RESEARCH

PREVALENCE OF CITROBACTER SPP. FROM

PET TURTLES AND THEIR ENVIRONMENT
Sabrina Hossain, MS, Sudu Hakuruge Madusha Pramud Wimalasena, BSc,
Mahanama De Zoysa, PhD, and Gang-Joon Heo, PhD, DrVetMed

Abstract
Pet turtles are considered a source of bacterial infection to humans when handled in captivity. Turtles
purchased from 9 pet shops and 8 online markets in Korea were examined to determine whether the
turtles and their environment were contaminated with Citrobacter spp. Biochemical tests and morphology
revealed that Citrobacter spp. were isolated from 7 fecal and 76 environmental samples. Among the 7 fecal
isolates, 5 bacteria were identified as Citrobacter freundii through 16S rRNA gene sequencing. The isolation
rate of Citrobacter spp. from soil and water samples increased over time. Each of the isolate’s antibiotic
resistance was characterized with a disk diffusion test. The strains showed susceptibility against amikacin,
ceftriaxone, ciprofloxacin, imipenem, sulfamethoxazole/trimethoprim, and tetracycline, but were resistant
to cefoxitin, cephalotin, and chloramphenicol. These results indicate that pet turtles are a potential source
of Citrobacter infection in humans in Korea. Copyright 2017 Elsevier Inc. All rights reserved.
Key words: prevalence; Citrobacter spp.; pet turtles; Citrobacter spp. infection; antibiotic resistance

C
itrobacter, a genus from the Enterobacteriaceae family, are Gram-negative, facultative
anaerobic bacteria that appear as coccobacilli or rods.1 Citrobacter spp. are motile and use
their peritrichous flagella to move.2 Citrobacter spp. ferment mannitol with production of
H2S, and can use citrate as their sole source of carbon.2,3 Citrobacter spp. are rare
opportunistic nosocomial bacteria that can cause urinary tract, hematologic, or neonatal
infections (e.g., meningitis, sepsis, joint, general bacteremia); intraabdominal sepsis; brain abscesses; or
pneumonia.4 Citrobacter spp. infections can be fatal, with 33% to 48% overall death rates being reported
including 30% for children.3,5 Children and immunocompromised, elderly, or debilitated patients are at
increased risk of infection.3,6 Citrobacter spp. are prevalent worldwide, as they are a component of the
normal intestinal flora of humans.7 Hosts of Citrobacter spp. include humans, animals, and aquatic
species (e.g., catfish, rainbow trout, and turtles).2,8-11 Citrobacter spp. are also abundant within various
environments (e.g., water, soil, and food) because of fecal contamination. Among Citrobacter spp., C.
freundii is frequently associated with reptiles, particularly as a turtle pathogen. The infection caused by C.
freundii in animals is often related to an immunocompromised state initiated and exacerbated by poor
husbandry conditions and other stress factors.11 Citrobacter spp. can cause septicemic cutaneous ulcerative
disease (SCUD) in turtles, and is characterized by distinctive clinical signs (e.g., anorexia, lethargy, liver
necrosis, and petechiae) on the carapace and skin. The scutes are often damaged and slough, and an
underlying discharge of purulent material may be present.12 In the highly intensive production practices
found on turtle farms, the disease can be transmitted to all uninfected turtles within 1 week.11 Currently,
on a global basis, pet reptile rearing has become increasingly popular. Reptiles are raised in
approximately 453,000 households in the USA.13 Among them, pet turtles are the most popular for their
small size and appearance.13 However, reptiles carry many typical enteric bacteria that have been
classically associated with warm-blooded animals (i.e., salmonellosis has been acquired through contact

From the College of Veterinary Medicine, Chungbuk National University, Cheongju, Korea; and the College of Veterinary Medicine, Chungnam
National University, Daejeon, Korea.
Address correspondence to: Gang-Joon Heo, PhD, DrVetMed, Laboratory of Aquatic Animal Medicine, College of Veterinary Medicine,
Chungbuk National University, Chungdae-ro 1, Seowon-gu, Cheongju, Chungbuk 28644, Korea. E-mail:gjh6087@gmail.com
Ó 2017 Elsevier Inc. All rights reserved.
1557-5063/17/2101-$30.00
http://dx.doi.org/10.1053/j.jepm.2016.10.004

Journal of Exotic Pet Medicine 26 (2017), pp 7–12 7

 with pet turtles).14,15 Moreover, Citrobacter spp. can infect humans if the owner fails to handle a pet turtle
with care. The bacteria can be transmitted by physical contact with the infected turtles or through
contaminated environments such as water and soil in the animal’s cage. The U.S. Food and Drug
Administration (FDA) has banned the sale of small turtles with a carapace length o4 inches to prevent
the transmission of pathogenic bacteria from turtles to small children16; however, there are no such
regulations in Korea. To prevent Citrobacter spp. infection by pet turtles, it is necessary to maintain
sanitary and hygienic management of pet turtles and their environment. Though several antibiotics for
treatment of Citrobacter infections are known, they are not always effective.17 Furthermore, repeated use of
antibiotics may lead to multiple antimicrobial resistance of Citrobacter spp. organisms.18 The objectives of
this research investigation were to determine the prevalence rate of Citrobacter spp. cultured from fecal
samples of pet turtles purchased in pet shops and online markets, and of the animal’s environment (soil)
over time. The authors also measured resistance of the Citrobacter spp. isolates against several common
antimicrobial drugs and characterized the cultured bacteria. The results of this study were used to assess
the risk of infection from pet turtles and their environment from a public health standpoint and provide
information concerning the prevention of Citrobacter spp. infection to humans exposed to reptiles.

MATERIALS AND METHODS
Purchase of Pet Turtles
A total of 34 turtles of 6 commercially popular
species were purchased through 9 pet shops and 8
online markets in Korea. The randomly purchased
turtles had an average weight of 15 ⫾ 2 g, carapace
diameter of 40 ⫾ 5 mm, and were less than 4
weeks of age. All the tested turtles were determined
to be healthy based on an external physical
examination and did not have any clinical signs of
SCUD. Among the 34 turtles, 10 Chinese stripe-
necked turtles (Ocadia sinensis), 8 yellow belly
sliders (Trachemys scripta scripta), 6 river cooters
(Pseudemys concinna concinna), 4 northern Chinese
softshell turtles (Pelodiscus maackii), 3 western
painted turtles (Chrysemys picta belli), and 3
common musk turtles (Sternotherus odoratus) were
evaluated.
Fecal Sample Collection
The fecal samples were collected immediately after
the turtles were purchased. Each turtle was placed
in a 500 mL beaker with 5 mL of sterilized distilled
water for 24 hours. As a fecal sample, 1 mL of the
distilled water containing the turtle’s feces was
collected. To prevent Citrobacter spp. transmission
among individuals, poly-gloves were changed each
time an animal was handled.
Enrichment and Isolation of Citrobacter spp.
The fecal samples were suspended in 3 mL of
sterile saline, and 1 mL of the suspension was
inoculated into 9 mL of tetrathionate broth
(MBcell Ltd., Seoul, Korea) at 371C for 24 hour.
Following the incubation procedure, the broth was
mixed for 5 seconds with a Vortex agitator. Then
one loopful from each tube was streaked onto a
plate of MacConkey agar (MBcell. Ltd, Seoul,
Korea) and incubated at 371C for 24 hours.
Pinkish colonies with a glossy surface were
considered candidates for Citrobacter spp. isolates
and were subcultured onto a plate of eosin
methylene blue agar (EMB; MBcell. Ltd, Seoul,
Korea) and incubated at 371C for 24 hours.
Environmental Conditions of Pet Turtles
in Cages
A total of 17 cages, each containing 1 to 3 turtles
of the same species from the same pet shop, were
used for the study; each cage had a slope made
with soil and pebbles, 2 L of sterilized water, and a
canister filter to maintain water quality. Feeding of
turtles followed general husbandry methods.19
Gammarus dried shrimp with calcium
supplements (Samhotech Co., Ltd., Seoul, Korea)
were fed 3 times a day and vitamin D3 powder
(Rep-Cal Research Labs, Los Gatos, CA USA) was
mixed with the feed every 5 days. Water
temperature and pH were maintained between 26
⫾ 21C and 6.5 to 8.2, respectfully, and 12 hours of
photoperiod was provided each day to the animals
during the research investigation.
Isolation Rate of Citrobacter spp. from
Environment Over Time
To determine the change in Citrobacter spp.
infiltration of the turtle’s environments over time,
water and soil samples were collected every 2 days
from each of the 17 cages for 10 days. Using a

8 Hossain et al./Journal of Exotic Pet Medicine 26 (2017), pp 7–12

TABLE 1. Nucleotide sequences of primers used for
16s rRNA gene sequencing
Primers Nucleotide Sequence (50 to 30 )
518 F CCAGCAGCCGCGGTAATACG
800 R TACCAGGGTATCTAATCC
sterile spoon, 5 g of soil from a turtle’s rest or
feeding area was obtained and incubated in 10 mL
of tetrathionate broth.20 From each cage, 10 mL of
water was collected using a sterile pipette and
suspended at room temperature for 1 minute. After
vortexing, 1 mL of the suspension was inoculated
into 9 mL of tetrathionate broth. Those samples
were incubated at 371C for 24 hours in enriched
media. Enrichment and isolation followed the
same methods described for the fecal samples.
Biochemical Tests and 16s Ribosomal RNA
Gene Sequencing
To characterize bacterial isolates from the feces,
water, and soil, several biochemical tests were
carried out. A citrate test was performed by
streaking the bacterial sample on Simmons citrate
agar (MBcell. Ltd, Seoul, Korea) and incubating at
371C for 24 hours. Motility, H2S, and indole tests
were also performed by streaking isolates on
sulfide indole motility (SIM) medium (MBcell.
Ltd, Seoul, Korea) and incubating at 371C for 24
hours.2,6 All bacterial isolates from the fecal
samples were 16S rRNA sequenced using universal
sequencing primers 518 F and 800 R (Table 1) at
Cosmogenetech Co. Ltd (Seoul, Korea). The
resulting sequences were analyzed and compared
with 16S rRNA gene sequences stored in GenBank.
Antibiotic Resistance Testing
All of the Citrobacter spp. were tested with the disk
diffusion method using 14 common veterinary
antibiotics. Veterinary antibiotic drugs. The disk
diffusion test was carried out according to the
European Committee on Antimicrobial
TABLE 2. Isolation rates of Citrobacter spp. from the fecal samples in turtles
Species
Chinese stripe-necked turtle (Ocadia sinensis),
Yellow belly slider (Trachemys scripta scripta)
River cooter (Pseudemys concinna concinna)
Northern Chinese softshell turtle (Pelodiscus maackii)
Western painted turtle (Chrysemys picta belli)
Common musk turtle (Sternotherus odoratus)
Total
a
Isolation rate: the ratio of positive samples to total samples.
Hossain et al./Journal of Exotic Pet Medicine 26 (2017), pp 7–12
Susceptibility Testing (EUCAST) standards.21 Every
Citrobacter spp. was cultured on Tryptic Soy Agar
(MBcell Ltd., Seoul, Korea) and colonies were
adjusted to a turbidity of McFarland 0.5 (5

105 CFU/mL) with saline. The bacterial suspension
was then spread onto a Mueller-Hinton Agar Plate
(MHA) (MBcell Ltd., Seoul, Korea). Amoxicillin
(30 μg), ampicillin (10 μg), chloramphenicol
(30 μg), nalidixic acid (30 μg), and tetracycline
(30 μg) disks were prepared by soaking each paper
disk separately with the given amount of antibiotic
agent. Amikacin (30 μg), cefoxitin (30 μg),
ceftriaxone (30 μg), cephalothin (30 μg),
ciprofloxacin (5 μg), imipenem (10 μg), and
sulfamethoxazole (23.75 μg)/trimethoprim
(1.25 μg) disks were purchased from Kisan Biotech
Co., Ltd. (Seoul, Korea). Not more than 7 disks
were placed per inoculated Mueller-Hinton Agar
plate, and the plates were incubated for 18 hours
at 371C. After incubation, the antimicrobial
resistance of each Citrobacter spp. was determined
by measuring the diameter of the inhibition zones
formed on the MHA plates.
RESULTS
Isolation of Citrobacter spp. from Fecal and
Environmental Samples
Citrobacter spp. were isolated from 7/34 (20.6%)
fecal samples (Table 2); positive samples were
obtained from 2/10 Chinese stripe-necked turtles,
2/8 yellow belly sliders, 2/6 western painted
turtles, and 1/6 river cooters. No Citrobacter spp.
was isolated from northern Chinese softshell or
common musk turtles.
Isolation Rate of Citrobacter spp. from the
Environment Over Time
As shown in the Figure, the isolation rate of
Citrobacter spp. increased over time. A total of 76
Citrobacter spp. were isolated from the
environmental samples; 39 from the soil and 37
from water. An example of this difference in the
No. of Tested No. Positive Isolation Ratea (%)
10 2 20
8 2 25
6 1 16.7
4 0 0
3 2 66.7
3 0 0
34 7 20.6
9
 rRNA sequencing, 5 were identified as C. freundii
and 2 as unknown Citrobacter spp. Citrobacter
freundii was isolated from 2 western painted
turtles, 1 yellow belly slider, 1 Chinese stripe-
necked turtle, and 1 river cooter. The 2 unknown
Citrobacter spp. were found in 1 yellow belly slider
and 1 Chinese stripe-necked turtle.

Antibiotic Resistance Test of Citrobacter spp.

FIGURE. Isolation of Citrobacter spp. from water and soil
samples over time.
isolation rate can be seen when comparing days 2
and 10. On day 2, Citrobacter spp. were isolated
from one water sample and one soil sample;
however, on day 10, Citrobacter spp. were isolated
from 15 water samples and 17 soil samples 10.
There was also a large spike in Citrobacter spp.
isolation between days 6 and 8. These findings
appear to demonstrate that most of the cage
environments containing the turtles were
contaminated with Citrobacter spp. over time.
Identification of Isolates
Citrobacter colonies were dusty brown on EMB
agar. The 7 isolates from fecal samples and 76
isolates from water and soil samples were positive
in the motility, citrate, and H2S tests, but negative
in the indole test. Biochemical testing
presumptively identified Citrobacter spp.; however,
the authors chose to genetically classify only 7
strains isolated from fecal samples that were
biochemically and morphologically identical with
water and soil isolates. After analysis with 16S
The antibiotic resistance of all strains was
determined by measuring the diameter of
inhibition zones and comparing them to Clinical
and Laboratory Institute (CLSI) standards
(Table 3).22 In Table 3, the C. freundii isolates were
named CF1, CF2, CF3, CF4, and CF5, and the 2
unknown Citrobacter spp. were classified as CA1
and CA2. All 7 Citrobacter spp. strains showed
susceptibility to most of the commonly used
veterinary antibiotic agents. Every Citrobacter spp.
strain was susceptible to amikacin, ceftriaxone,
ciprofloxacin, imipenem, sulfamethoxazole/
trimethoprim, and tetracycline, but resistant to
cefoxitin, cephalotin, and chloramphenicol. All
were resistant to amoxicillin and ampicillin except
CF1, which showed intermediate resistance. CF2,
CF3, CF4, and CF5 had intermediate resistance to
nalidixic acid, but CF1 showed susceptibility and
CA2 was resistant to the same antibiotic drug.
DISCUSSION
Reptiles are associated with zoonotic diseases, as
they are routinely identified as reservoirs of certain
viruses, bacteria, and fungi. With respect to turtles,
the presumed primarily transmission route is fecal
to oral and direct to indirect ingestion, resulting in

TABLE 3. Antibiotic resistance patterns of 7 Citrobacter spp. by disk diffusion test

Antibiotics CF1 CF2 CF3 CF4 CF5 CA1 CA2
Amikacin S S S S S S S
Amoxicillin I R R R NA R R
Ampicillin I NA NA NA NA NA NA
Cefoxitin R R R R R R R
Ceftriaxone S S S S S S S
Cephalotin NA NA NA NA NA NA NA
Chloramphenicol NA NA NA NA NA NA NA
Ciprofloxacin S S S S S S S
Imipenem S S S S S S S
Nalidixic acid S I I I I I R
Streptomycin I S S S S S S
Sulfamethoxazole/trimethoprim S S S S S S S
Tetracycline S S S S S S S
Inhibition zone diameters were evaluated according to CLSI (2007) standards. I, Intermediate resistance; NA, No growth inhibition;
R, Resistance; S, Susceptibility.

1 0 Hossain et al./Journal of Exotic Pet Medicine 26 (2017), pp 7–12

their classification as a high-risk group for reptile-
related infections in humans.23 As reptiles in the
pet market continue to flourish, aquaria, pet
shops, and online shops selling aquatic animals
are experiencing a sharp increase in demand for
these particular animal species. Reptiles, in general,
have been found to be popular among children.24
This popularity occurs despite FDA warnings that
pet turtles can transmit pathogens to children or
immunocompromised humans via physical
contact.16 In this study, Citrobacter spp. were
isolated from 7/34 (20.6%) fecal samples collected
from pet turtles. The isolation rate was relatively
low in this study because of the unusual presence
of Citrobacter spp. shedding in the feces of healthy
turtles.25 Moreover, the authors obtained fecal
samples as soon as possible after the turtles were
purchased. Consequently, Citrobacter spp. was only
isolated from animals shedding the bacteria at that
time. Other contaminated turtles may have also
been subclinical carriers of Citrobacter spp., but
were not shedding the bacteria when fecal samples
were collected. The increase of Citrobacter spp.
isolation rate over time from most cages showed
that the cage environments were contaminated
unless the water was changed and the environment
was kept clean. When the turtles were first
introduced to the cage environments, However,
the prevalence of Citrobacter spp. was low. The
turtles were not conditioned to the study
environment at that time of initial environmental
sampling. However, over time the animals
gradually acclimated to the environment and
natural behavior (e.g., swimming) was observed.
The spike in the number of Citrobacter spp. isolated
between days 6 and 8 may be partially explained
by this acclimation, as the shedding turtles
interacted more with their environments.
Therefore, the water and soil were contaminated
owing to shedding of bacteria from the turtles
while they were swimming. In addition, the soil
had a higher isolation rate than the water at
10 days. Many of the turtles preferentially spent
time on the designated resting area and only part of
the time swimming; therefore, it is plausible that
the Citrobacter spp. in the water were heavily
diluted compared to the soil samples. Furthermore,
over time horizontal transmission to other turtles
likely occurred and thereby increased the rate of
environmental contamination. Horizontal
transmission of amphibian and reptile-borne
Citrobacter spp.is mainly caused by the confinement
of several turtle breeds in one cage at pet shops or
aquaria.11,26 Therefore, the careless management of
cage environments can cause horizontal
Hossain et al./Journal of Exotic Pet Medicine 26 (2017), pp 7–12
transmission between turtles resulting in a greater
risk of exposure to human caretakers. However,
measures have not been employed to prevent
Citrobacter infections. Businesses associated with
reptile and amphibian trade must supply adequate
information concerning the prevention and control
of zoonotic diseases by highlighting the risks of
insufficient hygienic measures and emphasizing the
importance of terrarium cleanliness. Lastly,
hospitals and health care providers must educate
patients about the importance of rigorous hand-
washing and the use of disinfectants to eradicate
potential pathogens and provide reliable protection
against contaminants.27
Unfortunately, treatment may be unsatisfactory
because of multiple antibiotic resistance in bacterial
organisms of nosocomial importance
(e.g., Citrobacter spp.). However, in this study,
antibiotic resistance testing of 7 Citrobacter spp.
strains revealed resistance to only a few common
antibiotic agents to which most Enterobacteriaceae
are resistant.22 In another study, C. freundii isolated
from fish was susceptible to chloramphenicol.28
However, our 2 unknown Citrobacter spp. and 5 C.
freundii isolates showed resistance to
chloramphenicol. Furthermore, all strains were
susceptible to amikacin, which is considered to be
the most appropriate drug against Citrobacter spp.
infections.29 Additionally, all of the strains except
CF1 and CA2 showed intermediate resistance
against nalidixic acid, although Citrobacter spp.
strains in another study were generally susceptible
against nalidixic acid.30 Of the 7 Citrobacter spp., 6
were resistant to ampicillin but susceptible to
cefoxitin, which has been shown to effectively treat
infections caused by ampicillin resistant C.
freundii.31 All Citrobacter spp. isolates from the study
animals were also susceptible to other common
veterinary antibiotic agents. Thus, public awareness
to the risk of Citrobacter spp. exposure from pet
turtles is extremely important to prevent further
evolution of antimicrobial resistance. In addition,
further research investigations should focus on the
antibiotic resistance pattern of Citrobacter spp. with
antibiotic resistance genes (e.g., extended-spectrum
β-lactamase genes [ESBL-genes]) obtained from
water and soil samples to gain an increased
knowledge regarding the associated environmental
hazard of this public health concern.
CONCLUSIONS
This study concluded that some pet turtles sold in
Korea are subclinical carriers of Citrobacter spp.
Awareness of the potential for exposure to
1 1
 pathogenic bacteria when handling pet animals
(e.g., turtles) is important to prevent zoonotic
disease. The authors were unable to identify 2 of
the Citrobacter spp. isolates through 16S rRNA
sequencing. Therefore, further studies should be
performed to genetically characterize these
unclassified Citrobacter spp. isolates as well as other
harmful human pathogenic bacteria isolated from
the pet turtles.
ACKNOWLEDGMENTS
This research was supported by Basic Science
Research Program through the National Research
Foundation of Korea (NRF) funded by the Ministry
of Education (NRF-2015R1D1A1A01060638).
REFERENCES
1. Abbott SL: Klebsiella, Enterobacter, Citrobacter, Serratia,
Plesiomonas, and Other Enterobacteriaceae, in Murray PR,
Baron EJ, Jorgensen JH (eds): Manual of Clinical
Microbiology. (ed 9). Washington, DC, ASM press, pp
698-715, 2007
2. Knirel YA, Kocharova NA, Bystrova OV, et al: Structures
and serology of the O-specific polysaccharides of bacteria
of the genus Citrobacter. Arch Immunol Ther Exp 50:
379-391, 2002
3. Doran TI: The role of Citrobacter in clinical disease of
children: Review. Clin Infect Dis 28(2):384-394, 1999
4. Ryan KJ: Enterobacteriaceae, in Ryan KJ, Ray CG (eds):
Sherris Medical Microbiology: An Introduction to Infec-
tious Diseases. (ed 4). New York, NY, McGraw-Hill, pp
343-371, 2004
5. Pepperell C, Kus JV, Gardam MA, et al: Low-virulence
Citrobacter species encode resistance to multiple antimicrobials.
Antimicrob Agents Chemother 46(11):3555-3560, 2002
6. Chen YS, Wong WW, Fung CP, et al: Clinical features and
antimicrobial susceptibility trends in Citrobacter freundii
bacteremia. J Microbiol Immunol Infect 35(2):109-114,
2002
7. Holmes B, Aucken HM: Citrobacter, Enterobacter, Klebsiella,
Serratia and other members of the Enterobacteriaceae, in
Collier L, Balows A, Sussman M (eds): Microbiology and
Microbial Infections: Systematic Bacteriology. (ed 9).
London, Arnold, pp 999-1033, 1998
8. Austin B, Stobie M, Robertson PAW: Citrobacter freundii:
The cause of gastro-enteritis leading to progressive low
level mortalities in farmed rainbow trout, Oncorhynchus
mykiss Walbaum, in Scotland. Bull Eur Ass Fish Pathol 12:
166-168, 1992
9. MacDonald TT, Frankel G, Dougan G, et al: Host defenses
to Citrobacter rodentium. Int J Med Microbiol 293(1):
87-93, 2003
10. Nawaz M: Isolation and characterization of tetracycline-
resistant Citrobacter spp. from catfish. Food Microbiol 25
(1):85-91, 2008
11. Henriksen P: Diagnosis and treatment of disease in the
turtle. Iowa State Uni Vet 34(1):29-32, 1972
12. Ebani VV, Fratini F: Bacterial zoonoses among domestic
reptiles. Annali Fac Med Vet 58:85-91, 2005
13. Chommel BB: Zoonoses of house pets other than dogs,
cats, and birds. Pediatr Infect Dis J 11:479-487, 1992
1 2 Hossain et al./Journal of Exotic Pet Medicine 26 (2017), pp 7–12
14. McCoy RH, Seidler RJ: Potential pathogens in the environ-
ment: isolation, enumeration, and identification of seven
genera of intestinal bacteria associated with small green
pet turtles. J Appl Microbiol 25(4):534-538, 1973
15. Centers for Disease Control and Prevention, USA: Salmo-
nellosis associated with pet turtles-Wisconsin and Wyom-
ing, 2004. Morbidity and Mortality Weekly Report. 54
(09): 223-226, 2005
16. U.S. Food and Drug Administration, USA: Pet turtles: A
Source of Germs, 2015. 〈http://www.fda.gov/AnimalVeteri
nary/ResourcesforYou/AnimalHealthLiteracy/ucm247899.
htm〉Accessed 27.03.16.
17. Metri BC, Jyothi P, Peerapur BV: Antibiotic resistance in
Citrobacter spp. isolated from urinary tract infection. Urol
Ann 5(4):312-313, 2013
18. Ros A, Carricajo A, Berthelot P, et al: Extremely drug-
resistant Citrobacter freundii isolate producing NDM-1 and
other carbapenemases identified in a patient returning from
India. Antimicrob Agents Chemother 55(1):447-448, 2011
19. Highfield AC: Practical Encyclopedia of Keeping and
Breeding Tortoises and Freshwater Turtles. London: Car-
apace Press, 1996
20. Mitchell MA, Shane SM: Preliminary findings of Salmonella
spp. in captive green iguanas (Iguana iguana) and their
environment. Prev Vet Med 45(3-4):297-304, 2000
21. European Society of Clinical Microbiology and Infectious
Diseases: Antimicrobial Susceptibility Testing EUCAST Disk
Diffusion Method [WWW Document]. 〈http://www.eucast.
org/ast_of_bacteria/disk_diffusion_methodology/〉, 2015
22. Clinical and Laboratory Standards Institute: Performance
Standards for Antimicrobial Susceptibility; Seventeenth
Informational Supplement. CLSI document M100-S17
[ISBN 1-56238-625-5], 2007
23. Readel AM, Phillips CA, Goldberg TL: Prevalence of
Salmonella in intestinal mucosal samples from free-
ranging red-eared sliders (Trachemys scripta). Herpetol
Conserv Biol 5(2):207-213, 2008
24. Centers for Disease Control and Prevention, USA: Reptiles,
Amphibians and Salmonella 〈http://www.cdc.gov/fea
tures/salmonellafrogturtle/〉 November 25, 2013
25. Erkmen O, Bozoglu TF (eds): Food Microbiology: Princi-
ples into Practice (Vol 2). Somerset, NJ, John Wiley &
Sons, 2016
26. Harwood VJ, Butler J, Parrish D, et al: Isolation of fecal
coliform bacteria from thediamondback terrapin (Mala-
clemys terrapin centrata). Appl Environ Microbiol 65(2):
865-867, 1999
27. Centers for Disease Control and Prevention, USA: Eight
Multistate Outbreaks of Human Salmonella Infections to
Small Turtles (Final Update), 2013
28. Padua SB, Marques DP, Sebastiao FA, et al: Isolation,
characterization and pathology of Citrobacter freundii
infection in native Brazilian catfish Pseudoplatystoma. Braz
J Vet Pathol 7(3):151-157, 2014
29. Pavani G: Drug susceptibility pattern of Klebsiella and
Citrobacter infections in India. J Microbiol Biotech Res 2
(4):619-620, 2012
30. Navia MM, Ruiz J, Ribera A, et al: Analysis of the
mechanisms of quilnolone resistance in clinical isolates
of Citrobacter freundii. J Antimicrob Chemother 44:
743-748, 1999
31. Rae CE, Fazio A, Rosales JP: Successful treatment of
neonatal Citrobacter freundii meningitis with ceftriaxone.
Ann Pharmacother 25:27-29, 1991