doi:10.1111/j.1365-2591.2010.01786.
Effect of bioaggregate on differentiation of human
periodontal ligament fibroblasts
P. Yan, Z. Yuan, H. Jiang, B. Peng & Z. Bian
The State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) & Key Lab of Oral Biomedicine Ministry of
Education, School & Hospital of Stomatology, Wuhan University, Wuhan, China
Abstract
Yan P, Yuan Z, Jiang H, Peng B, Bian Z. Effect of bioaggre-
gate on differentiation of human periodontal ligament fibro-
blasts. International Endodontic Journal, 43, 1116–1121, 2010.
Aim To investigate the cytotoxicity of bioaggregate
(BA; Innovative Bioceramix, Vancouver, BC, Canada)
to human periodontal ligament (PDL) fibroblasts and its
effect on differentiation of human PDL fibroblasts and
to compare its performance to that of mineral trioxide
aggregate (MTA; Dentsply, Tulsa, OK, USA).
Methodology Cytotoxicity was assessed by 3-(4,5-
Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
(MTT) assay on days 1, 2, and 3 after incubation with
BA or MTA. The influence of BA and MTA on
differentiation of human PDL fibroblasts on days 3, 5,
and 7 was evaluated by gene expression of alkaline
phosphatase (ALP) and collagen type I (COLI) via
Introduction
An ideal root-end filling material should satisfy several
requirements: excellent biocompatibility, good sealing
ability, superior antibacterial effect, satisfactory ability
for tissue regeneration, sufficient radio-opacity, and user
friendly (Gartner & Dorn 1992). Because a root-end
filling material comes into contact with the surrounding
cells or tissues, understanding the cell–material interfa-
cial activity is important. For this reason, many studies
have focused on the biocompatibility of aggregate
Correspondence: Prof. Bin Peng and Prof. Zhuan Bian, The
State Key Laboratory Breeding Base of Basic Science of
Stomatology, (Hubei-MOST) & Key Lab of Oral Biomedicine
Ministry of Education, School & Hospital of Stomatology,
Wuhan University, 237 Luoyu Road, Wuhan 430079,
Wuhan, China (e-mails: phs301@vip.163.com; kqyywjtx@
hotmail.com).
1116 International Endodontic Journal, 43, 1116–1121, 2010
quantitative real-time polymerase chain reaction
(PCR). The data were analysed by one-way analysis
of variance followed by Tukey’s test.
Results Cell numbers in the BA group were similar to
that of the control group throughout the culture
period, whereas MTA suppressed the proliferation of
fibroblasts. ALP expression was significantly increased
in the BA group on day 7, whilst it was enhanced by
MTA on day 3. Gene expression of COLI was induced by
both BA and MTA compared to the control group.
Conclusions Bioaggregate was nontoxic to human
PDL fibroblasts and appeared to induce the differenti-
ation of human PDL fibroblasts.
Keywords: bioaggregate, cytotoxicity, differentia-
tion, periodontal ligament fibroblasts, root-end filling
material.
Received 13 January 2010; accepted 6 July 2010
materials with cells (Mitchell et al. 1999, Vajrabhaya
et al. 2006), the biological behaviour of cells in the
presence of root-end filling materials (Pistorius et al.
2003, Bonson et al. 2004), and the influence of these
materials in terms of related cellular signal pathways
(Huang et al. 2003, Minamikawa et al. 2009). Periodon-
tal ligament (PDL) fibroblasts are the major cells involved
in the reaction of cells with root-end filling materials.
Substantial research has been carried out on mineral
trioxide aggregate (MTA; Dentsply, Tulsa, OK, USA) and
its reaction with PDL fibroblasts. MTA is currently
viewed as being biocompatible with PDL fibroblasts and
could have positive influences on the cellular behaviour
of these fibroblasts in vivo (Camp et al. 2003, Balto 2004,
Bonson et al. 2004, Vajrabhaya et al. 2006, Gorduysus
et al. 2007).
Bioaggregate (BA; Innovative Bioceramix, Vancou-
ver, BC, Canada), a novel root-end filling material, is
ª 2010 International Endodontic Journal

mainly composed of calcium silicate, calcium hydrox-
ide, and hydroxyapatite. BA has shown similar anti-
bacterial effects and biocompatibility to those of MTA
and is considered as a possible alternative to MTA
(De-Deus et al. 2009, Zhang et al. 2009). However, no
studies have yet evaluated the effect of BA on differen-
tiation of PDL fibroblasts. The purpose of this study was
therefore to assess the cytotoxicity of BA to human PDL
fibroblasts and to investigate the effect of BA on
differentiation of human PDL fibroblasts.
Materials and methods
Cell culture
Human periodontal tissue was obtained from several
extracted third molars of patients who had given their
informed consent. The study protocol was approved by
the Institutional Review Board of Wuhan University
School of Stomatology. The periodontal tissue was
removed from the roots of the teeth and then divided
into small pieces with scissors. The specimens of
periodontal tissue were placed into 24-well plates
(Greiner Bio-One, Monroe, LA, USA) and cultured in
Dulbecco’s modified Eagle medium (DMEM; Hyclone,
Thermo Scientific, Logan, UT, USA) containing 10%
foetal bovine serum (FBS, Hyclone), 100 U mL)1 pen-
icillin, and 100 lg mL)1 streptomycin. The medium
was refreshed every 3 days. The plate was incubated
for 7 days at 37 C, in an atmosphere of 5% carbon
dioxide and 96% humidity. The PDL fibroblasts from
fifth to seventh passages were used.
Preparation of BA and MTA
Bioaggregate and MTA were prepared according to the
manufacturer’s instructions. Briefly, both the speci-
mens of BA and MTA were mixed with sterilized water
and were poured into paraffin wax moulds (diameter
3 mm and height 1 mm). The moulds were stored in
moist chamber at 37 C and 96% humidity for 3 h to
allow solidification of BA or MTA. After sterilization
with ultraviolet light for 1 h, the specimens were used
directly in the subsequent experiments (Chen et al.
2009).
Cell subculture
To test the cytotoxicity of BA and MTA to human PDL
fibroblasts, the solidified MTA and BA samples were
placed in 96-well plates filled with the cell culture
ª 2010 International Endodontic Journal
Yan et al. Effect of BA on differentiation of PDL
medium at 37 C for 24 h; the negative control group
was not subjected to any of the materials. After 24 h of
incubation, the cells were trypsinized with 0.25%
Trypsin, 1 g L)1 EDTA (Hyclone, Thermo Scientific)
and seeded in 96-well plates at a density of 1000 cells
per well in 100 lL DMEM supplemented with 10% FBS,
100 U mL)1 penicillin, and 100 lg mL)1 streptomy-
cin. On days 1, 2, and 3 post-incubation, the cells were
collected for MTT assays to test the cytotoxicity of MTA
and BA.
To evaluate the effect of BA and MTA on differen-
tiation of human PDL fibroblasts, three groups were
designed and the cells were seeded on 24-well plates
at the density of 5·104 each well and incubated in
DMEM supplemented with 10% FBS, 100 U mL)1
penicillin, 100 lg mL)1 streptomycin, 50 lg mL)1
ascorbic acid, 10 mmol L)1 Na-b-glycerophosphate,
and 10 nmol L)1 dexamethasone to promote differen-
tiation of the fibroblasts, as described previously
(Bonson et al. 2004). On days 3, 5, and 7 after
incubation, cells were collected and the selected gene
expression was determined by quantitative real-time
polymerase chain reaction (PCR).
MTT experiment
The cytotoxicity of BA and MTA to fibroblasts was
examined using a MTT Cell Proliferation kit I (Roche
Applied Science, Indianapolis, IN, USA). Briefly, after 1,
2, or 3 days of incubation with aggregate, 50 lL MTT
working solution was mixed with the fibroblasts in
each well and then incubated in 37 C for a further
4 h. When purple crystal formazan had formed around
the cells, the supernatant was removed gently and
100 lL dimethylsulfoxide was added to each well to
dissolve the formazan. The solution was cultured
another 15 min at 37 C to dissolve the formazan,
and the optical density values were measured at
490 nm using an ELISA plate reader.
Quantitative real-time PCR
After the PDL fibroblasts had been incubated for 3, 5,
and 7 days in the presence of MTA or BA, the cells from
each group were collected and the RNA was extracted
using Trizol Reagent (Invitrogen, Carlsbad, CA, USA).
The purity of the RNA was measured by spectropho-
tometer, and the value of A260/A280 ratios of the
RNA was 1.95. Then, the RNA was stored at )80 C
until used for reverse-transcriptase PCR. The Prime-
Script 1st Strand cDNA Synthesis kit (Takara, Dalian,
International Endodontic Journal, 43, 1116–1121, 2010 1117
 Effect of BA on differentiation of PDL Yan et al.

Table 1 Quantitative real-time PCR

Target gene Primer sequence (5¢ to 3¢) Product size (bp)
primer sequence information
ALP Forward: 5¢-GGGGTGAAGGCCAATGAG -3¢ 191
Reverse: 5¢- TCAGCCGAGTGGGCGTAG -3¢
COLI Forward: 5¢- AAGGTGTTGTGCGATGACG -3¢ 134
Reverse: 5¢- TCGACGCCGGTGGTTT -3¢
GAPDH Forward: 5¢- AGGGCTGCTTTTAACTCTGG -3¢ 178
Reverse: 5¢- CCTGGAAGATGGTGATGGG -3¢

China) was selected to synthesize the first cDNA from 0.5

extracted RNA via reverse-transcriptase PCR. The effect 0.45 Control
of BA and MTA on differentiation of human PDL 0.4 MTA *

Absorbance (490 nm)

BA
fibroblasts was evaluated by the examination of ALP 0.35
and COLI gene expression. The house-keeping gene 0.3
*
glyceraldehyde 3-phosphate dehydrogenase (GAPDH) 0.25
*
was used as control gene for normalization of RNA 0.2
expression. The specific primers for each gene are listed 0.15 *
*
in Table 1. The quantitative real-time PCR was per- 0.1
0.05
formed with a SYBR Green PCR kit (Invitrogen) using
0
the ABI PRISM7500 sequence detection system Day 1 Day 2 Day 3
(Perkin-Elmer Applied Biosystems). Each sample was Time (day)
tested in triplicate. The data for gene expression were
Figure 1 The cytotoxicity of mineral trioxide aggregate and
analysed with the 44Ct method described previously
bioaggregate to human periodontal ligament fibroblasts using
(Livak & Schmittgen 2001).
MTT assay. Results were demonstrated as mean of optical
density values at 490 nm (mean ± standard deviation).
Statistical analysis *P < 0.05 was considered as statistically significant.

Experimental data were analysed by one-way anova

analysis of variance followed by Tukey’s Tests. The
results were expressed as means ± standard deviation,
and P < 0.05 was considered statistically significant.
Results
ALP expression was significantly increased in the MTA
group on day 3 (P < 0.05) (Fig. 2a). In the BA group,
COLI expression was significantly enhanced on days 5
and 7 (P < 0.05). Similarly, COLI expression was also
induced by MTA on day 3 and day 5 (P < 0.05)
(Fig. 2b).

MTT assay analysis

The MTT assay tested the cytotoxicity of BA and MTA
to human PDL fibroblasts. Fig. 1 shows that human
PDL fibroblasts proliferated throughout the culture
period in all three groups. However, the rate of
proliferation of PDL fibroblasts in the MTA group was
significantly lower than in the control group on days 1,
2, and 3 (P < 0.05). There was also a significant
decrease in proliferation in response to BA on day 2
(P < 0.05).
Quantitative real-time PCR analysis
The effect of aggregates on mRNA expression of genes
involved in differentiation of fibroblasts was examined
via quantitative real-time PCR. The ALP expression
level was highest on day 7 in the presence of BA, and
Discussion
In this study, MTT assay was used to investigate the
biocompatibility of BA and MTA to PDL fibroblasts.
MTT assay provides a sensitive and simple method to
assess cytotoxicity of biomaterial by determining the
changes in metabolic activity of viable cells (Mosmann
1983). MTA has been widely used in endodontic
therapy, and its biocompatibility with PDL fibroblasts
has been characterized in many previous studies. For
example, Gorduysus et al. (2007) reported that MTA
was nontoxic to human PDL fibroblasts. In contrast,
other studies have reported suppression of growth of
human PDL fibroblasts by MTA (Keiser et al. 2000,
Karimjee et al. 2006, Vajrabhaya et al. 2006), consis-
tent with the present findings. MTA is composed
of tricalcium silicate, dicalcium silicate, tricalcium

1118 International Endodontic Journal, 43, 1116–1121, 2010 ª 2010 International Endodontic Journal
 Yan et al. Effect of BA on differentiation of PDL

(a) 5 was measured by quantitative real-time PCR in the

Control presence of BA. Because of its high precision, high
MTA
4 sensitivity, real-time character, and simplicity, quanti-
BA
Relative quantity

tative real-time PCR provides quantitative measure-

(ALP/GAPDH)

*
3 ments of gene expression changes over time, such as in
* *
* the response of cell cultures with biomaterials and
2 progression of cell differentiation.
Periodontal ligament fibroblasts could be differenti-
1 ated into osteoblasts upon induction (Inanc et al.
2007). ALP is a biochemical marker of bone turnover
0
Day 3 Day 5 Day 7 that is secreted from osteoblasts (Yu et al. 2009). The
Time (day) activity of ALP was significantly enhanced when
human mesenchymal stem cells were induced to
(b) 5 osteogenic differentiation (Kulterer et al. 2007). In this
Control study, ALP mRNA expression was significantly in-
4 MTA creased on day 7 by BA and on day 3 by MTA, which
Relative quantity

BA
(COLT/GAPDH)

was consistent with findings reported previously. These

3 different responses quite possibly reflect the different
* compositions of the two aggregates. For example,
2
* *
* * * although calcium silicate was a common component
1
0
Day 3 Day 5 Day 7
Time (day)
Figure 2 (a) Relative quantity of ALP gene expression nor-
malized to house-keeping gene GAPDH on days 3, 5, and 7.
*P < 0.05 was considered as statistically significant. (b)
Relative quantity of COLI gene expression normalized to
house-keeping gene GAPDH on days 3, 5, and 7. *P < 0.05
was considered as statistically significant.
aluminate, tetracalcium aluminoferrite, calcium sul-
phate, and bismuth oxide. Bismuth and aluminium ion
have been shown to be relatively highly toxic to rat
osteosarcoma-derived cells and fibroblasts (Yamamoto
et al. 1998, Di Virgilio et al. 2009). Therefore, the
inhibitory effects of MTA on the growth of human PDL
fibroblasts could be attributed to the bismuth and
aluminium ion released from MTA. According to the
manufacturer’s description, BA is an aluminium-free
ceramic nanoparticle cement, and its major compo-
nents are calcium silicate, calcium hydroxide, and
hydroxyapatite. Nanocrystalline hydroxyapatite has
been reported previously to stimulate the proliferation
of human PDL fibroblasts (Kasaj et al. 2008). There-
fore, this could explain why BA had relatively lower
cytotoxicity compared to MTA.
To evaluate the effect of BA on differentiation of
human PDL fibroblasts, expression of ALP and COLI
of BA and MTA (Bonson et al. 2004), release of calcium
and silicate from each might vary. In BA, the main
component was nanophase hydroxyapatite, which has
been shown previously to increase ALP activity and
promote osteogenic differentiation of human PDL
fibroblasts (Sun et al. 2007). Overall, the results indi-
cated that MTA influenced ALP expression in the early
stages of fibroblast culture, whilst the influence of BA
occurred at a later stage. The different effects of BA and
MTA on ALP expression might be related to the
differences in the ion composition of the two aggregates
and their degree of release during the culture period.
Pharmacokinetic studies on BA and MTA are therefore
required to characterize the ions released from BA or
MTA and their effects on pH of the culture media after
different incubation times (Nakayama et al. 2005,
Zhang et al. 2009).
COLI, an important component of the extracellular
matrix, codes for a collagenous protein whose expres-
sion increases during alveolar bone healing (Ebina et al.
2009). In the present study, mRNA expression of COLI
was induced on day 5 and day 7, and the COLI
expression level increased with culture time. For the
MTA group, gene expression was the highest on day 3,
which was similar to results reported previously
(Bonson et al. 2004). Calcium silicate, one of the main
components of both BA and MTA, has been reported
previously to increase COLI expression of MG-63
osteoblast-like cells (Sun et al. 2009). COLI expression
of MC3T3-E1 can also be enhanced in the presence
of hydroxyapatite (Tan et al. 2007), so this second

ª 2010 International Endodontic Journal International Endodontic Journal, 43, 1116–1121, 2010 1119
 Effect of BA on differentiation of PDL Yan et al.
component, available in BA but not in MTA, probably
also contributed to increased COLI expression in
human PDL fibroblasts.
Based on the results, BA could clearly induce ALP
and COLI gene expression, which are known to be
involved in differentiation of human PDL fibroblasts.
This indicates a clear role for BA in the induction of
differentiation of human PDL fibroblasts.
Conclusion
Bioaggregate appears to be a nontoxic root-end filling
material similar to MTA and is capable of inducing
differentiation of human PDL fibroblasts.
Acknowledgement
This study was supported by a grant (no.30872882)
from the National Natural Scientific Foundation of
China, a grant (no.30772417) from the National
Natural Scientific Foundation of China, and a grant
(no.304131587) from China Hubei Provincial Science
& Technology Department.
References
Balto HA (2004) Attachment and morphological behavior of
human periodontal ligament fibroblasts to mineral trioxide
aggregate: a scanning electron microscope study. Journal of
Endodontics 30, 25–9.
Bonson S, Jeansonne BG, Lallier TE (2004) Root-end filling
materials alter fibroblast differentiation. Journal of Dental
Research 83, 408–13.
Camp MA, Jeansonne BG, Lallier T (2003) Adhesion of human
fibroblasts to root-end-filling materials. Journal of Endodontics
29, 602–7.
Chen CL, Huang TH, Ding SJ, Shie MY, Kao CT (2009)
Comparison of calcium and silicate cement and mineral
trioxide aggregate biologic effects and bone markers expres-
sion in MG63 cells. Journal of Endodontics 35, 682–5.
De-Deus G, Canabarro A, Alves G, Linhares A, Senne MI,
Granjeiro JM (2009) Optimal cytocompatibility of a bioce-
ramic nanoparticulate cement in primary human mesen-
chymal cells. Journal of Endodontics 35, 1387–90.
Di Virgilio AL, Reigosa M, de Mele MF (2009) Response of
UMR 106 cells exposed to titanium oxide and aluminum
oxide nanoparticles. Journal of Biomedical Materials Research.
Part A 92, 80–6.
Ebina H, Hatakeyama J, Onodera M et al. (2009) Micro-CT
analysis of alveolar bone healing using a rat experimental
model of critical-size defects. Oral Diseases 15, 273–80.
Gartner AH, Dorn SO (1992) Advances in endodontic surgery.
Dental Clinics of North America 36, 357–78.
1120 International Endodontic Journal, 43, 1116–1121, 2010
Gorduysus M, Avcu N, Gorduysus O et al. (2007) Cytotoxic
effects of four different endodontic materials in human
periodontal ligament fibroblasts. Journal of Endodontics 33,
1450–4.
Huang TH, Ding SJ, Hsu TC, Kao CT (2003) Effects of mineral
trioxide aggregate (MTA) extracts on mitogen-activated
protein kinase activity in human osteosarcoma cell line
(U2OS). Biomaterials 24, 3909–13.
Inanc B, Eser Elcin A, Koc A, Balos K, Parlar A, Murat Elcin Y
(2007) Encapsulation and osteoinduction of human peri-
odontal ligament fibroblasts in chitosan-hydroxyapatite
microspheres. Journal of Biomedical Materials Research. Part
A 82, 917–26.
Karimjee CK, Koka S, Rallis DM, Gound TG (2006) Cellular
toxicity of mineral trioxide aggregate mixed with an
alternative delivery vehicle. Oral Surgery, Oral Medicine,
Oral Pathology, Oral Radiology, and Endodontics 102, e115–
20.
Kasaj A, Willershausen B, Reichert C, Rohrig B, Smeets R,
Schmidt M (2008) Ability of nanocrystalline hydroxyapatite
paste to promote human periodontal ligament cell prolifer-
ation. Journal of Oral Science 50, 279–85.
Keiser K, Johnson CC, Tipton DA (2000) Cytotoxicity of
mineral trioxide aggregate using human periodontal liga-
ment fibroblasts. Journal of Endodontics 26, 288–91.
Kulterer B, Friedl G, Jandrositz A et al. (2007) Gene expression
profiling of human mesenchymal stem cells derived from
bone marrow during expansion and osteoblast differentia-
tion. BMC Genomics 8, 70–85.
Livak KJ, Schmittgen TD (2001) Analysis of relative gene
expression data using real-time quantitative PCR and the
2(-Delta Delta C(T)) Method. Methods 25, 402–8.
Minamikawa H, Deyama Y, Nakamura K et al. (2009) Effect of
mineral trioxide aggregate on rat clonal dental pulp cells:
expression of cyclooxygenase-2 mRNA and inflammation-
related protein via nuclear factor kappa B signaling system.
Journal of Endodontics 35, 843–6.
Mitchell PJ, Pitt Ford TR, Torabinejad M, McDonald F (1999)
Osteoblast biocompatibility of mineral trioxide aggregate.
Biomaterials 20, 167–73.
Mosmann T (1983) Rapid colorimetric assay for cellular growth
and survival: application to proliferation and cytotoxicity
assays. Journal of Immunological Methods 65, 55–63.
Nakayama A, Ogiso B, Tanabe N, Takeichi O, Matsuzaka K,
Inoue T (2005) Behaviour of bone marrow osteoblast-like
cells on mineral trioxide aggregate: morphology and
expression of type I collagen and bone-related protein
mRNAs. International Endodontic Journal 38, 203–10.
Pistorius A, Willershausen B, Briseno Marroquin B (2003)
Effect of apical root-end filling materials on gingival fibro-
blasts. International Endodontic Journal 36, 610–5.
Sun W, Chu C, Wang J, Zhao H (2007) Comparison
of periodontal ligament cells responses to dense and
nanophase hydroxyapatite. Journal of Materials Science 18,
677–83.
ª 2010 International Endodontic Journal

Sun J, Wei L, Liu X et al. (2009) Influences of ionic dissolution
products of dicalcium silicate coating on osteoblastic prolif-
eration, differentiation and gene expression. Acta Biomate-
rialia 5, 1284–93.
Tan YF, Hong SF, Wang XL, Lu J, Wang H, Zhang XD (2007)
Regulation of bone-related genes expression by bone-like
apatite in MC3T3-E1 cells. Journal of Materials Science 18,
2237–41.
Vajrabhaya LO, Korsuwannawong S, Jantarat J, Korre S
(2006) Biocompatibility of furcal perforation repair material
using cell culture technique: ketac Molar versus ProRoot
MTA. Oral Surgery, Oral Medicine, Oral Pathology, Oral
Radiology, and Endodontics 102, e48–50.
ª 2010 International Endodontic Journal
Yan et al. Effect of BA on differentiation of PDL
Yamamoto A, Honma R, Sumita M (1998) Cytotoxicity
evaluation of 43 metal salts using murine fibroblasts and
osteoblastic cells. Journal of Biomedical Materials Research 39,
331–40.
Yu JH, Lee SP, Kim TI, Jang JH (2009) Identification of N-
methyl-D-aspartate receptor subunit in human periodontal
ligament fibroblasts: potential role in regulating differenti-
ation. Journal of Periodontology 80, 338–46.
Zhang H, Pappen FG, Haapasalo M (2009) Dentin enhances
the antibacterial effect of mineral trioxide aggregate and
bioaggregate. Journal of Endodontics 35, 221–4.
International Endodontic Journal, 43, 1116–1121, 2010 1121
This document is a scanned copy of a printed document. No warranty is given about the accuracy of the copy.
Users should refer to the original published version of the material.