2302

Journal of Food Protection, Vol. 67, No. 10, 2004, Pages 2302–2305
Copyright Q, International Association for Food Protection

Research Note

Development of a PCR Test To Differentiate between

Staphylococcus aureus and Staphylococcus intermedius
FLORENCE BARON,1* MARIE-FRANÇOISE COCHET,1 JEAN-LOUIS PELLERIN,2 NOURI BEN ZAKOUR,1
ANNE LEBON,1 ANNE NAVARRO,2 ISABELLE PROUDY,3 YVES LE LOIR,1 AND MICHEL GAUTIER1

Downloaded from http://meridian.allenpress.com/jfp/article-pdf/67/10/2302/1676056/0362-028x-67_10_2302.pdf by Indonesia user on 15 November 2021

1Laboratoire de Microbiologie, UMR 1055, Ecole Nationale Supérieure Agronomique, Institut National de la Recherche Agronomique, CS84215,

35042 Rennes, France; 2Unité de microbiologie, Département de pathologie générale, Ecole Nationale Vétérinaire, La Chantrerie, BP 40706, 44307
Nantes cedex 3, France; and 3Genesystems, 1 rue du Courtil, centre Cicea, Bâtiment 4, 35170 Bruz, France

MS 03-598: Received 31 December 2003/Accepted 10 April 2004

ABSTRACT
The presence of Staphylococcus intermedius in food remains unclear because routine laboratory analysis does not dis-
criminate between S. intermedius and Staphylococcus aureus, a major cause of food poisoning. Both species share many
phenotypic characteristics, including coagulase and thermonuclease production. In both species, some strains can produce
enterotoxin and therefore can be the cause of food poisoning outbreaks. Although the ID32 Staph System (bioMérieux, SA,
Marcy l’Etoile, France), based on a miniaturized phenotypic characterization, gives satisfactory results for discriminating
between these two species, some rapid molecular PCR-based methods have been developed to identify S. aureus specifically,
but they do not identify S. intermedius. Here, we developed a rapid, accurate, and discriminative multiplex PCR method that
targets species-specific sequences in the nuc gene, which encodes thermonuclease in the two species. The test includes an
internal positive control that targets a highly conserved region of 16S ribosomal RNA gene (rDNA). A total of 116 strains
were used to validate our test. The test gave no signal on the following Staphylococcus species: S. epidermidis, S. chromogenes,
S. hyicus, S. warneri, S. xylosus, S. lentus, and S. sciuri. It allowed a 100% successful discrimination between S. aureus (44
strains tested) and S. intermedius (57 strains) isolated from different origins.

Staphylococcus aureus is an opportunistic pathogen
that causes various infections ranging from abscesses to
septicemia. Some strains of S. aureus are able to produce
staphylococcal enterotoxins and are therefore involved in
foodborne poisoning outbreaks (17). S. aureus is one of the
three main microorganisms responsible for foodborne dis-
ease in France (9) and in other countries.
Staphylococcus intermedius is closely related to S. au-
reus. Both species are coagulase and thermonuclease pos-
itive. Some strains of S. intermedius are also able to pro-
duce staphylococcal enterotoxin (3). S. intermedius is rec-
ognized essentially as a common component of the skin,
oral, or nasal flora of healthy dogs and has also been found
in a wide range of other animal species (10). S. intermedius
has rarely been found in humans, even among individuals
with frequent exposure to animals. It is, however, respon-
sible for infections associated with dog bite wounds (21,
25). S. intermedius has been implicated in food poisoning
involving butter-blended products, resulting in 265 cases of
infection in the western United States (13). Jasper et al.
(12) and Langlois et al. (16) studied the staphylococcal spe-
cies isolated from cow milk and did not find S. intermedius.
However, the true frequency of S. intermedius in food re-
* Author for correspondence. Tel: 33 2 23 48 56 94; Fax: 33 2 23 48 55
78; E-mail: baron@agrorennes.educagri.fr.
mains unclear because it can be confused with S. aureus in
routine laboratory analysis (27).
In routine laboratory practice, the production of acid
from mannitol in anaerobic conditions, acetone, and hyal-
uronidase, protein A, and b-galactosidase activity are rec-
ommended for distinguishing S. aureus and S. intermedius
(22, 23). The use of the ID32 Staph system (bioMérieux,
SA, Marcy l’Etoile, France), a commercially available kit,
gives satisfactory results but is based on a miniaturized phe-
notypic characterization whose interpretation might be del-
icate. Phenotypic characterization has limitations that are
partly due to variable expression of characters and ambi-
guity in the interpretation of the end point reaction.
Recently, molecular methods such as rRNA gene re-
striction site polymorphism analysis (1), 16S ribosomal
RNA gene (rDNA) sequencing (19), 16S–23S rDNA inter-
genic spacer PCR (20), and DNA hybridization (8, 15) were
used to identify staphylococcal species. These methods fo-
cus on the development of a test for phylogenetic studies
or for a specific recognition of S. aureus. Furthermore, they
are time-consuming. On the other hand, two methods based
on a PCR test were developed: one method to identify S.
aureus on the basis of the amplification of a 270-bp frag-
ment in nuc, the gene encoding thermonuclease production
(5), and the other method to identify S. intermedius specif-
ically on the basis of the amplification of a 901-bp fragment
in the 16S ribosomal RNA gene (rDNA) (28). The two
J. Food Prot., Vol. 67, No. 10 DIFFERENTIATION BETWEEN S. AUREUS AND S. INTERMEDIUS 2303

TABLE 1. Staphylococcal species and strains tested by PCR Primer design. Sequence alignment for comparative analysis
was obtained with the use of Multalin 5.4.1 (7). The GenBank
Bacterial species
(no. of isolates) Source (no. of isolates)
accession numbers of the nuc sequences are N315, 15926905;
Mu50, 21204379; and MW2, 15924314 for S. aureus and 47146
S. aureus (44) Reference strains ATCC 27735, ATCC (6) for S. intermedius. The GenBank accession numbers of the
20231, ATCC 12600 16S ribosomal DNA sequences (complete or partial) are N315,
Cow milk (28) SArRNA01; Mu50, SAVrRNA01; MW2, MWrRNA01; FU16A2,
Chicken skin (8) 1199935; Kitami, 1199936; OA1, 1199938; and ATCC 12600T,
Turkey skin (4) 1199939 for S. aureus and ATCC 29663T, 1199951; CE5,
Dog (1) 6635425; CE79, 6635426; and CE80, 6635427 for S. intermedius.
S. intermedius (57) Reference strains ATCC 49052, ATCC Primers were designed with Primer3 software (24). Each primer
29663, CIP 81.60, CIP 81.77 was tested with all the others in order to confirm that each primer
Dog (pyoderma, ear, eyes, urine, abscess, of the set did not contain an intercomplementarity region with

Downloaded from http://meridian.allenpress.com/jfp/article-pdf/67/10/2302/1676056/0362-028x-67_10_2302.pdf by Indonesia user on 15 November 2021

conjunctivitis, skin) (52) primers of different pairs. All primers were synthesized by Eu-
Cat (ear) (1) rogentec (Seraing, Belgium).
S. chromogenes (4) Cow milk (3)
PCR amplification. PCR were performed in a 25-ml reaction
Dog (1)
volume. Each reaction mixture contained approximately 50 ng of
S. epidermidis (3) Cow milk (1)
DNA template, 0.05 to 0.2 mM of each primer, 1.5 units of Taq
Cheese (1)
DNA polymerase (MBI Fermentas, Cergy Pontoise, France), and
Human (1)
200 mM deoxyribonucleoside triphosphate (MBI Fermentas) in a
S. hyicus (3) Cow milk (3)
PCR buffer (2.5 ml of a 103 PCR buffer, MBI Fermentas). For
S. lentus (2) Chicken (2)
each run, the whole PCR mix without DNA template was used as
S. xylosus (1) Chicken (1)
a negative control. The amplification reactions were carried out in
S. warneri (1) Chicken (1)
a Bio-Rad iCycler (version 1.280, Bio-Rad, Marnes la Coquette,
S. sciuri (1) Chicken (1)
France) as follows: 4 min at 958C and 30 cycles of 30 s at 958C,
30 s at 558C, and 30 s at 728C. The program finished with an
additional 7-min extension step at 728C.
methods rely on the detection of a specific PCR fragment
After amplification, 10 ml of reaction mixture was analyzed
on agarose gel (positive result). The absence of this specific
by electrophoresis on a 1.2% agarose gel in Tris-Borate-EDTA
fragment is considered by the authors as the absence of the buffer (89 mM Tris, 89 mM boric acid, 2 mM EDTA) at 80 V
targeted microorganisms. These two tests gave satisfactory for 45 min and stained by ethidium bromide. Presence or absence
results for the identification of S. aureus or S. intermedius, and size of the PCR products were checked. The PCR experiments
respectively, but Wakita et al. (28) mentioned some speci- were conducted at least twice for each of the 116 strains.
ficity problems with their method for S. intermedius strains
Sequencing. Amplified products were sequenced with the
isolated from chicken. None of these methods distinguishes
ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction
between S. aureus and S. intermedius in a one-step proce-
Kit (PE-Applied Biosystems, Courtaboeuf, France), as recom-
dure. mended by the manufacturers, and analyzed with an ABI Prism
Thus, a method that achieves rapid differentiation be- 310 (PE-Applied Biosystems) and BioEdit software (Ibis Thera-
tween the two species is needed. In this study, we evaluated peutics, Carlsbad, Calif.) (11).
a multiplex PCR method designed to amplify species-spe-
cific sequences in the nuc gene to distinguish S. aureus RESULTS AND DISCUSSION
from S. intermedius. The PCR amplification of a 16S ri- Complete genome sequences of three S. aureus strains
bosomal RNA fragment conserved in several staphylococ- are now available (http://wit.integratedgenomics.com/
cal species was used as a positive control of the desired GOLD/) (2, 14), and four others are in the process of being
course of the PCR. determined. This wealth of data allows alignments of a giv-
MATERIALS AND METHODS en gene originating from several strains in order to check
sequence conservation or divergence. Unlike S. aureus,
Strain and culture conditions. The strains used in this study only 40 sequences are currently available for S. interme-
are described in Table 1. All strains were identified by the ID32
dius,. We chose the nuc gene sequence to distinguish S.
Staph system according to the manufacturer’s instructions. For
each species, the selected strains corresponded to a wide variety
aureus from S. intermedius because thermonuclease pro-
of ID32 profiles. duction is present in strains of both species. Moreover, sev-
The bacteria were isolated on Baird Parker agar (Merck, Fon- eral authors think this gene is a good candidate for S. au-
tenay sous Bois, France) and on Columbia agar with 5% (vol/vol) reus identification: the sequence is highly conserved and
sheep blood at 378C (AES Laboratories, Combourg, France) be- has species-specific sequences (1, 5, 18). The nuc gene of
fore phenotype identification. All strains were kept frozen in glyc- S. aureus (SAnuc) has already been used to design primers
erol stock (25%) at 2208C. for a simple PCR test aiming at the identification of S.
DNA isolation procedures. Staphyloccocal cells were prop- aureus strains (3). This PCR test was exclusively S. aure-
agated for 16 h at 378C and shaken at 150 rpm on tryptic soy us–specific and did not match any of the other staphylo-
agar (AES Laboratories). The DNA was extracted from staphy- coccal species tested as controls. Our goal here was to take
lococcal cells according to the method previously described by advantage of the available SAnuc and S. intermedius nuc
Ben Zakour et al. (4). gene (SInuc) sequences to design a set of primers that could
2304 BARON ET AL.
TABLE 2. Primers used in PCR
Name Sequence 59 to 39
NUCSEQ1 ACAGGCGTTTTAATCCTTGC
NUCSEQ2 TCCTTTTGGGCTTGTTCAAT
SInuc1 CAATGGAGATGGCCCTTTTA
SInuc2 AGCGTACACGTTCATCTTG
SAnuc1 TGCTATGATTGTGGTAGCCATC
SAnuc2 TCTCTAGCAAGTCCCTTTTCCA
16S1 GGACGGGTGAGTAACACGTGG
16S2 TCCCGTAGGAGTCTGGACCGT
be used for species-specific identification of S. aureus and
S. intermedius on a single PCR experiment. Because only
one SInuc sequence was available in GenBank, we ampli-
fied an internal fragment of SInuc by PCR with the use of
chromosomal DNA from five S. intermedius strains (two
reference strains and three strains isolated from dog) as a
template. Primers used for this PCR were designed from
the published SInuc sequence (6). NUCSEQ1 and NUC-
SEQ2 (Table 2) were successfully used to amplify a 455-
bp fragment in SInuc (corresponding to 89% of the nuc
gene) for the five strains. The PCR fragments generated
were used as a template for sequencing reactions on both
strands with NUCSEQ1 and NUCSEQ2 as sequence-prim-
er. The five new partial SInuc sequences obtained were
aligned with the three SAnuc sequences available in
GenBank to choose two internal regions in SInuc and SAn-
uc, respectively, because of their sequence divergence. In
published S. aureus complete genome sequences (N315 and
Mu50 (15) and MW2 (2)), two genes are annotated and
named ‘‘nuc.’’ One corresponds to the well-characterized
‘‘foggie’’ type of thermonuclease production (24); the other
corresponds to thermonuclease production, too. We chose
the latter to design SAnuc-specific primers because its se-
quence corresponds to the SInuc sequence available.
The aligned SInuc and SAnuc sequences presented
66% homology, but we exploited the divergence zone to
design two primer pairs (Table 2): one specific to S. inter-
medius (SInuc1, SInuc2) and one specific to S. aureus
(SAnuc1, SAnuc2).
To get a positive control on the desired course of the
PCR, the highly conserved 16S ribosomal RNA gene se-
FIGURE 1. Agarose gel electrophoresis of
the PCR products.
J. Food Prot., Vol. 67, No. 10
Size of
Melting amplified
temperature fragment
(8C) (bp)
59.23
59.55 455
59.89
54.76 125
59.99
60.36 420
64.90
Downloaded from http://meridian.allenpress.com/jfp/article-pdf/67/10/2302/1676056/0362-028x-67_10_2302.pdf by Indonesia user on 15 November 2021
65.37 252
quence of seven S. aureus and four S. intermedius was
aligned and a common sequence was chosen. A primer pair
was then designed (16S1, 16S2) that annealed to the 16S
ribosomal RNA gene of both species. The multiplex PCR
requires that primers share the same melting temperature
(Tm), with no possibility of cross-hybridization. After-
wards, analysis of PCR products by gel electrophoresis re-
quires clearly different sizes of amplified fragments. The
name, sequences of the primers, melting temperature, and
fragment sizes are given in Table 2.
Our triplex PCR test allowed a 100% successful dis-
crimination between S. aureus (44 strains tested) and S.
intermedius (57 strains) from different origins and with dif-
ferent ID32 profiles. The PCR products appeared as a single
DNA band with a size of 420 and 125 bp for S. aureus and
S. intermedius, respectively. For the two species, we also
observed a 252-bp band corresponding to the 16S positive
control. All three fragments are easily separated on 1.5%
agarose gel electrophoresis (Fig. 1). No amplification (ex-
cept for 16S positive control) occurred for the other staph-
ylococcal species tested. Among these species, only S. hyi-
cus is thermonuclease positive, but all species have been
reported in the literature as potential enterotoxin producers
(26).
The triplex PCR test described here allows a rapid,
accurate, reproducible, and nonsubjective discrimination
between S. aureus and S. intermedius. Our PCR test is
based on species-specific sequences of the thermonuclease
gene and includes an internal positive control that targets a
highly conserved region of 16S rDNA as a check on the
desired course of the PCR. This test could be used readily
J. Food Prot., Vol. 67, No. 10 DIFFERENTIATION BETWEEN S. AUREUS AND S. INTERMEDIUS
in routine laboratory procedures for epidemiological studies
and to evaluate the true frequency of S. intermedius versus
S. aureus in food.
ACKNOWLEDGMENTS
Our thanks to Jane Hall for her correction of our English and to
Olivier Chesneau for helpful discussion at the beginning of this work.
REFERENCES
1. Aubert, S., A. Morvan, J. L. Guesdon, and N. el Solh. 1992. Use-
fulness of the ID32 staph system and a method based on rRNA gene
restriction site polymorphism analysis for species and subspecies
identification of staphylococcal clinical isolates. J. Clin. Microbiol.
30:2346–2352.
2. Baba, T., F. Takeuchi, M. Kuroda, H. Yuzawa, K. Aoki, A. Oguchi,
Y. Nagai, N. Iwama, K. Asano, T. Naimi, H. Kuroda, L. Cui, K.
Yamamoto, and K. Hiramatsu. 2002. Genome and virulence deter-
minants of high virulence community–acquired MRSA. Lancet 359:
1819–1827.
3. Becker, P., W. Hufnagle, G. Peters, and M. Herrmann. 2001. Detec-
tion of differential gene expression in biofilm-forming versus plank-
tonic populations of Staphylococcus aureus using micro- represen-
tational-difference analysis. Appl. Environ. Microbiol. 67:2958–
2965.
4. Ben Zakour, N., M. Gautier, R. Andonov, D. Lavenier, M. F. Cochet,
P. Veber, A. Sorokin, and Y. Le Loir. 2004. GenoFrag: software to
design primers optimized for whole genome scanning by long-range
PCR amplification. Nucleic Acids Res. 32:1–8.
5. Brakstad, O. G., K. Aasbakk, and J. A. Maeland. 1992. Detection
of Staphylococcus aureus by polymerase chain reaction amplification
of the nuc gene. J. Clin. Microbiol. 30:1654–1660.
6. Chesneau, O., and N. el Solh. 1992. Nucleotide sequence of a nuc
gene encoding the thermonuclease of Staphylococcus intermedius.
Nucleic Acids Res. 20:5232.
7. Corpet, F. 1988. Multiple sequence alignment with hierarchical clus-
tering. Nucleic Acids Res. 16:10881–10890.
8. De Buyser, M. L., A. Morvan, S. Aubert, F. Dilasser, and N. el Solh.
1992. Evaluation of a ribosomal RNA gene probe for the identifi-
cation of species and subspecies within the genus Staphylococcus.
J. Gen. Microbiol. 138:889–899.
9. Haeghebaert, S., F. Le Querrec, V. Vaillant, E. Delarocque Astag-
neau, and P. Bouvet. 2001. Les toxi-infections alimentaires collec-
tives en France en 1998. Bull. Epidemiol. Hebd. 15:36–39.
10. Hajek, V. 1976. Staphylococcus intermedius, a new species isolated
from animals. Int. J. Syst. Bacteriol. 26:401–408.
11. Hall, T. A. 1999. BioEdit: a user-friendly biological sequence align-
ment editor and analysis program for Windows 95/98/NT. Nucleic
Acids Symp. Ser. 41:95–98.
12. Jasper, D. E., F. Infante, and J. D. Dellinger. 1985. Relationships
among the results of coagulase, staphylococcal toxin, and thermonu-
clease tests on staphylococci from cow milk. J. Clin. Microbiol. 21:
582–584.
13. Khambaty, F. M., R. W. Bennett, and D. B. Shah. 1994. Application
2305
of pulsed-field gel electrophoresis to the epidemiological character-
ization of Staphylococcus intermedius implicated in a food-related
outbreak. Epidemiol. Infect. 113:75–81.
14. Kuroda, M., T. Ohta, I. Uchiyama, T. Baba, H. Yuzawa, I. Kobay-
ashi, L. Cui, A. Oguchi, K. Aoki, Y. Nagai, J. Lian, T. Ito, M. Kan-
amori, H. Matsumaru, A. Maruyama, H. Murakami, A. Hosoyama,
Y. Mizutani-Ui, N. K. Takahashi, T. Sawano, R. Inoue, C. Kaito, K.
Sekimizu, H. Hirakawa, S. Kuhara, S. Goto, J. Yabuzaki, M. N.
Kanehisa, A. Yamashita, K. Oshima, K. Furuya, C. Yoshino, T. Shi-
ba, M. Hattori, N. Ogasawara, H. Hayashi, and K. Hiramatsu. 2001.
Whole genome sequencing of methicillin-resistant Staphylococcus
aureus. Lancet 357:1225–1240.
15. Kwok, A. Y., S. C. Su, R. P. Reynolds, S. J. Bay, Y. Av.-Gay, N. J.
Dovichi, and A. W. Chow. 1999. Species identification and phylo-
Downloaded from http://meridian.allenpress.com/jfp/article-pdf/67/10/2302/1676056/0362-028x-67_10_2302.pdf by Indonesia user on 15 November 2021
genetic relationships based on partial HSP60 gene sequences within
the genus Staphylococcus. Int. J. Syst. Bacteriol. 49:1181–1192.
16. Langlois, B. E., R. J. Harmon, and K. Akers. 1983. Identification of
Staphylococcus species of bovine origin with the API Staph-Ident
system. J. Clin. Microbiol. 18:1212–1219.
17. Le Loir, Y., F. Baron, and M. Gautier. 2003. Staphylococcus aureus
and food poisoning. Genet. Mol. Res. 2:63–76.
18. Liebl, W., F. Rosenstein, F. Götz, and K. H. Schleifer. 1987. Use of
staphylococcal nuclease gene as DNA probe for Staphylococcus au-
reus. FEMS Microbiol. Lett. 44:179–184.
19. Mahoudeau, I., X. Delabranche, G. Prevost, H. Monteil, and Y. Pie-
mont. 1997. Frequency of isolation of Staphylococcus intermedius
from humans. J. Clin. Microbiol. 35:2153–2154.
20. Mendoza, M., H. Meugnier, M. Bes, J. Etienne, and J. Freney. 1998.
Identification of Staphylococcus species by 16S–23S rDNA inter-
genic spacer PCR analysis. Int. J. Syst. Bacteriol. 48:1049–1055.
21. Raus, J., and D. N. Love. 1990. Comparison of the staphylocoagu-
lase activities of Staphylococcus aureus and Staphylococcus inter-
medius on Chromozym-TH. J. Clin. Microbiol. 28:207–210.
22. Roberson, J. R., L. K. Fox, D. D. Hancock, and T. T. Besser. 1992.
Evaluation of methods for differentiation of coagulase-positive
staphylococci. J. Clin. Microbiol. 30:3217–3219.
23. Rozen, S., and H. Skaletsky. 2000. Primer3 on the WWW for general
users and for biologists programmers. Methods Mol. Biol. 132:365–
386.
24. Shortle, D. 1983. A genetic system analysis of staphylococcal nu-
clease. Gene 22:181–189.
25. Talan, D. A., D. Staatz, A. Staatz, and G. D. Overturf. 1989. Fre-
quency of Staphylococcus intermedius as human nasopharyngeal flo-
ra. J. Clin. Microbiol. 27:2393.
26. Valle, J., E. Gomez-Lucia, S. Piriz, J. Goyache, J. A. Orden, and S.
Vadillo. 1990. Enterotoxin production by staphylococci isolated from
healthy goats. Appl. Environ. Microbiol. 56:1323–1326.
27. Vandenesch, F., M. Celard, D. Arpin, M. Bes, T. Greenland, and J.
Etienne. 1995. Catheter-related bacteremia associated with coagu-
lase-positive Staphylococcus intermedius. J. Clin. Microbiol. 33:
2508–2510.
28. Wakita, Y., J. Kawano, A. Shimizu, V. Hajek, E. Tomisaka, R. Ya-
suda, and E. Matsuo. 2002. Development of a PCR test for the iden-
tification of Staphylococcus intermedius based on the 16S rDNA
sequence. J. Vet. Med. Sci. 64:603–605.