCSC Genome Browser
F.1 - mRNA transcripts in the UCSC Genome Browser
Go back to the GeneCards site and the “Genomic Views” for your gene. Click “UCSC Golden Path
with GeneCards custom track” (this will open in the window/tab that Ensembl opened). You should
get a page that looks like this:
There is a LOT of data here. Let’s condense it. Under the red boxes and lines, click “Human ESTs
Including Unspliced.” This “rolls up” the track like a window shade. [“ESTs” stand for Expressed
Sequence Tag and is an old technology (from 1993) that was used to figure out what mRNAs are
present in an organism. Now we have better technology called RNA-Sequencing (publicly unveiled
in 2008) which gives us the “Human mRNAs from GenBank” track that we will use.]
Your Genome Browser should now look like this:
The track Human mRNAs from GenBank is a bunch of real mRNAs from real human samples
(either biopsies from people or human cell lines). Because RNA-seq isn’t available to everyone,
most of the subjects in the database are there because they have a disease or condition that
scientists are studying.
The thick boxes are exons and the lines are introns. The longer boxes at the beginning and end
are the untranslated regions (remember the first and last rows in the Ensemble table?)
Find the pattern in what exons and introns are excluded/included in the mRNAs. Explain the
pattern.
_____________________________________________________________________________
_____________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
41
F.2 - Conservation via UCSC Genome Browser
Let’s see how these introns and exons are conserved across species.
Scroll down to the bottom. Under Comparative Genomics, there are a bunch of categories.
Under Conservation, click open the drop down menu and choose pack.
Your genome browser should now look like this:
1. Which organism(s) that came up in conservation is most surprising?
______________________________________________________________________________
2. Which are more conserved, exons or introns? Why?
_____________________________________________________________________________
_____________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
3. Why do you think sequences outside of the gene are conserved?
_____________________________________________________________________________
_____________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
42
The E.coli Insulin Factory
In this activity, a simulated DNA message for the protein insulin is marked on the cell DNA.
Your task will be to find an enzyme that cuts the plasmid once (and only once) and the
cell DNA as close as possible on both ends of the insulin gene so that the insulin code can
be fused into the circle of the plasmid DNA.
To do this you will need to:
1. Determine which restriction enzyme to use to cut your DNA strand.
2. Determine which antibiotic you would use to determine if your finalized recombined
DNA was absorbed by the bacteria or not.
Methods
Part A.
1. This activity requires cooperation between yourself and a lab partners. Each group of
students will turn in one data sheet.
2. READ THE FOLLOWING DIRECTIONS CLOSELY. YOUR CLASS NOTES ON

PLASMIDS MAY HELP YOU REFRESH YOUR MEMORY ON HOW THEY FUNCTION.
3. Obtain scissors and a roll of tape.
4. Cut out the PLASMID DNA (red). Discard ANY TWO of the strips (except for the strip
which contains the "origin of replication" site (see code at bottom of sheet). Shuffle the
strips and tape the end of one to the end of another in any random fashion (as long as the
letters are going in the same direction). After you have taped the four strips into one long
strip, tape the two remaining ends together, to form one long circular paper plasmid. Save
the key about antibiotic resistance, from the bottom of the sheet for later use. Save extra
plasmid pieces until you have successfully completed step #8.
5. As one partner works on step 4, the other should cut out the CELL DNA (yellow)
strips. They must be taped together in order indicated at the bottom of each strip.
That is, strip 2 is taped to the bottom of strip 1, strip 3 is taped to the bottom of strip
two, etc. Note where the DNA code for insulin (the protein gene) is located.
6. After completing steps 4 and 5, use the PLASMID MAP on the data sheet to map
the relative locations of the DNA code for each of the antibiotic resistances. Use a
pencil to mark in the positions of the genes for antibiotic resistance that your plasmid
contains. Label each.
43
7. It is time to begin testing the various restriction enzymes that you have in your
laboratory. Cut out ENZYMES (green). There are 8 restriction enzymes given for cutting
the DNAs and one ligase fusing the DNAs together when done. Note that on each of the
restriction enzyme rectangles, there is the name of the enzyme (such as Ava II) and a short
DNA sequence that shows exactly what sequence that enzyme cuts.
8. Your job as a biochemist is to find a restriction enzyme that will cut open your plasmid
at ONE site only (this may or may not be possible depending upon how you constructed
your plasmid). The same enzyme should be able to cut your cell DNA at TWO SITES, one
above the and one below the gene for insulin. It is very important that you find an enzyme
cuts as close to the insulin gene as possible. The cells have genes for other unnecessary
proteins that need to be cut off leaving "sticky" ends that look like this
9. You and your partner have 8 restriction enzymes to choose from. Some of the
enzymes cannot cut open your plasmid, some can. Some of the enzymes cannot cut your
cell DNA at two sites, some can. If they don't meet your needs they are not usable.
10. One partner should take an enzyme, for example, Ava II, and check the pink plasmid
for a location or locations which can be cut by this enzyme. The other partner should use
a pen to mark on the PLASMID MAP (yellow answer sheets) where the enzyme will cut.
Label each. Also, note on the table on your yellow answer sheets how many times it will cut
the plasmid. REMEMBER THAT YOUR GOAL IS TO FIND THOSE ENZYMES THAT
WILL CUT THE PLASMID ONCE AND ONLY ONCE. Continue this procedure until all 8
enzymes have been tried. Each group's results will be different because they different
plasmid sequences. If you have no enzymes that will cut your plasmid only once, then
reconstruct your plasmid.
11. Once you have selected those enzymes that cut the plasmid once, start checking these
enzymes against the cell DNA strand. REMEMBER, THE GOAL IS TO FIND AN ENZYME
THAT WILL MAKE A CUT CLOSE TO THE GENE FOR INSULIN, ONE ABOVE AND ONE
BELOW. It is essential that the enzyme not cut into the insulin gene on the DNA. Mark
directly on the goldenrod cell DNA strip where the enzymes will cut. Draw the line
accurately showing exactly where the bases will be cut apart (and leave the "sticky" ends).
Write the name of the enzymes next to each line you draw.
12. After you have completed testing the enzymes, select which ONE enzyme you would
use to cut the plasmid and the cell DNA. Use scissors to make the cut in your plasmid and
the celll DNA. CAUTION: Scissors are sharp and easily cut through human flesh! Be
careful to make the cuts in the staggered fashion made by the actual enzyme. This will
expose the "sticky" ends where joining will be possible. (since one enzyme was used, all
"sticky" ends will be compatible). Use tape to splice your insulin gene into the plasmid
chain. You have created RECOMBINANT DNA!!!
13. Fill in the rest of the appropriate spaces in the table on the data sheet. Give exact
reasons why you did not use certain enzymes and the reason why you chose the one
enzyme you did.
Part B.
In a real situation, you would mix your recombinant DNA plasmids with the bacteria of your
choice. These bacteria would absorb the plasmids out of their environment and act as the
hosts. These host bacteria should then begin producing insulin. You could purify the insulin
and sell it so that it can be used by diabetics.
Early in this activity, you were asked to note and record which of the antibiotic
resistances you had on your plasmid. This knowledge is extremely useful in
44
determining if and which bacteria took up the plasmid as they were supposed to. The
host bacteria are normally killed by the antibiotics (kanamycin, ampicillin and
tetracycline). However, IF the recombinant plasmids were actually taken up by the
bacteria, the plasmids may have contained a DNA gene for resisting the effects of one
or more antibiotics. Therefore, if the host bacteria are placed in a growth medium
containing an antibiotic to which they have a resistant gene in their recombinant plasmid
DNA, they will survive. Any bacteria that failed to take in recombinant plasmids would
die in the growth medium. THEREFORE... the host bacteria that survive have taken in
the recombinant plasmids, those that do not survive have not taken it in.
Results
No. of Cuts
USED NOT
Restriction on:
(ONE) USED Reason For Use or Non-use
Enzyme Pla-
smid
DNA (X) (X)
Ava II
Bam HI
Bgl II
Eco RI
Hin dIll
Hpa ll
Sac I
Xma l
1. Which of the antibiotic resistances does your plasmid contain?
_____________________________________________________________________________
2. Which antiobiotic(s) could you use in your growth medium to test for plasmid uptake?
____________________________________________
3. Which antiobiotic(s) could NOT be used in your

growth medium to test for plasmid uptake?
___________________________________________
PLASMID MAP
Use this map to show 1- the relative positions of

the genes for antibiotic resistance and 2- the
approximate location(s) of the cuts that could be
made on the plasmid by the 8 restriction
enzymes.
45
Yeast Population and Bicarbonate Concentration: IA Introduction
Introduction (helps to frame research question AND establish personal engagement)
Yeasts are important for humanity and have been since prehistoric times. They are used in bread
making, beer brewing, industrial ethanol production, and even bioremediation. (Injarde, et al.,
2014)
Global warming has been linked to increased concentration of bicarbonate ions in the world’s
oceans. (Caldeira & Wickett, 2003) I felt it would be interesting to do an experiment if Yeast
population growth is affected by the addition bicarbonate ions to their growth solution as a way of
showing the possible effects of global warming on an important species for humanity.
Exploration
Consider the following research question- “What is the effect of calcium carbonate on Yeast?”
Is this a focused problem? (Hint- NO!) What more can you say?
_____________________________________________________________________________
_____________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
The independent variable is the one that you change. The dependent variable is what you will
directly measure.
What is the independent variable?
______________________________________________________________________________
What is the dependent variable?
______________________________________________________________________________
What range of the IV will be tested?
______________________________________________________________________________
Justify this range.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Write a focused research question below that contains the IV, Range of IV, DV, organism with
scientific name/system/database/simulation/etc.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
46
Background information
Find, summarize, and cite in MLA8 stye, TWO primary sources relating to the investigation.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Methodology
The methodology of the investigation is highly appropriate to address the research question
because it takes into consideration all, or nearly all, of the significant factors that may influence the
relevance, reliability and sufficiency of the collected data
Write a methods question that satisfies the criteria stated above. Write as numbered steps and
make a table of controlled variables. (Hint- consider using the visual cell counter app)
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
47
Safety, Ethical, and Environmental Issues
How did your investigation show awareness of these issues? Describe in a paragraph or table.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Analysis
Sufficient Relevant Qualitative Data
Describe any relevant observations about your test tubes. (Cloudy, clear, bubbles, smell, moving
cells, budding, etc.?)
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Sufficient Relevant Quantitative Data
Organize data into a table with a descriptive title, clear labels, units, and uncertainties.
Appropriate and Sufficient Data Processing

Clearly describe and show how the data is processed and displayed. This should include
sentences, equations, and a graph(s).
48
Measurement and Uncertainty
How does the report show evidence of full and appropriate consideration of the impact of
measurement uncertainty on the analysis? Explain.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Evaluation
Conclusion
Describe and justify a detailed conclusion.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Relate your conclusion to the accepted scientific context. (Does it agree or disagree with other
studies? Remember to cite them.)
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Limitations
Discuss strengths and weaknesses of the experiment, showing full awareness of the
methodological issues of the investigation.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Improvements
Discuss realistic and relevant improvements that relate directly to the identified weaknesses of the
investigation.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
49
Sustainability in a Winogradsky Mesocosm
Question: Under which conditions do various color bacteria thrive? What is the effect of the
type/volume/mass of the materials added to the mesocosm on the type and abundance of the
bacteria that live in the soil?
Research / Background information: In the 1880's, a Russian microbiologist named Sergei

Winogradsky discovered that water mud poured into a tall bottle and placed in the sun turned
many different colors. Many kinds of bacteria live in mud. He found that by adding a few simple
things, such as cheese or paper, he could control which colors appeared.
During the process of decomposition, all the oxygen near the bottom of the container is used up.
Red, orange, and green bacteria that grow near the bottom of the column are less tolerant or
completely intolerant of oxygen. They get energy from hydrogen sulfide, the gas that smells
like rotten eggs. These oxygen-phobic bacteria have crucial roles to play in the ecosystem. Some
take part in the global sulfur cycle, while others convert nitrogen into forms needed by plants.
Some bacteria are decomposers that get nutrients by breaking down organic materials things like
the paper or grass clippings.
Other bacteria are photosynthetic and aerobic. Blue-green bacteria near the top of the mud
column use light, carbon from carbon dioxide, and hydrogen from water to make carbohydrates
and give off oxygen just like plants. The carbon dioxide they need is released when the
decomposers break down the paper and grass clippings.
Establishing Groups, Research and Design

• You will work in groups of 2-4 students
• Each group will have 5 glass jars in which to make the columns
• Each column must have a different composition of ingredients in order to answer the
question: Under which conditions do various color bacteria thrive?
• Observe the materials that are provided
o Soil (also contains the bacteria)
o Pond water (contains bacteria)
o Paper (carbon source)
o Carbon powder
o Grass clippings (carbon source, but will also have other nutrients)
o Egg shell (CaCO3 is a carbon source, with calcium)
o Sodium sulfate (Na2SO4)
o Calcium sulfate (CaSO4)
o Paper clips, staples, nails (sources of iron)
• Decide as a group what combinations and measurements of ingredients you will include in
your columns
Record your design/exploration in your notebooks.
Methods
The following links will take you to various procedures. Choose the one you like best. You can also
search the internet for additional ones. Make notes and describe your methods on the next page.
http://www.exploratorium.edu/theworld/glow/grow.html
http://www.accessexcellence.org/AE/AEPC/WWC/1991/microbial.html
http://www.personal.psu.edu/faculty/j/e/jel5/biofilms/winogradsky.html
The Winogradsky Column
50
51
Results
52
Pitfall Traps DATABASE
This data base shows the results for invertebrates falling in pitfall traps at the end of June over
three successive years. The traps were set at 5m intervals along transect lines running from a
lawn into an area of woodland. They were left over a 24h period and the animals were collected
identified and counted. The animals were sorted into Families or Classes.
You will be emailed the TrapsDB.xls file. Save it onto your computer. Open the file.
The data is arranged by year, team, trap and then each taxon (family or class).
Each time an organism is recorded a P is entered for “present”.
Highlight the cells with the column headings. Go to Data, Filter, and then Auto filter
To verify which are the dominant groups of animals
Click on each column in turn and select P. The totals are given in the bottom left-hand corner.
After you have finished with a column to display all the data you must go to the filter for that
column again and select (All).
To determine how a group is distributed along the transect
Pick a dominant group. Select P in the filter. Then go to the Traps column and select each trap in
turn. Once again, the totals are given in the bottom left-hand corner of the screen.
Enter the values for each trap in a table under the spread sheet or open another spread sheet.
Then plot a bar chart of the distribution of that species.
To determine how the distribution of a group varies over a space and time
Try the same thing again but this time find out how the numbers caught for the group varied over
the three-year period. You will need to filter the group of animals first (select P). Then filter the trap
number (1, 2, 3, 4, 5 or 6). Finally, select each year.
The number of teams collecting data varied how are you going to compare them fairly?
______________________________________________________________________________
______________________________________________________________________________
53
Diversity
Inspect the data trap by trap to determine how many different types of groups are represented in
each trap each year or over the three years. Record your results in the space below.
Results
Data processing
Perform a Chi-squared test for the association of two species found in the data. Show your
calculations below.
54
Human, Hominoid, and Primate Skulls
Throughout time, no issue has interested humans more than learning about our origins. Where
did we come from? What did our ancestors look like? Where and how did they live? Today, we
are beginning to understand those questions, thanks to evidence provided by Biologists and
Anthropologists. Nevertheless, the topic remains controversial and often elicits strong responses
from people.
Methods
Read the following information and examine the drawings that follow. Then complete the data
table on page two.
Skull characteristics
a. Prognathism is the extent to which the face and jaws protrude forward when viewed
from the side. This can be measured as an angle.
b. Brow Ridge, which is the mass of bone over the eye sockets, supports the upper facial
skeleton against forces produced by chewing. The larger the brow ridge the stronger
the chewing action can be. Measure the length that the brow ridge extends from the
brain case.
c. Sagittal Crest is a thin ridge of bone atop and down the middle of the braincase. It is
also associated with jaw strength and chewing.
d. Foramen Magnum is the large opening in the base of the skull through which the spinal
cord passes. The position of this opening reflects the posture of the body and pattern of
movement. Species that walk standing completely upright on two legs have a Foramen
Magnum that 90º. Knuckle-walking apes have a foramen magnum that is much less
than 90º. Place a pencil in the Foramen Magnum to measure the degree.
Teeth
e. The four front teeth on the top and bottom are called incisors (A in diagram). Record
their size and shape.
f. The canine teeth (B in diagram) are longer and more pointed than the others. Some
primates have a Canine diastema which is the gap in the teeth corresponding to the
canines of the opposite jaw. Record this as present or absent.
g. There are eight premolars (C in diagram), which are followed by twelve molars (D in
diagram). Record their size and shape.
Measuring prognathism Sagittal Crest, Brow Ridge, Canine Diastema. Primate Teeth
Four-limb walking Knuckle-walking Slouched bipedal Bipedal
55
Results
Homo Australop- Australopi-
Homo Homo Pan Gorilla
Trait neanderth- ithecus thecus
sapiens erectus troglodyte gorilla
alensis boisei afarensis
Prognath-
ism/
angle
Brow
Ridge/
length
sagittal
crest/
length
foramen
magnum/
angle
Incisor/
length
and
shape
Canine/
Length
and
shape
Canine
Diastema/
Present
or
absent
Molar
& pre-
molar/
Width
and
shape
56
Analysis
Based on skull and teeth characteristics. Propose a hypothesis about the diet and pattern of
movement for each species.
Homo sapiens-
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Homo erectus-
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Homo neanderthalensis-
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Australopithecus boisei-
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Australopithecus afarensis-
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Pan troglodyte-
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Gorilla gorilla-
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
57
Comparing Amino Acid Sequences in Cytochrome C
Genes are made of DNA and are inherited from parent to offspring. Some DNA sequences
code for mRNA which, in turn, codes for the amino acid sequence of proteins. Cytochrome C
is a protein involved in using energy in the cell. Cytochrome C is found in most, if not all,
known eukaryotes. Over time, random mutations in the DNA sequence occur. As a result,
the amino acid sequence of Cytochrome C also changes. Cells without usable Cytochrome
C are unlikely to survive.
Methods
A. Compare the amino acid sequence of Cytochrome C in various organisms.
1. Mark the amino acids which are different Use the example to show you how.
Note that some of the amino acids are always the same in all species, these have
been shaded blue or light gray.
2. Count and record the total number of differences.
3. Note: Be sure to study the entire molecule.

Each protein sequence has 103-112 amino acids; the sequence extends onto two (2)
lines.
4. Share your data with the rest of the class and complete Table 1.
B . Make a branching tree, or cladogram using the data in Table 1.

1. The two most closely related species have the fewest differences in amino acid
sequence.
2. Place the two most closely related species on the two shortest branches of the tree.
3. Place the next two closest species onthe next shortest branches.
4. Place the species which is the next, closest
,, on the next longest branch. Continue until all
the species have been placed.
C. Complete the Analysis section.
58
59
Results
Cladogram Based on Cytochrome C Amino Acid Sequence
60
Analysis
1. How many Cytochrome C amino acid sequence differences are there between chickens
and turkeys?
2. Make a branching tree, or cladogram for chickens, penguins, and turkeys.
3. a. Predict the number of Cytochrome C amino acid sequence differences you

would expect to see between
1 ) horse and zebra ______ and 2) donkey and zebra______
b. What other information did you use to make this prediction?
4. Use this Cytochrome C sequence difference data to add a branch to the cladogram.
5 . List three other things used to determine how organisms are related to each other.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
6. Explain why more closely related organisms have more similar Cytochrome C.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
7. Other data , including other genes, suggests that fungi are more closely related to
animals than plants. What are some reasons that the Cytochrome C data suggests that
fungi, plants, and animals are equally distantly related?
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
61
DNA Sequence Analysis of the Great Apes
Below are two sections of DNA that were obtained for the great apes and another species. The
other species is called an “out group” and is commonly included by evolutionary biologists.
Our goal today is to obtain data that will help us evaluate the evolutionary relationships between
the great apes. DNA sequence analysis is like amino acid analysis. We simple examine the
differences and the species with the fewest differences are most closely related.
Methods
For the species below, determine the number of differences in the DNA of each species. On the
reverse of this paper, make a data table and cladogram for the species below.
62
Results
Analysis
Phylogeny
63
DNA Sequence Alignment and Analysis
Recent advances in genome mapping have allowed for rapid and sophisticated phylogenetic
analysis of thousands of species. In addition to comparing amino acid sequences of homologous
genes, DNA sequences may also be compared. In this activity, you will analyze the phylogeny of
eight organisms by aligning the DNA sequences of one gene.
Methods
1. Obtain DNA sequences for 8 species of your choice.

a. Go to the web-site of the National Center for Biotechnology Information
http://www.ncbi.nlm.nih.gov/pubmed/
b. Choose ‘gene’ from the search menu
c. Enter a gene plus the organism. Example- cytochrome oxidase 1 (COX1) for pan
(chimpanzee). If you do not know of a gene, you can enter a trait/disorder or choose
from one listed in the genome database. Look around the site, you will find eventually
find something useful.
d. For the above example, click on cox 1 and mouse over the section ‘Genomic regions,
transcripts, and products’ until ‘Nucleotide Links’ appears.
e. Choose Fast A and the sequence should appear. Be aware that you must specify the
whole sequence or selected regions. Copy the sequence and paste it into a .txt for
notepad file.
f. Repeat with at least 8 different species that you want to compare. If more than one of
your species does not have the gene that you have chosen, you must either 1- chose a
different gene or 2- chose different species. 7 species should be part of a clade and 1
species should be the outgroup, not in the clade but close enough to have the same
gene
64
2. Analyze the sequences. (NOTE- this step is challenging due to software compatibility)
a. computer align the sequences by downloading the software:
ClustalX at http://bips.u-strasbg.fr/fr/Documentation/ClustalX/
OR
PHYLIP at http://evolution.genetics.washington.edu/phylip.html
b. Save the file containing all the different sequences as sequences.fasta (some students
have also had success with each species in a separate file (¯\_(ツ)_/¯)
c. In the File menu, choose Load Sequences.
d. Select your file. Your sequences should show up in the program window.
e. Under the Alignment menu, choose Do Complete Alignment. Something like the
following should appear.
3. Construct a dichotomous cladogram for the 8 organisms.

a1. Download a TreeView program at:
http://taxonomy.zoology.gla.ac.uk/rod/treeview.html
https://treeview-x.en.softonic.com/ (Hint- remember to select PHYLIP file format or
file won’t work)
a2. Use the PHYLO_WIN program at:
pbil.univ-lyon1.fr/software/phylowin.html
4. Print and glue your phylogeny here, which should look something like the image below.
65
Natural Selection of Rabbits SIMULATION
Natural selection often takes a very long time and involves the death of organisms. For this
reason, a simulation is justified for this activity.
Methods
1. Go to https://phet.colorado.edu/en/simulation/natural-selection
2. Explore the simulation, changing the variables and observing the effects.
3. Choose an independent variable to study.
4. Conduct your experiment.
5. Print and glue your results/evidence of your investigation below.
Results
66
Absorption of Carbohydrates
Cola drinks contain a mixture of substances with different particle sizes. They can be used to
represent food in the small intestine. Dialysis tubing is semi-permeable so can be used to model
the wall of the small intestine. Cola contains glucose, phosphoric acid and caramel, a complex
carbohydrate added to produce a brown color. Keep in mind which of these substances will diffuse
out of the bag and predict whether the bag will gain or lose mass during the experiment.

• Benedict’s solution is poisonous if ingested. Never taste any of the solutions. Wash your
hands after leaving the lab.
• Benedict’s solution is caustic and will irritate or burn your skin and eyes. Wash your hands
immediately if you contact the chemicals. Wear eye protection at all times.
• Dispose of waste in the chemical waste container.
Methods
1. Fill a beaker with 200 cm3 of water and test 1-3 cm3 of it for glucose using Benedict’s
reagent in the hot water bath.
2. Record the initial pH of the water solution.
3. Make the model of the small intestine with cola inside. To make a model of the small
intestine, cut a length of dialysis tubing and seal one end by tying a knot in the tubing. Pour
in a 10 cm3 of cola and seal the open end by tying a knot.
4. Rinse the outside of the bag to wash off any traces of cola and then dry the bag.
5. Measure the mass of the bag using an electronic balance.
6. When you are ready to start, place the bag in the beaker of water from step 1.
7. Test the water around the bag every five minutes.

8. At each time lift the bag up and down a few times to mix the water in the beaker, then do
these tests:
a. Put a sample of the water in a spot plate. Look carefully at the water to see whether
it is still clear or has become brown.
b. Run the benedict’s test on 1 ml of the water to see if the glucose concentration has
changed.
c. Record the pH of the water surrounding your model.
d. Record or take a picture of the benedict’s test results.
9. At the end of your experiment find the final mass of your model.
10. Create a data table to record all the data collected in the lab.
67
11. Create a graph that shows how glucose concentration and pH changes throughout the
experiment.
Results
Conclusion
Explain the conclusions that you can draw about the permeability of the dialysis tubing from the
tests of the water and from the change in mass of the bag.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
68
Heart Dissection
These sheep hearts were obtained from a butcher, which satisfies the IB ethical standards.
Methods
1. Obtain a heart. Rinse it in water thoroughly to remove excess blood, trying to run water into
the larger blood vessels to force any blood clots out of the heart chambers.
2. Place the heart in a dissecting tray with its ventral surface up (See image below).
3. Locate the abundance of fat along the paths of various blood vessels. This adipose tissue
occurs in the loose connective tissue that underlies the visceral pericardium.
How can you tell which side of the heart is the ventral surface? ____________________________
______________________________________________________________________________
4. The line running diagonally down from the right side (facing you) of the heart to the bottom
left side is the coronary artery. The coronary artery supplies blood to the heart muscle
tissue. The pointed bottom of the heart is called the apex.
What results if there is blockage in this vessel?
______________________________________________________________________________
5. Hearts from butchers usually come with the major blood vessels trimmed very close to the
heart itself. Although this is less than ideal, identification of the vessels and their entrances
into the heart can easily be accomplished by inserting your finger into the vessels and
identifying the chamber the finger entered.
Identify the structures on the external surface of the heart in Figure 2:
69
6. Examine the dorsal surface of the heart. Locate the stumps of two relatively thin-walled
blood vessels that enter the right atrium. Demonstrate this connection by passing a blunt
probe or your finger through them. The upper vessel is the superior vena cava, and the
lower one is the inferior vena cava.
7. Open the right atrium. To do this, follow these steps:
a. Insert a blade of the scissors into the superior vena cava and cut downward through the
atrial wall.
b. Open the chamber, locate the tricuspid valve and examine its cusps.
c. Run some water through the tricuspid valve to fill the chamber of the right ventricle.
d. Gently squeeze the ventricles and watch the cusps of the valve as the water moves up
against them.
Describe the action of the tricuspid valve when you squeezed the water-filled right ventricle.
______________________________________________________________________________
______________________________________________________________________________
8. Open the right ventricle as follows:

a. Continue cutting downward through the tricuspid valve and the right ventricular wall until
you reach the apex of the heart.
b. Find the opening to the pulmonary trunk and use the scissors to cut upward through the
wall of the right ventricle. Follow the pulmonary trunk until you have exposed the pulmonary
valve.
c. Examine the valve and its cusps.
Compare the structure of the tricuspid valve with that of the pulmonary valve.
______________________________________________________________________________
______________________________________________________________________________
How do the walls of the atria compare with the walls of the ventricles?
______________________________________________________________________________
9. Open the left side of the heart. To do this, follow these steps:
a. Insert the blade of the scissors through the wall of the left atrium and cut downward to the
apex of the heart.
b. Open the left atrium and locate the four openings of the pulmonary veins. Pass a slender
probe through each opening and locate the stump of its vessel.
c. Examine the bicuspid valve (mitral valve) and its cusps.
d. Examine the string like structures attached to the edge of the cusps. These are called the
chordae tendinae.
70
What is the purpose of heart valves?
______________________________________________________________________________
Where is the other point of attachment of these structures? _______________________________
______________________________________________________________________________
What do you think is the function of the chordae tendinae? Hint: They do not pull the valves open.
______________________________________________________________________________
______________________________________________________________________________
Name and compare the heart valves found between the upper and lower chambers of the right
and left sides of the heart.
______________________________________________________________________________
______________________________________________________________________________
10. Locate the aorta, which leads away from the left ventricle, and proceed as follows:
a. Feel the walls of the aorta and the pulmonary trunk.
Compare the thickness of the aortic wall with that of the pulmonary trunk. What accounts for this
difference? _____________________________________________________________________
______________________________________________________________________________
b. Use scissors to cut along the length of the aorta to expose the aortic valve at its base.
c. Examine the cusps of the valve and locate the openings of the coronary arteries just
distal to them.
71
Physiology of the Circulatory System
The circulatory system functions to deliver oxygen and nutrients to tissues for growth and
metabolism, and to remove metabolic wastes. The heart pumps blood through a circuit that
includes arteries, arterioles, capillaries, venules, and veins. One important circuit is the
pulmonary circuit, where there is an exchange of gases within the alveoli of the lung. The right
side of the human heart receives deoxygenated blood from body tissues and pumps it to the
lungs. The left side of the heart receives oxygenated blood from the lungs and pumps it to the
tissues. With increased exercise, several changes occur within the circulatory system, thus
increasing the delivery of oxygen to actively respiring muscles cells. These changes include
increased heart rate, increased blood flow to muscular tissue, decreased blood flow to non-
muscular tissue, increased arterial pressure, increased body temperature and increased
breathing rate.
Blood Pressure
An important measurable aspect of the circulatory system is blood pressure. When the
ventricles of the heart contract, pressure is increased throughout all the arteries. Arterial blood
pressure is directly dependent on the amount of blood pumped by the heart per minute and
the resistance to blood flow through the arterioles. The arterial blood pressure is determined
using a device known as a sphygmomanomete.r This device consists of an inflatable cuff
connected by rubber hoses to a hand pump and to a pressure gauge graduated in millimeters
of mercury. The cuff is wrapped around the upper arm and inflated to a pressure that will shut
off the brachia! artery. The examiner listens for the sounds of blood flow in the brachia! artery
by placing the bell of a stethoscope in the inside of the elbow below the biceps.
At rest, the blood normally goes through the arteries so that the blood in the central part of the
artery moves faster than the blood in the peripheral part. Under these conditions, the artery is
silent when one listens. When the sphygmomanometer cuff is inflated to a pressure above the
systolic pressure, the flow of blood is stopped and the artery is silent again. As the pressure in the
cuff gradually drops to levels between the systolic and diastolic pressures of the artery, the blood
is pushed through the compressed walls of the artery in a turbulent flow. Under these conditions,
the blood is mixed, and the turbulence sets up vibrations in the artery that are heard as sounds in
the stethoscope. These sounds are known as the heart sounds or sounds of Korotkoff . The
sounds are divided into five phases based on the loudness and quality of the sounds.
Phase 1. A loud, clear tapping sound that increases in intensity as the cuff is
deflated.
Phase 2. A succession of murmurs can be heard. Sometimes the sounds seem to
disappear during this time which may be a result of inflating or deflating the
cuff too slowly.
Phase 3. A loud, thumping sound, similar to that in Phase 1 but less clear, replaces the
murmurs.
Phase 4. A muffled sound abruptly replaces the thumping sounds of Phase 3.
Phase 5. All sounds disappear.
The cuff pressure at which the first sound is heard (beginning of Phase 1) is taken as the systolic
pressure. The cuff pressure with the muffled sound (Phase 4) disappears (beginning of Phase 5). is
taken as the measurement of the diastolic pressure. A normal blood pressure measurement for a
given individual depends on a person's age, sex, heredity, and environment. When these factors
are taken into account, blood pressure measurements that are chronically elevated may indicate a
state deleterious to the health of the person. This condition is called hypertension and is a major
contributing factor in heart disease and stroke.
72
Table 1: Normal Blood Pressure for Men and Women at Different Ages
Methods
Exercise A: Measuring Blood Pressure
1. Work in pairs.
2. Attach the cuff of the sphygmomanometer snugly around the upper arm.
3. Place the stethoscope directly below the cuff in the bend of the elbow joint.
4. Close the valve of the bulb by turning it clockwise. Pump air into the cuff until
the pressure gauge goes past 200 mm Hg.
5. Turn the valve of the bulb counterclockwise and slowly release the air from the
cuff. Listen for pulse.
6. When you first hear the heart sounds, note the pressure on the gauge. This
is the systolic pressure.
7. Continue to slowly release air and listen until the clear thumping sound of the
pulse becomes strong and then fades. When you last hear the full heart beat,
note the pressure. This is the diastolic pressure.
8. Repeat the measurement two more times and determine the average systolic
and diastolic pressure, then record these values on the data sheet .
9. Trade places with your partner. Record average systolic and diastolic pressure on
the blood pressure data sheet.
73
Exercise B: A Test of Fitness
Determine the fitness level for one member of the pair (Tests 1 to 5 below) and then repeat the
process for the other member of the pair.
1. The subject should recline on a laboratory bench for at least 5 minutes. At the end of
this time, measure the systolic and diastolic pressure and record these values below.
reclining systolic pressure mm Hg reclining
diastolic pressure mm Hg
2. Remain reclining for two minutes, then stand and IMMEDIATELY repeat
measurements on the same subject (arms down). Record these values below.
standing systolic pressure mm Hg standing
diastolic pressure mm Hg
3. Determine the change in systolic pressure from reclining to standing by subtracting
the standard measurement from the reclining measurement. Assign fitness points
based on Table 2 and record the fitness data sheet.
Table 2: Changes in Systolic Pressure from Reclining to Standing
Cardiac Rate and Physical Fitness

During physical exertion, the cardiac rate (beats per minute) increases. This increase can be
measured as an increase in pulse rate. Although the maximum cardiac rate is usually the
same in people of the same age group, those who are physically fit have a higher stroke
volume(millimeters per beat) than more sedentary individuals. A person who is in poor
physical condition, therefore, reaches their maximum cardiac rate at a lower work level than
a person with of comparable age who is in better shape. Maximum cardiac rates are listed in
Table 3. Individuals who are in good physical condition can deliver more oxygen to their
muscles before reaching maximum cardiac rate than can those in poor condition.
Table 3: Maximum-Pulse Rate
Test 2: Standing Pulse Rate

1. The subject should stand at ease for 2 minutes after Test 1.
2. After the two minutes, determine your partner's pulse.
3. Count the number of beats for 30 seconds and multiply by 2. The pulse rate is the
number of beats per minute. Record this on the fitness data sheet. Assign fitness points
based on Table 4 and record them on the data sheet.
74
Table 4: Pulse Rate and Fitness Points
Test 3: Reclining Pulse Rate Procedure

1. The subject should recline for 5 minutes on the laboratory bench.
2. The other partner will determine the subject's resting pulse.
3. Count the number of beats for 30 seconds and multiply by 2. ( Note: the subject
should remain reclining for the next test!) Record it on the Data Sheet. Assign fitness
points based on Table 5 and record them on the fitness data sheet.
Table 5: Reclining Pulse Rate
Test 4: Baroreceptor Reflex (Pulse Rate Increase from Reclining to Standing)

1. The reclining subject should now stand up.
2. Immediately take the subject's pulse. Record this value below. The observed increase in
pulse rate is initiated by baroreceptors (pressure receptors)in the carotid artery and in the
aortic arch. When the baroreceptors detect a drop in blood pressure they signal the
medulla of the brain to increase the heartbeat, and consequently the pulse rate.
Pulse immediately upon standing= beats per minute
3. Subtract the reclining pulse rate (recorded in Test 3) from the pulse rate immediately
upon standing (recorded in Test 4) to determine the pulse rate increase upon standing.
Assign fitness points based on Table 6 and record on the fitness data sheet.
Table 6: Pulse Increase from Reclining to Standing
75
Test 5: Step Test- Endurance Procedure
1. Place your right foot on an 18-inch-high stool. Raise your body so that your left foot comes
to rest by your right foot. Return your left foot to the original position. Repeat these
exercise five times, allowing three seconds for each step up. (An alternative procedure
could be to quickly climb our stairs.)
2. Immediately after the completion of the exercise, measure the pulse for 15 seconds
and record below; measure again for 15 seconds and record; continue taking the
pulse and record at 60, 90, and 120 seconds.
3. Observe the time that it takes for the pulse rate to return to approximately the level as
recorded in Test 2. Assign fitness pints based on Table 7 and record them on the
fitness data sheet.
Table 7: Time Required for Return of Pulse Rate to Standing Level after Exercise
4. Subtract your normal standing pulse rate(recorded in Test 2) from your pulse rate
immediately after exercise (the 0-to 15-second interval) to obtain pulse rate increase.
Record this on the Blood Pressure Data Sheet (below). Assign fitness points based on
Table 8 and record them on the fitness data sheet.
76
Results
77
Breathing Rate and Mild Exercise
Oxygen is essential to life. We use the oxygen we breathe and the food we eat to produce
energy, which our cells can use. Physical activity increases our need for energy, increasing the
use of oxygen and nutrients.
The body can store some of the things it needs to function. Some animals have the ability to store
oxygen for long periods of time allowing them to hold their breath. However, humans can only
store oxygen for a very short period of time.
At rest, the blood holds about a quart of dissolved oxygen, but it is constantly being used by the
cells to transform energy during cellular respiration. The respiratory system must work all of the
time to supply enough oxygen to the body.
Methods
1. Determine your resting breathing rate. Sit down and breath normally. Use a clock or
stopwatch to time a 1 minute time period. During this time, count the number of times you
inhale. RECORD this information in the table in the data section.
2. Repeat Step 1 two more times. Record your trials. Calculate an average resting breathing
rate.
3. Determine your breathing rate during exercise. Run in place for 1 minute. During this
time, count the number of times you inhale. RECORD this information in the table in the
data section.
4. Repeat Step 3 two more times. Record your trials. Calculate an average breathing rate
during exercise.
5. For the last test, choose an activity that you can do for one minute (sit-ups, jumping jacks,
jump rope, standing on one foot, dance the “twist”, touching your toes, etc.). While doing
the activity, count the number of times you inhale in one minute. RECORD this information
in the data section.
6. Repeat Step 5 two more times. Record your trials. Calculate an average breathing rate.
Results
Title _____________________________________________
Trial 1 Trial 2 Trial 3 Average Range
Sitting at Rest
Running in
Place
(Record activity
here)
Bar Graph: Create a bar graph of the AVERAGES from your three activities.
• Add error bars that represent the range

• Label the axis with the variable and unit
• Add a descriptive title
78
Analysis
1. What is the relationship between breathing rate and exercise? WHY do you think your data turned
out as it did?
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
2. Did your data seem reasonable? Were there any surprises?

______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
3. List some controlled variables in your experiment.
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
79
Air Flow and Breathing Rate Data Based Questions
Remember to give units, show your calculations, and apply the rules of significant figures to
the following questions.
1- What is the breathing rate during rest?
______________________________________________________________________
2- What is the tidal volume during rest?
______________________________________________________________________
3- What is the average air flow during rest?
______________________________________________________________________
4- What is the breathing rate during exercise?
______________________________________________________________________
5- What is the vital capacity during exercise?
______________________________________________________________________
6- What is the average air flow during exercise?
______________________________________________________________________
80
Hormonal Control of the Female Reproductive System DATABASE
This investigation is another example of the use of databases in scientific investigation. You will
be emailed the Excel file MSDATA.
Data provided by Professor Paul Biscof Département de Gynécologie et d'Obstétrique Hôpital

Universitaire de Genève
The database that contains the data from 20 healthy women volunteers aged 20 to 35 years old in
Geneva, Switzerland. These women had not been taking oral contraceptives for at least 3 months
before the start of the study. Daily morning blood samples were taken on starting on the first day
of their menstrual cycle, which was determined by the start of bleeding (menses) and continued to
the first day of their next cycle.
Six hormones were measured in the blood samples:

• FSH
• LH
• Prolactin
• Oestradiol
• Progesterone
• Testostrone
Key to units:
UI = International Units
pg = picograms
ng = nanograms
The data was complemented by ultrasound scans of the volunteers’ ovaries to determine the
stage of the follicles.
Methods
Step 1: Obtain and prepare the Excel Database
Download the database from titled MSDATA.xls
Remove and empty dividing lines between volunteers (for example, line 29 and line 30)
Select the line(s), right click and select delete.
Repeat for other empty lines between the information for the twenty volunteers.
Step 2: Using an Excel Database
Return to line 1 of the database and highlight cells A to H
81
Go to Data, Filter, and then Auto filter
Small downward-pointing arrows will appear to the right in cells A to H in line 1

When you click on any one of the arrows you will obtain the following menu
Sort Ascending
Sort Descending
(All)
(Top 10….)
Custom
Followed by a list of items entered in the cells below the title cell.
Go to A1 Volunteer, click on the arrow and select 3
You have now filtered all the information concerning volunteer number 3.
82
Notice that the arrow in A1 is now a different color (in this case, blue). This indicates to you
that a filter has been used in this column.
You should also notice that the number of filtered entries is indicated in the left hand corner
of the Excel window. In this example “33 of 579 records found”.
To return to the complete database, click on the colored arrow (in this case in A1) and
select ALL.
Step 3: Using the Custom Option
This is very useful if you want to compare results, for example, those of volunteer 3 and
volunteer 7.
Return to the complete database. Click on the arrow in A1 and select Custom. A pop-up
window will appear.
Enter to information as shown below
And OK
You have now filtered the information from volunteers 3 and 7 only.
83
Now go to cell B1 and click on the arrow
Select day 8
You can now compare the results from day 8 from the two volunteers selected.
Notice that two arrows in line 1 are now colored (in this case, blue). This means that you
must click on both arrows, selecting ALL in each case, to return to the complete database.
Step 4: Sorting and Comparing
Start with the complete database.

Filter day 8 from B1
Now click on the arrow in line E1 and select Custom
When the pop-up box appears, enter “is greater than or equal to” and “10”
12 records are filtered

84
Now click on the arrow in column F1 and select Sort Descending
This allows you to compare the oestradiol levels (pg/ml) with high prolactin levels (≥ 10
ng/ml) during day 8 of the menstrual cycle from the 20 volunteers.
Questions
How many volunteers show progesterone levels greater than 1ng/ml on day 9 of menses?
____________________________________________________________________________________
Which volunteer shows FSH levels over 10UI/L during 5 days? Are these days consecutive?
____________________________________________________________________________________
Step 5: Investigation into Ovulation and Natural Birth Control (Rhythm Method)
The follicle ruptures about 36 hours after the LH peak.

Sample the database and plot the levels of LH against time.
Inspect the graphs and determine the lowest concentration that LH rises to in the peaks. If
you cannot do this, then manually determine the lowest LH peak value.
Select LH, Filter, Custom. In the dialogue box enter “greater or equal to” and enter your
figure. Press Enter.
You should now have a list of the volunteers whose level of LH went above your selected
value.
If you have two or more values from the same volunteer you will need to remove the days
that are not the greatest LH concentration for that individual. You will probably find that
some of the volunteers are missing after filtering. Why should this be? It might be worth
looking at them.
If, after filtering, you have five or less than five volunteers, you will need to lower the value
you are using.
The peaks for LH will occur on a particular day in the menstrual cycle. Ovulation occurs 36h
later.
Cut the Days from menses data and paste it under the data base.
Add 1.5 to the days column to determine the point of ovulation.
Establish the mean and standard deviation for the day of ovulation for this set of volunteers.
Mean = _____________ S = _____________
85
Problem: The rhythm method is a method of contraception which relies on calculating the “safe
period”. This is the period when there is no viable oocyte in the fallopian tube. Oocytes are
receptive to sperms for about 24h after ovulation and then die after 3 days. Authorities vary in their
estimations of how long sperm cells remain viable in the uterus and this depends greatly on
vaginal pH. Figures for sperm viability vary from as little as 1 day to as long as 7 days inside the
woman after ejaculation.
From the evidence from this data base evaluate this method of contraception.
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
Step 6: Establishing Correlation
There are a number of interactions between hormones in the cycle:
• Negative feedback controls FSH levels after they stimulate oestradiol secretion.
• There is a positive feedback between LH levels and oestradiol levels
• Testosterone is a precursor of oestradiol (testosterone is made by cells in the ovary then
converted to oestradiol).
• Prolactin is a hormone that causes breast milk production and inhibits progesterone
secretion.
Choose one of these interactions and sample the data base to see if there is sufficient
evidence to establish a correlation.
If one hormone stimulates another there should be a significant positive correlation between
their levels. If one hormone inhibits another, there should be a significant negative
correlation between their levels.
86
Internal Assessment Scoring Descriptors
Title and brief description of the investigation:
LEVELS AWARDED
Personal Engagement Exploration Analysis Evaluation Communication Total
/2 /6 /6 /6 /4 /24
Personal Engagement
LIMITED (1) SIGNIFICANT (2)
The evidence of personal engagement with the exploration is limited The evidence of personal engagement with the exploration is clear with
with little independent thinking, initiative, or creativity. significant independent thinking, initiative, or creativity.
The justification given for choosing the research question and/or the topic The justification given for choosing the research question and/or the topic under
under investigation does not demonstrate personal significance, interest, or investigation demonstrates personal significance, interest, or curiosity.
curiosity.
There is little evidence of personal input and initiative in the designing, There is evidence of personal input and initiative in the designing, implementation, or
implementation, or presentation of the investigation. presentation of the investigation.
Exploration
NOT FOCUSED/SUPERFICIAL – MARK (1-2) NOT FOCUSED BUT RELEVANT – MARK (3-4) FOCUSED/MAJOR FACTORS ADDRESSED – MARK (5-6)
The topic of the investigation is identified, and a The topic of the investigation is identified, and a The topic of the investigation is identified, and a relevant
research question of some relevance is stated relevant but not fully focused research question is and fully focused research question is clearly described.
but it is not focused. described.
The background information provided for the The background information provided for the The background information provided for the
investigation is superficial or of limited investigation is mainly appropriate and relevant and investigation is entirely appropriate and relevant and
relevance and does not aid the understanding of aids the understanding of the context of the enhances the understanding of the context of the
the context of the investigation. investigation. investigation.
The methodology of the investigation is only The methodology of the investigation is mainly The methodology of the investigation is highly
appropriate to address the research question to appropriate to address the research question but appropriate to address the research question because it
a very limited extent since it takes into has limitations since it takes into consideration takes into consideration all, or nearly all, of the significant
consideration few of the significant factors that only some of the significant factors that may factors that may influence the relevance, reliability, and
may influence the relevance, reliability, and influence the relevance, reliability, and sufficiency sufficiency of the collected data.
sufficiency of the collected data. of the collected data.
The report shows evidence of limited awareness The report shows evidence of some awareness of The report shows evidence of full awareness of the
of the significant safety, ethical or environmental the significant safety, ethical or environmental significant safety, ethical or environmental issues that are
issues that are relevant to the methodology of issues that are relevant to the methodology of the relevant to the methodology of the investigation*.
the investigation*. investigation*.
*This indicator should only be applied when appropriate to the investigation.
87
Analysis
INSUFFICIENT/INCOMPLETE – MARK (1-2) RELEVANT/INCOMPLETE – MARK (3-4) FOCUSED/MAJOR FACTORS ADDRESSED – MARK (5-6)
The report includes insufficient relevant raw The report includes relevant but incomplete quantitative The report includes sufficient relevant quantitative and
data to support a valid conclusion to the and qualitative raw data that could support a simple or qualitative raw data that could support a detailed and valid
research question. partially valid conclusion to the research question. conclusion to the research question.
Some basic data processing is carried out Appropriate and sufficient data processing is carried out Appropriate and sufficient data processing is carried out with
but is either too inaccurate or too that could lead to a broadly valid conclusion but there the accuracy required to enable a conclusion to the research
insufficient to lead to a valid conclusion. are significant inaccuracies and inconsistencies in the question to be drawn that is fully consistent with the
processing. experimental data.
The report shows evidence of little The report shows evidence of some consideration of the The report shows evidence of full and appropriate consideration
consideration of the impact of measurement impact of measurement uncertainty on the analysis. of the impact of measurement uncertainty on the analysis.
uncertainty on the analysis.
The processed data is incorrectly or The processed data is interpreted so that a broadly valid The processed data is correctly interpreted so that a completely
insufficiently interpreted so that the conclusion but incomplete or limited conclusion to the research valid and detailed conclusion to the research question can be
is invalid or very incomplete. question can be deduced. deduced.
Evaluation
NOT RELEVANT/SUPERFICIAL – MARK (1-2) SOME RELEVANCE/DESCRIPTIONS – MARK (3-4) FULLY JUSTIFIED/DESCRIBED/RELEVANT– MARK (5-6)
A conclusion is outlined which is not relevant A conclusion is described which is relevant to the A detailed conclusion is described and justified which is
to the research question or is not supported research question and supported by the data presented. entirely relevant to the research question and fully supported
by the data presented. by the data presented.
The conclusion makes superficial comparison A conclusion is described which makes some relevant A conclusion is correctly described and justified through
to the accepted scientific context. comparison to the accepted scientific context. relevant comparison to the accepted scientific context.
Strengths and weaknesses of the Strengths and weaknesses of the investigation, such as Strengths and weaknesses of the investigation, such as
investigation, such as limitations of the data limitations of the data and sources of error, are limitations of the data and sources of error, are discussed and
and sources of error, are outlined but are described and provide evidence of some awareness of provide evidence of a clear understanding of the
restricted to an account of the practical or the methodological issues involved in establishing the methodological issues involved in establishing the
procedural issues faced. conclusion. conclusion.
The student has outlined very few realistic The student has described some realistic and relevant The student has discussed realistic and relevant suggestions
and relevant suggestions for the improvement suggestions for the improvement and extension of the for the improvement and extension of the investigation.
and extension of the investigation. investigation.
Communication
UNCLEAR WITH ERRORS – MARK (1-2) CLEAR AND ERRORS DO NOT HAMPER UNDERSTANDING – MARK (3-4)
The presentation of the investigation is unclear, making it difficult to The presentation of the investigation is clear. Any errors do not
understand the focus, process, and outcomes. hamper understanding of the focus, process, and outcomes.
The report is not well structured and is unclear: the necessary information on focus, The report is well structured and clear: the necessary information on focus, process
process and outcomes is missing or is presented in an incoherent or disorganized way. and outcomes is present and presented in a coherent way.
The understanding of the focus, process and outcomes of the investigation is The report is relevant and concise thereby facilitating a ready understanding of
obscured by the presence of inappropriate or irrelevant information. the focus, process, and outcomes of the investigation.
There are many errors in the use of subject specific terminology and conventions*. The use of subject-specific terminology and conventions is appropriate and
correct. Any errors do not hamper understanding.
88
IA Lab Final Draft Possible Format
The IB has no required format. This is just one that I found that you could
possibly use. It is up to you to decide on the best format to describe your
investigation.
Delete all the writing in italics/red & use the entire regular font/underlined as your section headings &
subheadings.
Formatting – font: 12pt , Times New Roman; between sections double spaced, within sections single
spaced; every diagram, table, figure must be given a number and title; pages numbered; decent size
margins so I can leave comments; written from 1st person perspective.
TITLE
Introduction
The topic of the investigation is identified, and a relevant and fully focused
research question is clearly described.
The background information provided for the investigation is entirely appropriate
and relevant and enhances the understanding of the context of the investigation.
The methodology of the investigation is highly appropriate to address the
research question because it takes into consideration all, or nearly all, of the
significant factors that may influence the relevance, reliability, and sufficiency of
the collected data.
The report shows evidence of full awareness of the significant safety, ethical or
environmental issues that are relevant to the methodology of the investigation.
Research Question: (as an aim or in question form) Make it focused, as taught in class.
Hypothesis: (optional)
H1 Alternate hypothesis: explaining rationale for your hypothesis with

citations H0 Null hypothesis: state that your treatment has no effect
Table 1: Variables Selected for this Experiment

Units Range
Independent Variable
Dependent Variable
Control Variables Units (e.g. g, ºC, mm) Possible effect on results
Background Information:
a) Try to include known values / expected results from literature/websites
b) Include what you may have learned from a similar lab
c) If you are going to include diagrams make sure you give them a fig # & descriptive title.
d) Include references from articles or books.
e) Place your experiment in context. Why is it important to get to the bottom of this?
89
Methodology (procedure):
a) Plan to collect between 3 and 10 replications, depending on the design.
b) Be specific, but do not include things like, “collect materials” or “prepare to collect
data” or “wash glassware after experiment”. These steps are part of every
experiment.
c) Writing a paragraph is best; it is how scientists usually write. You may use a
numbered list though
Safety, ethical or environmental issues:

a) How might you or someone else be injured during your data collection?
b) Especially if you are using human or any small animals, what steps are you
going to take to make sure that you will fully respect animal life and health?
c) Will your experiment have an impact on the environment? How will you
minimize/eliminate any negative effects?
Analysis
The report includes sufficient relevant quantitative and qualitative raw data that
could support a detailed and valid conclusion to the research question.
Appropriate and sufficient data processing is carried out with the
accuracy required to enable a conclusion to the research question to be drawn that
is fully consistent with the experimental data.
The report shows evidence of full and appropriate consideration of the impact of
measurement uncertainty on the analysis.
The processed data is correctly interpreted so that a completely valid and
detailed conclusion to the research question can be deduced.
Raw Data
a. Headings and units are included and are correct.
b. Where relevant uncertainties are included in table headings.
c. Uncertainties are consistent (same number of significant figures) with the raw data.
d. There is no variation in the precision of the raw data e.g. significant figures are all
the same & they reflect the precision of the instrument.
e. Include observations that do not involve numbers, these are very important too
Table 2: Title of raw data table
Processing Raw Data

Processes the quantitative raw data correctly.
a. Processes raw data, if necessary, into a form suitable for graphical representation
e.g. combing & manipulating the data.
b. Plots a suitable ‘best-fit’ line graph or bar graph
c. Recording & processing of data may be shown in the one table BUT they
must be clearly distinguishable.
Table 3: Title (should include the independent and dependent variables, printout from
Excel/Sheets/Word)
Presenting Processed Data
Presents processed data appropriately and, where relevant, includes errors and
uncertainties.
a. If you are comparing a relationship between parameters then a graph will be most
appropriate as it provides a visual representation of the data
a. Both axes labelled and include the correct units
b. At least 70% of the graph paper is used.
c. Points are plotted accurately
d. Error bars are drawn for at least one variable or line of best fit is included.
90
EVALUATION
• A detailed conclusion is described and justified which is entirely
relevant to the research question and fully supported by the data
presented.
• A conclusion is correctly described and justified through relevant
comparison to the accepted scientific context.
• Strengths and weaknesses of the investigation, such as limitations of
the data and sources of error, are discussed and provide evidence of a
clear understanding of the methodological issues involved in
establishing the conclusion.
• The student has discussed realistic and relevant suggestions for the
improvement and extension of the investigation.
Concluding
States a conclusion, with justification, based on a reasonable interpretation of

the data.
a. The relationship between the variables is correctly stated.
b. Students must justify their conclusion and note any systematic or
unforeseen random uncertainties (anomalies).
c. Connects to the research question, and hypothesis.
Strengths and Weaknesses
Evaluates weaknesses and limitations.
a. Comments on the overall ‘quality’ of the procedure used and data collected.
b. Significant weaknesses and limitations in the process, equipment used, and
management of time are identified.
c. Has some appreciation of the significance of each weakness.
d. Aim for identifying 3 weaknesses/limitations.
Improving the Investigation
Suggests realistic improvements in respect of identified weaknesses and

limitations.
a. Weaknesses and limitations identified earlier are addressed.
b. Realistic improvements are suggested.
c. Suggestions state exactly what should be done to reduce random
uncertainties or to improve the quality of the data.
d. Suggestions on how to remove systematic uncertainties, if present, are made.
Bibliography or Works Cited

Make an alphabetized list of any sources that you used. 3 sources minimum, but 8 to 10 is
typical.
91
Extraction of DNA from an Onion
The structure of DNA was discovered in the 1950’s. DNA is a chemical named deoxyribonucleic
acid. Because it is a chemical, we can do reactions with it just like any other chemical. In this lab,
we will use the chemical properties of DNA to extract it from the cells of onions.

• The chemicals used are not hazardous and can be disposed in the sink.
Materials
• Flasks
• Mortar and pestle
• Beakers
• Graduated cylinders
• Cheese cloth or gauze
• Test tube and rack
• Stirring rod
Methods
1. Prepare a buffer solution by pouring the following into a clean flask:
• 20.0 cm3 of water
• 0.25 g of sodium chloride
• 1.0 g of sodium hydrogen carbonate
• 0.5 g of detergent powder
Purpose of the buffer solution:
The saltiness and acidity (pH) of the solution is very close to that in living things; as a result,
the DNA will like to dissolve into this solution. The detergent is added to help break down
the cell membrane.
2. Chill the buffer solution by placing the flask in a larger beaker filled with crushed ice and
water.
3. Dice half an onion with a knife. Use a mortar and pestle to mash the pieces into a pulpy
sludge. Add water if there is not enough liquid produced by the onion.
Purpose of onion mashing:
This breaks the cell walls, releasing the DNA into the liquid.
92
4. Place about 10 cm3 of the mashed onion solution (don’t add solids) into a small, clean
beaker and mix in the chilled buffer solution. Stir vigorously with a stirring rod for three
minutes. Squeeze the mashed liquid through gauze or cheese cloth to get all the liquid.
5. Pour this liquid into a clean test tube. Let the test tube sit in a crushed ice/water bath for
five minutes. In this time, the solids should settle to the bottom of the test tube, and the top
should mainly be liquid.
6. Decant the solution into another clean test tube, so that the remaining solids are removed.
7. Obtain some ice-cold isopropyl alcohol from the ice bath. Tilt the test tube and gently pour
the alcohol until there is about 3 cm sitting above the buffer solution. Your goal is to have
the alcohol stay on the top of the DNA solution as a separate layer with as little mixing as
possible.
8. Very gently insert a glass rod through the upper alcohol layer in the test tube into the DNA
containing buffer solution. While disturbing the solution as little as possible, leave the glass
rod or stirrer in one place and rotate it in one direction. If done correctly, the DNA
fragments will wind onto the rod in the same way that thread winds onto a spool.
Purpose of the glass rod
DNA spools onto the glass rod because it is polar. Glass is also polar, so the ends of the DNA are
attracted to the stirrer.
9. After twirling the stick several times, pull the stirrer up through the alcohol layer. You
should see the DNA adhere to the end of the stick and appear as clear or white with a
string-like texture, like the image below. The molecule that you have collected on this stick
consists of the entire genome of the onion.
Purpose of the alcohol layer

When you pull the DNA through the nonpolar alcohol layer, it clumps together because it is polar.
10. Clean up: All solutions can go down the sink, while the onion goo should be wrapped in a
paper towel and thrown in the garbage.
Qualitative Observations
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
93
DNA Barcoding DATABASE
1. Research the cytochrome c oxidase enzyme complex. Google “cytochrome c oxidase” (one
of its subunits is called CO1). Wikipedia is good enough for this answer.
a) State specifically where it is found and describe its specific activity.

______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
b) Read the section on “Structure.” in Wikipedia’s article. Explain briefly the level of protein
structure for the protein complex as seen in the diagrams. State the two types of
secondary structure seen in the diagrams.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
2. Research mitochondrial DNA (mtDNA), state its location, and describe its evolutionary origin
and inheritance in most multicellular organisms. Again, the Wikipedia response is good
enough for this answer.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
3. Go to the website http://ccdb.ca and click on the “About us” tab at the top of the page.
State what the CCDB is best known for.

______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
4. Click on the “Solutions” tab at the top of the page. Scroll down to “International Barcode of
Life” (iBOL) and read the paragraph.
State what iBOL participants gathered within 5 years.

______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
94
5. Click on the title “International Barcode of Life” which opens a new website http://ibol.org.
Hover over “About Us” in the top menu bar and click on “What is DNA Barcoding?”
a) Outline how DNA barcodes can be used like UPC barcodes.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
b) Describe the gene region being used for DNA barcoding.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
c) State the advantages of using CO1 (Cytochrome Oxidase 1).
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
d) State why CO1 cannot be used in plants and state where genes that may be used for DNA
barcoding have been located in plants.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
6. On the same page, read “The Barcode Production Pipeline.”
List the four steps in the technique used to obtain a DNA barcode from a tissue sample.
1.
2.
3.
4.
7. Go back to http://ibol.org. Scroll down to the “Building the Barcode Library” article and click
on “Learn more”.
a) State what BOLD stands for.
______________________________________________________________________________
95
b) State what BOLD is used for.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
So why is all of this important?

8. Read the article DNA Barcoding: Cracking Down on Bushmeat. (It will be delivered as a
pdf file) Explain how this technology may be used to stop the trade in illegal bushmeat and
other animal parts.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
9. Suggest three other applications, not outlined on this assignment, for the use of DNA
barcodes. Information under the “Solutions” tab at http://ccdb.ca will help here.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
10. Use the BOLD Systems to search for DNA barcodes and identify species. If an individual is
attempting to bring some feline pelts through customs, you can find out if any of these may
be endangered species and if trade in the pelts is or may be illegal.
a) Go to http://www.barcodinglife.org or http://www.boldsystems.org .
b) Click on “Identification” in the top menu bar.
c) The second bullet, “Species Level Barcode Records”, should be selected.
d) The (FASTA) sequences for two ‘unknown’ COI gene samples are below. (You will also
receive an electronic copy)
FASTA sequence 1
AACCGCTGACTATTTTCAACCAATCACAAAGATATTGGAACTCTTTACCTTCTAT
TTGGTGCCTGGGCTGGCATGGTGGGGACTGCTCTC---
AGTCTCTTAATCCGAGCCGAACTGGGTCAACCTGGCACACTGCTAGGGGAC---
GACCAAATTTATAATGTAGTCGTTACCGCCCATGCTTTTGTAATAATCTTCTTTA
TAGTAATGCCCATCATGATTGGAGGATTCGGAAACTGATTGGTCCCATTAATA--
-
ATTGGAGCCCCCGATATAGCATTCCCTCGAATGAATAATATGAGCTTTTGACTC
CTTCCCCCATCTTTCCTACTTTTGCTCGCATCATCTATGGTAGAGGCTGGGGCA
GGAACTGGATGAACAGTATACCCACCCCTAGCCGGCAACCTAGCCCATGCAG
GGGCATCCGTAGATTTA---
ACTATTTTTTCACTACACCTGGCAGGTGTCTCCTCAATCTTAGGCGCTATTAATT
TTATTACTACTATTATTAATATAAAACCCCCTGCTATATCCCAATACCAAACACC
TCTATTCGTCTGATCGGTCTTAATCACTGCTGTATTGCTACTCCTATCACTGCC
AGTTTTAGCAGCA---
GGCATCACTATGCTACTGACAGATCGAAATCTGAACACCACATTCTTTGACCCT
GCCGGAGGGGGGGATCCTATCTTATACCAGCACCTATTCTGATTTTTTGGTCA
CCCAGAAGTTTATATTTTAATTTTACCCGGGTTCGGAATAATTTCACACATTGTC
ACCTATTACTCAGGTAAAAAA---
GAGCCTTTTGGCTATATGGGAATAGTTTGAGCTATAATATCGATTGGCTTCCTG
GGCTTTATCGTGTGAGCCCACCACATGTTTACTGTAGGAATAG
96
FASTA sequence 2
AACCGCTGACTATTTTCAACTAACCATAAAGATATTGGAACTCTTTACCTTTTAT
TTGGCGCTTGGGCCGGTATAGTAGGGACTGCTCTT---
AGTCTTTTAATTCGAGCTGAGCTGGGTCAACCTGGCACGCTACTAGGGGAT---
GACCAGATTTATAATGTAGTCGTCACTGCTCATGCCTTCGTAATAATCTTTTTTA
TAGTAATACCCATTATGATTGGAGGGTTTGGAAACTGACTGGTCCCATTAATA---
ATTGGGGCCCCCGACATAGCATTCCCTCGAATAAATAACATAAGCTTCTGACTC
CTTCCTCCGTCTTTCCTACTTTTGCTCGCATCGTCTATAGTAGAGGCCGGGGC
AGGAACTGGGTGGACAGTGTACCCGCCCCTAGCCGGCAATCTGGCCCATGCA
GGAGCATCTGTAGACTTG---
ACTATCTTTTCACTACATCTAGCGGGTGTTTCCTCTATCCTGGGCGCTATTAATT
TTATTACTACTATTATTAATATAAAACCTCCTGCCATATCTCAATACCAAACACC
ACTATTTGTCTGATCAGTCTTAATCACTGCTGTATTACTGCTTTTATCACTGCCA
GTTCTAGCAGCA---
GGTATTACTATGCTACTGACAGATCGAAATTTAAATACTACATTTTTCGACCCTG
CTGGGGGAGGGGACCCTATCCTATATCAACACTTATTCTGGTTTTTCGGTCATC
CAGAGGTTTATATTTTAATTTTACCCGGGTTTGGAATAATTTCACATATCGTCAC
CTACTACTCCGGTAAAAAA---
GAGCCTTTTGGCTATATGGGAATGGTTTGAGCTATAATGTCAATTGGCTTTCTG
GGCTTTATCGTATGAGCTCACCATATGTTTACTGTAGGAATAG
e) For the first sample, copy and paste the first sequence into the box where it states
“Enter sequences in FASTA format.”
f) Click the “Submit” button.
g) On the resulting page, use the information under the “Identification Summary” sub-title
to complete the following table for the first sequence.
h) Repeat steps (a) to (g) for the second FASTA sequence.
Table 1. Identification Summary for the FASTA sequences and probability of
placement
First Sequence Second Sequence
Taxonomic Level
Taxon Assignment Prob. Taxon Assignment Prob.
phylum
class
order
family
genus
species
i) Research the common name of each animal identified above, where it lives, and its
conservation status (ie. endangered, threatened, etc.) Explain if this animal can legally be
hunted and if trade for its pelt or other body parts would be legal or not.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
97
Evaluating Metabolism and Health
One of the objectives of the course is to have students “Evaluate claims about diet and health”.
According to the IB, to evaluate something is to assess the implications and limitations.
There are many popular claims about diet and health. If you go to a supermarket you can find
many products or supplements that claim to be healthy or have properties that benefit a person.
There are many popular diets. Some diets encourage one type of food and discourage others,
claiming health benefits and/or weight loss. Are these claims supported by evidence? In today’s
activity, we will use a database of studies to try and find out.
Methods
Step 1- Explore and Find Something of Interest
Go to the following databases and spend 5 minutes each exploring the site.
http://agricola.nal.usda.gov/
http://www.ncbi.nlm.nih.gov/pubmed
Step 2- Formulate a Research Question
What is the effect of (diet/ supplement/ vitamin/ food group/ etc.) on (weight loss/ cancer rate/
mental function/ Alzheimer’s disease/ etc.)?
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Step 3- Find research studies that relate to your question
Find several studies. What are the conclusions? Does one study contradict another?
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
98
Step 4- Critically Evaluate the Studies
Are you convinced by the study? Were their methods controlled? Was the study of a large
sample? Do the results of the study apply to all populations? Are the authors reputable? Who
funded the study? Are they reputable?
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Step 5- Conclusion
Come to an answer about your research question. Share this with the class.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
99
Inhibition of Catechol Oxidase in Banana by Heavy Metals
When some fruit and vegetables are damaged, they turn brown. This is due to an enzyme called
catechol oxidase. This enzyme acts on its substrate catechol to form a yellow compound which
then reacts with oxygen in the air to form brown melanin pigments. The more active the enzyme,
the stronger the brown coloration.
Catechol → yellow pigment → brown MELANIN
catechol oxygen in
oxidase air
You are going to extract the catechol oxidase from banana and mix it with varying concentrations
of lead which is thought to inhibit the enzyme. A control tube will also be present. The experiment
is carried out in the presence of a buffer solution. Such solutions are used to try and prevent
changes in pH. Measuring the intensity of the brown colour formed at the end of the experiment
will indicate how active the enzyme is and thus how much the volume of lead added has inhibited
the enzyme.

• Take great care while using the lead ethanoate solution. It is TOXIC!
• Wear goggles and aprons at all times.
• Dispose of chemical waste in the designated waste container, not the sink.
Part 1 - Extracting the enzyme

You are going to extract the catechol oxidase from banana and mix it with varying concentrations
of lead which is thought to inhibit the enzyme. A control tube will also be present. The experiment
is carried out in the presence of a buffer solution. Such solutions are used to try and prevent
changes in pH. Measuring the intensity of the brown colour formed at the end of the experiment
will indicate how active the enzyme is and thus how much the volume of lead added has inhibited
the enzyme.
Materials
• 8 g banana (a slice of banana about 1cm thick)
• a little sand
• 25 cm3 distilled water
• mortar and pestle
• piece of muslin
• small beaker
• centrifuge tube
Methods
1. Mix the banana, sand and water together thoroughly using a mortar and pestle.
2. Strain the mixture through muslin into a beaker.
3. The enzyme, catechol oxidase, is present in the clear liquid in the beaker.
4. Very occasionally it may be necessary to pour the beaker contents into a centrifuge tube
and centrifuge for about 3 minutes until all small fragments of fruit have settled at the bottom
of the tube.
100
Part 2 – The experiment
Materials
• marker pen • 5 boiling tubes
• buffer solution pH 7 • 5 test tubes
• 0.09 M (1%) catechol solution • 2 x 1 cm3 pipettes
• 0.13 M (5%) lead ethanoate (lead (II) • colour chart
acetate) solution • test tube rack
• 2 x 10 cm3 syringes • 5 filter funnels
• 5 filter papers (No. 6) • goggles and gloves
Methods
1. Label 5 boiling tubes A, B, C, D and E.
2. With reference to the table below, add varying volumes of buffer solution and lead ethanoate to
each tube using the 10 cm3 syringe
Test tubes A B C D E
Volume of
10 9 8 5 2
buffer/ cm3
Volume of
Lead
0 1 2 5 8
Ethanoate/
cm3
3. Add 1 cm3 of catechol solution to each boiling tube. The catechol is a substrate for the enzyme to
act on.
4. Finally, add 1 cm3 of the enzyme, catechol oxidase, extracted from the banana to each boiling tube.
5. Filter the contents of each test tube with the No. 6 filter papers. These high-quality filter papers are
required to remove the very fine precipitate formed during the experiment.
6. a) The intensity of the yellow color formed can be measured using a colorimeter.
b) Alternatively, if the SAPS color chart below is used to estimate the results, put the test tubes to
the side till next day to allow the brown melanins to form. If results are required sooner, mixing the
test tube contents with air will speed up melanin formation.
101
Results
Draw up a table of results using correct headings and appropriate units. Present these results as a graph
with suitable scales and axes labelled with quantities and units. The volume of lead ethanoate added will
form the horizontal x-axis, % transmission will be on the vertical y-axis.
102
Germination Rate and Salinity
Fact: “Seawater is about 3.4% salt by weight, and it has probably been less than 4% as far back
as we have data. If it ever rose to more than 6%, all life in the sea (except possibly some
archaebacteria) would be killed.” (Miller)
*Purpose To determine the level of salinization that will inhibit mung bean seed germination.
Materials
NaCl solution (10% by volume), water, petri dishes, graduated cylinders, beakers, mung bean
seeds, paper towels, foreceps, hand lenses, stirring rods, electronic balance, labeling stickers.
When diluting a solution, remember the formula V1C1 = V2C2 (Volume 1 x Concentration 1 =
Volume 2 x Concentration 2)
Methods
Design an experiment which will quantitatively display the relationship between salt concentration
and seed germination and growth. Write as a numbered set of directions. Include quantities of
materials used. Be specific. Remember that the goal for this section is to make the directions so
clear that a total stranger could replicate your experiment perfectly. (Replicability!) Be sure to
include a control with your experiment. Be sure to include a description of how you will determine
a change in germination.
103
Results
Create a meaningful chart, graph, and/or table to record your findings in a clear manner.
Analysis
1. Identify the independent and dependent variables in your methods
______________________________________________________________________________
______________________________________________________________________________
2. Identify the factors which were held constant between the control and experimental groups.
______________________________________________________________________________
______________________________________________________________________________
3. Explain why you chose to work with the particular salt solutions that you did. How did they
reflect real-world situations?
______________________________________________________________________________
______________________________________________________________________________
4. Describe one real life situation in which salinity might change dramatically within an
ecosystem.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
104
Transpiration of a Plant Using a Potometer
You will be working in groups of two or three for this experiment.
Methods
1. Obtain a plastic tub and fill it full of water.
2. Push the tip of a 1 cm3 pipette into one end of the rubber tubing.
3. Take the rubber tubing-pipette combination and place the free-end of the tubing into the
basin. Using a pipette bulb, pull water up into the pipette through the tubing. Watch for any
bubbles. If bubbles form, you will need to flush out the water and start over.
4. Fill the pipette up to the 0 mark and leave the pipette bulb on the pipette.
a) VERY IMPORTANT: During the following steps, the cut end of the plant must always
be under water and not exposed to air. If the end comes out of the water, a small air
bubble will be trapped in the end and the plant will not be able to draw up water as
efficiently. If this happens, you must cut off the end again about an inch up the stem.
5. Select a bean seeding. These plants have been growing for about three weeks. Try to find
a plant with a stem about the inside diameter of the rubber tubing, and pull the plant out by
the roots, if possible.
6. Rinse the dirt off the roots in the bucket indicated by your instructor.
7. Place the roots in your basin of water.
8. While keeping the roots and lower stem of your plant under water in the basin, cut off the
stem at an angle (see below), approximately 3 cm from the roots.
LEAVE THE CUT END OF THE PLANT UNDER WATER!
9. Stick the stem of the bean plant into the submerged rubber tubing. The diameter of your
plant stem should just fit into the rubber tubing.
10. Remove the rubber tubing-pipette-plant apparatus from the basin. Quickly smear a layer of
lubricant (Vaseline) around the area where the plant’s stem and the rubber tubing come
together. This procedure will produce a watertight seal.
105
11. Tighten the rubber tubing-plant connection in one clamp and the rubber tubing-pipette
connection in the other clamp, bending the tubing into a “U” shape as in Figure 2. During
this set up, make sure that the stem of the plant is always in contact with water. In addition,
make sure that the water column is not moving up into the pipette bulb.
12. Remove the pipette bulb and watch the water level. If you have a watertight seal, the level
of water in the pipette should not change. If the water level drops, check with your
instructor to see what you should do next. You may have to return to step 8.
13. If you have a watertight seal, expose your plant to the experimental conditions your group is
working with, and allow the potometer to stabilize for about 5 minutes before you begin your
readings.
a) Control – place the potometer on the lab bench away from direct light or heat.
b) Wind – place the potometer in front of a small fan that is on low speed
c) Heat & intense light – place the potometer in front of a desk lamp
d) Dark – place the potometer in a dark closet or cabinet
e) Colored light – place the potometer in front of a lamp that has a piece of colored
transparent film in front of it. Different colors of film can be used; green, red, blue,
yellow.
14. Read the water level in the pipette at time zero and continue recording readings every 10
minutes for 60 minutes.
15. After you have completed your measurements, remove the plant from the tubing.
16. Download a leaf area app (Search “Leaf Area Free”) and use to determine the surface area
of the leaves used in the experiment.
106
Results
107
Linkage in Sordaria
In this investigation you are going to investigate the results of meiosis and crossing over in two
distinct strains of Sordaria fimicola, an ascomycete fungus.
Methods
1. Examine the images below. The plates in these images were inoculated by placing small
pieces of agar containing mycelia from both black (+) and tan (tn) spored parental strains at
four positions on the plate. Note the fuzzy appearance on the plate surface; this is the
fungal mycelium composed of highly branched filaments containing haploid nuclei. Because
the spore color genes affect melanin production and deposition in the cell walls of the
mycelium as well as the spores, you should be able to see a difference in the color of the
mycelia on different regions of each plate.
2. Note the many small black objects on the surface of the agar. These are the perithecia or
spore-dispersal organs of the fungus. Each contains numerous asci, in various stages of
development. On these plates, mycelia from two genetically distinct strains have grown
together, mating and producing perithecia, each containing numerous asci. This cross is
symbolized as: t x t+ where t = tan spores and t+ = wild (black) spores: The ordering of the
ascospores within this ascus reflects the arrangement of homologous chromosomes during
metaphase I, and will reveal when crossing over between the locus of these alleles and the
centromere occurred. Examine the diagrams below.
Formation of
non-crossover
asci
Formation of crossover asci
Formation of
crossover asci
108
3. Examine images of squashed perithecia, which have ejected their asci in a radial
arrangement, like the spokes of a wheel. You need to classify the asci according to the
order of black and tan spores in each ascus. You need to count a total of at least 100 asci
to get a large enough sample for analysis. Record your results below.
a. bbtt refers to an asci with 4 black and 4 tan ascospores in that order
b. ttbb has 4 tan and 4 black ascospores in that order
c. btbt has 2 black, 2 tan, 2 black, and 2 tan ascospores in that order
d. tbtb has 2 tan, 2 black, 2 tan, and 2 black ascospores in that order
e. tbbt has 2 tan, 4 black, and 2 tan ascospores in that order
f. bttb has 2 black, 4 tan, and 2 black ascospores in that order
Results
Tetrad Analysis in Sordaria fimicola
Genotype Tally Marks Total
bbtt
ttbb
tbtb
btbt
tbbt
bttb
Total Asci
Counted
Data processing
bbtt
Ratio = _______
ttbb
bttb + tbbt + tbtb + btbt

% Crossover Asci = x 100 = _____
total asci
% Crossover Asci
Distance between Centromere and Locus of Tan Gene = = ______
2
Conclusion
Actual Value - Observed Value
Percent
State the Error =map distance. _______________________
calculated x 100 = _______
Actual Value
Evaluation
Published results indicate that the actual map distance is 26 map units Calculate your percent
error from this value..
109
Hardy-Weinberg Equilibrium MATHMATICAL MODEL
p2 + 2pq + q2 = 1
p+q=1
Evolution occurs in populations of organisms and involves variation, heredity, and selection.
One way to study evolution is to examine micro-evolution, evolution at the level of allele
frequencies.
This investigation will help you understand and develop the skill of modeling biological
phenomena with computers. Mathematical models and computer simulations are tools used to
explore the complexity of biological systems that might otherwise be difficult or impossible to
study.
Building a Simple Mathematical Model

The real world is complicated. To penetrate that complexity using model building, you must make
reasonable, simplifying assumptions about complex processes.
Any model is a simplification of the real world. For that reason, you need to constantly evaluate
the assumptions you make as you build a model, as well as evaluate the results of the model with
a critical eye. This is a powerful benefit of using models — it forces you to think deeply about an
idea.
Determine the Assumptions

For this model, we assume that all the organisms in the hypothetical population are diploid. This
organism has a gene locus with two alleles — A and B. (A and a are difficult to work with in a
spreadsheet) Assume that the population has all the alleles in the population for this gene.
Gametes for the next generation are selected totally at random and individuals survive with equal
probability. The population does not experience immigration or emigration. Later, you will need
to evaluate the assumptions used in your model.
Figure 1: Life stages of a population of organisms.

110
Methods
Part I
1. To create the initial model, first define a couple of variables.
p = the frequency of the A allele

q = the frequency of the B allele
2. Open an Excel® spreadsheet.
3. In cell D2, enter a value between 0 and 1.0 for the frequency of the A allele.
4. Because all the alleles in a population are either A or B for a given trait, the Hardy-
Weinberg equation p + q = 1 applies, therefore in cell D3, enter the formula to calculate the
value of q.
=1-D2
5. Your spreadsheet should now look like Figure 2.
Figure 2
6. Explore the very important spreadsheet function- random number generator. In a nearby
empty cell, enter the function below-
=Rand()
Note that the parentheses in the equation above have nothing between them. After hitting
enter, what do you find in the cell? Click the CALCULATE NOW (FORMULAS TAB) button or
F9 several times to force recalculation. What happens to the value in the cell?
_____________________________________________________________________________
The RAND function returns random numbers between 0 and 1 in decimal format. This is a
powerful feature of spreadsheets. It allows us to enter a sense of randomness to our model if
needed. What part of our model requires randomness?
_____________________________________________________________________________
7. Delete the contents of the cell used in step six.
8. Select two gametes from the gene pool. In cell E5, generate a random number, compare it
to the value of p, and then place either an A gamete or a B gamete in the cell. You need
two functions to do this, The RAND function and the IF function. The function to be entered
in cell E5 is
=IF(RAND()<=D$2,”A”,”B”)
Be sure to include the “$” in front of the 2 in the cell address D2. It will save time later when
you build onto this spreadsheet.
111
The formula in this cell says-
if a random number between 0 and 1 is less than or equal to the value of p, then put an A
gamete in this cell, or if it is not less than or equal to the value of p, put a B gamete in this
cell.
9. Copy the formula from E5 into F5 and recalculate your spreadsheet. If you have entered the
functions correctly in the two cells, you should see changing values in the two cells. (This is
part of the testing and retesting that you do while model building.) Your spreadsheet
should look like Figure 3.
Figure 3
10. Try recalculating 10 times and answer the questions below.
What are the initial p and q values that you entered in your spreadsheet? ______ ______
Estimate the average number of A and B alleles in your 10 trials. __________ __________
Do both cells change to A and B in the ratios you’d expect from your p value?
_____________________________________________________________________________
11. Change the initial p value to 0.8 and recalculate 10 times. Answer the questions below.
Estimate the average number of A and B alleles in your 10 trials. __________ __________
Do both cells change to A and B in the ratios you’d expect from your initial p value?
_____________________________________________________________________________
12. Reset the initial p value to 0.5. Then copy the two formulas in E5 and F5 down for 20 rows
to represent gametes from the gene pool that will form zygotes in the next generation. To
copy the formulas, click on the bottom right-hand corner of the cell and, with your finger
pressed down on the mouse, drag the cell downward. Your spreadsheet should look like
Figure 4, except with 20 offspring.
Figure 4
112
13. The zygotes that would form from the fusion of the selected gametes will go in cell G5. The
zygote is a combination of the two randomly selected gametes. In the spreadsheet, you
want to add the two gametes across the row. In spreadsheet vernacular, you want to
concatenate the values in the two cells. In cell G5 enter the function
=CONCATENATE(E5,F5)
Copy this formula down as far down as you have gametes, as in Figure 5.
Figure 5
14. The H, I, and J columns will be used for keeping track of the numbers of each zygote’s
genotype. They are complex functions that use IF function to count the different genotypes
of the zygotes. The function in cell H5 is
=IF(G5=”AA”,1,0)
This means- if the value in cell G5 is AA, then put a “1” in the cell; if not, then put a “0”.
15. Enter the similar function in cell J5.
=IF(G5=”BB”,1,0)
16. Insert a nested IF function. This is needed because the heterozygous AB and BA
genotypes are equivalent. In cell I5 enter the nested function.
=IF(G5=”AB”,1,(IF(G5=”BA”,1,0)))
Copy these three formulas down for all the rows in which you have produced gametes.
17. Enter the labels for the columns in cell H4, AB in cell I4, and BB in cell J4, as shown in
Figure 6.
Figure 6
113
18. Recalculate several times to test if the model is working as expected.
19. Calculate the sum of the AA genotypes in column H by entering the following formula in cell
H25
=SUM(H5:H24)
Calculate the sum of the AB and BB genotypes in columns I and J using the same formula in
cells I25 and J25, respectively. Enter the label for the calculations you’ve been working on, as
in Figure 7.
Figure 7
20. Calculate the number of each allele A and B in cells H28 and I28, respectively. Because
each homozygous AA individual has two A alleles, and each heterozygous AB individual
has only one A allele, use the following equation
=SUM(2*(H25),I25)
21. Calculate the allele frequency of the A allele by dividing the number of A alleles by the total
number of alleles in the population. Because your simulation generated 20 offspring, and
each offspring is diploid, there are 40 alleles total. The equation below calculates the
frequency of each allele
=(H28/40)
Your spreadsheet should now look like Figure 8.
Figure 8
114
22. Use the Hardy-Weinberg equations to test the accuracy of your computer model. Record
your calculations in the space provided below.
p2 + 2pq + q2 = 1
p+q=1
Part II
Use your model to investigate each of the following three variables.
1. Explore the following question: How do alleles behave at extreme frequencies?
a. How will you use your spreadsheet to model an extreme p value?
___________________________________________________________________________
b. Increase the frequency of the A allele to 0.9. Run your simulation 6 times and record
your results below, then answer the following questions.
Frequency of Each Frequency of Each

Genotype Genotype
AA AB BB AA AB BB
Trial 1 Trial 4
Trial 2 Trial 5
Trial 3 Trial 6
How many of the trials resulted in 0 BB genotypes? _________________
c. Decrease the frequency of the A allele to 0.1 and run the simulation 6 more times.
Compare the results to the results from step b.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
115
d. Your model predicts what will happen to A and B alleles during one generation. Predict
what will happen to the frequency of the A allele after 50 generations, by sketching the
anticipated frequency of the A allele in the graph below.
Frequency
of the A
Allele
Generation
e. Go to http://www.radford.edu/~rsheehy/Gen_flash/popgen/
Run the simulation and compare the graph that results with the graph you have
drawn above.
2. Explore the following question: How do alleles behave when the population size is increased?
a. How will you use your spreadsheet to model an increase in population size?
___________________________________________________________________________
b. Increase the population size to 100. Run your simulation 6 times with an allele
frequency of 0.5 for p. Record your results below, then answer the following
questions.
Frequency of each allele Frequency of each allele
A B A B
Trial 1 Trial 4
Trial 2 Trial 5
Trial 3 Trial 6
c. Compare the results of the simulation when using a larger vs. smaller population
size.
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
116
d. Predict what will happen to the frequency of the A allele after 500 generations, by
sketching the anticipated frequency of the A allele in the graph below.
Frequency
of the A
Allele
Generation
3. Consider the following question: How do allele frequencies change over many generations?
a. How will you use your spreadsheet to model the changes in allele frequency after
multiple generations?
___________________________________________________________________________
b. Run your simulation for 10 generations with your population size of 100 and initial p
value of 0.5. Record your results below, then answer the following questions.
Initial p Final p Initial p Final p
Trial 1 0.5 Trial 4 0.5
a. Compare the results of the simulation when using 1 vs. 10 generations.

___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
Part III
You have built a model and explored the effect of three variables. The next challenge is to-
1) build a more accurate model OR

2) use the existing model to answer new questions.
Ideas for option 1-

How can selection (natural or sexual) be introduced into the model?
How can immigration or emmigration be modelled?
How can mutation be modelled?
How can the dominant or recessive nature of the genes be modelled?
117
Ideas for option 2- (Think of these on your own or with a classmate)
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Questions for Analysis
1. What would happen if there were no randomness in this mathematical model?

______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
2. In the absence of random events (an infinitely large population), are the allele frequencies
of the original population expected to change from generation to generation?
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
3. How does this compare to a population that has random gamete selection but is small? In
other words, what happens to allele frequencies in such a population? Is it predictable?
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
4. Which will increase in frequency more rapidly when favored by selection: a rare recessive
allele, or a rare dominant allele?
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
5. Which rises to a frequency of 1.0 more rapidly under selection: a common recessive allele
or a common dominant allele? Why?
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
118
Kidney Dissection

• Wear gloves and aprons, but safety glasses are optional.
• Dispose of the Kidney in the designated waste container.
Methods
1. Carefully remove the fat on the inside curvature of the kidney to expose the blood vessels.
Distinguish the renal artery from the renal vein. They should be dyed with red and blue
latex. The renal artery should also be easy to distinguish since they have thicker walls but
are usually smaller in diameter than veins. .
2. Locate the ureter, the long, thin tube leaving the kidneys. These tubes carry urine to the
urinary bladder.
3. Locate the hilus, the inner groove of the kidney.
4. Next, remove the renal capsule. Then, carefully cut the kidney lengthwise to expose the
internal structures.
5. The peripheral and somewhat lighter portion is the cortex. The greatest portion of the
nephrons lie here. The darker, inner portion is the medulla where the collecting tubules are
found. Filtered urine travels then to the calyx in the renal sinus where it exits out the ureter.
Locate the major calyx, minor calyx, and renal sinus. Find internet images to assist you, if
needed.
6. Locate the renal pelvis, renal column, and renal pyramid.
7. When you are finished locating the structures, place your kidney in the designated location.
Clean your dissecting tools, tray, and lab station thoroughly. Wash your hands.
119
Chicken Arm Dissection
How do the muscles, bones, and tendons work together to move a joint of a chicken wing and how
do they compare to a human arm?
Although many differences exist between the anatomy of humans and chickens, one structure
that shows similarities in muscle pairing and range of motion is a bird’s wing. In this activity you
will study chicken wing structure and function, which is comparable to that of the human arm.
Bones of the Human Arm

The arm reaches from the shoulder to the wrist. It
consists of two basic parts:
1. the upper arm, which extends between the
shoulder and the elbow, and
2. the forearm, which extends between the
elbow and the wrist.
The upper arm is formed by one long bone, the

humerus. The top end of the humerus is
rounded and fits into a cup-shaped depression in
the scapula, or shoulder bone, forming a ball-
and- socket joint. Ball-and-socket joints allow for
circular movement.
The two bones of the forearm are the radius and

the ulna. The ulna is fixed in position, but the
radius can rotate over the ulna. This makes
rotation of the forearm possible in motions such
as twisting a screwdriver.
Skeletal Muscles of the Human Arm

Skeletal muscles are responsible for
hundreds of movements. When an organism
wants to move, signals travel from the brain
to the skeletal muscle cells. The muscle cells
then contract or get shorter.
Strands of tough connective tissue connect
the skeletal muscles to bones. These strands
of tissue are called tendons. When a muscle
that connects two bones gets shorter, the
bones are pulled closer to each other. For
example, tendons attach the biceps muscle to
a bone in your shoulder and to a bone in your
forearm. When the biceps muscle shortens,
your forearm bends toward your shoulder.
The skeletal muscles often work in pairs to
produce smooth, controlled motions by
pulling, or contracting. When one muscle in
the pair bends part of the body, the other
muscle extends or straightens part of the
body.
120
Bones of the Chicken
The upper wing consists of a
humerus, which is at one end, and
the ulna and the radius at the
lower wing. These bones connect
at the elbow joint. The rest of the
wing is composed of modified hand
bones.
Materials
• dissection tray & instruments
• fresh chicken wing
• gloves
Getting Under the Skin

a. Examine the chicken wing
and compare it with the
Figure to the right.
b. Identify the upper wing,
the lower wing, and the
wingtip.
c. Examine the wing at the point where
it was removed from the body.
Depending on the way the wing is cut,
you might see cartilage and bone
marrow.
d. Using the scissors, cut down the
middle of the skin, starting at the top
end of the upper wing. Try not to cut
through the muscles below the skin. Do
this by piercing the skin and then
slipping the scissors between the skin
layer and the muscle. Cut until you
reach the shoulder joint. (See cut 1.)
e. Cut down the sides of the skin to make a
T- shaped cut. Start at the first cut and
cut away from it in both directions. Peel
the skin and cut to loosen it. (Note: the
chicken skin can be very difficult to
remove. Take your time peeling it back
so as not to damage the tissues
underlying it. (See cut 2.)
Results
Complete Table 1, Observation Table, as you complete your dissection and Analysis
Questions as you complete the dissection.
Fat
Look for yellowish tissue clumped together beneath the skin. This is fat tissue, made of fat
cells.
121
Muscles
a. Observe the muscles in the wing. They look like bundles of pale pink tissue.
b. Find two muscles in the wing that bend and straighten the elbow joint. Each muscle pulls
on the lower wing bones in one direction (the flexor bends the joint). Since the flexor
cannot lengthen by itself to push the bone back to straighten the joint, another muscle
pulls the bone in the opposite direction (extensor).
c. Hold the wing down at the shoulder and alternately pull on each muscle. Observe what
happens.
Tendons
a. Tendons are shiny white tissues at the ends of the muscles that attach muscles to bones.
Find as many tendons as you can on the chicken wing.
b. Pull on a tendon to see how it helps the chicken move its wing.
Joints and Ligaments
a. Two bones come together at a joint. Bend and straighten the elbow joint and observe
how the bones fit together.
b. Ligaments connect bones to other bones at joints. They look like a shiny white
covering of the joint surfaces.
c. Closely examine the elbow joint between the upper wing and the lower wing and
identify the ligaments.
Cartilage
Between the bones is another shiny white material that is slippery. This is cartilage, which
helps the bones move without grinding against one another, or without causing trauma.
Wing
a. Move the wing again. Explore how the muscles, tendons, ligaments, and cartilage
play roles in the wing’s movement.
b. Complete the Observation Table. When you have finished observing the wing and
writing your notes, throw the chicken remains away. Wash all equipment in hot, soapy
water.
Table 1 Observation Table
Tissue Description (color, texture, etc.) Tissue it attaches to
Skin
Fat
Muscle
Tendon
Ligament
Cartilage
122
Analysis
What purpose does the connective tissue serve?
______________________________________________________________________________
What type of tissue actually moves the chicken wing? __________________________________

Why are tendons important to a muscle’s ability to make the body move?
______________________________________________________________________________
What tissue of the chicken wing is commonly referred to as the “meat”?
______________________________________________________________________________
Making the Human Connection
With your left hand grasp something with weight such as a heavy textbook or pencil pouch and
hold it at your side. Place your right hand on your upper left arm so that you can feel your
muscles move. Slowly bend your left arm to raise the weight. Then slowly straighten your left
arm to lower it. Repeat this motion a few times until you can feel and see what is
happening.What joint did you use to lift the weight?
______________________________________________
Explain which muscle contracted and which muscle extended. as you raised the weight.
______________________________________________
Then explain what happened to each muscle as you

lowered the weight.
______________________________________________
Which bone(s) in the arm moved?
______________________________________________
Which bone(s) in the arm didn’t move?
______________________________________________
Then, based upon your observations in this activity, explain either how the chicken wing or
the human arm moves using all of the above terms in your answer
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
123
Correlates of Immunization Rate DATABASE
The IB Biology syllabus has an ICT requirement. Among the requirements is that students
perform at least one investigation using a database. The syllabus defines a database as-
an organized collection of information stored on a computer. The user can extract
subsets of the information or can query the database. Data bases can include
qualitative information or numerical information. They can be stored on spread
sheets that can then be used to sort, select and process the information.
Database query investigations require many of the skills used in traditional laboratory
investigations, except that you will not be measuring the data that you collect. You must still
create an interesting and original question, a method of sorting and organizing the data, a way to
display the collected data, a data processing technique, a way to display the processed data, and
a conclusion and evaluation.
Database
Vaccination and Immunization Statistics, jointly produced by the United Nations Children’s Fund
(UNICEF) and the World Health Organization (WHO).
https://data.unicef.org/topic/child-health/immunization/
Investigation
Use of this database to perform an investigation of your choice. Submit a report of your
investigation.
The report must include:
1. a clear and focused research question
2. a method of sorting and collecting a subset of the data in the database
3. processing of the collected data
4. presentation of the processed data, and
5. a conclusion and evaluation.
“Nothing worth doing is easy”
124
It is not the strongest of the species
that survives, not the most intelligent
that survives. It is the one that is the
most adaptable to change.
-Charles Darwin
If you know you are on the right

track, if you have this inner
knowledge, then nobody can turn
you off... no matter what they say.
-Barbara McClintock

Grade 11-12 IB DP: Laboratory Manual For HL Biology

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Grade 11-12 IB DP: Laboratory Manual For HL Biology

Uploaded by

Copyright:

Available Formats

2021-2022 Edition

Topic 2: Molecular Biology

Topic 5: Evolution and Biodiversity

Topic 6: Human Physiology

Topic 8: Metabolism, Cell Respiration, and Photosynthesis

Topic 9: Plant Biology

Topic 10: Genetics and Evolution

Topic 11: Animal Physiology

Draw the micrometer on –

2. Convert your measurements to the following units.

1- Graph the data with Excel

Potato cell solute concentration = _________________________

How confident are you in your data?

How could this experiment be improved?

2. What characteristics of life do coacervates exhibit?

Dish soap- Hand soap-

5. Explain these results in terms of intermolecular forces.

Experiment 2- Benedict’s test for reducing carbohydrates

Lipid Solvent Relative solubility

Experiment 3- Iodine absorption test for saturated fatty acids

Experiment 4- Sudan III test

Experiment 1- Denaturing by heat

Experiment 2- Effect of Acetone

Experiment 3- Biuret Test

Starch Solution Amylase

This law implies that if temperature and volume are

For respirometer assembly:

VOLUME EQUALIZATION BETWEEN EXPERIMENTAL AND CONTROL SETUPS:

Weight of 100 non-germinating peas = g

Volume of germinating peas = (_____cm3 – 20.0 cm3) =_____ cm3

Place the germinating seeds on a paper towel and label them.

Number of glass beads needed = _____

Known density = (from step 2)

Desired volume = (as calculated in step 3)

Therefore, the mass of the dry peas needs to be = g (volume x density).

20 dry non-germinating peas weight =

10. Prepare the room-temperature bath (approx. 25 ºC)

11. Make a sling of masking tape attached to each side of

RECORDING DATA AND MAINTAINING TEMPERATURE

Room Readin Diff* Readin Diff* Correc Readin Diff* Correc

* Difference = (initial reading at time 0) - (reading at time X)

Condition Show Calculations Here Rate/ cm3 O2 min-1

Germinating peas (Room

Dry Peas (Room Temp.)

Designing and Conducting Your Own Investigation:

When identifying your design, be sure to address the following:

Pigment Color Rf value

Color of spot Distance moved Rf value Identity

Color of spot Distance moved Rf value Identity

2. Which pigments, if any, were present in both vegetables? Explain.

3. Why was acetone used?

4. Why was a standard used?

Biological grade drawings

Evaluate the use of oil immersion technique to identify cells.

Identify the stage of meiosis shown in the cells in image below.

Trait Dominant Hybrid Recessive

2. Are there any abnormalities present? If so, describe them.

b. In October 2005? ____________________________

c. In October 2010? ____________________________

Part C: Find a disease gene via OMIM

Name of disease _________________________________

4. Write down the gene you chose:

Part D: Explore gene function via GeneCards

Volume of germinating peas = (_cm3 – 20.0 cm3) =_ cm3

1 ) horse and zebra and 2) donkey and zebra