See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/330119174

3D printed PCL/SrHA scaffold for enhanced bone regeneration

Article · April 2019

DOI: 10.1016/j.cej.2019.01.015

CITATIONS READS

13 218

10 authors, including:

Wei Nie Weizhong Wang

Wake Forest School of Medicine Fudan University
49 PUBLICATIONS   1,117 CITATIONS    31 PUBLICATIONS   731 CITATIONS   

SEE PROFILE SEE PROFILE

Chuanglong He
Donghua University
167 PUBLICATIONS   3,962 CITATIONS   

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Design, synthesis, structure-morphology-property relationships of block-type proton exchange membranes View project

nanomedicine View project

All content following this page was uploaded by Chuanglong He on 16 October 2019.

The user has requested enhancement of the downloaded file.

 Chemical Engineering Journal 362 (2019) 269–279

Contents lists available at ScienceDirect

Chemical Engineering Journal

journal homepage: www.elsevier.com/locate/cej

3D printed PCL/SrHA scaffold for enhanced bone regeneration T

a a b a a a
Dinghua Liu , Wei Nie , Dejian Li , Weizhong Wang , Lixia Zheng , Jingtian Zhang ,
⁎
Jiulong Zhangc, Chen Pengc, Xiumei Moa, Chuanglong Hea,
a
Key Laboratory of Science and Technology of Eco-Textiles, Ministry of Education, College of Chemistry, Chemical Engineering and Biotechnology, Donghua University,
2999 North Renmin Road, Shanghai 201620, China
b
Department of Orthopedics, Shanghai Pudong Hospital, Fudan University Pudong Medical Center, Shanghai 201301, China
c
Department of Radiology, Shanghai Tenth People's Hospital, School of Medicine, Tongji University, Shanghai 200072, China

H I GH L IG H T S G R A P H I C A L A B S T R A C T

• The hybrid organic/inorganic scaf-

folds were fabricated by 3D printing
technology.
• Strontium-containing hydroxyapatite
(SrHA) served as the inorganic com-
ponent.
• Srosteogenic
element enhanced proliferation and
differentiation of BMSCs in
vitro.
• Srtionelement enhanced bone regenera-
in the cranial defect of SD rats.

A R T I C LE I N FO A B S T R A C T

Keywords: Strontium-containing hydroxyapatite (SrHA) is a promising material for bone repair and bone replacement due
3D printing technology to the similar inorganic components with natural bone. In this study, the poly(ɛ-caprolactone) (PCL)/SrHA
Strontium composite scaffold was fabricated by 3D printing method. Scanning electron microscopy (SEM) images of the
Composite scaffold fabricated scaffolds showed that SrHA was uniformly embedded in the interior of scaffold struts, and in vitro
Ions release
release profiles revealed that Sr and Ca ions released from the PCL/SrHA scaffold in a sustained manner. To
Bone regeneration
confirm the performance of the fabricated composite scaffolds for bone regeneration, the cell proliferation and
osteogenic differentiation of rat bone marrow-derived mesenchymal stem cells (BMSCs) grown on the scaffolds
were evaluated. The experimental results indicated that incorporation of SrHA in the 3D printed PCL scaffold
significantly facilitated the cell proliferation, and the PCL/SrHA scaffolds induced higher levels of BMSCs dif-
ferentiation compared to the PCL and PCL/HA scaffolds, as demonstrated by ALP activity and osteo-related gene
expression. Furthermore, in vivo cranial defect experiments further revealed that the incorporation of SrHA into
3D printed PCL scaffold was capable of promoting bone regeneration. Taken together, these results indicate that
the PCL/SrHA composite scaffold can be readily fabricated by 3D printing technology and is highly promising as
implantable material for bone tissue engineering application.

1. Introduction bone tumors and bone loss by trauma [1]. However, traditional bone
grafts such as autografts, allografts and xenografts can not completely
There is a huge clinical demand for bone grafts due to the high meet the clinical requirements. For instance, autografts is commonly
incidence of bone defects, which are mainly caused by bone infections, limited by the donor shortage and donor site morbidity, whereas

⁎
Corresponding author.
E-mail address: hcl@dhu.edu.cn (C. He).

https://doi.org/10.1016/j.cej.2019.01.015
Received 24 September 2018; Received in revised form 18 December 2018; Accepted 3 January 2019
Available online 03 January 2019
1385-8947/ © 2019 Elsevier B.V. All rights reserved.
D. Liu et al.
allografts and xenografts are restricted by the potential risk of disease
transmission and immune response [2]. Bone tissue engineering has
emerged as a promising approach to construct bone graft substitutes
that aims to overcome these shortcomings [3,4]. An ideal bone scaffold
should not only provide structural support for implanted cells, but also
offer favorable osteogenic activity to regulate cell responses and pro-
mote tissue repair [5]. Therefore, it is highly desirable to develop new
bioactive materials with capacity of inducing osteogenesis for bone
tissue engineering applications.
3D printing technology can be used to fabricate porous scaffolds
with controllable shape conveniently. It has been widely used in the
fields of biomaterials and bone tissue engineering [6–11]. However, the
3D printed constructs made from single biomaterials have some short-
comings, such as destitute bioactivity, insufficient wear resistance, and
undistinguished bone induction and so on. When two or more bioma-
terials are combined organically, each component of the composites not
only keeps the relative independence of the properties, but also com-
plements each other's strengths and weaknesses, thus greatly con-
quering the shortcomings in the application of a single material.
Therefore, the fabrication of composite inorganic/organic bone scaffold
with excellent bioactivity has been became an inevitable research trend
[12]. The inorganic ingredients used in the current printed scaffold are
mostly bioceramics with good biological activity such as β-Tricalcium
phosphate (β-TCP) and hydroxyapatite (HA), and so on. Nevertheless,
these components have certain limitations such as slow degradation
rate, single bone induction performance, etc [12–15]. Xu et al. [16]
collected the relevant data of goat femurs defect location through
computed tomography (CT), and then utilized CT-guided fused de-
position modeling (FDM) to fabricate poly(ɛ-caprolactone) (PCL)/HA
artificial bones to mimic natural goat femurs. They showed the similar
mechanical properties with the natural bones, but the single therapeutic
ability limits their clinical application. Hence, researchers became in-
terested in exploring new printing and adding inorganic components for
composite bioactive scaffold.
Combining trace elements in human body plays an important role in
bone bonding. It is therefore an important potential research focus area
that introduction of trace elements (such as strontium, magnesium,
zinc, silver, silicon, etc.) into scaffolds for enhanced bone tissue re-
generation. As the analogous element of calcium, strontium can replace
calcium in hydroxyapatite as strontium apatite solid solution material
for bone tissue repair. Strontium-containing hydroxyapatite (SrHA)
bone cement obtained by replacing part of calcium in HA with low dose
strontium (generally < 10%) not only changes its dissolution kinetics
and improves biodegradability, but also has better biocompatibility
than pure bone cement, and even improves bone induction ability to a
certain extent [17,18]. SrHA can promote osteoblast activity, promote
proliferation and enhance ALP activity [18,19]. However, the SrHA as a
bioactive component used in the 3D printed scaffolds is rarely reported.
In this study, the PCL/SrHA composite scaffold was fabricated by 3D
printing of blend of PCL and SrHA. The SrHA was synthesized, then the
physicochemical properties of the SrHA nanoparticles were evaluated
and their biocompatibility was investigated by in vitro studies. To op-
timize the incorporated content of SrHA in printed PCL scaffold, com-
posite printed scaffolds containing different content of SrHA were
prepared and characterized. Conclusively, based on the bionic concept,
3D printed PCL/SrHA scaffold was prepared to mimic the organic/in-
organic components in the natural bone tissue using motor assisted
manufacturing (MAM). The physicochemical properties and strontium
release behavior of the 3D printed scaffolds were evaluated.
Furthermore, the in vitro osteogenic properties of the 3D printed scaf-
folds and their in vivo performance in a Sprague Dawley (SD) rat skull
bone segmental defect model were investigated.
270
Chemical Engineering Journal 362 (2019) 269–279
2. Materials and methods
2.1. Materials
Tetrahydrofuran (THF) and PCL were purchased from Sigma-
Aldrich Trading Co., Ltd. (Shanghai, China). Strontium nitrate (Sr
(NO3)2), calcium dinitrate tetrahydrate (Ca(NO3)2·4H2O), ammonium
dihydrogen phosphate (NH4H2PO4) and ammonium hydroxide
(NH4OH) were obtained from Sinopharm Chemical Reagent Co., Ltd.
(Shanghai, China). ATCC-formulated Eagle's Minimum Esscaffoldial
Medium (MEM), Dulbcco's modified eagle's medium/nutrient mixture
F-12 (DMEM/F-12), fetal bovine serum (FBS), penicillin, streptomycin
and phosphate buffer saline (PBS) were provided from Gibco (Grand
Island, USA). Cell Counting Kit-8 (CCK-8) was obtained from Beyotime
Biotechnology Co., Ltd. (Shanghai, China). Calcein AM, cell lysis buffer,
TRIeasy total RNA extraction reagent, Hieff™ first strand cDNA synth-
esis kit and HieffTM qPCR SYBR Green master mix (Low Rox Plus) kit
were obtained from Yeasen biotech Co., Ltd. (Shanghai, China).
Alkaline phosphatase (ALP) assay kit was purchased from Beyotime
Institute of Biotechnology (Shanghai, China). ICR laboratory mice and
Sprague-Dawley rats were ordered from Slac Laboratory Animal, Co.,
Ltd. (Shanghai, China). High purity deionized water (18.2 MΩ·cm) ob-
tained from a Millipore system (Millipore Corp., Bedford, MA, USA) was
used throughout this work and all other chemicals were of analytical
grade.
2.2. Synthesis and characterization of SrHA
According to previous report [20], SrHA nanoparticles were pre-
pared by hydrothermal method with the substitution degree, respec-
tively, at 0 (Sr0HA or HA), 10 (Sr10HA), and 100% (Sr100HA). The
morphology of SrHA nanoparticles was observed by transmission
electron microscopy (TEM, JEOL, JEM-2010) at 200 kV. The average
length of SrHA nanoparticles was obtained from the measurements on a
typical TEM image using Image J 1.40G software (NIH, USA). X-ray
diffraction (XRD) patterns of nanoparticles were obtained with a D/
max-2500 PC diffractometer (Rigaku Co., Japan) using Cu/Kα radiation
with a wavelength of 0.154 nm at 40 kV and 200 mA over the range of
5–60°. Then, the atomic concentrations of key elements (Ca and Sr)
were quantified by the energy dispersive X-ray spectrometry (EDS,
JEOL JSM-6701F) analysis. Subsequently, the extracts of the SrHA na-
noparticles were first prepared by immersing each test material with
the concentration of 0.1 g·mL−1 in cell culture medium at 37 °C for
24 h. Finally, proliferation assay and ALP activity of BMSCs in the ex-
tracts of the SrHA were measured. The effect of dissolution ions on cell
proliferation was evaluated with Cell Counting Kit-8 (CCK-8) assay and
ALP activity was normalized to total protein measured with the Bio-Rad
protein assay (Shanghai, China).
2.3. Fabrication and characterization of 3D printed scaffold
Firstly, we prepared the composite raw materials for 3D printing. To
optimize the incorporated content of SrHA in printed PCL scaffold,
composite printed scaffolds containing different content of SrHA were
prepared. Briefly, nanoparticles and PCL with varying weight ratios
(0:100, 10:90, 30:70 and 50:50) were weighed, and then THF was
added to dissolve PCL at room temperature under magnetic stirring
until the nanoparticles were dispersed homogeneously in the PCL/THF
solution (10% w/v). Then the solution was quickly poured into the
molds and vigorously stirred to evaporate the THF. In order to remove
the residual THF, the composite raw materials were exposed to a ven-
tilated place for 3 days before the printing process. Subsequently, the
scaffolds were designed with a reconstruction software model and ex-
ported in STL format, which was the standard format used by a 3D
printing machine (Motor Assisted Microsyringe, Fochif Mechatronics
Technology Co., Ltd). Melt blending filament were extruded through a
D. Liu et al. Chemical Engineering Journal 362 (2019) 269–279

Table 1
Primer sequences used for PCR amplification.
Rat gene Primer sequences (5′-3′) Product size (bp)

Col1A1 Forward 5′ TCAAGATGGTGGCCGTTACT 3′ Reverse 5′ CATCTTGAGGTCACGGCATG 3′ 166

OCN Forward 5′ AATAGACTCCGCGCTACCTC 3′ Reverse 5′ GCTAGCTCGTCACAATTGGG 3′ 112
RUNX2 Forward 5′ ACGTACCCAGGCGTATTTCA 3′ Reverse 5′ GCTGGATAGTGCATTCGTGG 3′ 187
OPN Forward 5′ AGCCATGAGTCAAGTCAGCT 3′ Reverse 5′ ACTCGCCTGACTGTCGATAG 3′ 183
GADPH Forward 5′CAAGTTCAACGGCACAGTCA 3′ Reverse 5′ CCCCATTTGATGTTAGCGGG 3′ 102

Fig. 1. Schematic diagram representing the preparation of PCL/SrHA scaffold for bone tissue engineering.

heated metal nozzle at suitable temperature and deposited onto a re-
ceiving station to form the desired scaffolds. The obtained 3D printed
scaffolds were respectively labeled as PCL/0SrHA, PCL/10SrHA, PCL/
30SrHA and PCL/50SrHA according to the SrHA content in the com-
posite scaffold. Briefly, the composite raw materials were loaded into
the extrusion chamber and heated to suitable temperature (PCL/0SrHA
at 80 °C, PCL/10SrHA at 95 °C, PCL/30SrHA at 120 °C and PCL/50SrHA
at 200 °C). The 0/90° lay-down pattern of the scaffolds was adopted to
obtain square pores. In addition, the internal diameter of used nozzle
was 330 µm. The slice thickness was set as 300 µm and the distance
between center lines of two adjacent parallel strands was set as 500 µm.
Then the surface morphology of the obtained 3D printed scaffolds was
characterized using a scanning electron microscope (SEM, JSM-5600,
Japan).
Next, the compressive mechanical properties of the 3D printed
scaffolds were measured using a universal material testing machine
(H5K-S, Hounsfield, UK). The speed of cross-head was set as 10 mm/
min. The thermogravimetric analysis (TGA) was employed to evaluate
the weight loss of the samples in air from the room temperature to
600 °C at a heating rate of 10 °C min−1 using a thermal analyzer (TG
209 F1, Germany). The in vitro release of Sr2+ and Ca2+ were studied as
follows: The 3D printed scaffolds were first cut into pieces with about
10 mg, then 10 mg sample was dispersed in 10 mL phosphate buffer (pH
7.4) containing 0.02% sodium azide (NaN3) as preservative. The sample
suspensions were placed in a thermostatic shaker with the rotate speed
of 100 rpm at 37 °C. At every predetermined time, 10 mL released
medium was collected by centrifugation and another 10 mL fresh PBS
was added. Then, the ionic concentrations of Sr2+ and Ca2+ in the
graded extracts were investigated by inductively coupled plasma-
atomic emission spectroscopy (ICP-AES) [21].
2.4. In vitro cell culture
Rat bone marrow mesenchymal stem cells (BMSCs) were obtained
from bone marrow of SD rats according to the previous report [22]. The
cells were cultured in DMEM/F12 with 10% fetal bovine serum (FBS)
and 1% penicillin-streptomycin in an incubator at 37 °C with 5% CO2.
For in vitro study, the 3D printed scaffolds were placed in an airtight
container with 75% ethanol for 12 h. After being sterilized, the scaffolds
were placed into 48-well culture plates and washed three times with
phosphate buffered saline (PBS) to remove the residual ethanol.
Typically, 105 BMSCs suspended in 500 μL DMEM/F12 medium was
added into each well. At the designated time points, cell proliferation
and morphologies were assessed.
The proliferation of BMSCs on the scaffolds was tested using a
standard CCK-8 assay at 1, 3 and 7 days. Briefly, the cell medium was
discarded and DMEM (0.5 mL) containing 10% CCK-8 was added into
each well. After incubation for 2 h at 37 °C, 100 μL of the above solution
was taken out from each well and added to a fresh 96-well plate. The
absorbance was monitored at 450 nm using a microplate reader. Also,
the cells were stained with 300 μL growth medium solution containing
500 nM calcein-AM for 30 min at 37 °C and observed by fluorescence
microscope. Three specimens were tested for each sample.
2.5. Osteogenic induction
The osteogenic differentiation of BMSCs on scaffolds was evaluated
as previously described [23]. A total of 105 BMSCs were seeded onto
each scaffold and cultured in growth medium. After 1 day, the medium
was replaced with osteogenic differentiated medium to induce differ-
entiation. The osteogenic differentiated medium was changed every
2 days. The differentiation was assessed by ALP activity and osteogenic
gene expression.
ALP activity as an early osteogenic differentiation marker was
measured by using the ALP assay kit (Shanghai, China). Briefly, BMSCs
were cultured on each 3D printed scaffold in osteogenic differentiated
medium for 7 and 14 days. Then the cells were washed 3 times with PBS
to remove the medium. After that, 300 μL of 0.2% Triton X-100 cell
lysis buffer was added to the well and the scaffolds were then homo-
genized in 4 °C. The mixture was subjected to sonication and

271
D. Liu et al.
Fig. 2. Characterization of synthesized SrHA. (A) TEM images, (B) the length, (C) XRD patterns and (D) EDS spectrum of SrHA. *: p < 0.05, **: p < 0.01.
centrifuged at 13000 rpm for 15 min under 4 °C. Then the ALP activity
and total protein from the supernatant were respectively determined by
the ALP and BCA assay kit according to the manufacturer's instructions.
The relative ALP activity was normalized to the protein concentration
of each sample.
The osteogenic gene expression of BMSCs on 3D printed scaffolds,
including Collagen Type I Alpha 1 (Col1A1), osteocalcin (OCN), runt-
related transcription factor 2 (RUNX2) and osteopontin (OPN) were
detected by quantitative real-time reverse transcription polymerase
chain reaction (qRT-PCR, 7500, Applied Biosystems, Foster City, CA).
At 7, 14 and 21 days, the total RNA was extracted using Trizol reagent
(Invitrogen, USA) and purified by Deoxyribonuclease I. Complementary
DNA (cDNA) was then synthesized using a Hieff™ First Strand cDNA
Synthesis Kit in a thermal cycler (T100, Bio-rad). Oligonucleotide pri-
mers for the PCR were designed for osteogenic specific genes as de-
scribed in Table 1, using glyceraldehydes-3-phosphatedehydrogenase
(GADPH) as internal control gene for normalization. Real-time PCR was
performed using the 7500 Fast Real-Time PCR System (Applied Bio-
systems, Bedford, MA, USA) to determine mRNA expression of each
gene by a HieffTM qPCR SYBR Green Master Mix (Low Rox Plus) Kit.
2.6. In vivo bone regeneration
A total of 21 adult SD rats weighing around 180 g (obtained from
Slac laboratory animal Co., Ltd. Shanghai, China) were used and ran-
domly divided into three different treatment groups (n = 7 per group):
(1) PCL scaffold, (2) PCL/HA scaffold, and (3) PCL/SrHA scaffold. The
use of SD rats and the animal surgery experimental protocols were
performed in compliance with the Institutional Animal Care and Use
Committees (IACUC) guidelines.
For assessing the bone regeneration in an orthotopic model, the SD
rats were anaesthetized and a cranial bone defect model was con-
structed. Briefly, the fur over the skull of the animals was shaved and a
sagittal incision was made on the scalp, then the cranium was exposed
by blunt dissection. For each animal, the underlying periosteum was
sharply incised and the calvarial bone defect was created on one side of
the skull by a 5-mm diameter trephine bur under low speed drilling
272
Chemical Engineering Journal 362 (2019) 269–279
with continuous cool PBS [23]. This size of defect was chosen because it
is the ‘critical size’: a defect of this size does not heal by itself without
intervention [24]. In this study, the skull of each mouse was drilled
with two defect holes, and the scaffold was implanted on the left side
for repair, while the hole on the right side was used as a blank control to
observe the repair effect.
The 3D printed scaffolds were cut and treated with UV light for
sterilization prior to implantation. The prepared scaffolds were im-
planted into the defects, and the control group was left untreated. In all
animals, after washed with the 0.9% saline rinse, the periosteum and
the subcutaneous tissue were closed sequentially using the sutures.
After operation, the animals were kept on a surgical bed until they
awoke and had free access to food and water thereafter. At the end of
the experiment, the animals were euthanatized with overdose pento-
barbital injection and the scaffolds with surrounding tissue were col-
lected for histological examination.
In order to observe the osteogenesis of different scaffolds in rat
cranial defects, the scan was acquired with a high-resolution Triumph
small animal microcomputed tomography (micro-CT) scanner (Gamma
Medica, USA) at 12 weeks. After scanning, the original data is imported
into GEHC Microview software (GE Healthcare BioSciences, Chalfont
St. Giles, UK) to reconstruct 3D images.
After micro-CT analysis of the samples, the rats were sacrificed at
predetermined time points. The specimens were fixed in 10% formalin
for 48 h, washed with PBS several times, dehydrated in a series of
graded alcohol and embedded in paraffin and sectioned at a thickness
of 6 μm. Serial sections were stained with haematoxylin & eosin (H&E)
and Masson’s trichrome staining (Masson) and the stained sections were
visualized under a light microscope (Leica, Italy).
2.7. Statistical analysis
Statistical analyses were performed using Origin 9.0 (OriginLab,
USA). Statistical significance was assessed by using one way analyses of
variance (ANOVA) and Tukey’s multiple comparison tests. The data was
considered significant only if the p < 0.05: * indicates p < 0.05, and
** represent p < 0.01. All data were showed as the mean value ±
D. Liu et al.
Fig. 3. In vitro BMSCs culture in the extracts of the various SrHA. (A) Living cells staining, (B) CCK-8 assay, (C) ALP activity. *: p < 0.05.
standard deviation.
3. Results and discussion
In this study, 3D printed PCL/SrHA scaffold was prepared using
MAM. The in vitro mechanical properties, in vitro cell biocompatibility,
and in vivo performance of the 3D printed PCL/SrHA scaffold in a SD rat
skull bone segmental defect model were investigated (Fig. 1).
3.1. Synthesis and characterization of SrHA
First, the SrHA nanoparticles were first prepared by hydrothermal
method. The characterization analysis of SrHA nanoparticles were
shown in Fig. 2. As showed in Fig. 2A, the TEM images revealed that the
273
Chemical Engineering Journal 362 (2019) 269–279
SrHA nanoparticles possessed the similar rod-like shape as HA nano-
particles. The length of nanoparticles were measured and showed in
Fig. 2B. As shown, the length of Sr10HA nanoparticles
(67.46 ± 16.19 nm) was smaller than that of HA nanoparticles
(79.07 ± 11.18 nm) when Sr substitution degree was only 10%.
However, the length of Sr100HA nanoparticles obviously increased to
195.43 ± 19.27 nm when Sr substitution degree increased to 100%.
The results were in accordance with the previous report that low Sr
replacement to Ca in hydroxyapatite decreased the length of nano-
particles, whereas relatively high Sr content increased the length of
nanoparticles [25]. In addition, the XRD patterns of nanoparticles
showed that all the SrHA were consistent with the presence of HA as a
unique crystalline phase (Fig. 2C). But the XRD peaks for Sr-contained
HA nanoparticles, especially for Sr100HA, shifted slightly to the smaller
D. Liu et al.
Fig. 4. Characterization of 3D printed PCL/SrHA scaffolds with various SrHA content. (A) SEM images, (B) compressive stress-strain curves and (C) TGA curves.
angle, which was mainly attributed to the larger ionic radius of Sr in the
SrHA nanoparticles [20]. The presence of Sr element in SrHA nano-
particles can be detected by EDS analysis (Fig. 2D). The measured Sr/
(Ca + Sr) ratios were close to the intended values, and the (Ca + Sr)/P
ratio close to the stoichiometric value, 1.67. All of these results de-
monstrated that SrHA nanoparticles were successfully synthesized in
our work.
In order to optimize the incorporated content of Sr in HA, the
proliferation assay and ALP activity of BMSCs cultured in the extracts of
the various SrHA were measured (Fig. 3). The cells viability was first
qualitatively monitored by living cells staining using Calcium-AM. The
result showed that BMSCs could grow in all of the extracts (Fig. 3A). But
the quantitative result of cell proliferation measured by CCK-8 showed
that that prepared Sr10HA (with 10 mol% Ca2+ replaced by Sr2+) en-
hanced BMSCs proliferation after culture for 5 days (Fig. 3B). While the
Sr100HA (with 100 mol% Ca2+ replaced by Sr2+) showed the suppres-
sion effect on BMSCs proliferation. Similarly, the result of ALP activity
showed BMSCs cultured in the extracts of the Sr10HA possessed the
highest expression of ALP (Fig. 3C). The above results are in accordance
with those in a previous study [20]. The possible reason is that Sr with
low content enhances both the biocompatibility and bioactivity of
biomaterials, while Sr with high content appears detrimental. There-
fore, Sr10HA was used for following studies and named SrHA.
3.2. Fabrication and characterization of 3D printed scaffolds
Next, in order to optimize the incorporated content of SrHA in the
3D printed PCL scaffold, the 3D printed PCL/SrHA scaffolds with var-
ious SrHA content were prepared and characterized (Fig. 4). The
274
Chemical Engineering Journal 362 (2019) 269–279
morphology of 3D printed scaffolds was firstly observed by SEM. As
shown in Fig. 4A, no SrHA nanoparticles were found on the surface of
PCL/0SrHA, but they were visible on the surface of PCL/10SrHA, PCL/
30SrHA and PCL/50SrHA printed scaffolds. However, as the amount of
SrHA increased from 0 to 50%, the required temperature for printing
process became higher, such as PCL/50SrHA required a temperature of
200 °C for printing. If the printing temperature is too high, it would
oxidize the PCL/SrHA composites, which would make the printing
process become more difficult. Simultaneously, the compressive me-
chanical properties of the printed scaffolds were investigated. As shown
in Fig. 4B, the mechanical characterization indicated that the yielding
stress can increase when adding SrHA to PCL, but the composite be-
came brittle when adding 50% SrHA to the PCL scaffold. The contents
of inorganic and organic components in the 3D printed scaffolds were
analyzed by thermogravimetric analysis (TGA), and the results were
shown in Fig. 4C. As shown, at the temperature of 600 °C, there is no
residual substance for pure PCL scaffold, indicating this scaffold was
composed of organic component and completely thermal-decomposed
at the high temperature. The solid residue of inorganic material for
PCL/0SrHA, PCL/10SrHA, PCL/30SrHA and PCL/50SrHA were 4.36 wt
%, 12.40 wt%, 30.65 wt% and 47.49 wt%, respectively, which are ba-
sically consistent with the proportion of inorganic components in
composites.
According to the above results, introduction of 30% SrHA endowed
the 3D printed composite scaffold with biomimetic chemical composi-
tion for native bones and the best biomechanics among all PCL/SrHA
scaffolds with various SrHA contents. Therefore, 3D printed PCL/SrHA
scaffold with weight ratio of 70:30 was used for following studies.
Meanwhile, the 3D printed PCL/HA scaffold with the same weight ratio
D. Liu et al. Chemical Engineering Journal 362 (2019) 269–279

Fig. 5. SEM images of 3D printed PCL, PCL/HA and PCL/SrHA scaffolds. The inorganic nanoparticles content in the composite scaffold was 30%. SrHA refers to
Sr10HA.

Fig. 6. Ion release behavior from 3D printed PCL/SrHA and PCL/HA scaffolds. The inorganic nanoparticles content in the composite scaffold was 30%. SrHA refers to
Sr10HA. (A) Strontium release curves, (B) calcium release curves.

275
D. Liu et al. Chemical Engineering Journal 362 (2019) 269–279

Fig. 7. The growth of BMSCs cultured on 3D printed scaffolds. The inorganic nanoparticles content in the composite scaffold was 30%. SrHA refers to Sr10HA. (A)
Living cells staining of BMSCs cultured on the scaffold, (B) cell proliferation measured by CCK-8 assay, (C) ALP activity of BMSCs cultured on the 3D printed scaffolds
for 7 and 14 days. *: p < 0.05, **: p < 0.01.

and the 3D printed PCL scaffold were prepared as positive control and scaffold, the calcium ions release quantity from the PCL/SrHA scaffold
negative group. was close to that released from the PCL/HA scaffold. That is mainly
The morphology of 3D printed scaffolds was observed by SEM because the dissolubility of the strontium hydroxyapatite is better than
(Fig. 5). As shown in Fig. 5, all of these scaffolds possessed well-defined the hydroxyapatite, thus accelerating the release rate of calcium ions,
orthogonal structure with macropores. The macropore size was about which coincided with the phenomena described in the published lit-
200 μm and large enough for cells infiltration. Additionally, the pure eratures [17,18].
PCL scaffold has a smooth surface, while the section of the PCL/HA and
PCL/SrHA scaffolds is evenly distributed with a large number of white
3.3. In vitro cell biocompatibility studies
particles, indicating that the HA and SrHA nanoparticles have been
successfully incorporated into the PCL bulks.
In order to evaluate the proliferation of BMSCs on the 3D printed
Next, the release of Sr2+ and Ca2+ from 3D printed PCL/HA scaf-
scaffolds, cells were seeded on the scaffolds and cultured. The growth of
folds and PCL/SrHA scaffolds was evaluated (Fig. 6). As shown in
BMSCs was first assessed qualitatively by living cells staining and ob-
Fig. 6A, no Sr2+ release was observed for the PCL/HA scaffold. Fur-
served using a fluorescence microscope, and the results were shown in
thermore, the release trend of Ca2+ from PCL/HA and PCL/SrHA
Fig. 7A. From the fluorescence images, BMSCs were successfully at-
scaffold was almost identical (Fig. 6B). Although the Ca content in the
tached to the scaffolds with the round shape after culture for 1 day.
PCL/SrHA scaffold was relatively lower than that in the PCL/HA
With the prolongation of culture time, cells showed the increasing

276
D. Liu et al.
Fig. 8. The osteogenic-related gene expression ratio in BMSCs cultured on the
3D printed PCL/SrHA and PCL/HA scaffold for 7, 14, and 21 days. The in-
organic nanoparticles content in the composite scaffold was 30%. SrHA refers to
Sr10HA.
Fig. 9. Micro-CT images and 3-D reconstruction images of SD rats’ skull defects
after treatment with different 3D printed scaffolds for 12 weeks.
numbers on the scaffolds with the elongation and spread shape.
The proliferation of BMSCs on the 3D scaffolds was also quantita-
tively detected by CCK-8. As shown in Fig. 7B, the absorbance value for
each group increased with the culture time, meaning BMSCs pro-
liferation on these scaffolds. There is no obvious difference of absor-
bance value between the three groups after culture for 3 days. However,
after culture for 7 days, the absorbance value for the 3D printed PCL
scaffold was significantly less than that on other two groups. More
importantly, the absorbance value for PCL/SrHA scaffold was higher
than that of PCL/HA scaffold, implying the better proliferation behavior
of BMSCs on Sr-contained scaffold. All those results indicated that the
3D printed bone scaffolds have good biocompatibility and the in-
troduction of HA and SrHA can promote BMSCs proliferation. However,
there is no statistical difference of the two inorganic nanomaterials on
the BMSCs proliferation.
The ALP activity of BMSCs cultured on the 3D printed scaffolds for
7 days and 14 days was measured and shown in Fig. 7C. As shown, there
was no significant difference of ALP activity between each group after
culture for 7 days. But after culture for 14 days, the ALP activity for
PCL/SrHA scaffold showed an obvious up-regulation compared with
that for other two groups, indicating that 3D printed PCL/SrHA scaffold
could promote ALP activity of BMSCs.
Then the osteogenic-related gene expression of BMSCs on PCL/SrHA
277
Chemical Engineering Journal 362 (2019) 269–279
scaffold and PCL/HA scaffold was also investigated. After induction and
culture for 7, 14 and 21 days, the expression of osteogenic marker genes
was detected by RT-PCR. Fig. 8 shows the relative mRNA expression
ratio on PCL/SrHA scaffold and PCL/HA scaffold. As shown, after cul-
ture for 7 days, the relative mRNA expression ratios for four genes (Coll
A1, OCN, RUNX2 and OPN) were close to 1, meaning similar expression
level of these osteogenic-related genes on both of PCL/SrHA scaffold
and PCL/HA scaffold. However, after continue culture for more than
14 days, the expression ratio of the four genes, especially OCN, is much
larger than 1, which means that more mRNA of osteogenic-related
genes was expressed on the PCL/SrHA scaffold than that on the PCL/HA
scaffold. In other word, the expression levels of the osteogenic-related
genes for the 3D printed PCL/SrHA scaffold were obviously up-regu-
lated than those for the 3D printed PCL/HA scaffold. The above results
showed that 3D printed PCL/SrHA scaffolds could enhance the osteo-
genic differentiation of BMSCs compared with 3D printed PCL/HA
scaffolds.
3.4. In vivo bone regeneration studies
SD rat skull defect model was used to evaluate the osteogenic po-
tential of the 3D printed scaffold in vivo. Micro-CT was used to evaluate
the repair of bone defects after implantation for 12 weeks. Obviously,
the repair performance of bone defect treated with scaffolds was better
than the blank group. Especially, the 3D printed PCL/SrHA scaffold
showed the best repair effect for bone defect (Fig. 9). The reason is that
not only calcium ions but also strontium ions are released from the
PCL/SrHA scaffold during the repair progress, and the best repair effect
is achieved under the double effect.
The ability of new bone formation in skull defect can be examined
by histological staining including H&E and Masson staining (Fig. 10). In
Fig. 10A, the H&E staining images showed that there are some soft
tissues in the defect without any treatment, and no obvious in-
flammatory reaction was observed after the scaffold was implanted in
the defect, indicating that the 3D printed scaffolds have good bio-
compatibility. In addition, after 12 weeks implantation, the bone defect
treated with 3D printed PCL/SrHA scaffold showed more new bone
formation than the other groups.
Fig. 10B showed the Masson staining of slices for the different
samples after implantation for 12 weeks. The area around the defect for
all the experimental groups was stained with blue color due to the
presence of collagen fibers in the native bones. After implantation for
12 weeks, a large number of osteoblasts in the scaffold group trans-
formed into osteoid and collagen, which showed the good repair per-
formance of the 3D printed scaffolds. Notably, the most collagen was
produced in the defect which was treated with 3D printed PCL/SrHA
scaffold, indicating the 3D printed PCL/SrHA scaffold showed the best
osteogenic activity in vivo.
4. Conclusion
In summary, 3D printed PCL/SrHA bone scaffold was prepared by
using PCL and SrHA, aiming to simulate the natural bone components.
Owing to the introduction of SrHA, the 3D printed PCL/SrHA scaffold
exhibited significant osteogenic activity both in vitro and in vivo. It can
simultaneously release strontium ions and calcium ions to promote
osteogenesis repair. In conclusion, 3D printed PCL/SrHA bone scaffold
is a potential material for bone defect repair.
Acknowledgements
This work was financially supported by the National Key Research
and Development Program of China (2018YFB1105602), Fundamental
Research Funds for the Central Universities (2232018A3-07), National
Natural Science Foundation of China (31570984, 31771048),
International Cooperation Fund of the Science and Technology
D. Liu et al.
Fig. 10. (A) H&E and (B) Masson staining of SD rats’ skull defects after treatment with different 3D printed scaffolds for 12 weeks.
Commission of Shanghai Municipality (15540723400).
References
[1] A. Berner, J.C. Reichert, M.B. Muller, J. Zellner, C. Pfeifer, T. Dienstknecht,
M. Nerlich, S. Sommerville, I.C. Dickinson, M.A. Schutz, B. Fuchtmeier, Treatment
of long bone defects and non-unions: from research to clinical practice, Cell Tissue
Res. 347 (2012) 501–519.
[2] T.J. Webster, E.S. Ahn, Nanostructured biomaterials for tissue engineering bone,
Adv. Eiochem. Eng. Biot. 103 (2006) 275–308.
[3] R. Langer, J.P. Vacanti, Tissue engineering, Science 260 (1993) 920–926.
[4] V. Karageorgiou, D. Kaplan, Porosity of 3D biomaterial scaffolds and osteogenesis,
Biomaterials 26 (2005) 5474–5491.
[5] S. Fu, P. Ni, B. Wang, B. Chu, J. Peng, L. Zheng, X. Zhao, F. Luo, Y. Wei, Z. Qian, In
vivo biocompatibility and osteogenesis of electrospun poly(epsilon-caprolactone)-
poly(ethylene glycol)-poly(epsilon-caprolactone)/nano-hydroxyapatite composite
scaffold, Biomaterials 33 (2012) 8363–8371.
[6] A. Butscher, M. Bohner, S. Hofmann, L. Gauckler, R. Muller, Structural and material
approaches to bone tissue engineering in powder-based three-dimensional printing,
Acta Biomater. 7 (2011) 907–920.
[7] H.W. Kang, S.J. Lee, I.K. Ko, C. Kengla, J.J. Yoo, A. Atala, A 3D bioprinting system
to produce human-scale tissue constructs with structural integrity, Nat. Biotechnol.
34 (2016) 312–319.
[8] Y. Zhang, L. Xia, D. Zhai, M. Shi, Y. Luo, C. Feng, B. Fang, J. Yin, J. Chang, C. Wu,
Mesoporous bioactive glass nanolayer-functionalized 3D-printed scaffolds for ac-
celerating osteogenesis and angiogenesis, Nanoscale 7 (2015) 19207–19221.
[9] H.S. Ma, C.A. Jiang, D. Zhai, Y.X. Luo, Y. Chen, F. Lv, Z.F. Yi, Y. Deng, J.W. Wang,
J. Chang, C.T. Wu, A bifunctional biomaterial with photothermal effect for tumor
therapy and bone regeneration, Adv. Funct. Mater. 26 (2016) 1197–1208.
[10] C.J. Deng, Q.Q. Yao, C. Feng, J.Y. Li, L.M. Wang, G.F. Cheng, M.C. Shi, L. Chen,
J. Chang, C.T. Wu, 3D printing of bilineage constructive biomaterials for bone and
cartilage regeneration, Adv. Funct. Mater. 27 (2017) 1703117.
[11] W.J. Zhang, C. Feng, G.Z. Yang, G.L. Li, X. Ding, S.Y. Wang, Y.D. Dou, Z.Y. Zhang,
J. Chang, C.T. Wu, X.Q. Jiang, 3D-printed scaffolds with synergistic effect of
hollow-pipe structure and bioactive ions for vascularized bone regeneration,
278
Chemical Engineering Journal 362 (2019) 269–279
Biomaterials 135 (2017) 85–95.
[12] J.K. Sherwood, S.L. Riley, R. Palazzolo, S.C. Brown, D.C. Monkhouse, M. Coates,
L.G. Griffith, L.K. Landeen, A. Ratcliffe, A three-dimensional osteochondral com-
posite scaffold for articular cartilage repair, Biomaterials 23 (2002) 4739–4751.
[13] J. Braux, F. Velard, C. Guillaume, S. Bouthors, E. Jallot, J.M. Nedelec, D. Laurent-
Maquin, P. Laquerriere, A new insight into the dissociating effect of strontium on
bone resorption and formation, Acta Biomater. 7 (2011) 2593–2603.
[14] A. Matsuo, H. Chiba, H. Takahashi, J. Toyoda, H. Abukawa, Clinical application of a
custom-made bioresorbable raw particulate hydroxyapatite/poly-L-lactide mesh
tray for mandibular reconstruction, Odontology 98 (2010) 85–88.
[15] A.E. Jakus, A.L. Rutz, S.W. Jordan, A. Kannan, S.M. Mitchell, C. Yun, K.D. Koube,
S.C. Yoo, H.E. Whiteley, C.P. Richter, Hyperelastic “bone”: A highly versatile,
growth factor-free, osteoregenerative, scalable, and surgically friendly biomaterial,
Sci. Transl. Med. 8 (2016) 358ra127.
[16] N. Xu, X. Ye, D. Wei, J. Zhong, Y. Chen, G. Xu, D. He, 3D artificial bones for bone
repair prepared by computed tomography-guided fused deposition modeling for
bone repair, ACS. Appl. Mater. Interfaces 6 (2014) 14952–14963.
[17] J. Christoffersen, M.R. Christoffersen, N. Kolthoff, O. Bärenholdt, Effects of stron-
tium ions on growth and dissolution of hydroxyapatite and on bone mineral de-
tection, Bone 20 (1997) 47–54.
[18] G.X. Ni, B. Shu, G. Huang, W.W. Lu, H.B. Pan, The effect of strontium incorporation
into hydroxyapatites on their physical and biological properties, J. Biomed. Mater.
Res. Part B 100B (2012) 562–568.
[19] C. Capuccini, P. Torricelli, F. Sima, E. Boanini, C. Ristoscu, B. Bracci, G. Socol,
M. Fini, I.N. Mihailescu, A. Bigi, Strontium-substituted hydroxyapatite coatings
synthesized by pulsed-laser deposition: In vitro osteoblast and osteoclast response,
Acta Biomater. 4 (2008) 1885–1893.
[20] W. Zhang, Y. Shen, H. Pan, K. Lin, X. Liu, B.W. Darvell, W.W. Lu, J. Chang, L. Deng,
D. Wang, W. Huang, Effects of strontium in modified biomaterials, Acta Biomater. 7
(2011) 800–808.
[21] X.X. Yan, X.H. Huang, C.Z. Yu, H.X. Deng, Y. Wang, Z.D. Zhang, S.Z. Qiao, G.Q. Lu,
D.Y. Zhao, The in-vitro bioactivity of mesoporous bioactive glasses, Biomaterials 27
(2006) 3396–3403.
[22] W. Nie, C. Peng, X.J. Zhou, L. Chen, W.Z. Wang, Y.Z. Zhang, P.X. Ma, C.L. He,
Three-dimensional porous scaffold by self-assembly of reduced graphene oxide and
nano-hydroxyapatite composites for bone tissue engineering, Carbon 116 (2017)
D. Liu et al.
325–337.
[23] K. Qiu, B. Chen, W. Nie, X. Zhou, W. Feng, W. Wang, L. Chen, X. Mo, Y. Wei, C. He,
Electrophoretic deposition of dexamethasone-loaded mesoporous silica nano-
particles onto poly(L-lactic acid)/poly(epsilon-caprolactone) composite scaffold for
bone tissue engineering, ACS. Appl. Mater. Interfaces 8 (2016) 4137–4148.
279
View publication stats
Chemical Engineering Journal 362 (2019) 269–279
[24] P.P. Spicer, J.D. Kretlow, S. Young, J.A. Jansen, F.K. Kasper, A.G. Mikos, Evaluation
of bone regeneration using the rat critical size calvarial defect, Nat. Protoc. 7 (2012)
1918–1929.
[25] A. Bigi, E. Boanini, C. Capuccini, M. Gazzano, Strontium-substituted hydroxyapatite
nanocrystals, Inorg. Chim. Acta 360 (2007) 1009–1016.