BioMed Research International

Application of Innovative
Technologies for Improved Food
Quality and Safety
Guest Editors: Yiannis Kourkoutas, Nikos Chorianopoulos, Aspasia Nisiotou,
Vasilis P. Valdramidis, and Kimon A. G. Karatzas
Application of Innovative Technologies for
Improved Food Quality and Safety
BioMed Research International

Application of Innovative Technologies for

Improved Food Quality and Safety

Guest Editors: Yiannis Kourkoutas, Nikos Chorianopoulos,

Aspasia Nisiotou, Vasilis P. Valdramidis,
and Kimon A. G. Karatzas
Copyright © 2016 Hindawi Publishing Corporation. All rights reserved.

This is a special issue published in “BioMed Research International.” All articles are open access articles distributed under the Creative
Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original
work is properly cited.
Contents
Application of Innovative Technologies for Improved Food Quality and Safety
Yiannis Kourkoutas, Nikos Chorianopoulos, Aspasia Nisiotou, Vasilis P. Valdramidis,
and Kimon A. G. Karatzas
Volume 2016, Article ID 9160375, 2 pages

Towards a Universal Approach Based on Omics Technologies for the Quality Control of Food
Emanuele Ferri, Andrea Galimberti, Maurizio Casiraghi, Cristina Airoldi, Carlotta Ciaramelli,
Alessandro Palmioli, Valerio Mezzasalma, Ilaria Bruni, and Massimo Labra
Volume 2015, Article ID 365794, 14 pages

Facets of Nanotechnology as Seen in Food Processing, Packaging, and Preservation Industry

Neha Pradhan, Surjit Singh, Nupur Ojha, Anamika Shrivastava, Anil Barla, Vivek Rai, and Sutapa Bose
Volume 2015, Article ID 365672, 17 pages

Current and New Approaches in GMO Detection: Challenges and Solutions

Marie-Alice Fraiture, Philippe Herman, Isabel Taverniers, Marc De Loose,
Dieter Deforce, and Nancy H. Roosens
Volume 2015, Article ID 392872, 22 pages

Structure and Antioxidant Activity of Soy Protein Isolate-Dextran Conjugates Obtained by TiO2
Photocatalysis
Bei Jin, Xiaosong Zhou, Bing Li, Caiyan Chen, Xiaosa Zhang, and Siqiao Chen
Volume 2015, Article ID 150603, 7 pages

A Novel Reference Plasmid for the Qualitative Detection of Genetically Modified Rice in Food and Feed
Liang Li, Mei Dong, Na An, Lixia Liang, Yusong Wan, and Wujun Jin
Volume 2015, Article ID 948297, 6 pages

Effect of Chitosan Coating with Cinnamon Oil on the Quality and Physiological Attributes of China
Jujube Fruits
Yage Xing, Hongbin Lin, Dong Cao, Qinglian Xu, Wenfeng Han, Ranran Wang, Zhenming Che,
and Xihong Li
Volume 2015, Article ID 835151, 10 pages
Hindawi Publishing Corporation
BioMed Research International
Volume 2016, Article ID 9160375, 2 pages
http://dx.doi.org/10.1155/2016/9160375

Editorial
Application of Innovative Technologies for
Improved Food Quality and Safety

Yiannis Kourkoutas,1 Nikos Chorianopoulos,2 Aspasia Nisiotou,2

Vasilis P. Valdramidis,3 and Kimon A. G. Karatzas4
1
Applied Microbiology and Molecular Biotechnology Research Group, Department of Molecular Biology and Genetics,
Democritus University of Thrace, 68100 Alexandroupolis, Greece
2
Institute of Technology of Agricultural Products, Greek Agricultural Organization Demeter, 14123 Athens, Greece
3
Department of Food Studies and Environmental Health, Faculty of Health Sciences, University of Malta, Msida 2080, Malta
4
Department of Food and Nutritional Sciences, University of Reading, Reading RG6 6AD, UK

Correspondence should be addressed to Yiannis Kourkoutas; ikourkou@mbg.duth.gr

Received 9 December 2015; Accepted 10 December 2015

Copyright © 2016 Yiannis Kourkoutas et al. This is an open access article distributed under the Creative Commons Attribution
License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly
cited.

Nowadays, consumers in developed countries demand food
products of high-quality, which are easy-to-handle, safe, and
with natural flavor and color, as well as with an extended shelf
life [1]. One of the most significant challenges in the food
industry is to apply efficient technologies in the production
chain to fulfill these demands. Major studies have introduced
innovative technologies, such as nonthermal or alternative,
quicker, and sensory-milder thermal methodologies [2].
Methods that are used today, such as packaging, application
of antimicrobials (natural or chemicals), pasteurization, high
pressure processing, or combinations of these technolo-
gies (hurdle technologies), have been widely explored and
introduced applicable control tools in reducing bacterial
contamination levels [1, 2].
In this respect, application of new discoveries in health-
promoting food manufacture has been an intriguing and
exciting topic of major public concern, while at the same
time it confers multiple advantages in the industrial sector.
In response to demands from increasingly health conscious
consumers, the global new trend focuses on foods not only
with superior sensory appeal but also of improved nutritional
attributes. Current innovations in food production have
resulted in the development of novel products with specific
functional ingredients, reduction or removal of undesirable
components, modification of food compositions, and overall
improved quality and safety.
One of the main objectives of this special issue was
to provide a number of documents to summarize new
inventions, developments, and ideas in the most recent
innovation opportunities and technological achievements in
the production of foods with potent beneficial effects. In
this context, the structural characteristics and antioxidant
activities of soy protein isolate (SPI) dextran conjugates
obtained by TiO2 photocatalysis treatment were explored.
Results revealed that the UV-vis absorption and the fluores-
cence intensity increased with higher photocatalytic power.
SPI-dextran conjugate was successfully formed by TiO2
photocatalysis treatment. Likewise, the effect of chitosan
coating with cinnamon oil on the physiological attributes
and preservation quality of China jujube fruits during storage
was investigated. This investigation revealed that the complex
coating of chitosan and cinnamon oil could directly control
disease decay and maintained the good sensory acceptability
of jujube fruits. Moreover, during storage time, the treatment
of chitosan-oil coating might maintain the quality attributes
and induce the defense reaction system of jujube fruits.
A universal approach based on “omics” technologies
for the quality control of food was fully discussed. Up-
to-date technologies based on digital information systems
such as web platforms and smartphone applications, can
facilitate the adoption of molecular labelling. In this respect,
recent smartphone “apps” are becoming a powerful tool
to promote the consumption of high-quality foodstuffs and
in particular the consumption of those food items able to
prevent diseases [3–6]. Such informative tools (including
online portals and dissemination web sites) can be useful for
2 BioMed Research International

different stakeholders to translate a molecular label based on [8] J. F. Graveland-Bikker and C. G. de Kruif, “Food nanotechnol-
“omics” in a more understandable language for the whole ogy,” Trends in Food Science and Technology, vol. 17, no. 5, pp.
category of consumers. 196–203, 2006.
An overview of current and new approaches in genetically [9] B. Farhang, “Nanotechnology and applications in food safety,”
Global Issues in Food Science and Technology, vol. 22, pp. 401–
modified organisms detection was also assumed. Further-
410, 2009.
more, the benefits and drawbacks of such methodologies
were discussed, too. In addition, a protocol was validated and
determined to be suitable for practical use in monitoring and
identifying genetically modified rice. The results indicated
that the established methodology is convenient, rapid, and
of low-cost for routine detection of genetically modified
rice.
Finally, nanotechnology has proven its competence in
almost all possible fields to food and agricultural systems
[7–9]. Hence, a summary of the different methods of food
processing, packaging, and preservation techniques is pro-
vided and the role of nanotechnology in the food processing,
packaging, and preservation industry is highlighted and
assessed.

Yiannis Kourkoutas
Nikos Chorianopoulos
Aspasia Nisiotou
Vasilis P. Valdramidis
Kimon A. G. Karatzas

References
[1] J. H. Chen, Y. Ren, J. Seow, T. Liu, W. S. Bang, and H. G. Yuk,
“Intervention technologies for ensuring microbiological safety
of meat: current and future trends,” Comprehensive Reviews in
Food Science and Food Safety, vol. 11, no. 2, pp. 119–132, 2012.
[2] T. Aymerich, P. A. Picouet, and J. M. Monfort, “Decontamina-
tion technologies for meat products,” Meat Science, vol. 78, no.
1-2, pp. 114–129, 2008.
[3] S. L. Casperson, J. Sieling, J. Moon, L. Johnson, J. N. Roemmich,
and L. Whigham, “A mobile phone food record app to digitally
capture dietary intake for adolescents in a free-living environ-
ment: usability study,” JMIR mHealth and uHealth, vol. 3, no. 1,
article e30, 2015.
[4] M. J. Hutchesson, M. E. Rollo, R. Callister, and C. E. Collins,
“Self-monitoring of dietary intake by young women: online
food records completed on computer or smartphone are as
accurate as paper-based food records but more acceptable,”
Journal of the Academy of Nutrition and Dietetics, vol. 115, no.
1, pp. 87–94, 2015.
[5] W. Zhang, Q. Yu, B. Siddiquie, A. Divakaran, and H. Sawhney,
“‘Snap-n-Eat’: food recognition and nutrition estimation on a
smartphone,” Journal of Diabetes Science and Technology, vol. 9,
no. 3, pp. 525–533, 2015.
[6] C. Behnke and S. Seo, “Using smartphone technology to
assess the food safety practices of farmers’ market foodservice
Employees,” Journal of Foodservice Business Research, vol. 18, no.
1, pp. 1–19, 2015.
[7] Y.-J. Cho, C.-J. Kim, N. Kim, C.-T. Kim, and B. Park, “Some
cases in applications of nanotechnology to food and agricultural
systems,” Biochip Journal, vol. 2, no. 3, pp. 183–185, 2008.
Hindawi Publishing Corporation
BioMed Research International
Volume 2015, Article ID 365794, 14 pages
http://dx.doi.org/10.1155/2015/365794

Review Article
Towards a Universal Approach Based on
Omics Technologies for the Quality Control of Food

Emanuele Ferri,1 Andrea Galimberti,2 Maurizio Casiraghi,2

Cristina Airoldi,3 Carlotta Ciaramelli,3 Alessandro Palmioli,1,3
Valerio Mezzasalma,2 Ilaria Bruni,2 and Massimo Labra2
1
FEM2 Ambiente s.r.l., P.za della Scienza 2, 20126 Milan, Italy
2
ZooPlantLab, Department of Biotechnology and Biosciences, University of Milano-Bicocca, P.za della Scienza 2, 20126 Milan, Italy
3
BioNMR Lab, Department of Biotechnology and Biosciences, University of Milano-Bicocca, P.za della Scienza 2, 20126 Milan, Italy

Correspondence should be addressed to Massimo Labra; massimo.labra@unimib.it

Received 29 July 2015; Accepted 19 November 2015

Academic Editor: Vasilis P. Valdramidis

Copyright © 2015 Emanuele Ferri et al. This is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

In the last decades, food science has greatly developed, turning from the consideration of food as mere source of energy to a growing
awareness on its importance for health and particularly in reducing the risk of diseases. Such vision led to an increasing attention
towards the origin and quality of raw materials as well as their derived food products. The continuous advance in molecular biology
allowed setting up efficient and universal omics tools to unequivocally identify the origin of food items and their traceability. In
this review, we considered the application of a genomics approach known as DNA barcoding in characterizing the composition of
foodstuffs and its traceability along the food supply chain. Moreover, metabolomics analytical strategies based on Nuclear Magnetic
Resonance (NMR) and Mass Spectroscopy (MS) were discussed as they also work well in evaluating food quality. The combination
of both approaches allows us to define a sort of molecular labelling of food that is easily understandable by the operators involved
in the food sector: producers, distributors, and consumers. Current technologies based on digital information systems such as web
platforms and smartphone apps can facilitate the adoption of such molecular labelling.

1. The Demand for Universal Analytical Tools
to Characterize Foodstuffs
The globalization of the food market has led to a corre-
sponding increase in issues concerning the authenticity and
safety of imported foods. Consumers are susceptible to any
form of food alteration that may occur during artisanal or
industrial manufacturing processes and pay attention to food
ingredients as these can influence nutritional and health
conditions [1–3]. The consumer’s awareness in terms of food
quality and safety is growing and growing and implies the
search for products with exhaustive labelling reporting details
about the original raw materials and with assurances about
the absence of harmful chemical and microbial contaminants
[4–6]. These topics drove the development of new analytical
tools in the context of food science [7]. A relevant section of
approaches was the one devoted to the screening of undesired
microorganisms, often occurring in foodstuffs, to ensure
human safety and preventing food spoilage and/or the spread
of foodborne disease outbreaks [8, 9]. Foodborne pathogens,
as well as spoilage microorganisms, can already be present in
the indigenous microbiota of raw materials or colonize the
final food product by contamination during manufacturing
[10]; therefore, laboratory analyses must be conducted both
on raw materials and transformed food items. There is a great
number of microorganism taxa traditionally associated with
human diseases and for which every food product should
be tested in order to ensure their absence. Salmonella spp.
is one of the major pathogens responsible for foodborne
disease outbreaks throughout the world and S. enterica is
the most frequently isolated species [11]. Other important
and frequently reported foodborne pathogens belong to the
genera Campylobacter, Yersinia, Shigella, Vibrio, Clostrid-
ium, Bacillus, Listeria, and Staphylococcus [12, 13]. Most of
2 BioMed Research International
these microorganisms are not easily detectable with culture-
dependent approaches, but DNA-based tests that improve
their detection have been developed. Most of these are based
on the simultaneous detection of a wide panel of entities by
using universal DNA marker regions such as the 16s rDNA or
the ITS [14, 15].
DNA-based approaches have acquired a growing impor-
tance also to respond to another consumer’s request that is
the authentication of both raw materials and processed food
products [1]. Such a demand arose due to different factors:
(i) the globalization of the food market that caused a longer
and more articulated food supply chain, where raw materials
are globally exported and processed in countries different
from the origin; (ii) the industrialization of manufacturing
processes (e.g., fermentation, biopreservation, and function-
alization [16]) that are becoming more and more complex and
largely unknown to the consumers; (iii) the strong modifica-
tions to which foodstuffs are subject before being sold (e.g.,
slicing and powdering) that impede a correct identification
of the original raw materials by the consumer; (iv) the
growing occurrence of allergies and intolerances related to
certain foods or components of processed foodstuffs, typical
of western countries. A plethora of molecular-based tools
has been developed to characterize food composition and
validate food authenticity [1], most of which relying on the
analysis of proteins [17] and/or DNA sequences [18]. Protein-
based approaches are useful in characterizing the composi-
tion of fresh products; however, these methods can be biased
by several factors such as the strong food manufacturing
processes, the limited number of detectable isozymes, or
the high tissue and developmental stage specificity of the
markers [19]. DNA markers were definitely proven to be
more informative than protein-based methods because DNA
better resists industrial processes such as shredding, boiling,
pressure cooking, or transformations mediated by chemical
agents [20, 21]. This property allows a successful identification
of animal, plant, or fungi raw materials, even when they
are present at small traces. Moreover, the availability of
advanced technologies and efficient commercial kits for DNA
extraction permits obtaining an acceptable yield of genetic
material from processed or degraded biological material [8,
22, 23].
DNA analyses in food science are based on specific
genome regions used as “identity markers” easily detectable
by Polymerase Chain Reaction (PCR) [18]. Discontinuous
molecular markers such as Amplified fragment Length Poly-
morphisms (AFLPs), as well as their variants (i.e., ISSR, SSAP,
and SAMPL), have been successfully used in the characteriza-
tion of several food raw materials [18, 24]. Moreover, species-
specific makers have been developed for the most important
and traded categories of animal and plant raw materials. This
is the case of Single Nucleotide Polymorphisms (SNPs) and
Simple Sequence Repeats (SSRs) that are largely used because
of their high level of polymorphism and high reproducibility
[25]. These approaches are used both in the identification of
plant cultivars [26, 27] and animal breeds [28, 29] and to
prevent fraudulent commercial activities [30, 31]. However,
being highly species-specific, these approaches require a deep
knowledge of the genotypes of the organisms and their
application is often limited to a single taxon, or to a few
closely related taxa. Nowadays, producers, manufacturers,
distributors, and consumers advocate the development and
adoption of universal tools to assess not only the origin
and traceability of raw materials and derived food products
but also the inadvertent occurrence of other species (i.e.,
contamination) or cases of species substitution (i.e., frauds).
The development of innovative food-related universal tools
based on DNA analysis will be the first issue treated in this
paper.
However, the DNA certification of identity and origin of
foodstuffs are not necessarily synonyms of food quality. As an
example, the genetic identity of a vineyard influences some
aspects of wine quality [32] but other environmental factors
could affect the plant phenotype and therefore the wine
organoleptic properties [33–35]. For these reasons, the DNA-
based analysis should be combined with a precise evaluation
of chemical food characteristics. The second section of this
paper will be devoted to the analysis of modern metabolomics
techniques in the field of food science.
Both DNA-based and metabolomics approaches can
be simultaneously performed through the so called omics
platforms [36], the use of which is expected to progressively
become a routine in the context of food control. Given the
recent bioinformatics advances, omics platforms are able
to process huge amounts of data and combine information
belonging to different analytical approaches. Hence, the
technological innovations concerning food quality lie in both
the development of universal and more accurate analytical
systems and their reciprocal integration.
2. DNA Barcoding: A Universal Approach for
Food Characterization
As discussed in the previous chapter, an aspect of primary
importance in food science is the need to identify the origin
of food raw materials, as well as tracing food products along
the entire food supply chain by using universal, rapid, and
inexpensive tools. In the last decade, “DNA barcoding” was
proposed as a universal method to identify living organism
including edible plants and animals [37]. The rationale of this
approach consists in the analysis of the variability at one or
a few standard region/s of the genome (i.e., DNA barcodes)
occurring in the whole panel of organisms constituting the
raw materials and their derived food products [38].
The 5󸀠 -end portion of mitochondrial coxI gene was
suggested as standard DNA barcode region for metazoans. In
plants, mitochondrial DNA has slower substitution rates and
shows intramolecular recombination [39], therefore imped-
ing a reliable species identification. The research for an ideal
DNA barcode in terrestrial plants has focused on two plastid
DNA regions (i.e., rbcL and matK) considered as the “core-
barcode” [40]. These can be supported by other regions,
such as the trnH-psbA intergenic spacer, due to their higher
variability among congenerics [41, 42]. Internal transcribed
spacer regions of nuclear ribosomal DNA (ITS) were also
recommended as additional markers in angiosperms [39].
BioMed Research International
Although there is still much debate on the identification
performances of these markers, DNA barcoding showed its
effectiveness when used to characterize unknown specimens
based on the comparison with reference sequences [42, 43],
especially for edible organisms used in food production [44–
47]. The efficacy of DNA barcoding is supported by the
availability of a comprehensive and continuously growing
public library of DNA barcodes, the Barcode of Life Data
System (BOLD), which provides a global identification sys-
tem that is freely accessible [48, 49]. This platform consists of
several components, including the Identification Engine tool
(BOLD-IDS), which works with DNA barcode sequences and
returns a taxonomic assignment at the species level whenever
possible.
A case in which DNA barcoding works well is the analysis
of seafood [50], where coxI showed higher discrimination
ability and in several cases allowed the identification of
the origin of certain fish stocks. Moreover, in the modern
market, many seafood species are sold as fillets or slices,
therefore hindering the application of classical identification
approaches. In such cases, the molecular analysis is the only
reliable strategy to identify species [51]. Given its efficacy,
DNA barcoding was adopted by the US Food and Drug
Administration for the authentication of fish-based commer-
cial products [52].
A limited success of the method was achieved concerning
meat identification, especially concerning farmed species.
The main reason of this pitfall lies in the scarce variability of
the conventional barcode region among animal breeds and
in the frequent occurrence of hybridization events [53]. In
contrast, regarding dairy products, DNA barcoding has been
proven efficient in characterizing composition and origin of
milk. Indeed, the plastidial rbcL barcode marker was found to
be able to detect traces of food-derived plant DNA fragments
in raw cow milk [54, 55], thus opening new perspectives for
the traceability of milk and dairy products in general.
Among plant-based foodstuffs, the DNA barcoding
approach has been used for many applications [56] and
to investigate the genetic relationships between wild and
cultivated plants, as well as their origin. As an example,
DNA barcoding was used to characterize the bean germplasm
(Phaseolus vulgaris L.) and was found able to distinguish
among different haplotypes of bean accessions from the
Mesoamerican and Andean areas [57]. Similarly, the DNA
barcoding approach was adopted to assess the origin and
quality of spices [44, 58], herbal products [59, 60], and
naturally processed plant products such as multiflower honey
[61]. Other studies investigated the ability of DNA barcoding
in discerning toxic plants from edible species: cultivated
species of the genera Solanum and Prunus were successfully
distinguished from their toxic congenerics [62] and from
some frequent plant species misidentifications that cause
poisoning in human [63].
On the whole, the most important innovation introduced
by DNA barcoding is the merging in a single approach of
three characteristics typical of molecular analytic tools: (i) the
molecularization of identification processes (i.e., the investi-
gation of DNA variability to discriminate among taxa); (ii)
the standardization of molecular marker/s and of analytical
3
procedures; (iii) the data computerization of identification
results (i.e., the not redundant transposition of the data using
informatics) [64]. This last element is fundamental to make
the analytic DNA-based tool accessible to the different actors
involved in the food supply chain. Table 1 provides an updated
list of DNA barcoding case studies dealing with raw materials
and foodstuffs with a clear indication of the beneficiary
subjects of the analysis: producer, distributor, and consumer.
Although DNA barcoding largely demonstrated its high
sensitivity and reliability in the authentication of food prod-
ucts, it should be specified that most food products are com-
posed of a mix of organisms. In these cases, the use of univer-
sal primers and standard sequencing approaches, based on
the traditional Sanger technology, are inefficient to discrim-
inate among the single components. As a result, the require-
ment for high-throughput sequencing techniques grew by an
unpredicted extent [106]. Several novel approaches evolved
to replace the traditional Sanger sequencing method; these
modern advances have been referred to as “high-throughput
DNA sequencing” (HTS). HTS techniques are able to provide
billion sequence data several times faster and cheaper than
the conventional Sanger approach. The reduction in cost
and time for generating DNA sequence data has resulted
in a range of new successful applications, including food
traceability and especially food microbiology [16, 107]. As
an example, HTS techniques have been used to identify
fruit species in yogurts [108] and pollen composition in
multiflower honeys [109].
Nowadays, the use of DNA barcoding in the food sector
moved from the academic research to a real application.
The “molecular labelling” provided by DNA barcoding has
benefits for both consumers (who are ensured on the origin,
quality, and safety of food items) and producers (who can give
an additional value to their products or have an assurance
on the quality of starting raw materials). Concerning the
analytical feasibility of the method, the DNA barcoding tool
is easily accessible due to the availability of public molecular
reference databases and a lot of equipped public or private
laboratories able to perform the analysis. Newmaster and
colleagues, in a publication dated 2009, estimated the cost
of a single analysis in a few Euro and very short times of
response [110]. Federici and colleagues demonstrated that
portions of the standard DNA barcodes could be chosen
as SCAR markers to discriminate in less than three hours
between edible plant species from poisonous ones [63].
These characteristics make DNA barcoding a diagnostic
method suitable for food control analyses by national and
international agencies. As previously underlined, to assess
the origin of food items, DNA-based analyses should be
combined with the characterization of food metabolites to
obtain an exhaustive molecular label.
3. Innovative Applications of Metabolomics
Tools for an Exhaustive Food Labelling
The analysis of food metabolome represents a new frontier
in the evaluation of food quality [111]. The metabolome
consists of low molecular weight entities (i.e., <1,000 Da)
4 BioMed Research International

Table 1: Updated list of DNA barcoding case studies in the field of food science and principal stakeholders. Producers are interested in valuing
their crops or breeds by molecular certification; distributors are mainly interested in the traceability and authentication of traded products;
the interest of consumers is to avoid commercial frauds/species substitutions and have an assurance on food provenance.

Interested stakeholders
Food category Target analysis References
Producer Distributor Consumer
Identification of species and provenance of Mangifera species X X X [65]
Traceability of Lycium barbarum (Goji) X X [66]
Authenticity analyses of berry species X X X [67]
Molecular identification of pineapple cultivars X [68]
Identification of cocoa (Theobroma spp.; Malvaceae) cultivars X [69]
Identification of date cultivars X X [70]
Identification of Capsicum species X X [71]
Authentication of PDO Fava Santorini (Lathyrus clymenum) X X X [72]
Identification of Mediterranean bean species X [73]
Plants
Identification and authentication of some Lamiaceae species X X [44]
Identification of Thymus species X [74]
Authentication of saffron X X [75]
Authentication of black pepper powder X X [76]
Identification of Salvia species X X X [77]
Authentication of herbal teas X X X [78]
Authentication of turmeric powder (Zingiberaceae) X X [79]
Identification of herbs in beverages X [80]
Authentication of fruits in jams X X [81]
Mushrooms Mushrooms identification X X [82, 83]
Honey Characterization of monofloral or multiflower honey X X [42, 61]
Identification of commercial fish species X X [84–86]
Identification of processed fish products X [87–92]
Labelling authentication of fish products X X [47, 51, 93–96]
Fishes and seafood Identification of poisonous seafood species X X [97]
Identification of crab meat products X [98, 99]
Origin and Authentication of Hairtail Fish and Shrimp X X X [100]
Identification of Octopus species X [101]
Labelling authentication of game meat species X [45, 102, 103]
Meat Identification of ground meat products X X [104]
Identification of bovid species X X X [105]

[112] belonging to a wide range of chemical classes, occurring
at different concentrations. In general, these metabolites
are the final downstream products of the genome and of
its interactions with the environment. For this reason, the
analysis of genotype only (e.g., DNA barcoding) is certainly
important but not exhaustive to evaluate the overall quality of
food items.
In food chemistry, some molecules such as sugars are
common and abundant, whereas minor compounds like
vitamins occur at smaller amounts or even at trace con-
centrations (e.g., femtomolar). In addition, the physico-
chemical properties of some groups of molecules, or the
patterns of reciprocal interaction, could pose problems to
their fine characterization and quantification. Thus, efficient
and sensitive analytical tools are required for a reliable
characterization of food metabolome. Whilst in DNA fin-
gerprinting approaches the identification is based on the
reading of short nucleotide DNA sequences, a metabolomics
fingerprinting analysis aims at establishing the patterns of
metabolites belonging to different chemical classes and that
are correlated to certain characteristics. Thus, one of the
main challenges in food metabolomics is facing the complex
networks of molecules (e.g., sugars, amino acids, peptides,
organic acids, phenols, terpenes, or steroids) occurring in
a particular food item. For these reasons, two approaches
(profiling and fingerprinting) can be used to characterize the
food metabolome. Profiling is a targeted strategy focused on
the analysis of a group of related metabolites, often belonging
to the same chemical class. An example of this approach is the
discrimination between Arabica and Robusta coffee origins,
based on the identification and quantification of a specific
class of molecules, including 16-O-Methylcafestol, by NMR
spectroscopy [113]. In addition, very recently, Monti and
coworkers discriminated among different peach qualities and
level of ripening, which depend on the abundance of several
metabolites, including amino acids, sugars, and organic acids
BioMed Research International 5

NMR and MS in food analysis: subject areas

13%
24%
8%
8%
NMR and MS in food analysis: publications from 2001 to 2014 11% 21%
3000
15%
2500

2000

1500 Chemistry
1000 Agricultural and biological sciences
Biochemistry, genetics, and molecular biology
500 Medicine
Pharmacology, toxicology, and pharmaceutics
0
Environmental science
2001
2002
2003
2004
2005
2006
2007
2008
2009
2010
2011
2012
2013
2014
Others
(a) (b)

Figure 1: (a) Studies published in the area of food research, based on NMR and/or MS analyses, from 2001 to 2014. (b) NMR- and/or MS-based
studies published from 2001 to 2014, divided for subject area. Source: Scopus (entries: NMR, food or Mass Spectrometry, food).

[114]. The second approach (fingerprinting), is an untargeted could remain unidentified. On the other side, the main
strategy based on comparing patterns of metabolites among advantages of NMR are the ease sample preparation and the
different samples using chemometric tools. The main aim of determination of very different chemical species in a single
fingerprinting is not to identify all the involved compounds experiment. In addition, the identification of molecules is
but to establish patterns among them; this approach enables easier and more straightforward than in the case of MS. Other
the simultaneous detection of a wide class of metabolites. important advantages of NMR are its inherently quantitative
Examples of metabolic fingerprinting on different foodstuffs signals and its nontargeted and nondestructive nature with
include grape and wine [115, 116], orange [117], saffron [118], regard to the specimen of the technique. Thus, in case of
olive oil [119], and wheat and bread [120]. Profiling and an initial metabolomics study where the composition of the
fingerprinting can offer complementary information and metabolite pool is not known, a NMR approach is useful and
thus can be used alone or in combination [121, 122]. can inform future studies by targeted GC-MS metabolomics
Independently from the adopted strategy, a reliable tool to or other approaches to look for specific low-concentration
analyse the metabolome of a certain food should ideally meet metabolites (targeted strategy). NMR sensitivity is considered
some features: (i) the possibility of recognizing a variety of one of the main limitations in its application to metabolomics
chemical structures, (ii) the possibility of dealing with large analysis, especially when compared to MS. However, continu-
range of concentrations at which metabolites are present in a ous developments in hardware (e.g., magnet strength, probe
matrix, (iii) the capability of the analytical platforms, and (iv) head design, and console electronics) have allowed and will
the availability of reference databases with extensive details allow a growing sensitivity of NMR. Also, a rapid growth
and descriptors [123]. in new, potent algorithms for multivariate data analysis
Today, there are two analytical platforms meeting these facilitates the use of NMR spectroscopy as a competitive,
criteria: Nuclear Magnetic Resonance (NMR) spectroscopy complementary analytical platform for investigating the food
and Mass Spectrometry (MS) [121]. The application of metabolome (Table 2).
NMR and MS techniques greatly increased in the last years The most important innovation provided by metabo-
(Figure 1(a)) and this research field covers several subject lomics tools is their standardization and the universality
areas and disciplines (Figure 1(b)). of the procedures. The amount of data generated by these
A good advantage of both techniques is the “high- analyses is enormous. For this reason, several chemometric
throughput” capability of spectroscopic and structural infor- tools [139, 140] are employed. In fact, to analyze food
mation that permits characterizing a wide range of metabo- metabolomics data, some intermediate steps are necessary,
lites simultaneously, with high analytical precision. Com- including peak detection, spectra normalization, integration,
pared to NMR, MS is more sensitive and can be used alone or and data alignment before multivariate statistical analysis.
combined with gas chromatography, liquid chromatography, Based on these aspects, it is currently possible to create
or capillary electrophoresis to provide a higher sensitivity a molecular label, which combines the genetic profile of a
for metabolites present at low or even at trace concentra- certain food item and its metabolic content. The advantages
tions [124–127]. However, even though MS-based analytical of such integration are relevant and would certainly constitute
methods can detect hundreds of metabolites, many others a real innovation in food science. One example is the case
6 BioMed Research International

Table 2: Examples of NMR and MS application in the field of food science.

Scope Food category Aim of the analysis Analytical tool References

Saffron (Crocus sativus L.) Quality and geographical origin NMR [118]
Orange Geographical origin UPLC-qTOF-MS [117]
Safety: drug residues and other UPLC–ESI–MS/MS [128]
Raw milk
Food traceability, contaminants
authenticity, and safety Apple, hazelnuts, maize, green LC–MS/MS [129]
Safety: fungal and bacterial metabolites
pepper
Buffalo’s mozzarella Quality and traceability NMR [130]
Olive oil Geographical origin NMR [119]
Wheat and bread Geographical and varietal origin NMR and IRMS [120]
Effects of agronomical practices on NMR [116]
Grape
Food composition and composition
physical characteristics Pork meat Fatty acid chain composition NMR [131]
Onion Metabolic profiling NMR and HPLC-MS [132]
Wine Effects of fermentation and aging NMR [115]
Tea Processing (variety) LC–DAD-MS [133]
Food processing and
storage Profiling of raw materials for beer HS-SPME-GC-MS [134]
Beer
production
Coffee Roasting process NMR [135]
Compounds against neurodegenerative STD-NMR [136]
Salvia sclareoides
disease
Food and health Compounds against neurodegenerative
Green tea STD-NMR [137]
disease
Litchi (Litchi chinensis Sonn.) Identification of bioactive compounds NMR and MS [138]

of wine, which can be putatively characterized with both
DNA analysis of the original grape cultivar (e.g., [141, 142])
and the metabolic profile to identify wine characteristics,
such as fermentation behaviours and antioxidant properties.
Indeed, the analysis of metabolome was shown successful
in identifying specific chemical compounds strictly related
to the geographic production areas [115, 143]. The origin of
wine could also be supported by the DNA-based analysis
of must/wine microbiome [144–146]. Merging these three
sources of data would result in a molecular label that is truly
exhaustive and follows the Protected Designation of Origin
(PDO) of wine.
Another application of metabolomics was on olive oil.
Longobardi et al. [119] used a1 H NMR fingerprinting com-
bined with multivariate statistical analysis to authenticate
extra virgin olive oils from seven different Mediterranean
regions, demonstrating the possibility to predict the origin
of olive oil samples with a very high confidence (>78%). At
the DNA level, DNA barcoding cannot distinguish among
different olive cultivars, whereas other genomics markers
such as SSR and SNP were successful in achieving this goal
[147]. DNA barcoding, combined with HRM (High Resolu-
tion Melting) analysis, was used instead to detect adulteration
of olive oil with other oils [148]. Also in this case, genomics
and metabolomics analyses could be complementary, to offer
to the producer/consumer a comprehensive certification of
origin and quality of oil.
An important aspect of food metabolome is that of
flavour and aroma determination, which is often linked to
the composition in volatile molecules. Dynamic headspace
solid-phase microextraction (HS-SPME) followed by GC
separation and high resolution MS analyser can be exploited
to characterize the volatile components of some foodstuffs.
With this approach, the volatile metabolomics pattern of beer
raw materials has been defined in a recent paper [134]. Similar
results were obtained with aromatic spices [149, 150] that have
been also characterized using DNA barcoding approaches
[44, 76]. In a strict sense, these results indicate that in the
case of spices it is possible not only to identify the species but
also the peculiar aromatic components responsible for their
flavour and scent. Such combined analytical system can be
seen as a way to also evaluate the efficacy of the processing
of spices-based products along the entire supply chain (e.g.,
harvesting, exsiccation, grinding, and packaging).
Taking advantage of all these features and tools, NMR
and MS are today able to answer most issues related to
food analysis: (i) food traceability, authenticity, and safety,
(ii) food composition and physical characteristics, (iii) food
processing and storage, and (iv) food and health.
Thus, the study of the whole metabolic profile of food
products can help defining quality features that make certain
foods unique and can bring information on food safety and
authenticity. For example, genetic modification, microorgan-
isms colonization, and other food characteristics of major
concern for human health are likely to influence large
portions of the raw material or processed food molecular
profile.
BioMed Research International
Another advantage of including the characteristics of the
metabolome in the molecular label of a certain food is the
potential of metabolomics in evaluating critical steps of the
supply chain such as production, storage, and distribution.
In 2014, Gallo and colleagues [116] described an interesting
NMR application to study the influence of agronomical
practices on the chemical composition of commercial table
grapes. Specifically, the variability of the grape metabolome
composition was evaluated considering primary metabolites,
the compounds directly involved in the growth, and develop-
ment of fruits. The authors found glucose, fructose, arginine,
and ethanol as compounds quantitatively influenced by farm-
ing practices. Moreover, the comparison between organic and
conventional productions showed a higher sugar content for
the latter, resulting in a higher sugar-to-acid ratio [116].
In such a context, a metabolomics approach is com-
plementary to a DNA barcoding analysis in evaluating the
production processes as well as in monitoring the occurrence
of alterations and species substitutions cases. For example, in
2015, Cagliani et al. [118] published an interesting application
of metabolomics to characterize saffron, a very expensive
and PDO spice. By using a multivariate statistical analysis
of NMR data, they identified reliable biomarkers, specifically
picrocrocin and crocins that permit distinguishing Italian
products from other commercial varieties, where these pecu-
liar compounds are less abundant (or even absent) [118].
The availability of an analytical platform based on the
combination of genomics and metabolomics tools will have
great potential in terms of food safety. As underlined in
the first chapter, since its introduction in the 90’s, the
DNA-based diagnostics has developed different strategies
to detect food pathogenic organisms. A DNA barcoding
approach, combined with the use of HTS technologies, could
certainly provide great advantages in this field because it
would permit obtaining a comprehensive vision of all the
putative food-related pathogens. However, this integrative
panel of data would not be completely exhaustive because
some microorganisms could be dead or inactive or become
pathogenic only when they release specific toxins or metabo-
lites [151, 152]. In this context, a metabolomics analysis
based on MS/NMR approaches could provide important
information regarding the occurrence of these metabolites
or other compounds of major concern (e.g., antibiotics
and pesticides) in foodstuffs. A rapid and simple analytical
method, able to identify 255 veterinary drug residues in raw
milk, was developed by Zhan and coworkers [128]. Their
method was based on a two-step precipitation and ultra
performance liquid chromatography coupled with electro-
spray ionization and tandem Mass Spectrometry (UPLC–
ESI–MS/MS). Malachová et al. [129] optimized and val-
idated in 2014 a LC–MS/MS method for the detection
of 295 fungal and bacterial metabolites in four different
types of food matrices: apple puree for infants (high water
content), hazelnuts (high fat content), maize (high starch
and low fat content), and green pepper (difficult or unique
matrix).
Finally, recent studies have shown the possibility to link
the metabolic profiling and characterization of foodstuffs to
7
the screening of food matrices, aiming at the identification
of small molecules able to bind and modulate the activity
of a target protein (often involved in the etiology of spe-
cific pathologies). Techniques such as Saturation Transfer
Difference- (STD-) NMR [153–155] and trNOESY NMR
experiments [156, 157] allowed the identification of natural
ligands present in Salvia sclareoides [136] and green tea [137],
able to recognize, bind, and modulate the activity of A𝛽
peptides (whose aggregation processes are considered among
the main biochemical events leading to Alzheimer’s disease).
In conclusion, the future of food analysis will necessarily
be based on the exploitation of integrative approaches,
including both genomics and metabolomics. If in the past this
was not feasible because of the lack of expertise and technical
limitations, the current technological advances offer high
performances in terms of standardization and universality to
investigate a wide panel of food items. The spread of omics
platforms, able to simultaneously process different matrices
with a multiapproach strategy [111], unified under the control
of bioinformatics tools, is boosting this revolution.
4. From Omics to Foodomics
The use of omics platforms to assess important aspects of
food items (i.e., contaminants and bioactive molecules) is
essential to obtain an exhaustive characterization of food
quality and safety or to assess the effect of food on human
cells, tissues, and organs as well. The availability of such
platforms responds to a general trend in food science about
the linking between food and health [7]. Nowadays, food is
more and more considered not only as a source of energy but
also as an affordable way to prevent future diseases. In this
scenario, human health should be considered as a dynamic
position in a multidimensional space [158] that spans from
growth to development to reproduction. Early nutritional
events (i.e., since the embryonic state) and food imprinting
can define the trajectories of development and contribute
to the wellness or the insurgence of noncommunicable
diseases such as allergy, diabetes, and obesity [159]. In the
development and maintaining ages, a proper nutrition could
offer the better cost effective way to prevent such non-
communicable diseases [160]. Furthermore, undernutrition
and overweight are global problems. The “global nutrition
report” of 2013 highlights how the world is off-track to
meet the 2025 World Health Assembly targets for nutrition
[161]. Apart from social and economical issues, from the
scientific point of view, nutrition research can furnish the
keys for defining the characteristics of a proper nutrition.
Therefore, a new discipline known as “foodomics” has been
defined to study the food and nutrition domains through
the application of advanced omics technologies to improve
consumer’s well-being, health, and confidence [162, 163].
Thanks to foodomics, many issues related to food could be
addressed such as the evaluation of the effects of certain
bioactive food components on biochemical, molecular, and
cellular mechanisms, or the identification of gene-based
differences among individuals in response to a specific dietary
pattern [164–166]. Foodomics tools could permit identifying
molecular biomarkers strictly related to the genes involved in
8 BioMed Research International
the early stages of a certain disease and to elucidate the effect
of bioactive food constituents on crucial molecular pathways
for preventing future diseases with an adequate diet [166–
168]. For example, a foodomics analysis was used to evaluate
the effect of dietary polyphenols against colon cancer [169].
Ibáñez and coworkers [169] tested the chemopreventive effect
of polyphenols from rosemary on the total gene, protein, and
metabolite expression in human HT29 colon cancer cells. The
results obtained from each component of the omics platform
(i.e., transcriptomics, proteomics, and metabolomics) were
integrated to estimate which cellular pathways were activated
in response to polyphenols. Data suggests that polyphenols
bring about an induction of cell-cycle arrest, an increase of
apoptosis, and an improvement of cellular antioxidant activ-
ity. The genes, proteins, and metabolites involved in these
three processes were identified thanks to the multiparameter
omics analysis. It is important to underline the fact that the
induction of apoptosis is especially relevant in colon cancer,
since the renewal of the colon epithelium via apoptosis is
the way used by the organism to eliminate deteriorated cells
that can mutate to carcinogenic. Therefore, a diet rich in
polyphenols plays an important role in the prevention of
colon cancer.
Foodomics is a powerful discipline to identify the adding
value properties of food items, as well as to detect food-
related toxins and allergens or to assess the effects of food
on human metabolism by evaluating cell-response [170, 171].
The efficacy of omics in the food sector also meets the
emerging needs related to personalized nutrition [172]. A
number of recent studies underlined the enormous variability
of individual response to the same diet or food components:
it is well known that food ingredients have effects that
are unique to each individual, as unique as is its own
transcriptome, proteome, and metabolome [158]. The role of
foodomics does not finish once a personalized diet has been
identified. Indeed, an exhaustive evaluation of the factors
altering the metabolic properties of food components should
also be taken into account. These factors include production
process, methods, and duration of conservation, interaction
with other components, cooking procedures, digestion, and
interaction with microbiome [173].
The advantages of foodomics are relevant not only for
producers but also for consumers to encourage a healthy
diet and to reduce educational, behavioural, and economic
barriers to accessing wellness. In this context, recent smart-
phone “apps” are becoming a powerful tool to promote the
consumption of high-quality foodstuffs and in particular the
consumption of those food items able to prevent diseases
[174–177]. Such informative tools (including online portals
and dissemination web sites) can be useful for different
stakeholders to translate a molecular label based on omics
approaches in a more understandable language for the
whole category of consumers. The molecular labelling that
combines DNA barcoding and metabolomics data with the
information of foodomics represents a precious source of data
to meet consumer requirements. In this sense, smartphone
apps represent a simple tool able to share and translate
molecular data to the various stakeholders of the food supply
chain.
Conflict of Interests
The authors declare that there is no conflict of interests
regarding the publication of this paper.
References
[1] A. Galimberti, F. De Mattia, A. Losa et al., “DNA barcoding as a
new tool for food traceability,” Food Research International, vol.
50, no. 1, pp. 55–63, 2013.
[2] C. Byrd-Bredbenner, M. N. Cohn, J. M. Farber et al., “Food
safety considerations for innovative nutrition solutions,” Annals
of the New York Academy of Sciences, vol. 1347, no. 1, pp. 29–44,
2015.
[3] B. C. Remington, J. L. Baumert, W. M. Blom, G. F. Houben,
S. L. Taylor, and A. G. Kruizinga, “Unintended allergens in
precautionary labelled and unlabelled products pose significant
risks to UK allergic consumers,” Allergy, vol. 70, no. 7, pp. 813–
819, 2015.
[4] W. Van Rijswijk and L. J. Frewer, “Consumer perceptions of food
quality and safety and their relation to traceability,” British Food
Journal, vol. 110, no. 10, pp. 1034–1046, 2008.
[5] W. Van Rijswijk and L. J. Frewer, “Consumer needs and
requirements for food and ingredient traceability information,”
International Journal of Consumer Studies, vol. 36, no. 3, pp.
282–290, 2012.
[6] G. Nocella, D. Romano, and G. Stefani, “Consumers’ attitudes,
trust and willingness to pay for food information,” International
Journal of Consumer Studies, vol. 38, no. 2, pp. 153–165, 2014.
[7] V. Garcı́a-Cañas, C. Simó, M. Herrero, E. Ibáñez, and A.
Cifuentes, “Present and future challenges in food analysis:
foodomics,” Analytical Chemistry, vol. 84, no. 23, pp. 10150–
10159, 2012.
[8] M. J. Myers, “Molecular identification of animal species in
food: transition from research laboratories to the regulatory
laboratories,” Veterinary Journal, vol. 190, no. 1, pp. 7–8, 2011.
[9] V. Fusco and G. M. Quero, “Culture-dependent and culture-
independent nucleic-acid-based methods used in the microbial
safety assessment of milk and dairy products,” Comprehensive
Reviews in Food Science and Food Safety, vol. 13, no. 4, pp. 493–
537, 2014.
[10] D. G. Newell, M. Koopmans, L. Verhoef et al., “Food-borne
diseases—the challenges of 20 years ago still persist while
new ones continue to emerge,” International Journal of Food
Microbiology, vol. 139, no. 1, pp. S3–S15, 2010.
[11] B. R. Jackson, P. M. Griffin, D. Cole, K. A. Walsh, and S. J. Chai,
“Outbreak-associated Salmonella enterica serotypes and food
commodities, United States, 1998–2008,” Emerging Infectious
Diseases, vol. 19, no. 8, pp. 1239–1244, 2013.
[12] L. Settanni and A. Corsetti, “The use of multiplex PCR to detect
and differentiate food- and beverage-associated microorgan-
isms: a review,” Journal of Microbiological Methods, vol. 69, no.
1, pp. 1–22, 2007.
[13] M. P. Doyle and R. L. Buchanan, Eds., Food Microbiology:
Fundamentals and Frontiers, ASM Press, Washington, DC,
USA, 4th edition, 2013.
[14] D. Ercolini, “High-throughput sequencing and metagenomics:
moving forward in the culture-independent analysis of food
microbial ecology,” Applied and Environmental Microbiology,
vol. 79, no. 10, pp. 3148–3155, 2013.
BioMed Research International
[15] S. Ceuppens, D. Li, M. Uyttendaele et al., “Molecular methods
in food safety microbiology: interpretation and implications of
nucleic acid detection,” Comprehensive Reviews in Food Science
and Food Safety, vol. 13, no. 4, pp. 551–577, 2014.
[16] A. Galimberti, A. Bruno, V. Mezzasalma, F. De Mattia, I.
Bruni, and M. Labra, “Emerging DNA-based technologies to
characterize food ecosystems,” Food Research International, vol.
69, pp. 424–433, 2015.
[17] A. M. Almeida, A. Bassols, E. Bendixen et al., “Animal board
invited review: advances in proteomics for animal and food
sciences,” Animal, vol. 9, no. 1, pp. 1–17, 2014.
[18] I. Mafra, I. M. P. L. V. O. Ferreira, and M. B. P. P. Oliveira,
“Food authentication by PCR-based methods,” European Food
Research and Technology, vol. 227, no. 3, pp. 649–665, 2008.
[19] Y.-J. Park, J. K. Lee, and N.-S. Kim, “Simple sequence repeat
polymorphisms (SSRPs) for evaluation of molecular diversity
and germplasm classification of minor crops,” Molecules, vol. 14,
no. 11, pp. 4546–4569, 2009.
[20] T. Bauer, P. Weller, W. P. Hammes, and C. Hertel, “The effect of
processing parameters on DNA degradation in food,” European
Food Research and Technology, vol. 217, no. 4, pp. 338–343, 2003.
[21] Ö. Aslan, R. M. Hamill, T. Sweeney, W. Reardon, and A. M.
Mullen, “Integrity of nuclear genomic deoxyribonucleic acid
in cooked meat: implications for food traceability,” Journal of
Animal Science, vol. 87, no. 1, pp. 57–61, 2009.
[22] M. T. Cimino, “Successful isolation and PCR amplification of
DNA from national institute of standards and technology herbal
dietary supplement standard reference material powders and
extracts,” Planta Medica, vol. 76, no. 5, pp. 495–497, 2010.
[23] J. P. Llongueras, S. Nair, D. Salas-Leiva, and A. E. Schwarzbach,
“Comparing DNA extraction methods for analysis of botan-
ical materials found in anti-diabetic supplements,” Molecular
Biotechnology, vol. 53, no. 3, pp. 249–256, 2013.
[24] D. I. Ellis, V. L. Brewster, W. B. Dunn, J. W. Allwood, A. P.
Golovanov, and R. Goodacre, “Fingerprinting food: current
technologies for the detection of food adulteration and contam-
ination,” Chemical Society Reviews, vol. 41, no. 17, pp. 5706–5727,
2012.
[25] P. Kumar, V. K. Gupta, A. K. Misra, D. R. Modi, and B. K. Pandey,
“Potential of molecular markers in plant biotechnology,” Plant
Omics Journal, vol. 2, no. 4, pp. 141–162, 2009.
[26] M. Labra, S. Imazio, F. Grassi et al., “Molecular approach to
assess the origin of cv. Marzemino,” Vitis, vol. 42, no. 3, pp. 137–
140, 2003.
[27] F. De Mattia, S. Imazio, F. Grassi et al., “Genetic characterization
of Sardinia grapevine cultivars by SSR markers analysis,” Journal
International des Sciences de la Vigne et du Vin, vol. 41, no. 4, pp.
175–184, 2007.
[28] I. J. Nijman, M. Otsen, E. L. C. Verkaar et al., “Hybridization
of banteng (Bos javanicus) and zebu (Bos indicus) revealed by
mitochondrial DNA, satellite DNA, AFLP and microsatellites,”
Heredity, vol. 90, no. 1, pp. 10–16, 2003.
[29] The Bovine HapMap Consortium, “Genome-wide survey of
SNP variation uncovers the genetic structure of cattle breeds,”
Science, vol. 324, no. 5926, pp. 528–532, 2009.
[30] N. Z. Ballin, “Authentication of meat and meat products,” Meat
Science, vol. 86, no. 3, pp. 577–587, 2010.
[31] H.-Y. Chuang, H.-S. Lur, K.-K. Hwu, and M.-C. Chang,
“Authentication of domestic Taiwan rice varieties based on fin-
gerprinting analysis of microsatellite DNA markers,” Botanical
Studies, vol. 52, no. 4, pp. 393–405, 2011.
9
[32] M. Labra, M. Winfield, A. Ghiani et al., “Genetic studies on
Trebbiano and morphologically related varieties by SSR and
AFLP markers,” Vitis, vol. 40, no. 4, pp. 187–190, 2001.
[33] G. V. Jones, M. A. White, O. R. Cooper, and K. Storchmann,
“Climate change and global wine quality,” Climatic Change, vol.
73, no. 3, pp. 319–343, 2005.
[34] G. Martins, C. Miot-Sertier, B. Lauga et al., “Grape berry
bacterial microbiota: impact of the ripening process and the
farming system,” International Journal of Food Microbiology, vol.
158, no. 2, pp. 93–100, 2012.
[35] R. Ferrise, G. Trombi, M. Moriondo, and M. Bindi, “Climate
change and grapevines: a simulation study for the mediter-
ranean basin,” Journal of Wine Economics, pp. 1–17, 2014.
[36] M. L. Jiménez-Pranteda, A. Pérez-Davó, M. Monteoliva-
Sánchez, A. Ramos-Cormenzana, and M. Aguilera, “Food
omics validation: towards understanding key features for gut
microbiota, probiotics and human health,” Food Analytical
Methods, vol. 8, no. 2, pp. 272–289, 2015.
[37] M. Casiraghi, M. Labra, E. Ferri, A. Galimberti, and F. de
Mattia, “DNA barcoding: a six-question tour to improve users’
awareness about the method,” Briefings in Bioinformatics, vol. 11,
no. 4, pp. 440–453, 2010.
[38] P. D. N. Hebert, S. Ratnasingham, and J. R. de Waard, “Bar-
coding animal life: cytochrome c oxidase subunit 1 divergences
among closely related species,” Proceedings of the Royal Society
B: Biological Sciences, vol. 270, supplement 1, pp. S96–S99, 2003.
[39] P. M. Hollingsworth, S. W. Graham, and D. P. Little, “Choosing
and using a plant DNA barcode,” PLoS ONE, vol. 6, no. 5, Article
ID e19254, 2011.
[40] M. L. Hollingsworth, A. Andra Clark, L. L. Forrest et al., “Select-
ing barcoding loci for plants: evaluation of seven candidate loci
with species-level sampling in three divergent groups of land
plants,” Molecular Ecology Resources, vol. 9, no. 2, pp. 439–457,
2009.
[41] W. J. Kress, D. L. Erickson, N. G. Swenson, J. Thompson, M.
Uriarte, and J. K. Zimmerman, “Advances in the use of DNA
barcodes to build a community phylogeny for tropical trees in
a Puerto Rican forest dynamics plot,” PLoS ONE, vol. 5, no. 11,
Article ID e15409, 2010.
[42] A. Galimberti, F. De Mattia, I. Bruni et al., “A DNA barcoding
approach to characterize pollen collected by honeybees,” PLoS
ONE, vol. 9, no. 10, Article ID e108344, 2014.
[43] K. S. Burgess, A. J. Fazekas, P. R. Kesanakurti et al., “Dis-
criminating plant species in a local temperate flora using the
rbcL+matK DNA barcode,” Methods in Ecology and Evolution,
vol. 2, no. 4, pp. 333–340, 2011.
[44] F. De Mattia, I. Bruni, A. Galimberti, F. Cattaneo, M. Casiraghi,
and M. Labra, “A comparative study of different DNA barcoding
markers for the identification of some members of Lamiacaea,”
Food Research International, vol. 44, no. 3, pp. 693–702, 2011.
[45] P. Gaubert, F. Njiokou, A. Olayemi et al., “Bushmeat genetics:
setting up a reference framework for the DNA typing of African
forest bushmeat,” Molecular Ecology Resources, vol. 15, no. 3, pp.
633–651, 2015.
[46] H. A. Raja, T. R. Baker, J. G. Little, and N. H. Oberlies,
“DNA barcoding for identification of species in mushrooms: a
component of product certification,” Planta Medica, vol. 80, no.
10, article PR4, 2014.
[47] R. Khaksar, T. Carlson, D. W. Schaffner et al., “Unmasking
seafood mislabeling in U.S. markets: DNA barcoding as a
unique technology for food authentication and quality control,”
Food Control, vol. 56, pp. 71–76, 2015.
10
[48] S. Ratnasingham and P. D. N. Hebert, “BOLD: the barcode of life
data system (http://www.barcodinglife.org),” Molecular Ecology
Notes, vol. 7, no. 3, pp. 355–364, 2007.
[49] S. Ratnasingham and P. D. N. Hebert, “A DNA-based registry for
all animal species: the Barcode Index Number (BIN) System,”
PLoS ONE, vol. 8, no. 7, Article ID e66213, 2013.
[50] S. Becker, R. Hanner, and D. Steinke, “Five years of FISH-BOL:
brief status report,” Mitochondrial DNA, vol. 22, no. 1, pp. 3–9,
2011.
[51] M. Barbuto, A. Galimberti, E. Ferri et al., “DNA barcoding
reveals fraudulent substitutions in shark seafood products:
the Italian case of ‘palombo’ (Mustelus spp.),” Food Research
International, vol. 43, no. 1, pp. 376–381, 2010.
[52] H. F. Yancy, T. S. Zemlak, J. A. Mason et al., “Potential use
of DNA barcodes in regulatory science: applications of the
regulatory fish encyclopedia,” Journal of Food Protection, vol. 71,
no. 1, pp. 210–217, 2008.
[53] Y. Kikkawa, T. Takada, Sutopo et al., “Phylogenies using mtDNA
and SRY provide evidence for male-mediated introgression in
Asian domestic cattle,” Animal Genetics, vol. 34, no. 2, pp. 96–
101, 2003.
[54] A. Nemeth, A. Wurz, L. Artim et al., “Sensitive PCR analysis of
animal tissue samples for fragments of endogenous and trans-
genic plant DNA,” Journal of Agricultural and Food Chemistry,
vol. 52, no. 20, pp. 6129–6135, 2004.
[55] E. Ponzoni, F. Mastromauro, S. Gianı̀, and D. Breviario,
“Traceability of plant diet contents in raw cow milk samples,”
Nutrients, vol. 1, no. 2, pp. 251–262, 2009.
[56] A. Galimberti, M. Labra, A. Sandionigi, A. Bruno, V. Mezza-
salma, and F. De Mattia, “DNA barcoding for minor crops and
food traceability,” Advances in Agriculture, vol. 2014, Article ID
831875, 8 pages, 2014.
[57] S. Nicolè, D. L. Erickson, D. Ambrosi et al., “Biodiversity studies
in Phaseolus species by DNA barcoding,” Genome, vol. 54, no. 7,
pp. 529–545, 2011.
[58] V. A. Parvathy, V. P. Swetha, T. E. Sheeja, and B. Sasikumar,
“Detection of plant-based adulterants in turmeric powder using
DNA barcoding,” Pharmaceutical Biology, vol. 53, no. 12, pp.
1774–1779, 2015.
[59] A. T. Uncu, A. O. Uncu, A. Frary, and S. Doganlar, “Authenti-
cation of botanical origin in herbal teas by plastid non-coding
DNA length polymorphisms,” Journal of Agricultural and Food
Chemistry, vol. 63, no. 25, pp. 5920–5929, 2015.
[60] P. Mishra, A. Kumar, A. Nagireddy et al., “DNA barcoding:
an efficient tool to overcome authentication challenges in the
herbal market,” Plant Biotechnology Journal, 2015.
[61] I. Bruni, A. Galimberti, L. Caridi et al., “A DNA barcoding
approach to identify plant species in multiflower honey,” Food
Chemistry, vol. 170, pp. 308–315, 2015.
[62] I. Bruni, F. De Mattia, A. Galimberti et al., “Identification of
poisonous plants by DNA barcoding approach,” International
Journal of Legal Medicine, vol. 124, no. 6, pp. 595–603, 2010.
[63] S. Federici, D. Fontana, A. Galimberti et al., “A rapid diagnostic
approach to identify poisonous plants using DNA barcoding
data,” Plant Biosystems, vol. 149, no. 3, 2015.
[64] M. Casiraghi, M. Labra, E. Ferri, A. Galimberti, and F. De
Mattia, “DNA barcoding: theoretical aspects and practical
applications,” in Tools for Identifying Biodiversity: Progress and
Problems, P. L. Nimis and R. Vignes Lebbe, Eds., pp. 269–273,
Edizioni Università di Trieste, Trieste, Italy, 2010.
BioMed Research International
[65] T. Hidayat, A. Pancoro, and D. Kusumawaty, “Utility of matK
gene to assess evolutionary relationship of genus Mangifera
(anacardiaceae) in Indonesia and Thailand,” Biotropia, vol. 18,
no. 2, pp. 74–80, 2011.
[66] T. Xin, H. Yao, H. Gao et al., “Super food Lycium barbarum
(Solanaceae) traceability via an internal transcribed spacer 2
barcode,” Food Research International, vol. 54, no. 2, pp. 1699–
1704, 2013.
[67] L. Jaakola, M. Suokas, and H. Häggman, “Novel approaches
based on DNA barcoding and high-resolution melting of
amplicons for authenticity analyses of berry species,” Food
Chemistry, vol. 123, no. 2, pp. 494–500, 2010.
[68] T. Hidayat, F. I. Abdullah, C. Kuppusamy, A. A. Samad, and
A. Wagiran, “Molecular identification of Malaysian pineapple
cultivar based on internal transcribed spacer region,” APCBEE
Procedia, vol. 4, pp. 146–151, 2012.
[69] N. Kane, S. Sveinsson, H. Dempewolf et al., “Ultra-barcoding
in cacao (Theobroma spp.; malvaceae) using whole chloroplast
genomes and nuclear ribosomal DNA,” American Journal of
Botany, vol. 99, no. 2, pp. 320–329, 2012.
[70] M. R. Enan and A. Ahmed, “DNA barcoding based on plastid
matK and RNA polymerase for assessing the genetic identity of
date (Phoenix dactylifera L.) cultivars,” Genetics and Molecular
Research, vol. 13, no. 2, pp. 3527–3536, 2014.
[71] R. L. Jarret, “DNA barcoding in a crop genebank: the Capsicum
annuum species complex,” The Open Biology Journal, vol. 1, no.
1, pp. 35–42, 2008.
[72] I. Ganopoulos, P. Madesis, N. Darzentas, A. Argiriou, and A.
Tsaftaris, “Barcode High Resolution Melting (Bar-HRM) anal-
ysis for detection and quantification of PDO ‘fava Santorinis’
(Lathyrus clymenum) adulterants,” Food Chemistry, vol. 133, no.
2, pp. 505–512, 2012.
[73] P. Madesis, I. Ganopoulos, A. Anagnostis, and A. Tsaftaris, “The
application of Bar-HRM (Barcode DNA-High Resolution Melt-
ing) analysis for authenticity testing and quantitative detection
of bean crops (Leguminosae) without prior DNA purification,”
Food Control, vol. 25, no. 2, pp. 576–582, 2012.
[74] S. Federici, A. Galimberti, F. Bartolucci et al., “DNA barcoding
to analyse taxonomically complex groups in plants: the case of
Thymus (Lamiaceae),” Botanical Journal of the Linnean Society,
vol. 171, no. 4, pp. 687–699, 2013.
[75] A. Gismondi, F. Fanali, J. M. M. Labarga, M. G. Caiola, and A.
Canini, “Crocus sativus L. genomics and different DNA barcode
applications,” Plant Systematics and Evolution, vol. 299, no. 10,
pp. 1859–1863, 2013.
[76] V. A. Parvathy, V. P. Swetha, T. E. Sheeja, N. K. Leela, B.
Chempakam, and B. Sasikumar, “DNA barcoding to detect
chilli adulteration in traded black pepper powder,” Food
Biotechnology, vol. 28, no. 1, pp. 25–40, 2014.
[77] M. Wang, H.-X. Zhao, L. Wang et al., “Potential use of DNA
barcoding for the identification of Salvia based on cpDNA and
nrDNA sequences,” Gene, vol. 528, no. 2, pp. 206–215, 2013.
[78] M. Y. Stoeckle, C. C. Gamble, R. Kirpekar, G. Young, S. Ahmed,
and D. P. Little, “Commercial teas highlight plant DNA barcode
identification successes and obstacles,” Scientific Reports, vol. 1,
article 42, 2011.
[79] V. A. Parvathy, V. p. Swetha, T. E. Sheeja, and B. Sasikumar,
“Detection of plant-based adulterants in turmeric powder using
DNA barcoding,” Pharmaceutical Biology, vol. 53, no. 12, pp.
1774–1779, 2015.
[80] M. Li, K.-L. Wong, W.-H. Chan et al., “Establishment of DNA
barcodes for the identification of the botanical sources of the
BioMed Research International
Chinese ‘cooling’ beverage,” Food Control, vol. 25, no. 2, pp. 758–
766, 2012.
[81] M. Arleo, F. Ruibal, J. Pereyra, E. Miquel, M. Fernández, and
C. Martı́nez, “A DNA-based approach to discriminate between
quince and apple in quince jams,” International Food Research
Journal, vol. 19, no. 4, pp. 1471–1477, 2012.
[82] B. T. M. Dentinger, M. Y. Didukh, and J.-M. Moncalvo, “Com-
paring COI and ITS as DNA barcode markers for mushrooms
and allies (Agaricomycotina),” PLoS ONE, vol. 6, no. 9, Article
ID e25081, 2011.
[83] P. Khaund and S. R. Joshi, “DNA barcoding of wild edible
mushrooms consumed by the ethnic tribes of India,” Gene, vol.
550, no. 1, pp. 123–130, 2014.
[84] A. Ardura, A. R. Linde, J. C. Moreira, and E. Garcia-Vazquez,
“DNA barcoding for conservation and management of Amazo-
nian commercial fish,” Biological Conservation, vol. 143, no. 6,
pp. 1438–1443, 2010.
[85] A. Ardura, S. Planes, and E. Garcia-Vazquez, “Applications of
DNA barcoding to fish landings: authentication and diversity
assessment,” ZooKeys, vol. 365, pp. 49–65, 2013.
[86] D. C. Carvalho, R. M. Palhares, M. G. Drummond, and T.
B. Frigo, “DNA Barcoding identification of commercialized
seafood in South Brazil: a governmental regulatory forensic
program,” Food Control, vol. 50, pp. 784–788, 2015.
[87] P. J. Smith, S. M. McVeagh, and D. Steinke, “DNA barcoding
for the identification of smoked fish products,” Journal of Fish
Biology, vol. 72, no. 2, pp. 464–471, 2008.
[88] A. Abdullah and H. Rehbein, “Authentication of raw and pro-
cessed tuna from Indonesian markets using DNA barcoding,
nuclear gene and character-based approach,” European Food
Research and Technology, vol. 239, no. 4, pp. 695–706, 2014.
[89] A. Galal-Khallaf, A. Ardura, K. Mohammed-Geba, Y. J. Borrell,
and E. Garcia-Vazquez, “DNA barcoding reveals a high level of
mislabeling in Egyptian fish fillets,” Food Control, vol. 46, pp.
441–445, 2014.
[90] A. Mottola, P. Marchetti, M. Bottaro, and A. Di Pinto, “DNA
barcoding for species identification in prepared fishery prod-
ucts,” Albanian Journal of Agricultural Sciences, vol. 13, pp. 447–
453, 2014.
[91] M. A. de Brito, H. Schneider, I. Sampaio, and S. Santos, “DNA
barcoding reveals high substitution rate and mislabeling in
croaker fillets (Sciaenidae) marketed in Brazil: the case of
‘pescada branca’ (Cynoscion leiarchus and Plagioscion squamo-
sissimus),” Food Research International, vol. 70, pp. 40–46, 2015.
[92] A. Di Pinto, P. Marchetti, A. Mottola et al., “Species identifi-
cation in fish fillet products using DNA barcoding,” Fisheries
Research, vol. 170, pp. 9–13, 2015.
[93] B. A. Maralit, R. D. Aguila, M. F. H. Ventolero, S. K. L. Perez,
D. A. Willette, and M. D. Santos, “Detection of mislabeled
commercial fishery by-products in the Philippines using DNA
barcodes and its implications to food traceability and safety,”
Food Control, vol. 33, no. 1, pp. 119–125, 2013.
[94] K. Nagalakshmi, P. Annam, G. Venkateshwarlu, G. Pathakota,
and W. S. Lakra, “Mislabeling in Indian seafood: an investiga-
tion using DNA barcoding,” Food Control, vol. 59, pp. 196–200,
2016.
[95] R. Lamendin, K. Miller, and R. D. Ward, “Labelling accuracy
in Tasmanian seafood: an investigation using DNA barcoding,”
Food Control, vol. 47, pp. 436–443, 2015.
[96] A. M. Pappalardo and V. Ferrito, “DNA barcoding species
identification unveils mislabeling of processed flatfish products
11
in southern Italy markets,” Fisheries Research, vol. 164, pp. 153–
158, 2015.
[97] A. Armani, L. Guardone, R. La Castellana, D. Gianfaldoni, A.
Guidi, and L. Castigliego, “DNA barcoding reveals commercial
and health issues in ethnic seafood sold on the Italian market,”
Food Control, vol. 55, pp. 206–214, 2015.
[98] P. A. Haye, N. I. Segovia, R. Vera, M. D. L. Á. Gallardo, and
C. Gallardo-Escárate, “Authentication of commercialized crab-
meat in Chile using DNA Barcoding,” Food Control, vol. 25, no.
1, pp. 239–244, 2012.
[99] V. R. Vartak, R. Narasimmalu, P. K. Annam, D. P. Singh,
and W. S. Lakra, “DNA barcoding detected improper labelling
and supersession of crab food served by restaurants in India,”
Journal of the Science of Food and Agriculture, vol. 95, no. 2, pp.
359–366, 2015.
[100] H. Kim, K. S. Kumar, S. Y. Hwang, B. Kang, H. Moon, and
K. Shin, “Utility of stable isotope and COI gene sequencing
analysis in inferring origin and authentication of Hairtail fish
and Shrimp,” Journal of Agricultural and Food Chemistry, vol.
63, no. 22, pp. 5548–5556, 2015.
[101] F. Debenedetti, A. Dalmasso, M. T. Bottero et al., “Application
of DNA barcoding for controlling of the species from Octopus
genus,” Italian Journal of Food Safety, vol. 3, no. 4, pp. 196–199,
2014.
[102] S. Bitanyi, G. Bjørnstad, M. Nesje, E. M. Ernest, R. H. Mdegela,
and K. H. Røed, “Molecular identification versus local people’s
information for accurate estimates of bushmeat utilization
from the Serengeti ecosystem, Tanzania,” African Journal of
Biotechnology, vol. 11, no. 1, pp. 243–252, 2013.
[103] C. A. Quinto, R. Tinoco, and R. S. Hellberg, “DNA barcoding
reveals mislabeling of game meat species on the US commercial
market,” Food Control, vol. 59, pp. 386–392, 2016.
[104] D. E. Kane and R. S. Hellberg, “Identification of species in
ground meat products sold on the US commercial market using
DNA-based methods,” Food Control, vol. 59, pp. 158–163, 2015.
[105] Y. Cai, L. Zhang, F. Shen et al., “DNA barcoding of 18 species
of Bovidae,” Chinese Science Bulletin, vol. 56, no. 2, pp. 164–168,
2011.
[106] L. Solieri, T. C. Dakal, and P. Giudici, “Next-generation
sequencing and its potential impact on food microbial
genomics,” Annals of Microbiology, vol. 63, no. 1, pp. 21–37, 2013.
[107] P. Madesis, I. Ganopoulos, I. Sakaridis, A. Argiriou, and A.
Tsaftaris, “Advances of DNA-based methods for tracing the
botanical origin of food products,” Food Research International,
vol. 60, pp. 163–172, 2014.
[108] A. Ortola-Vidal, H. Schnerr, M. Rojmyr, F. Lysholm, and A.
Knight, “Quantitative identification of plant genera in food
products using PCR and Pyrosequencing technology,” Food
Control, vol. 18, no. 8, pp. 921–927, 2007.
[109] A. Valentini, C. Miquel, and P. Taberlet, “DNA barcoding for
honey biodiversity,” Diversity, vol. 2, no. 4, pp. 610–617, 2010.
[110] S. G. Newmaster, S. Ragupathy, and J. Janovec, “A botanical
renaissance: state-of-the-art DNA bar coding facilitates an
automated identification technology system for plants,” Inter-
national Journal of Computer Applications in Technology, vol. 35,
no. 1, pp. 50–60, 2009.
[111] F. R. Pinu, “Metabolomics—the new frontier in food safety and
quality research,” Food Research International, vol. 72, pp. 80–81,
2015.
[112] E. Trujillo, C. Davis, and J. Milner, “Nutrigenomics, proteomics,
metabolomics, and the practice of dietetics,” Journal of the
American Dietetic Association, vol. 106, no. 3, pp. 403–413, 2006.
 12
[113] E. Schievano, C. Finotello, E. De Angelis, S. Mammi, and L.
Navarini, “Rapid authentication of coffee blends and quan-
tification of 16-O-methylcafestol in roasted coffee beans by
nuclear magnetic resonance,” Journal of Agricultural and Food
Chemistry, vol. 62, no. 51, pp. 12309–12314, 2014.
[114] L. L. Monti, C. A. Bustamante, S. Osorio et al., “Metabolic pro-
filing of a range of peach fruit varieties reveals high metabolic
diversity and commonalities and differences during ripening,”
Food Chemistry, vol. 190, pp. 879–888, 2016.
[115] H.-S. Son, G.-S. Hwang, H.-J. Ahn, W.-M. Park, C.-H. Lee,
and Y.-S. Hong, “Characterization of wines from grape varieties
through multivariate statistical analysis of 1H NMR spectro-
scopic data,” Food Research International, vol. 42, no. 10, pp.
1483–1491, 2009.
[116] V. Gallo, P. Mastrorilli, I. Cafagna et al., “Effects of agronomical
practices on chemical composition of table grapes evaluated by
NMR spectroscopy,” Journal of Food Composition and Analysis,
vol. 35, no. 1, pp. 44–52, 2014.
[117] R. Dı́az, O. J. Pozo, J. V. Sancho, and F. Hernández,
“Metabolomic approaches for orange origin discrimination
by ultra-high performance liquid chromatography coupled to
quadrupole time-of-flight mass spectrometry,” Food Chemistry,
vol. 157, pp. 84–93, 2014.
[118] L. R. Cagliani, N. Culeddu, M. Chessa, and R. Consonni, “NMR
investigations for a quality assessment of Italian PDO saffron
(Crocus sativus L.),” Food Control, vol. 50, pp. 342–348, 2015.
[119] F. Longobardi, A. Ventrella, C. Napoli et al., “Classification
of olive oils according to geographical origin by using 1H
NMR fingerprinting combined with multivariate analysis,” Food
Chemistry, vol. 130, no. 1, pp. 177–183, 2012.
[120] F. Longobardi, D. Sacco, G. Casiello, A. Ventrella, and A. Sacco,
“Characterization of the geographical and varietal origin of
wheat and bread by means of nuclear magnetic resonance
(NMR), isotope ratio mass spectrometry (IRMS) methods and
chemometrics: a review,” Agricultural Sciences, vol. 6, no. 1,
Article ID 53433, 2015.
[121] E. Cubero-Leon, R. Peñalver, and A. Maquet, “Review on
metabolomics for food authentication,” Food Research Interna-
tional, vol. 60, pp. 95–107, 2014.
[122] A. Trimigno, F. C. Marincola, N. Dellarosa, G. Picone, and L.
Laghi, “Definition of food quality by NMR-based foodomics,”
Current Opinion in Food Science, vol. 4, pp. 99–104, 2015.
[123] L. Laghi, G. Picone, and F. Capozzi, “Nuclear magnetic res-
onance for foodomics beyond food analysis,” TrAC Trends in
Analytical Chemistry, vol. 59, pp. 93–102, 2014.
[124] K. Dettmer, P. A. Aronov, and B. D. Hammock, “Mass spectrom-
etry-based metabolomics,” Mass Spectrometry Reviews, vol. 26,
no. 1, pp. 51–78, 2007.
[125] D. E. Garcia, E. E. Baidoo, P. I. Benke et al., “Separation and mass
spectrometry in microbial metabolomics,” Current Opinion in
Microbiology, vol. 11, no. 3, pp. 233–239, 2008.
[126] X. Li and C. Legido-Quigley, “Advances in separation science
applied to metabonomics,” Electrophoresis, vol. 29, no. 18, pp.
3724–3736, 2008.
[127] H. J. Issaq, Q. N. Van, T. J. Waybright, G. M. Muschik,
and T. D. Veenstra, “Analytical and statistical approaches to
metabolomics research,” Journal of Separation Science, vol. 32,
no. 13, pp. 2183–2199, 2009.
[128] J. Zhan, X.-J. Yu, Y.-Y. Zhong et al., “Generic and rapid determi-
nation of veterinary drug residues and other contaminants in
raw milk by ultra performance liquid chromatography-tandem
BioMed Research International
mass spectrometry,” Journal of Chromatography B: Analytical
Technologies in the Biomedical and Life Sciences, vol. 906, pp.
48–57, 2012.
[129] A. Malachová, M. Sulyok, E. Beltrán, F. Berthiller, and R.
Krska, “Optimization and validation of a quantitative liquid
chromatography—tandem mass spectrometric method cover-
ing 295 bacterial and fungal metabolites including all regulated
mycotoxins in four model food matrices,” Journal of Chromatog-
raphy A, vol. 1362, pp. 145–156, 2014.
[130] P. Mazzei and A. Piccolo, “ 1 H HRMAS-NMR metabolomic
to assess quality and traceability of mozzarella cheese from
Campania buffalo milk,” Food Chemistry, vol. 132, no. 3, pp.
1620–1627, 2012.
[131] C. Siciliano, E. Belsito, R. De Marco, M. L. Di Gioia, A. Leggio,
and A. Liguori, “Quantitative determination of fatty acid chain
composition in pork meat products by high resolution 1H NMR
spectroscopy,” Food Chemistry, vol. 136, no. 2, pp. 546–554, 2013.
[132] T. H. Soininen, N. Jukarainen, S. O. K. Auriola, R. Julkunen-
Tiitto, R. Karjalainen, and J. J. Vepsäläinen, “Quantitative
metabolite profiling of edible onion species by NMR and HPLC-
MS,” Food Chemistry, vol. 165, pp. 499–505, 2014.
[133] Y. Zhao, P. Chen, L. Lin, J. M. Harnly, L. Yu, and Z. Li, “Tentative
identification, quantitation, and principal component analysis
of green pu-erh, green, and white teas using UPLC/DAD/MS,”
Food Chemistry, vol. 126, no. 3, pp. 1269–1277, 2011.
[134] J. L. Gonçalves, J. A. Figueira, F. P. Rodrigues et al., “A powerful
methodological approach combining headspace solid phase
microextraction, mass spectrometry and multivariate analysis
for profiling the volatile metabolomic pattern of beer starting
raw materials,” Food Chemistry, vol. 160, pp. 266–280, 2014.
[135] F. Wei, K. Furihata, M. Koda, F. Hu, T. Miyakawa, and M.
Tanokura, “Roasting process of coffee beans as studied by
nuclear magnetic resonance: time course of changes in compo-
sition,” Journal of Agricultural and Food Chemistry, vol. 60, no.
4, pp. 1005–1012, 2012.
[136] C. Airoldi, E. Sironi, C. Dias et al., “Natural compounds
against Alzheimer’s disease: molecular recognition of A𝛽1–42
peptide by Salvia sclareoides extract and its major component,
rosmarinic acid, as investigated by NMR,” Chemistry, vol. 8, no.
3, pp. 596–602, 2013.
[137] E. Sironi, L. Colombo, A. Lompo et al., “Natural compounds
against neurodegenerative diseases: molecular characterization
of the interaction of catechins from green tea with A𝛽1-42,
PrP106-126, and ataxin-3 oligomers,” Chemistry—A European
Journal, vol. 20, no. 42, pp. 13793–13800, 2014.
[138] G. Jiang, S. Lin, L. Wen et al., “Identification of a novel
phenolic compound in litchi (Litchi chinensis Sonn.) pericarp
and bioactivity evaluation,” Food Chemistry, vol. 136, no. 2, pp.
563–568, 2013.
[139] E. K. Kemsley, G. Le Gall, J. R. Dainty et al., “Multivariate
techniques and their application in nutrition: a metabolomics
case study,” British Journal of Nutrition, vol. 98, no. 1, pp. 1–14,
2007.
[140] T. Skov, A. H. Honoré, H. M. Jensen, T. Næs, and S. B. Engelsen,
“Chemometrics in foodomics: handling data structures from
multiple analytical platforms,” Trends in Analytical Chemistry,
vol. 60, pp. 71–79, 2014.
[141] M. Labra, G. Moriondo, A. Schneider et al., “Biodiversity of
grapevines (Vitis vinifera L.) grown in the Aosta valley,” Vitis,
vol. 41, no. 2, pp. 89–92, 2002.
[142] F. De Mattia, S. Imazio, F. Grassi et al., “Genetic characterization
of sardinia grapevine cultivars by SSR markers analysis,” Journal
 BioMed Research International
International des Sciences de la Vigne et du Vin, vol. 41, no. 4, pp.
175–184, 2007.
[143] R. Godelmann, F. Fang, E. Humpfer et al., “Targeted and non-
targeted wine analysis by 1H NMR spectroscopy combined with
multivariate statistical analysis. Differentiation of important
parameters: grape variety, geographical origin, year of vintage,”
Journal of Agricultural and Food Chemistry, vol. 61, no. 23, pp.
5610–5619, 2013.
[144] N. A. Bokulich, C. M. L. Joseph, G. Allen, A. K. Benson, and
D. A. Mills, “Next-generation sequencing reveals significant
bacterial diversity of botrytized wine,” PLoS ONE, vol. 7, no. 5,
Article ID e36357, 2012.
[145] N. A. Bokulich, M. Ohta, P. M. Richardson, and D. A. Mills,
“Monitoring seasonal changes in winery-resident microbiota,”
PLoS ONE, vol. 8, no. 6, Article ID e66437, 2013.
[146] V. David, S. Terrat, K. Herzine et al., “High-throughput
sequencing of amplicons for monitoring yeast biodiversity in
must and during alcoholic fermentation,” Journal of Industrial
Microbiology & Biotechnology, vol. 41, no. 5, pp. 811–821, 2014.
[147] C. Agrimonti, M. Vietina, S. Pafundo, and N. Marmiroli, “The
use of food genomics to ensure the traceability of olive oil,”
Trends in Food Science & Technology, vol. 22, no. 5, pp. 237–244,
2011.
[148] I. Ganopoulos, C. Bazakos, P. Madesis, P. Kalaitzis, and A.
Tsaftaris, “Barcode DNA high-resolution melting (Bar-HRM)
analysis as a novel close-tubed and accurate tool for olive oil
forensic use,” Journal of the Science of Food and Agriculture, vol.
93, no. 9, pp. 2281–2286, 2013.
[149] A. Yilmaz, N. T. Nyberg, P. Mølgaard, J. Asili, and J. W.
Jaroszewski, “1H NMR metabolic fingerprinting of saffron
extracts,” Metabolomics, vol. 6, no. 4, pp. 511–517, 2010.
[150] A. B. Uryupin and A. S. Peregudov, “Application of NMR
techniques to the determination of the composition of tobacco,
coffee, and tea products,” Journal of Analytical Chemistry, vol.
68, no. 12, pp. 1021–1032, 2013.
[151] J. Giacometti, A. B. Tomljanović, and D. Josić, “Application of
proteomics and metabolomics for investigation of food toxins,”
Food Research International, vol. 54, no. 1, pp. 1042–1051, 2013.
[152] T. J. Montville and M. L. Chikindas, “Biological control of
foodborne bacteria,” in Food Microbiology: Fundamentals and
Frontiers, M. P. Doyle and R. L. Buchanan, Eds., pp. 803–822,
ASM Press, Washington, DC, USA, 4th edition, 2013.
[153] R. Caraballo, H. Dong, J. P. Ribeiro, J. Jiménez-Barbero, and O.
Ramström, “Direct STD NMR identification of 𝛽-galactosidase
inhibitors from a virtual dynamic hemithioacetal system,”
Angewandte Chemie—International Edition, vol. 49, no. 3, pp.
589–593, 2010.
[154] C. Airoldi, S. Sommaruga, S. Merlo et al., “Targeting bacte-
rial membranes: NMR spectroscopy characterization of sub-
strate recognition and binding requirements of D-arabinose-5-
phosphate isomerase,” Chemistry, vol. 16, no. 6, pp. 1897–1902,
2010.
[155] C. Airoldi, S. Giovannardi, B. La Ferla, J. Jiménez-Barbero, and
F. Nicotra, “Saturation transfer difference NMR experiments of
membrane Proteins in living cells under HR-MAS conditions:
the interaction of the SGLT1 co-transporter with its ligands,”
Chemistry—A European Journal, vol. 17, no. 48, pp. 13395–13399,
2011.
[156] C. Airoldi, A. Palmioli, A. D’Urzo et al., “Glucose-derived Ras
pathway inhibitors: evidence of Ras-ligand binding and Ras-
GEF (Cdc25) interaction inhibition,” ChemBioChem, vol. 8, no.
12, pp. 1376–1379, 2007.
13
[157] A. Palmioli, E. Sacco, C. Airoldi et al., “Selective cytotoxicity of
a bicyclic Ras inhibitor in cancer cells expressing K-RasG13D,”
Biochemical and Biophysical Research Communications, vol. 386,
no. 4, pp. 593–597, 2009.
[158] A. Bordoni and F. Capozzi, “Foodomics for healthy nutrition,”
Current Opinion in Clinical Nutrition and Metabolic Care, vol.
17, no. 5, pp. 418–424, 2014.
[159] S. Chadio and B. Kotsampasi, “The role of early life nutrition
in programming of reproductive function,” Journal of Develop-
mental Origins of Health and Disease, vol. 5, no. 1, pp. 2–15, 2014.
[160] S. M. Solon-Biet, S. J. Mitchell, R. de Cabo, D. Raubenheimer,
D. G. Le Couteur, and S. Simpson, “Macronutrients and caloric
intake in health and longevity,” Journal of Endocrinology, 2015.
[161] L. Haddad, E. Achadi, M. A. Bendech et al., “The global
nutrition report 2014: actions and accountability to accelerate
the world’s progress on nutrition,” The Journal of Nutrition, vol.
145, no. 4, pp. 663–671, 2015.
[162] A. Cifuentes, “Food analysis and foodomics,” Journal of Chro-
matography A, vol. 1216, no. 43, p. 7109, 2009.
[163] M. Herrero, V. Garcı́a-Cañas, C. Simo, and A. Cifuentes,
“Recent advances in the application of capillary electromigra-
tion methods for food analysis and Foodomics,” Electrophoresis,
vol. 31, no. 1, pp. 205–228, 2010.
[164] C. M. Williams, J. M. Ordovas, D. Lairon et al., “The challenges
for molecular nutrition research 1: linking genotype to healthy
nutrition,” Genes and Nutrition, vol. 3, no. 2, pp. 41–49, 2008.
[165] J. Wittwer, I. Rubio-Aliaga, B. Hoeft, I. Bendik, P. Weber, and H.
Daniel, “Nutrigenomics in human intervention studies: current
status, lessons learned and future perspectives,” Molecular
Nutrition & Food Research, vol. 55, no. 3, pp. 341–358, 2011.
[166] C. E. Smith, J. M. Ordovás, C. Sánchez-Moreno, Y.-C. Lee, and
M. Garaulet, “Apolipoprotein A-II polymorphism: relationships
to behavioural and hormonal mediators of obesity,” Interna-
tional Journal of Obesity, vol. 36, no. 1, pp. 130–136, 2012.
[167] D. Corella, D. K. Arnett, K. L. Tucker et al., “A high intake of
saturated fatty acids strengthens the association between the
fat mass and obesity-associated gene and BMI,” The Journal of
Nutrition, vol. 141, no. 12, pp. 2219–2225, 2011.
[168] A. Valdés, C. Simó, C. Ibáñez et al., “Effect of dietary polyphe-
nols on K562 leukemia cells: a foodomics approach,” Elec-
trophoresis, vol. 33, no. 15, pp. 2314–2327, 2012.
[169] C. Ibáñez, A. Valdés, V. Garcı́a-Cañas et al., “Global Foodomics
strategy to investigate the health benefits of dietary con-
stituents,” Journal of Chromatography A, vol. 1248, pp. 139–153,
2012.
[170] U. Anđelković, T. Martinović, and D. Josić, “Foodomic investi-
gations of food allergies,” Current Opinion in Food Science, vol.
4, pp. 92–98, 2015.
[171] D. Rešetar, S. K. Pavelić, and D. Josić, “Foodomics for investi-
gations of food toxins,” Current Opinion in Food Science, vol. 4,
pp. 86–91, 2015.
[172] K. S. Vimaleswaran, C. I. Le Roy, and S. P. Claus, “Foodomics
for personalized nutrition: how far are we?” Current Opinion in
Food Science, vol. 4, pp. 129–135, 2015.
[173] G. H. Beaton, J. Burema, and C. Ritenbaugh, “Errors in the
interpretation of dietary assessments,” The American Journal of
Clinical Nutrition, vol. 65, no. 4, pp. 1100S–1107S, 1997.
[174] S. L. Casperson, J. Sieling, J. Moon, L. Johnson, J. N. Roemmich,
and L. Whigham, “A mobile phone food record app to digitally
capture dietary intake for adolescents in a free-living environ-
ment: usability study,” JMIR mHealth and uHealth, vol. 3, no. 1,
article e30, 2015.
 14 BioMed Research International

[175] M. J. Hutchesson, M. E. Rollo, R. Callister, and C. E. Collins,

“Self-monitoring of dietary intake by young women: online
food records completed on computer or smartphone are as
accurate as paper-based food records but more acceptable,”
Journal of the Academy of Nutrition and Dietetics, vol. 115, no.
1, pp. 87–94, 2015.
[176] W. Zhang, Q. Yu, B. Siddiquie, A. Divakaran, and H. Sawhney,
“‘Snap-n-Eat’ food recognition and nutrition estimation on a
smartphone,” Journal of Diabetes Science and Technology, vol. 9,
no. 3, pp. 525–533, 2015.
[177] C. Behnke and S. Seo, “Using smartphone technology to
assess the food safety practices of farmers’ market foodservice
employees,” Journal of Foodservice Business Research, vol. 18, no.
1, pp. 1–19, 2015.
Hindawi Publishing Corporation
BioMed Research International
Volume 2015, Article ID 365672, 17 pages
http://dx.doi.org/10.1155/2015/365672

Review Article
Facets of Nanotechnology as Seen in Food Processing,
Packaging, and Preservation Industry

Neha Pradhan,1 Surjit Singh,1 Nupur Ojha,1 Anamika Shrivastava,1

Anil Barla,1 Vivek Rai,2 and Sutapa Bose1
1
Earth and Environmental Science Research Laboratory, Department of Earth Sciences, Indian Institute of
Science Education and Research Kolkata, Mohanpur, West Bengal 741 246, India
2
Institute of Life Sciences (An Autonomous Institute of the Department of Biotechnology), Nalco Square, Bhubaneswar,
Odisha 751 023, India

Correspondence should be addressed to Vivek Rai; vivekrai@rediffmail.com and Sutapa Bose; sutaparai@gmail.com

Received 16 July 2015; Accepted 30 September 2015

Academic Editor: Kimon A. Karatzas

Copyright © 2015 Neha Pradhan et al. This is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Nanotechnology has proven its competence in almost all possible fields we are aware of. However, today nanotechnology has evolved
in true sense by contributing to a very large extent to the food industry. With the growing number of mouths to feed, production of
food is not adequate. It has to be preserved in order to reach to the masses on a global scale. Nanotechnology made the idea a reality
by increasing the shelf life of different kinds of food materials. It is not an entirely full-proof measure; however it has brought down
the extent of wastage of food due to microbial infestation. Not only fresh food but also healthier food is being designed with the
help of nano-delivery systems which act as a carrier for the food supplements. There are regulations to follow however as several
of them pose serious threats to the wellbeing of the population. In coming days, newer modes of safeguarding food are going to be
developed with the help of nanotechnology. In this paper, an overview has been given of the different methods of food processing,
packaging, and preservation techniques and the role nanotechnology plays in the food processing, packaging, and preservation
industry.

1. Introduction
Since prehistoric age, man has been trying to improve and
devise better food preservation techniques. From the cave
man trying to preserve the food by storing the fresh kill in
caves that provided a dampened environment in order to
keep it from being spoiled to the refrigeration techniques
of the 21st century, man has come a long way. Cellars and
cold streams would also find their use in the preservation
of food. Drying and fermentation processes existed almost
10,000 B.C. ago and today we use the modified versions of
these processes [1]. Fermenting, salting, sun drying, roasting,
oven baking, smoking, steaming, salting, curing, pickling,
canning, bottling, jellying, irradiation, carbonation of food,
and also the use of chemical or artificial preservatives are
few of the methods of preservation that has been commonly
used by man on a day-to-day basis. All these methods
targeted at one simple idea, that is, to either slow down
the multiplication of the disease causing organism or killing
the organism altogether however, none of these techniques
were applied with complete cognizance of the scientific
mechanism behind it. Methods like osmotic inhibition and
vacuum preservation are also commonly used techniques for
the preservation of food. Archaeological evidence supports
the idea of the practice of the mentioned preservation
techniques and their existence in the Greek, Roman, and
Egyptian civilizations. The Egyptians used to sun-dry their
foods in order to protect them from spoilage [2]. The Romans
introduced the idea of pickling in order to prevent the food
from microbial infestation [3]. The Greeks were however
responsible for jellying of food by introducing honey or sugar
in the preservation techniques [3]. William Cullen in the year
1784 made the first technologically innovative breakthrough
in the preservation techniques of food by making a crude
2 BioMed Research International
Water Glucose Antibody Virus Bacteria
(nm)
10−1 1 10 102 103
Liposome Dendrimer Gold nanoshell
Figure 1: Several nanomaterials are seen, ranging from a scale of 1 to 100 nm. The reduced size of these nanomaterials makes them efficient
in acting as scaffolds and aid in drug delivery. However, with nanotechnology slowly encroaching into the food sector, the services of the
nanomaterials are no longer limited to the delivery of drugs, but they equally deliver food supplements, nutraceuticals [17, 18].
method of artificial refrigeration [2]. The early 1800 witnessed
canning of food and salting, in order to keep it fresh for a
longer period of time [2]. There were others too who had
made significant discoveries in the preservation techniques
such as in 1809 Nicolas Appert [2] who invented a vacuum
bottling technique that would supply food for French troops,
and this contributed to the development of tinning and then
canning by Peter Durand in 1810 [4]. With the introduction
of pasteurization by Louis Pasteur in 1862, milk, wine, and
beer could be preserved [4]. However, these methods were
indeed crude and were unable to preserve food for a longer
duration. There was a necessity of a permanent and a more
reliable solution for the preservation of food.
The word “nano” in layman terminology refers to some-
thing small, tiny, and atomic in nature [5]. The application
of such an idea, incorporated with science, leads to the field
of “nanoscience.” “Nanotechnology” or “nanoscience,” today,
has become the call of the century. It finds its use in each
and every field of science and technology. In Figure 1, a short
compilation of the several nanomaterials conventionally used
is given based on their size in comparison to biomolecules or
microorganisms which comes close to the size of a nanoma-
terial. It had a revolutionary effect on the depth and pattern of
our perspective. It had a thriving application in several other
sectors and its application in the food industry has been a
recent event. However, it has been making a steady and rapid
progress in the food industry. Food quality and safety have
always been a matter of great concern. Keeping the idea of a
healthy population in mind, researchers have been trying to
find out innovative technologies in order to improve the food
quality and its safety. The intrusion of nanotechnology in the
field of nutrition has led to the designing and development
Cancer cell A period Tennis ball
104 105 106 107 108
Quantum dot Fullerene
of novel food with better solubility, thermal stability, and
oral bioavailability [6]. To incorporate functional elements in
food is a field where research has been carried out for a very
long time. Nanotechnology has paved the way to this idea
and this has led to the development of nanoemulsions and
nanocomposites [7]. Nanotechnology as such in food science
is applied in several ways; it has a lot of potential that can
be utilized in the improvement of the quality and safety of
the food. From enhancing shelf life to improved food storage
to tracking and tracing of contaminants to introduction of
antibacterial or health supplements in food, nanotechnology
plays a vital role in the field of food science [8].
The pre- and postharvest issues related to agricultural
produce have been remarkably reduced due to the appli-
cation of nanotechnology for the preservation of the food
products [9]. The preservation industry has been increasing
in the same rate as the food industry, almost 10–12% per
year [10]. Reports have suggested that the market value of
food packaging industry increased by US$2.5 billion in the
year 2012 [11]. It can be further suggested based on the
reports that the industry has flourished much more and
the revenues have equally soared higher. Several funding
bodies, such as National Nanotechnology Initiative (NNI),
National Science Foundation (NSF), National Institutes of
Health (NIH), Centre of Nanoscale Science and Technology
(CNST), US Department of Agriculture (USDA), National
Institute of Food and Agriculture (NIFA), and Agriculture
and Food Research Initiative (AFRI), have been funding the
research and development of nanotechnology in USA [12].
Some of the European funding bodies for nanotechnology
are as follows: European Commission (EC), Engineering
and Physical Sciences Research Council (EPSRC), Medical
BioMed Research International
Research Council (MRC), Biotechnology and Biological Sci-
ences Research Council (BBSRC), Regional Developmental
Agencies (RDA), and Austrian Nano Initiative (ANI) [13]. As
per the Indian scenario, although remarkable works related
to nanotechnology are being conducted, however, the data
based on their growth or even yield has not been reported.
Their contribution to the food industry as such cannot be
estimated currently due to lack of reported data. However,
several companies have sprung up and several universi-
ties all over the country are slowly but steadily making
a breakthrough in the field of nanotechnology. Several of
those companies are Adnano Technologies, NanoBio Chem-
icals, NanoShel, NanoXpert Technologies, Sisco Research
Laboratories, Quantum Corporations, DaburPharma, Meda
Biotech, and Velbionanotech [14]. With funds from bodies
such as Department of Science and Technology (DST),
Department of Biotechnology (DBT), Department of Atomic
Energy (DAE), Defense Research Development and Orga-
nization (DRDO), Indian Council of Medical Research
(ICMR), Ministry of New and Renewable Energy (MNRE),
and Council of Scientific and Industrial Research (CSIR),
universities are also coming forward with new and innovative
ways of utilizing what nanotechnology has to offer [15].
With the help of nanotechnology, the shelf life of foods
can be increased and the extent of food spoilage can be
decreased, as finally healthy food can reach the masses
and eventually it will improve the health of the people
and can aid in reducing the problem of food shortage.
Several forms of “nanosystems” such as solid nanoparti-
cles, nanofibers, nanocapsules, nanotubes, nanocomposites,
nanosensors, nanobarcodes are few of the major nanomate-
rials that find their use in the food processing, packaging,
preservation sectors [16].
2. Food Management
2.1. Food Processing. Food processing can be defined as a
practice of preserving food with the help of methods and
techniques in order to transform food to a consumable
state. These techniques are designed as such that the flavour
and quality of the food are kept intact but they are also
protected from infestation of microorganisms that leads to
food spoilage. Irradiation, ohmic heating, and high hydro-
static pressure are few of the conventional methods of food
processing [17, 18]. Food processing methods that involve
the nanomaterials include incorporation of nutraceuticals,
gelation and viscosifying agents, nutrient delivery, mineral
and vitamin fortification, and nanoencapsulation of flavours
[67, 68]. In Figure 2, diagrammatic examples of several
nanomaterials used in food processing are summarized. Pro-
cessing of food is mainly carried out in order to keep the food
intact and also to increase its shelf life. Processed foods help
the producer to transfer it over very large distances without
running the risk of the food being spoiled. Yearly availability
of different kinds of food, especially the seasonal ones such as
peas or corns, is also one of the perks of processed food. Fresh
foods are not the only target of food processing industry.
Producing healthier food is also part of the concern and
therefore these days processed food contains micronutrients
3
which is a huge benefit for the consumers. The involvement
of different nanomaterials and their techniques that find their
use in the food processing industry is summarized in Table 1.
2.1.1. Nanoencapsulation. Nanoencapsulation is carried out
with the help of nanocapsules. They provide several benefits
such as ease of handling, enhanced stability, protection
against oxidation, retention of volatile ingredients, taste mak-
ing, moisture triggered controlled release, pH triggered con-
trolled release, consecutive delivery of multiple active ingre-
dients, change in flavour character, long lasting organoleptic
perception, and enhanced bioavailability and efficacy [69,
70]. They can be defined as nanovesicular systems that exhibit
a typical core-shell structure in which the drug is confined
to a reservoir or within a cavity surrounded by a polymer
membrane or coating [21]. The cavity can contain the active
substance in liquid or solid form or as a molecular dispersion.
Nanocapsules are involved in the delivery of the desired
component and entrapment of the odour and unwanted
components in the food and thereby resulting in the preser-
vation of the food. In the biological system, nanocapsules
carry the food supplements via the gastrointestinal tract and
this leads to increased bioavailability of the substance. There
are six basic ways of preparation of nanocapsules, namely,
nanoprecipitation, emulsion-diffusion, double emulsifica-
tion, emulsion-coacervation, polymer coating, and layer-
by-layer [71]. The basic difference between a conventional
emulsion and nanoemulsion is that a nanoemulsion does
not change the appearance of the food item when added
to it. These nanocapsules find their use in the delivery of
pesticides, fertilizers and vaccines to the plants. They are also
used to deliver lipophilic health supplements such as vitamin
and minerals in the food, fatty acids, and growth hormones,
increasing the nutrient content of the food [72]. The basic
benefit of encapsulation is to protect the hidden component
so as to deliver it precisely at the target even in unfavourable
conditions. Liposome is an example of a nanobased car-
rier used for nanoencapsulation. Nanoliposomes help in
controlled and specific delivery of the several components
within the system. They are known to deliver nutraceuticals,
nutrients, enzymes, vitamins, antimicrobials, and additives
[73]. Zein fibres loaded with gallic acid using electrospinning
are a new method of encapsulation technique where research
is being carried out [22]. Zein fibre protects the lipids from
getting degraded within the system before it reaches the
target delivery. This new, effective method can actually be
utilized thoroughly by the food packaging industry. Lipid
based encapsulation systems are much more efficient in com-
parison to other encapsulation systems because of the better
solubility and specificity of the components encapsulated
within it. This system helps the component not to interact
with food material to a great extent and in this way the
original characteristic of the food is kept intact and the
component to be delivered within the biological system is
also unaltered. Similarly, colloidosomes are hollow shell-like
structures that are very minute in size almost less than a
quarter of a human cell and they appear as capsules [23].
Several components are believed to be placed inside the shell
and it can prove to be a good carrier of food supplements and
4 BioMed Research International

Entrapped hydrophilic drug

Lipid bilayer
Entrapped drug
(a) Liposomes (b) Nanosphere

Lipophilic drugs
Encapsulated drug Hydrophilic head

Nucleic acids Hydrophobic tail

(c) Nanocapsule (d) Micelles

Drug molecule

Targeting moiety or imaging agent Conjugated drug

(e) Dendrimer (f) Nanoconjugate and linear

polymers

Figure 2: Different types of nanomaterials used in food management. (a) Liposomes (∼100–400 nm) are small spherical artificial vesicles
typically made with lipid bilayers. (b) Nanoparticles (∼20–200 nm) are typically made with biodegradable polymers for sustained drug or
antioxidants release. (c) Nanocapsules (∼10–1000 nm) can encapsulate relatively large amounts of drugs and nucleic acids such as DNA,
microRNA, siRNA, and shRNA. (d) Micelles (∼10–100 nm) are self-assembled amphiphilic particles that can encapsulate both lipophilic or
lipophobic drugs stabilized by surfactants. (e) Dendrimers (∼3–20 nm) are mono-disperse macromolecules that can be used to encapsulate or
covalently conjugate drugs, targeting moieties and imaging agents. (f) Nanoconjugates are polymers to which drug molecules are covalently
conjugated [19].

drugs within the biological system. Likewise, nanocochleates
help in improving the quality of the processed food. They
are nanocoils that wrap around the micronutrients and result
into stabilizing it. It is composed of soy based phospho-
lipids which can be either phosphatidyl serine, phospha-
tidic acid, dioleoylphosphatidyl serine, phosphatidylinositol,
phosphatidyl glycerol, phosphatidyl choline, phosphatidyl
ethanolamine, diphosphatidyl glycerol, dioleoylphosphatidic
acid, distearoylphosphatidylserine, dimyristoylphosphatidyl
serine, and dipalmitoylphosphatidyl glycerol [2]. Nanoen-
capsulation of probiotics is also an emerging field where
nanotechnology triumphs as it is an effort to design vaccines
BioMed Research International
Table 1: List of selected nanotechniques used by different food industries for food processing.
Nanotechniques Examples with its compositions
Nanocapsules
Nanoliposomes
(zein fibres loaded with gallic
acid)
Nanoencapsulation
Colloidosomes
Nanocochleates (soy based
phospholipids)
Archaeosomes (archaebacterial
membrane lipids)
Daily Boost
Colour emulsion
Nanoceuticals
Slim Shake Chocolate & Nanotea
Nanoemulsions
In the form of proteins (egg,
milk, and vegetable protein) &
Nanoemulsions carbohydrates (starch, pectin,
alginate, carrageenan, xanthan,
and guar gum)
Brominated vegetable oil, ester
gum, dammar gum and
sucrose-acetate isobutyrate
that will be able to regulate the immune response within
the system. With the nanoencapsulation technology, the
probiotics are also well preserved and delivered to the
gastrointestinal tract efficiently. Starch-like nano particles
help in preservation of lipid bodies and are also efficiently
delivered at target site within the biological system according
to several reports [74]. Archaeosomes are also an example
of nanoencapsulated delivery system for antioxidants. They
are prepared from archaeobacterial membrane lipids. These
lipids are known to be thermostable and resistant to stress
[24]. Furthermore reports have suggested that milk can
be protected from degradation by nanoencapsulating 𝛼-
tocopherol in fat droplets [70]. Few of the food products
that have been commercialized that have found their use as
5
Used in Advantages References
Enhanced stability, protection against
oxidation, and retention of volatile
Food ingredients
processing [21]
Taste making and moisture triggered
controlled release
pH triggered controlled release
Enhanced bioavailability and efficacy
Entrapment of the odour and unwanted
components in the food
Food [22]
Delivery of enzymes, additives, vitamins,
processing
and so forth in the food
Delivery of pesticides, fertilizers, and
vaccines to the plants
Food Delivery of vitamin and minerals in the food
[23]
processing Increasing the nutrient content of the food
Food Help in improving the quality of the [2]
processing processed food
Food [24]
Delivery system for antioxidants
processing
Food Used for the nanoencapsulation of fortified [25]
processing vitamin or bioactive components beverage
Food Used for the production of Beta-carotenal, [26]
processing apocarotenal, or paprika nanoemulsions
Used for the nanoencapsulation of the
Food nanoclusters that help enhance the flavour [27]
processing of the shake without having to add sugar to
the drink
Produce food products for salad dressing,
Food [28]
flavoured oils, sweeteners, personalized
processing
beverages, and other processed foods
Food Help in improving the texture and [29]
processing uniformity of the ice creams
Used as weighting agent [30]
Food
Used to reduce creaming and sedimentation [31]
processing
Help in the dispersion and availability of the [31]
nutrients in the food
materials for nanoencapsulation such as canola active oil, by
a company called Shemen, in Haifa, Israel, which is used
for the nanoencapsulation of fortified phytosterols [75]. The
rest of the food products are manufactured in USA and
their respective companies and product names are Fortified
Fruit Juice, by a company called High Vive, which is used
for the nanoencapsulation of fortified vitamin, lycopene,
theanine, and sun active iron; NanoResveratrol, by a company
called Life Enhancement, which is a plant-based lipid, such
as a solid triglyceride, enclosed by a shell consisting of a
natural phospholipid, such as phosphatidylcholine delivery
system; Spray for Life Vitamin Supplements, by a company
called Health Plus International, which are used for the
nanoencapsulation of fortified vitamin beverage; Daily Boost
6 BioMed Research International
by a company called Jamba Juice Hawaii, which is used for
the nanoencapsulation of fortified vitamin or bioactive com-
ponents beverage; Color Emulsion by, a company called Wild
Flavors, which is used for the production of Beta-carotenal,
apocarotenal, or paprika nanoemulsions; Nanoceuticals Slim
Shake Chocolate, manufactured by RBC Life Sciences Inc.
is used for the nanoencapsulation of the nano clusters that
help enhance the flavour of the shake without having to
add sugar to the drink [25–27, 76, 77]; and Nanotea which
is another nanoencapsulated product manufactured by a
company called Qinhuangdao Taiji Ring Nano-Products Co.
Ltd. from China [78].
2.1.2. Nanoemulsions. Nanoemulsions are used to produce
food products for salad dressing, flavoured oils, sweeteners,
personalized beverages, and other processed foods. They
help in releasing different flavours with the help of several
stimulations in the form of heat, pH, ultrasonic waves, and
so forth [79]. They retain the flavours efficiently and prevent
them from oxidation and enzymatic reactions. Nanoemul-
sions are created mainly by two approaches; high energy
approach involves the steps of high pressure homogenisation,
ultrasound method, high-speed liquid coaxial jets and high-
speed devices method [80]. Similarly, low energy approach
involves membrane emulsification, spontaneous emulsifica-
tion, solvent displacement, emulsion inversion point, and
phase inversion point [81]. The nanoemulsions are created
by dispersing liquid phase in continuous aqueous phase. The
components that are used for the creation of nanoemulsion
is lipophilic where the lipophilic component is mixed thor-
oughly with the oil phase [28]. The placement of the lipophilic
component within the nanoemulsion depends on several fac-
tors such as molecular and physicochemical properties. The
physicochemical property includes hydrophobicity, surface
activity, oil-water partition coefficient, solubility, and melting
point [29]. Several lipophilic components are encapsulated
with the help of nanoemulsion formation, for example,
𝛽-carotene, citral, capsaicin, flaxseed oil, tributyrin, coen-
zymeQ and several oil soluble vitamins [82]. They are highly
stable to gravitational separation and droplet aggregation and
nanoemulsion is also thermally stable in comparison to the
conventional emulsions. Nanoemulsions are preferred these
days rather than the conventional emulsions because the
smaller the droplet is, larger the surface area is and the more
readily they will be digested by the digestive enzymes and
ultimately be absorbed easily. Smaller emulsions are helpful
in penetrating the mucous layer present in the small intestine
[83]. With the advantage of being smaller, the emulsions
are transported across the epithelial layer and therefore
help in better adsorption of the components that forms the
emulsions. The solubility of the lipophilic components also
increases when they are smaller in size [84]. Nanoemulsions
in the form of proteins (e.g., egg, milk, and vegetable protein)
or carbohydrates (e.g., starch, pectin, alginate, carrageenan,
xanthan, and guar gum) help in improving the texture and
lead to uniformity of the ice cream [85]. Brominated vegetable
oil, ester gum, dammar gum and sucrose-acetate isobutyrate
are used as weighting agent [86]. Weighting agents are used
to reduce creaming and sedimentation. They are also known
to help in the dispersion and availability of the nutrients in
the food [87]. Biomolecules like milk proteins and micelles
and carbohydrates such as dextrin can actually prove to be
potential carrier of nutrients with the help of encapsulation
[88]. Hydrolyzed milk proteins such as 𝛼-lactalbumin have
evolved to be a potential carrier of drugs, nutrients, and
supplements [89]. Casein micelles and carbohydrates such
as dextrin also act as carriers. Casein micelles best serve the
purpose of delivering the hydrophobic nutraceuticals [89].
Nanoemulsions are known to have antimicrobial activity
and they are more effective on Gram-positive organisms
than on Gram negative-organisms [90]. Due to this rea-
son the nanoemulsions are used for decontaminating food
packaging articles. Microbial growth is avoided with the
help of nanoemulsions developed from nonionic surfactants,
soybean oil, and tributyl phosphate [91]. Self-assembled
nanoemulsions are responsible for keeping the flavour of
the functional compounds from the degrading actions of
enzymes, temperature, oxidation processes, and change in
pH and hydrolysis processes [92]. The functional com-
pounds that are generally encapsulated by the self-assembled
nanoemulsions are lutein, 𝛽-carotene, lycopene, vitamins
A, D, E3, and Q10, and isoflavones [93]. Nanoemulsions
basically rose to fame as a delivery system of phytochemicals.
Mainly two of the phytochemicals, namely, carotenoids and
polyphenols, are responsible for lowering blood pressure,
reducing cancer causing factors, regulate digestive tract
system, strengthen immune system, regulate blood sugar
level and cholesterol, and also act as antioxidants [30, 94–
96]. However the only problem the manufacturers faced was
the lack of proper bioavailability of these phytochemicals.
Nanoemulsions made this impossible feat feasible by increas-
ing the bioavailability of the phytochemicals by devising
efficient delivery systems. The smaller is the size of lipids,
the higher is the bioavailability of the phytochemicals [97].
Nanoemulsions triumph over the conventional emulsions
due their reduced size. Reduced size provides larger surface
area which results into increasing the rate of adsorption. This
is the basic principle in making the nanoemulsions efficient.
2.2. Food Packaging and Food Preservation. Food packaging
methods are used to make sure that the quality of the food
is kept intact however; they are packaged in a way so that it
is safe for consumption. Packaging mainly aims at providing
physical protection in order to prevent the food from external
shocks and vibration, microbial infestation, and temperature
in providing barrier protection by scavenging oxygen and
other spoilage causing gases. The packaging materials are
preferably made of biodegradable materials in order to
reduce environmental pollution. This idea has been turned
into reality due to the introduction of nanotechnology in
food packaging industry. High barrier plastics, introducing
antimicrobials, and detection measures for contaminants are
few of the methods that require being paid attention to while
food is being packaged. A summary of the different type of
nanotechniques used for the preservation and packaging of
food is given in Table 2.
Whereas treating and handling of food in order to slow
down the spoilage, resulting in the prevention of loss of food
BioMed Research International 7

Table 2: List of selected nanotechniques used by different food industries for food packaging and preservation.

Nanotechniques Examples with composition Used in Advantages References

Detection of any sort of change in the [31]
colour of the food
Detection of any gases being produced [31]
Metal based nanosensors (Palladium, Food due to spoilage
platinum, and gold) packaging Detection of any change in light, heat,
humidity, gas, and chemicals into [32]
electrical signals
Detection of toxins such as aflatoxin B1 in [33]
milk
Monitoring the condition of the soil [34]
Single walled carbon Nano tubes and Food required for the growth of the crop
DNA packaging Detection of the presence of pesticides on [34]
the surface of fruits and vegetables
Detection carcinogens present in the food [35]
Food materials
Carbon black and polyaniline
packaging Detection of food-borne pathogens [36]
Detection of the microorganisms that [37]
usually infest the food
Changes colour on coming in contact
Array biosensors, electronic noses, Food [37]
with any sign of spoilage in the food
nano-test strips, and nanocantilevers packaging
material
Food Detection of any sort of environmental [38]
Nano-smart dust
packaging pollution
Food Detection of the quality of the [38]
Nanobarcodes
packaging agricultural produce
Nanosensors
Food [38]
Nanobiosensors Detection of the viruses and the bacteria
packaging
Determination of the presence of
mycotoxins and several other toxic
Biomimetic sensors (protein &
Food compounds [38]
biomimetic membranes) and smart
packaging Act as pseudo cell surfaces which help in
biosensors
the detection and removal of the
pathogens
Surface Plasmon-coupled emission Food [39]
Detection of pathogenic organisms
biosensors (with Au) packaging
Cerium oxide immunosensors and Food Detection of several toxins such as [40]
chitosan based nanocomposites packaging ochratoxin A
Carbon nanotubes and silicon nanowire Food Detection of staphylococcal enterotoxin B [40]
transistors packaging and cholera toxin
iSTrip of time-temperature Food Detection of the spoilage of food based [41]
indicator/integrator packaging on the history of temperature
Food Determination of the desired temperature [42]
Abuse indicators
packaging has been achieved or not
Integration of time-temperature history
Food [42]
Partial temperature history indicator when the temperature exceeds a certain
packaging
pre-determined value
Registers a continuous change in
Food temperature with respect to time [43]
Full-temperature history indicator
packaging Detection of the change in temperature of
frozen foods
Food Detection of E. coli contamination in [43]
Reflective interferometry
packaging packaged foods
8 BioMed Research International

Table 2: Continued.
Nanotechniques Examples with composition Used in Advantages References
Used to create gas barriers which
Food [44]
Nanoclay (polymer & nanoparticles) minimize the leakage of carbon dioxide
packaging
from the bottles of carbonated beverages
Food Act as oxygen scavengers, retaining the [44]
Aegis
packaging carbon dioxide in the carbonated drinks
Food Provides stiffness to the paperboard [45]
Durethan (polyamide)
packaging containers for fruit juices
Food [46]
Imperm (nylon) Meant to scavenge oxygen
packaging
Used in the manufacturing of plastic beer
Food [47]
Nanocor bottles in order to prevent the escape of
packaging
carbon dioxide from the beverage
Food Used to coat meats, cheese, fruits, [47]
Nanoencapsulation (nanolaminates)
packaging vegetables, and baked goods
Nanocomposites Act as an antimicrobial agent [48]
Zinc oxide and pediocin & silver coated Food
nanocomposites packaging Degrade the lipopolysaccharide [26]
Cause irreversible damage to the bacterial [49]
DNA
PEG coated with garlic oil Food Control pests at stores that infest the [49]
nanocomposites packaging packaged food materials
Food Proven to be efficient as layering [50]
Bionanocomposites (cellulose & starch)
packaging materials for the packaging applications
Food Provides a larger surface area and faster [51]
Enzyme immobilization
packaging transfer rates
Food Help in ripening of vegetables and fruits [51]
Top Screen DS13 & Guard IN Fresh
packaging by scavenging ethylene gas
Helps in rapid absorption of unpleasant
Food [51]
NanoCeram PAC components which may cause foul odour
packaging
and create repulsive taste
Reducing the leakage of moisture [52]
Food
Anticaking and drying agent [53]
Silicon dioxide packaging &
preservation Absorbs the water molecules in food, [54]
showing hygroscopic application
Acts as a food colourant [54]
Food Photocatalytic disinfecting agent [55]
Titanium dioxide packaging & Used as food whitener for food products
preservation such as milk, cheese, and other dairy [56]
products
Food
Reduce the flow of oxygen inside the [57]
Nanoparticles Zinc oxide packaging &
packaging containers
preservation
Act as antibacterial agent and protect the [57]
Food food from microbial infestation
Silver nanoparticles packaging & Extend the shelf life of the fruits and
preservation vegetables by absorbing and [58]
decomposing ethylene
Food
Inorganic nanoceramic packaging & Used in cooking oil for deep-frying food [58]
preservation
Food
Known to be efficient delivery systems [58]
Polymeric nanoparticles packaging &
and are bactericidal
preservation
BioMed Research International
Heat/mass transfer Nanoscale reaction
engineering
Nanoparticles
Nanoemulsions
Materials
Nanocomposites
Nanostructured
materials
Nanosensors
Figure 3: A summarized version of different steps of food management and the contribution of nanotechnology to each of the steps is given
[20].
quality, edibility, or nutritive value by the microorganisms,
are termed as food preservation. Drying, canning, and
freezing are few of the conventional methods that have found
their use as food preservation techniques.
Food is managed in several different steps which involve
processing, packaging and preservation means at the same
time. Each of these steps is assisted by nanotechnology with
the help of several nanomaterials. A flowchart in Figure 3
represents the idea.
2.2.1. Nanosensors. Nanosensors help in detecting any sort
of change in the colour of the food and it also helps in the
detection of any gases being produced due to spoilage. The
sensors are usually sensitive towards gases such as hydrogen,
hydrogen sulphide, nitrogen oxides, sulphur dioxide and
ammonia [31]. They are a device comprising an electronic
data processing part and sensing part that is able to detect any
change in light, heat, humidity, gas, and chemicals into elec-
trical signals [98]. The high sensitivity and selectivity of the
nanosensors make them more efficient than the conventional
sensors. These gas sensors are made up of metals such as
Palladium, platinum, and gold [99]. Gold based nanoparticles
are also used at times to detect toxins such as aflatoxin B1 in
milk [32]. At times they are even made up of single walled
carbon nanotubes and DNA, which increases the sensitivity
of the sensors. In agriculture, nanosensors help in monitoring
the condition of the soil required for the growth of the
crop. They also help in detecting the presence of pesticides
on the surface of fruits and vegetables. Not only pesticides,
but there are also nanosensors that have been developed to
detect carcinogens too in food materials [33]. Gas sensors
are also made up of conducting polymers. These electroactive
conjugated polymer based sensors have conducting particles
implanted within an insulating polymer matrix [100]. The
9
Nanobiotechnology Molecular synthesis
Processing
Delivery
Food Science
and Technology
Product
Formulation
Food safety Packaging
and
biosecurity
Nanotracers
governing factors of the conducting polymers are mainly
electrical, optical, and magnetic properties and they are
related to their conjugated 𝜋 electron backbones. Change
in resonance which is brought about in the presence of
the gas to be detected results in a response pattern on the
conducting polymer based sensor [100]. Reports suggest that
these sensors have also been used for the detection of food-
borne pathogens when the nanosensors were embedded with
carbon black and polyaniline [34]. Nanosensors can also be
installed at the packaging plant itself where they can detect
the microorganisms that usually infest the food. In this way
the packaged food product does not need to be sent to the
lab for sampling. These sensors alert the consumers regarding
the quality of the food product with the help of colour
changes. The commonly used sensors that are used in the
food packaging industries are time-temperature integrator
and gas detector. Several different types of nanosensors are
used for example, array biosensors, nanoparticle in solution,
nanoparticle based sensors, electronic noses, nano-test strips,
nanocantilevers [101]. Electronic noses are a type of sensor
that uses several chemical sensors which is attached to a data
processing system [35]. Since the sensor behaves like a human
nose, the sensor is known as electronic nose. Along with the
electronic nose, there are reports of electronic tongue sensors
that work on a similar principle as that of an electronic nose.
It changes colour on coming in contact with any sign of
spoilage in the food material thus declaring that the food
is not fit for consumption [36]. For the electrochemical
determination of the adulterants in food and beverages such
as food dyes, for example, sunset yellow and tartrazine,
carbon ceramic electrode is customized with multiwalled
carbon nanotubes ionic nanocomposites [102]. Biosensors
are also an emerging technology which is being applied
successfully. Along with the nano-gas sensors, nano-smart
10
dust can be used to detect any sort of environmental pollution
[37]. These sensors are composed of tiny wireless sensors and
transponders. Nanobarcodes are also an efficient mechanism
for the detection of the quality of the agricultural produce
[103]. For the detection of the viruses and the bacteria,
these days the nanobiosensors are proving to be quite handy
and efficient. Biomimetic sensors and smart biosensors have
also been reported and they are efficient in determining the
presence of mycotoxins and several other toxic compounds
[38]. The biomimetic sensors are developed using protein
and biomimetic membranes. The sensors act as pseudo
cell surfaces which help in detecting and removal of the
pathogens [104]. Surface Plasmon-coupled emission biosen-
sors modified with gold nanoparticles help in the detection
of pathogenic organisms [39]. The use of nanosensors has
actually helped in reducing the detection limits as they were
modified to have improved level of selectivity and sensitivity.
There are several immunosensors that have been developed to
detect several toxins such as ochratoxin A that is detected by
cerium oxide immunosensor and chitosan based nanocom-
posite; carbon nanotubes and silicon nanowire transistors
detect staphylococcal enterotoxin B and cholera toxin [105].
Nanocomposites of SnO2 , microrods of titanium dioxide, and
SnO nanobelts are used for the detection of volatile organic
compounds such as ethylene, carbon monoxide, acetone and
ethanol [40]. Nanocomposites of SnO2 detect the presence
of oxygen in packaged foods. It has to be photosensitized
by UV-B radiation unlike the titanium dioxide particles
which require UV-A radiation [41]. The sensor comprises
an electron donor in the form of glycerol, a redox dye in
the form of methylene blue, and an encapsulating polymer
which is made up of hydroxyethyl cellulose. On irradiation
with UV-B, the redox dye is bleached and, in the presence of
oxygen, the original blue colour is seen. The extent of blue
colour of the sensor is directly proportional to the presence
of oxygen [106]. Sensors designed to detect the presence of
pathogens in food materials provide the biggest advantage
in reducing the incubation time required in conventional
methods to detect the presence of pathogens. Along with
all these above-mentioned sensors are indicators known as
time-temperature integrators. They are mainly of three basic
types, namely, abuse indicators, partial temperature history
indicator, and full-temperature history indicator [42]. A
time-temperature indicator/integrator helps in detecting the
spoilage of food based on the history of temperature. Abuse
indicators are also known as critical temperatures as they help
in determining whether the desired temperature has been
achieved or not [42]. Partial temperature history indicator
is responsible for integrating time-temperature history when
the temperature exceeds a certain predetermined value. Full-
temperature history indicator registers a continuous change
in temperature with respect to time [42]. Commercial avail-
ability of such TTI (time-temperature integrator) in the form
of iSTrip, made by the company Timestrip, with the help of
colour change, detects the change in temperature of frozen
foods [42]. They are made up of gold nanoparticles which
change colour to red when there is a sudden rise in freezing
temperature while preserving frozen foods. Sensors known as
reflective interferometry have been developed to detect E. coli
BioMed Research International
contamination in packaged foods [43]. The protein of E. coli is
placed on the silicon chip which binds to the similar protein
in the presence of contamination. It works on the principle of
scattering of light by the mitochondria. This scattered light is
detected by analysing digital images.
2.2.2. Nanocomposites. Nanocomposites are usually made up
of polymers in combination with nanoparticles and they help
to enhance the property of the polymer by combining with
it [44]. Nanocomposites basically provide a highly versatile
chemical functionality and therefore they are used for the
development of high barrier properties [107]. They help in
keeping the food products fresh, devoid of any microbial
infestation for a sustainable amount of time. They usually
act as gas barriers in order to minimize the leakage of
carbon dioxide from the bottles of carbonated beverages
[107]. In this way, it increases the shelf life of the product.
Instead of making expensive cans and heavy glass bottles,
manufacturing industries can use the nanocomposites to
layer their bottles in order to prevent the leakage. Nanoclay
is the example of a nanocomposite which is used to create
these gas barriers and it is an example of a polymer in combi-
nation with nanoparticles. Nanoclays are naturally occurring
aluminium silicates, generally referred to as phyllosilicates,
and are inexpensive, stable, and ecofriendly in nature [45].
Phyllosilicates are found as montmorillonite, kaolinite, hec-
torite, and saponite based on their compositions. Nanoclay
reinforcements categorize nanoclay nanocomposites into two
broad categories, namely, intercalated nanocomposites and
exfoliated nanocomposites [45]. Intercalated nanocompos-
ites are ordered multilayer polymeric structure with alternat-
ing polymeric layers that are formed due to the penetration
of polymer chains into the interlayer region of the clay [45].
The exfoliated nanocomposites are clay layers, randomly dis-
persed in the polymer matrix, and are formed due to extensive
polymer penetration. Cellulose nanoreinforcements result
into inexpensive, light weight nanocomposite [46]. These
cellulose reinforcements are grown in plants in the form
of microfibrils that are stabilized by hydrogen bonds. Such
reinforcements make the nanocomposites much flexible and
provide low permeability of the polymer matrix. Single
walled nanotubes along with silicon dioxide nanoparticles
copolymerized and gives rise to excellent gas barriers [47].
The commercial names of few of the nanoclays available in
the market are Aegis, Imperm, and Durethan [47]. These
nanoclays based polymers that are available in the market
count above the rest due to their biodegradable nature,
low density, transparency, good flow, and better surface
properties. Aegis acts as oxygen scavengers and thereby
improves the barrier property of the clay retaining the carbon
dioxide in the carbonated drinks [47]. Durethan is made
up of polyamide and it provides stiffness to the paperboard
containers for fruit juices [47]. Imperm which is another
example of commercialized nanoclay based polymer is made
up of nylon and nanoclay and is meant to scavenge oxygen
[47]. Nanocor, an example of gas barrier which is also a
nanoclay based polymer, is used in the manufacturing of
plastic beer bottles in order to prevent the escape of carbon
dioxide from the beverage [108]. Nanocoatings for example,
BioMed Research International
nanolaminates, are another example of nanoencapsulation.
These nanolaminates are used to coat meats, cheese, fruits,
vegetables, and baked goods. Polymers that are reinforced
with metals act as antimicrobials in the form of nanozinc
oxide and nanomagnesium oxide.
Zinc oxide and pediocin incorporated nanoparticles in
the nanocomposite films also have antimicrobial activity [48].
Silver coated nanocomposites also act as an antimicrobial
agent. Silver attaches to the cell surface and degrades the
lipopolysaccharide and hence results into increased perme-
ability, causing irreversible damage to the bacterial DNA.
In order to control pests at stores that infest the packaged
food materials, PEG coated with garlic oil nanocomposites
prove to be very effective [48]. Bionanocomposites, which
are usually made up of starch and cellulose derivatives,
poly lactic acid, polycaprolactone, polyhydroxybutyrate, and
polybutylene succinate, have proven to be efficient as layer-
ing materials for the packaging applications [26]. Another
nanocomposite based commercialized product is known as
Guard IN Fresh which helps in ripening of vegetables and
fruits by scavenging ethylene gas [109]. Nanocomposites
are widely used in the field of food packaging as they are
known to be ecofriendly ad biodegradable. Top Screen DS13
is one such example of a nanocomposite which is easily
recyclable [49]. Unlike the wax-based coating, Top Screen
DS13 flaunts the idea of being water based and hence easily
degraded. Another such ecofriendly nanocomposite based
coating material is known as NanoCeram PAC and it helps in
rapid absorption of unpleasant components which may cause
foul odour and create repulsive taste [110]. Immobilization
of enzymes and their use in the packaging of food is not a
very widely travelled path; however, it is catching pace in the
ever-evolving food industry. The method is not very popular
as enzymes are sensitive to quite a number of degrading
factors. Enzymes can get degraded at high temperatures or at
unfavourable pH or even in the presence of proteases. Lactase
or cholesterol reductase in packaging materials helps the
consumers who are deficient in these enzymes in their system
[50]. Enzyme immobilization triumphs over the conventional
systems of coatings used in packaging materials as they
provide a larger surface area and faster transfer rates. It is con-
sidered as the most effective type of nanocomposite, used in
the food packaging industry. The enzymes are incorporated
into the nanoclays and used for packaging of food [51].
2.2.3. Nanoparticles. At nanoscale, nanoparticles serve sev-
eral purposes in the processing of food. They help in
improving the food’s flow property, colour, and stability. The
effectiveness of the nanoparticles in the food depends on
its bioavailability in a system [52]. Previously, nanoparticles
were used as delivery systems for drugs and now they find
their use in food industry in a similar fashion. In the form
of plastic films, nanoparticles, such as silicate nanoparticles,
zinc oxide, and titanium oxide, are used to reduce the flow
of oxygen inside the packaging containers [53]. They also
help in reducing the leakage of moisture, keeping the food
fresh for a longer time [53]. There are nanoparticles that
aid in selective binding and hence lead to the removal of
the pathogens or chemicals from food [111]. Silicon dioxide
11
and titanium dioxide are the two most commonly used
nanoparticles in food packaging. Silicon dioxide finds its use
as an anticaking and a drying agent [55]. It helps in absorbing
the water molecules in food, thus displaying hygroscopic
application. Titanium dioxide is another nanoparticle which
acts as a food colourant [56]. It is known as a photocatalytic
disinfecting agent. Titanium dioxide is used as food whitener
for food products such as milk, cheese, and other dairy
products [56]. It finds its use as a barrier in food packaging
for UV protection. Silver nanoparticles act as antibacterials
and hence protect the food from microbial infestation [55].
Nanosized silver particles provide larger surface area and
can be easily dispersed in food and are readily ionized and
chemically active, acting as a potent antibacterial agent. Silver
nanoparticles prove to be effective as antimicrobials as they
have a broader spectrum of activity unlike other conventional
metallic nanoparticles that act as antimicrobials [55]. Silver
has been known to be quite stable since it is an element
and it has been reported that it does not pose any major
threat to the biological system if incorporated within limits as
assigned by the FDA (Food and Drug Association) standards
[55]. Being stable is definitely a perk; however silver mainly
scores over the rest as an effective antimicrobial since it can
penetrate through biofilms [55]. Silver mainly triumphs over
the rest of the antimicrobials that are available in the market
because silver can be easily incorporated into the packaging
materials. Silver has also proven to have lesser propensity
in making microbes resistant to it and therefore these days
it is a preferable means of packaging material [55]. Silver,
as per reports, infiltrates within the microbial system and
disrupts the ribosomal activity and hence causes hindrance
in the production of several important enzymes [55]. Silver
nanoparticles are more effective as bactericide towards Gram-
negative organism than Gram-positive organism as it is easier
for the particles to penetrate through the thinner cell wall
of the Gram-negative organism [55]. Silver nanoparticles are
also known to extend the shelf life of the fruits and vegetables
by absorbing and decomposing ethylene [55]. Other than
the silver, zinc and titanium nanoparticles, carbon nanotubes
are also used for packaging of food. However, the toxicity
levels are considerably high in case of carbon nanotubes
and hence the use is limited. Polymeric nanoparticles are
made using polymers and surfactants, alginic acid, polylactic
coglycolic acid, and chitosan and are known to be efficient
delivery systems [56]. Reports also suggest the development
of biopolymeric nanoparticles that proved to be bactericidal.
Titanium dioxide is another nanoparticle that has been
reported to have antimicrobial activity however; the usage is
limited as it is photocatalyzed [112]. It is only active in the
presence of ultraviolet light. It is an active bactericide against
several pathogens only under UV illumination. It leads to the
peroxidation of phospholipids present in the cell membrane
of the bacterial cell wall. Titanium dioxide nanoparticles
photosensitize the reduction of methylene blue on irradiation
from UV light. Upon irradiation, the particles bleach and,
only in the presence of oxygen, it changes its colour to blue.
Several other reported nanoparticles that have antimicrobial
activity are magnesium oxide, copper and copper oxide, zinc
oxide, cadmium, selenium, telluride, chitosan, and single
12
walled carbon nano tubes. Chitosans are responsible for
binding to the negatively charged cell wall as it is positively
charged [57]. This leads to increased permeability and disrup-
tion of cell wall. Inorganic nanoceramic is used in cooking oil
for deep-frying food [58]. The nanoparticles in the oil keep
the food crispier and increase the shelf life of the food.
3. Health Hazards Related to Usage of
Nanotechnology in Food Processing,
Packaging, and Preservation Industry
There are several products that are an outcome of the ever-
evolving field of nanotechnology; they pose serious threat
to the health of the population. For example, although
nanoemulsions have a wide field of application in the food
processing industry, however, the consumers get to pay the
cost in the form of physical ailments that target them.
The toxic effects of these nanoemulsions are potentially
related to their size. Absorption, distribution, metabolism,
and excretion of the nanoemulsion changes once the size
is reduced to nanodimension [59]. Concentration, particle-
size distribution, electrical charge, and interfacial character-
istics are the factors that are responsible for bringing about
the biological changes in the human system. Nondigestible
inorganic nanoparticles and digestible organic nanoparticles
have different effects on the body. Nondigestible inorganic
nanoparticles include minerals and metals whereas digestible
organic nanoparticles include surfactants, lipids, proteins,
and carbohydrates [113]. Nanoemulsion has a shell and a core
arrangement where the lipophilic component comprises the
core and the shell is made up of adsorbing material. The
lipophilic core is mainly made up of nonpolar components
such as triacyl glycerol, diacyl glycerol, essential oils, flavour
oils, mineral oils, fat substitutes, weighting agent, and fat
soluble vitamins, nutraceuticals [60]. The outer shell of the
nanoemulsion that encloses the lipophilic core is usually
made up of surfactants, phospholipids, proteins, polysac-
charides and minerals [61]. Both the core and shell have
different rate and extent of digestion and adsorption in
the gastrointestinal tract. Based on this idea of differential
rate of digestion, the fate of the nanoemulsion can be
determined; however, research still needs to be carried out
in this field to have a thorough knowledge regarding the
fate of the nanoemulsion within the system of the human
body. Bioavailability of components within the biological
system is also regarded as one of the factors that determine
the toxicity of nanoemulsions. At times the bioavailability
of the component within the nanoemulsion might be very
low; however, the adsorption rate might be very high as the
component is enclosed within the nanoemulsion. This leads
to bioaccumulation of the components within the system.
Consumption of nanoemulsions on a very high scale can
prove to be harmful as nanoemulsions are made of surfactants
and solvents which are chemical in nature [114]. Natural
emulsifiers are not effective in making nanoemulsions and
when these are consumed at a very high level they can
have adverse effect on the biological system [62]. Although
lipid based nanoemulsions score above the conventional
BioMed Research International
nanoemulsions as a better mode of delivery of components
within the biological systems, however, high lipid content of
the nanoemulsions results into adverse effects on the body
such as cardiovascular disease and obesity being a few [115].
Several nanoparticles have been reported to cause cel-
lular damage to biological systems when they accumulate
within the system. At times they also disrupt the normal
working of the cellular components within the biological
system because there are reports that they attach to cellular
receptors of the cells of the immune system and confound
them [63]. The nanoparticles also at times get coated with
proteins and this leads to the degradation of the protein and
hence the normal cellular mechanism is disrupted. Silver
nanoparticles have been reported to have adverse effects on
the human system. They affect the human lung fibroblast
by reducing ATP content, increasing ROS production, and
damaging mitochondria and DNA [64]. It also leads to
chromosomal aberration. Hence quite positively it can be said
that silver nanoparticles are genotoxic, cytotoxic, and even
carcinogenic. The reduced size of the nanoparticles allow it
to cross the cellular barrier and its exposure leads to the
formation of free radicals in the tissues and eventually leads
to oxidative damage to the cells and tissues [116]. Carbon
nanotubes that are mainly used as packaging material for
food usually migrate into food and can lead to toxic effects
on the skin and lungs of human [65].
Not only human health but also the ecosystems are highly
affected by nanomaterials that are disposed of by several
manufacturing industries. These nanomaterials migrate and
accumulate in the water or soil and disrupt the normal biota
of that region. Nanoparticles that are washed off to the marine
systems form a layer on top of the marine body and prove to
be toxic to the planktons [66]. The pelagic species that feed on
these planktons are likely to be affected by the toxicity caused
by the nanoparticles [66]. Once the nanoparticles settle down
to the floor of the marine body, the benthic species are
affected by them [66]. Aluminium nanoparticles have been
reported to result into inhibition of plant growth [66]. A
summarized view of the implications of the nanoemulsions
in the biological system is given in Table 3.
4. Regulations and Nanosystems
There are several regulatory bodies such as the Euro-
pean Food and Safety Authority (EFSA), Environmental
Protection Agency (EPA), Food and Drug Administration
(FDA), National Institute for Occupational Safety and Health
(NIOSH), Occupational Safety and Health Administration
(OSHA), US Department of Agriculture (USDA), Consumer
Product Safety Commission (CPSC), and US Patent and
Trademark Office (USPTO) that govern the use and applica-
tion of nanosystems in food [117]. Keeping the implications in
mind, these regulations have to be abided by the food indus-
try involved in the processing, packaging, and preservation
of food. European Parliament and Council Legislation are
responsible for meting out the regulations on the size of the
nanoparticles and it is a cause of concern from the consumer
point of view [118]. A fixed size needs to be maintained
in case of nanoparticles as food additives. Precautionary
BioMed Research International 13

Table 3: Effect of nanoemulsion in human system.

Hazardous Advantages Health Hazards References

Nanoemulsion
components
Reducing ATP content [59]
Food packaging
Increasing ROS production [59]
Nondigestible Food processing Damaging mitochondria and DNA [60]
inorganic Silver nanoparticles Chromosomal aberration [61]
nanoparticles
Food preservation Genotoxic [62]
Cytotoxic [62]
Carcinogenic [63]
Bioaccumulation [64]
Food packaging
Cellular damage [65]
Surfactants, lipids,
Digestible organic Degradation of proteins [65]
proteins, and Food processing
nanoparticles Cardiovascular diseases [65]
carbohydrates
Food preservation Obesity [65]
Carbon nanotubes Food packaging Cause skin and lungs disease [66]

principle (PP) has to be adopted by the industries on a
strict basis so that freely engineered nanomaterials in the
food are less incorporated [119]. Only after proper study
and research, the nanomaterials are to be introduced in the
food items. EC Food Law Regulation has chalked out several
points which need to be incorporated in the designing of
nanomaterials to be used in food industry. The regulation
states that the nanomaterials engineered should be free of
toxic and heavy metals and also from several mycotoxins
toxins [120]. European regulatory body led to the Framework
1935/2004 Regulation which states that the substances that are
being incorporated in the food shall not change the inherent
and organoleptic properties of the food [121]. It should remain
inert and should not promote deterioration of the food and
prove to have harmful effect on human health. The Regulation
also states that the nanocomponents that are incorporated
in the food should be first studied for dose response and
the toxic effect of such components. Directive 89/107/EEC
states that if some active nanocomponent meant for delivery
of food supplements is being added as a packaging material
for food, then it has to be first assessed as a direct food
additive [122]. These regulations devised by the regulatory
bodies have to be followed by one and all responsible for
the production of nanotechnology based materials used in
the food industry. In a country like India, these regulatory
norms are sometimes not followed and the consumers land
up paying a price for it and most importantly there is no
specific regulatory framework that exists in India. However,
such a scenario should be avoided and, on a global scale, these
regulations should be abided by.
5. Conclusion
Nanotechnology has brought forth a revolutionary effect on
the food processing and preservation industry. There are
definite advantages of the technology but the drawbacks are
equally prominent. Several food industry giants are paying
in millions to develop nanosystems that will help preserve
the food better. Care should be taken while designing newer
nanosystems so that they are both environment friendly
and they do not have any toxic effect on the food. Thor-
ough testing needs to be carried out in health claims of
the products that are being launched. Rather than having
a chemical approach towards designing the nanosystems,
research should be carried out in trying to discover natural
nano-systems for the delivery of drug or health supplements
through food.
Nanoparticles, being ultramicroscopic in size, are easily
taken up by the cells inside the human body and can
have toxic effects. The toxicity is in an enhanced fashion
due to their higher bioavailability and it can also affect
the immune system. Silver nanoparticles, for example, can
actually make the cells resistant to any other antibacterials as
the mobility of the nanoparticle within the biological is still
unknown [123]. Not just silver nanoparticles, several other
nanoparticles, such as titanium dioxide and zinc oxide, cause
environmental pollution due to their high toxicity [124]. Eco-
friendly nanoparticles need to be designed which both can
serve as antibacterial and also cannot cause harm to the
environment.
The smaller the size of the particles or the emulsions, the
higher the threat that they pose of affecting the system with
the human body. Several regulatory bodies all over the world
have chalked out the regulations and standards required for
the usage of nanoparticles in food. They need to be carefully
followed so that the consumers do not get affected. The
biggest drawback in the usage of the nanosystems in the
food is that, they are still under study and have not been
characterized thoroughly; therefore the extent of damage that
they can actually cause to the biological systems is yet to be
identified.
6. Future Trends
Several nanosystems are still at the stage of being developed
as efficient nanocomponents to find application in the food
14
industry. Researchers are trying to develop better and more
efficient nanocarriers with increased level of bioavailability
without compromising the appearance and taste of the food
products in which these carriers are incorporated. The idea
of “Smart Packaging” is slowly being realized and research is
being carried out in developing antigen specific biomarkers
used in packaging of food and also the incorporation of
nanoparticles to make polymer nanocomposite films [125].
The antigen specific biomarkers will help to detect the
presence of the organism responsible for the spoilage of the
food material. BioSilicon, designed by pSivida, Australia,
finds its use in food packaging industry [126]. It is made up of
nanopores and is used for packaging of food. The speciality
lies in its composition; it is made up of nanostructured
silicon. RFID or Radio Frequency Identification Display is
a newly engineered device that helps in swift distribution
of food products that have a shorter shelf life [127]. There
are transistors too that are being used based on the RFID
technology. These transistors are meant for detecting even
a very small change in temperature, pressure, or even pH.
The sensitivity level is exceptionally high in case of these
transistors. The Indian scenario is not similar to that of the
developed countries. Unlike the developed countries, the
university-industry interaction is not a commendable one.
This is one of the reasons why the product development and
commercialization sector in the field of nanotechnology is
still lagging behind. However, it is slowly picking up with
the trends of the world and devising newer methods and
making its own contribution to this field. There is plenty of
potential in the India, and it can only be harnessed properly
once there is proper collaboration with the scientists at the
universities and the industries. Better marketing strategies
and infrastructure can help heighten the present condition
[128].
Conflict of Interests
The authors declare that there is no conflict of interests
regarding the publication of this paper.
Acknowledgments
Authors are grateful to IISER-Kolkata for providing infras-
tructure and research facility. Sutapa Bose is grateful to
DST for providing Ramanujan Research Grant (SR/S2/RJN-
09/2011) and Vivek Rai is grateful to DBT for providing him
with Ramalingaswamy Research Grant to carry this work.
References
[1] C. Chellaram, G. Murugaboopathi, A. A. John et al., “Signifi-
cance of nanotechnology in food industry,” APCBEE Procedia,
vol. 8, pp. 109–113, 2014.
[2] K. A. Abbas, A. M. Saleh, A. Mohamed, and N. MohdAzhan,
“The recent advances in the nanotechnology and its applications
in food processing: a review,” Journal of Food, Agriculture &
Environment, vol. 7, no. 3-4, pp. 14–17, 2009.
[3] http://cordis.europa.eu/result/rcn/92494 en.html.
[4] http://www.nanowerk.com/news2/newsid=28652.php.
BioMed Research International
[5] M. Garcı́a, T. Forbe, and E. Gonzalez, “Potential applications of
nanotechnology in the agro-food sector,” Ciência e Tecnologia
de Alimentos, vol. 30, no. 3, pp. 573–581, 2010.
[6] E. Semo, E. Kesselman, D. Danino, and Y. D. Livney, “Casein
micelle as a natural nano-capsular vehicle for nutraceuticals,”
Food Hydrocolloids, vol. 21, no. 5-6, pp. 936–942, 2007.
[7] M. Avella, J. J. De Vlieger, M. E. Errico, S. Fischer, P. Vacca, and
M. G. Volpe, “Biodegradable starch/clay nanocomposite films
for food packaging applications,” Food Chemistry, vol. 93, no. 3,
pp. 467–474, 2005.
[8] Y. P. Neo, S. Ray, J. Jin et al., “Encapsulation of food grade antiox-
idant in natural biopolymer by electrospinning technique: a
physicochemical study based on zein-gallic acid system,” Food
Chemistry, vol. 136, no. 2, pp. 1013–1021, 2013.
[9] J. K. Momin, C. Jayakumar, and J. B. Prajapati, “Potential of
nanotechnology in functional foods,” Emirates Journal of Food
and Agriculture, vol. 25, no. 1, pp. 10–19, 2013.
[10] B. S. Sekhon, “Nanotechnology in agri-food production: an
overview,” Nanotechnology, Science and Applications, vol. 7, no.
2, pp. 31–53, 2014.
[11] N. Scott and H. Chen, “Nanoscale science and engineering for
agriculture and food systems,” Industrial Biotechnology, vol. 9,
no. 1, pp. 17–18, 2013.
[12] http://www.nano.gov/about-nni/what/funding.
[13] http://atip.org/index.php/atip-publications-2/atip-reports/2008-
1/6214-atip08-007-nanosciencenano-funding-in-europe-an-
overview.
[14] https://www.foresight.org/policy/brief1.html.
[15] D. J. McClements and J. Rao, “Food-grade nanoemulsions:
formulation, fabrication, properties, performance, biological
fate, and potential toxicity,” Critical Reviews in Food Science and
Nutrition, vol. 51, no. 4, pp. 285–330, 2011.
[16] T. V. Duncan, “Applications of nanotechnology in food pack-
aging and food safety: barrier materials, antimicrobials and
sensors,” Journal of Colloid and Interface Science, vol. 363, no.
1, pp. 1–24, 2011.
[17] http://www.eolss.net/Eolss-sampleAllchapter.aspx.
[18] S. Neethirajan and D. S. Jayas, “Nanotechnology for the Food
and Bioprocessing Industries,” Food and Bioprocess Technology,
vol. 4, no. 1, pp. 39–47, 2011.
[19] Q. Xu, S. P. Kambhampati, and R. M. Kannan, “Nanotechnology
approaches for ocular drug delivery,” Middle East African
Journal of Ophthalmology, vol. 20, no. 1, pp. 26–37, 2013.
[20] http://www.nanoisrael.org/category.aspx?id=1277.
[21] B. S. Sekhon, “Food nanotechnology—an overview,” Nanotech-
nology, Science and Applications, vol. 3, no. 1, pp. 1–15, 2010.
[22] K. Thomas and P. Sayre, “Research strategies for safety eval-
uation of nanomaterials, part I: evaluating the human health
implications of exposure to nanoscale materials,” Toxicological
Sciences, vol. 87, no. 2, pp. 316–321, 2005.
[23] S. J. Klaine, P. J. J. Alvarez, G. E. Batley et al., “Nanomaterials
in the environment: behavior, fate, bioavailability, and effects,”
Environmental Toxicology and Chemistry, vol. 27, no. 9, pp. 1825–
1851, 2008.
[24] S. M. Alfadul and A. A. Elneshwy, “Use of nanotechnology in
food processing, packaging and safety—review,” African Journal
of Food, Agriculture, Nutrition and Development, vol. 10, no. 6,
2010.
[25] X. Liu, J.-H. Wang, and J.-P. Yuan, “Pharmacological and anti-
tumor activities of ganoderma spores processed by top-down
BioMed Research International
approaches,” Journal of Nanoscience and Nanotechnology, vol. 5,
no. 12, pp. 2001–2013, 2005.
[26] A. Baeumner, “Nanosensors identify pathogens in food,” Food
Technology, vol. 58, no. 8, pp. 51–55, 2004.
[27] H. Chen, J. Weiss, and F. Shahidi, “Nanotechnology in nutraceu-
ticals and functional foods,” Food Technology, vol. 60, no. 3, pp.
30–36, 2006.
[28] G. Oberdörster, V. Stone, and K. Donaldson, “Toxicology of
nanoparticles: a historical perspective,” Nanotoxicology, vol. 1,
no. 1, pp. 2–25, 2007.
[29] S. Sinha Ray and M. Okamoto, “Polymer/layered silicate
nanocomposites: a review from preparation to processing,”
Progress in Polymer Science, vol. 28, no. 11, pp. 1539–1641, 2003.
[30] A. Fernández, D. Cava, M. J. Ocio, and J. M. Lagarón, “Perspec-
tives for biocatalysts in food packaging,” Trends in Food Science
and Technology, vol. 19, no. 4, pp. 198–206, 2008.
[31] S. Kang, M. Pinault, L. D. Pfefferle, and M. Elimelech, “Single-
walled carbon nanotubes exhibit strong antimicrobial activity,”
Langmuir, vol. 23, no. 17, pp. 8670–8673, 2007.
[32] X. Mao, J. Huang, M. F. Leung et al., “Novel core-shell nanopar-
ticles and their application in high-capacity immobilization of
enzymes,” Applied Biochemistry and Biotechnology, vol. 135, no.
3, pp. 229–246, 2006.
[33] D. D. Meetoo, “Nanotechnology and the food sector: from the
farm to the table,” Emirates Journal of Food and Agriculture, vol.
23, no. 5, pp. 387–407, 2011.
[34] N. Sozer and J. L. Kokini, “Nanotechnology and its applications
in the food sector,” Trends in Biotechnology, vol. 27, no. 2, pp.
82–89, 2009.
[35] R. Vidhyalakshmi, R. Bhakyaraj, and R. S. Subhasree, “Encap-
sulation ‘the future of probiotics’—a review,” Advances in
Biological Research, vol. 3, no. 3-4, pp. 96–103, 2009.
[36] Y. Yuan, Y. Gao, J. Zhao, and L. Mao, “Characterization and
stability evaluation of 𝛽-carotene nanoemulsions prepared by
high pressure homogenization under various emulsifying con-
ditions,” Food Research International, vol. 41, no. 1, pp. 61–68,
2008.
[37] S. K. Biswal, A. K. Nayak, U. K. Parida, and P. L. Nayak, “Appli-
cations of nanotechnology in agriculture and food sciences,”
International Journal of Science Innovations and Discoveries, vol.
2, no. 1, pp. 21–36, 2012.
[38] D. Coles and L. J. Frewer, “Nanotechnology applied to European
food production—a review of ethical and regulatory issues,”
Trends in Food Science and Technology, vol. 34, no. 1, pp. 32–43,
2013.
[39] A. Senturk, B. Yalcın, and S. Otles, “Nanotechnology as a food
perspective,” Journal of Nanomaterials & Molecular Nanotech-
nology, vol. 2, article 6, 2013.
[40] S. R. Mousavi and M. Rezaei, “Nanotechnology in agriculture
and food production,” Journal of Applied Environmental and
Biological Science, vol. 1, no. 10, pp. 414–419, 2011.
[41] Y. Li, Y. T. H. Cu, and D. Luo, “Multiplexed detection of
pathogen DNA with DNA-based fluorescence nanobarcodes,”
Nature Biotechnology, vol. 23, no. 7, pp. 885–889, 2005.
[42] H. C. Su, M. Zhang, W. Bosze, J.-H. Lim, and N. V. Myung,
“Metal nanoparticles and DNA co-functionalized single-walled
carbon nanotube gas sensors,” Nanotechnology, vol. 24, no. 50,
Article ID 505502, 2013.
[43] A. K. Wanekaya, W. Chen, N. V. Myung, and A. Mulchandani,
“Nanowire-based electrochemical biosensors,” Electroanalysis,
vol. 18, no. 6, pp. 533–550, 2006.
15
[44] L. Yotova, S. Yaneva, and D. Marinkova, “Biomimetic nanosen-
sors for determination of toxic compounds in food and agri-
cultural products (review),” Journal of Chemical Technology and
Metallurgy, vol. 48, no. 3, pp. 215–227, 2013.
[45] D. Davis, X. Guo, L. Musavi, C.-S. Lin, S.-H. Chen, and V. C. H.
Wu, “Gold nanoparticle-modified carbon electrode biosensor
for the detection of listeria monocytogenes,” Industrial Biotech-
nology, vol. 9, no. 1, pp. 31–36, 2013.
[46] A. Thirumurugan, S. Ramachandran, and A. S. Gowri, “Com-
bined effect of bacteriocin with gold nanoparticles against food
spoiling bacteria—an approach for food packaging material
preparation,” International Food Research Journal, vol. 20, no.
4, pp. 1909–1912, 2013.
[47] J. Flanagan and H. Singh, “Microemulsions: a potential delivery
system for bioactives in food,” Critical Reviews in Food Science
and Nutrition, vol. 46, no. 3, pp. 221–237, 2006.
[48] C. I. Moraru, C. P. Panchapakesan, Q. Huang, P. Takhistov, S.
Liu, and J. L. Kokini, “Nanotechnology: a new frontier in food
science,” Food Technology, vol. 57, no. 12, pp. 24–29, 2003.
[49] T. G. Mason, J. N. Wilking, K. Meleson, C. B. Chang, and S.
M. Graves, “Nanoemulsions: formation, structure, and physical
properties,” Journal of Physics: Condensed Matter, vol. 18, no. 41,
pp. R635–R666, 2006.
[50] A. L. Brody, “Nano food packaging technology,” Food Technol-
ogy, vol. 57, no. 12, pp. 52–54, 2003.
[51] O. G. Burdo, “Nanoscale effects in food-production technolo-
gies,” Journal of Engineering Physics and Thermophysics, vol. 78,
no. 1, pp. 90–96, 2005.
[52] V. Coma, “Bioactive packaging technologies for extended shelf
life of meat-based products,” Meat Science, vol. 78, no. 2, pp. 90–
103, 2008.
[53] S. R. Horner, C. R. Mace, L. J. Rothberg, and B. L. Miller, “A
proteomic biosensor for enteropathogenic E. coli,” Biosensors
and Bioelectronics, vol. 21, no. 8, pp. 1659–1663, 2006.
[54] N. Jones, B. Ray, K. T. Ranjit, and A. C. Manna, “Antibacterial
activity of ZnO nanoparticle suspensions on a broad spectrum
of microorganisms,” FEMS Microbiology Letters, vol. 279, no. 1,
pp. 71–76, 2008.
[55] R. Zhao, P. Torley, and P. J. Halley, “Emerging biodegrad-
able materials: starch- and protein-based bio-nanocomposites,”
Journal of Materials Science, vol. 43, no. 9, pp. 3058–3071, 2008.
[56] E. Acosta, “Bioavailability of nanoparticles in nutrient and
nutraceutical delivery,” Current Opinion in Colloid and Interface
Science, vol. 14, no. 1, pp. 3–15, 2009.
[57] K. Arshak, C. Adley, E. Moore, C. Cunniffe, M. Campion, and
J. Harris, “Characterisation of polymer nanocomposite sensors
for quantification of bacterial cultures,” Sensors and Actuators,
B: Chemical, vol. 126, no. 1, pp. 226–231, 2007.
[58] H. Bouwmeester, S. Dekkers, M. Y. Noordam et al., “Review of
health safety aspects of nanotechnologies in food production,”
Regulatory Toxicology and Pharmacology, vol. 53, no. 1, pp. 52–
62, 2009.
[59] C. Chawengkijwanich and Y. Hayata, “Development of TiO2
powder-coated food packaging film and its ability to inactivate
Escherichia coli in vitro and in actual tests,” International Journal
of Food Microbiology, vol. 123, no. 3, pp. 288–292, 2008.
[60] Q. Cheng, C. Li, V. Pavlinek, P. Saha, and H. Wang, “Surface-
modified antibacterial TiO2 /Ag+ nanoparticles: preparation
and properties,” Applied Surface Science, vol. 252, no. 12, pp.
4154–4160, 2006.
16
[61] N. Cioffi, L. Torsi, N. Ditaranto et al., “Copper nanopar-
ticle/polymer composites with antifungal and bacteriostatic
properties,” Chemistry of Materials, vol. 17, no. 21, pp. 5255–5262,
2005.
[62] P. N. Ezhilarasi, P. Karthik, N. Chhanwal, and C. Anandhara-
makrishnan, “Nanoencapsulation techniques for food bioactive
components: a review,” Food and Bioprocess Technology, vol. 6,
no. 3, pp. 628–647, 2013.
[63] J. Jordan, K. I. Jacob, R. Tannenbaum, M. A. Sharaf, and I. Jasiuk,
“Experimental trends in polymer nanocomposites—a review,”
Materials Science and Engineering A, vol. 393, no. 1-2, pp. 1–11,
2005.
[64] J. S. Kim, E. Kuk, K. N. Yu et al., “Antimicrobial effects of
silver nanoparticles,” Nanomedicine: Nanotechnology, Biology,
and Medicine, vol. 3, no. 1, pp. 95–101, 2007.
[65] A. Mills and D. Hazafy, “Nanocrystalline SnO2 -based, UVB-
activated, colourimetric oxygen indicator,” Sensors and Actua-
tors B: Chemical, vol. 136, no. 2, pp. 344–349, 2009.
[66] J. R. Morones, J. L. Elechiguerra, A. Camacho et al., “The
bactericidal effect of silver nanoparticles,” Nanotechnology, vol.
16, no. 10, pp. 2346–2353, 2005.
[67] Q. Huang, H. Yu, and Q. Ru, “Bioavailability and delivery of
nutraceuticals using nanotechnology,” Journal of Food Science,
vol. 75, no. 1, pp. R50–R56, 2010.
[68] J. Weiss, P. Takhistov, and D. J. McClements, “Functional
materials in food nanotechnology,” Journal of Food Science, vol.
71, no. 9, pp. R107–R116, 2006.
[69] K. Marsh and B. Bugusu, “Food packaging—roles, materials,
and environmental issues: Scientific status summary,” Journal
of Food Science, vol. 72, no. 3, pp. R39–R55, 2007.
[70] Q. Chaudhry, M. Scotter, J. Blackburn et al., “Applications and
implications of nanotechnologies for the food sector,” Food
Additives and Contaminants, vol. 25, no. 3, pp. 241–258, 2008.
[71] A. D. Maynard, R. J. Aitken, T. Butz et al., “Safe handling of
nanotechnology,” Nature, vol. 444, no. 7117, pp. 267–269, 2006.
[72] K. L. Dreher, “Health and environmental impact of nanotech-
nology: toxicological assessment of manufactured nanoparti-
cles,” Toxicological Sciences, vol. 77, no. 1, pp. 3–5, 2004.
[73] H. A. Godwin, K. Chopra, K. A. Bradley et al., “The University
of California Center for the environmental implications of
nanotechnology,” Environmental Science and Technology, vol.
43, no. 17, pp. 6453–6457, 2009.
[74] H. M. C. de Azeredo, “Nanocomposites for food packaging
applications,” Food Research International, vol. 42, no. 9, pp.
1240–1253, 2009.
[75] J. F. Graveland-Bikker and C. G. de Kruif, “Unique milk protein
based nanotubes: food and nanotechnology meet,” Trends in
Food Science and Technology, vol. 17, no. 5, pp. 196–203, 2006.
[76] M. D. Cobb and J. Macoubrie, “Public perceptions about nan-
otechnology: risks, benefits and trust,” Journal of Nanoparticle
Research, vol. 6, no. 4, pp. 395–405, 2004.
[77] R. Bodmeier, H. G. Chen, and O. Paeratakul, “A novel approach
to the oral delivery of micro- or nanoparticles,” Pharmaceutical
Research, vol. 6, no. 5, pp. 413–417, 1989.
[78] K. Donaldson and A. Seaton, “The janus faces of nanoparticles,”
Journal of Nanoscience and Nanotechnology, vol. 7, no. 12, pp.
4607–4611, 2007.
[79] M. N. V. Ravi Kumar, “A review of chitin and chitosan applica-
tions,” Reactive and Functional Polymers, vol. 46, no. 1, pp. 1–27,
2000.
BioMed Research International
[80] K. Letchford and H. Burt, “A review of the formation and classi-
fication of amphiphilic block copolymer nanoparticulate struc-
tures: micelles, nanospheres, nanocapsules and polymersomes,”
European Journal of Pharmaceutics and Biopharmaceutics, vol.
65, no. 3, pp. 259–269, 2007.
[81] S. Moore, “Nanocomposite achieves exceptional barrier in
films,” Modern Plastics, vol. 76, no. 2, pp. 31–32, 1999.
[82] T. Vo-Dinh, B. M. Cullum, and D. L. Stokes, “Nanosensors and
biochips: frontiers in biomolecular diagnostics,” Sensors and
Actuators B: Chemical, vol. 74, no. 1–3, pp. 2–11, 2001.
[83] L. Zarif, “Nanocochleate cylinders for oral & parenteral delivery
of drugs,” Journal of Liposome Research, vol. 13, no. 1, pp. 109–
110, 2003.
[84] S. A. Renken and J. J. Warthesen, “Vitamin D stability in milk,”
Journal of Food Science, vol. 58, no. 3, pp. 552–555, 1993.
[85] S. A. Hogan, B. F. McNamee, E. Dolores O’Riordan, and
M. O’Sullivan, “Microencapsulating properties of sodium
caseinate,” Journal of Agricultural and Food Chemistry, vol. 49,
no. 4, pp. 1934–1938, 2001.
[86] S. G. Gilbert, “Food/package compatibility,” Food Technology,
vol. 39, no. 12, pp. 54–56, 1985.
[87] I. Arcan and Y. Ahmet, “Incorporating phenolic compounds
opens a new perspective to use zein films as flexible bioactive
packaging materials,” Food Research International, vol. 44, no.
2, pp. 550–556, 2011.
[88] A. Fernandez, S. Torres-Giner, and J. M. Lagaron, “Novel route
to stabilization of bioactive antioxidants by encapsulation in
electrospun fibers of zein prolamine,” Food Hydrocolloids, vol.
23, no. 5, pp. 1427–1432, 2009.
[89] R. Yoksan, J. Jirawutthiwongchai, and K. Arpo, “Encapsulation
of ascorbyl palmitate in chitosan nanoparticles by oil-in-water
emulsion and ionic gelation processes,” Colloids and Surfaces B:
Biointerfaces, vol. 76, no. 1, pp. 292–297, 2010.
[90] Y. Wang, Q. Zhang, C.-L. Zhang, and P. Li, “Characterisation
and cooperative antimicrobial properties of chitosan/nano-
ZnO composite nanofibrous membranes,” Food Chemistry, vol.
132, no. 1, pp. 419–427, 2012.
[91] P. Sanguansri and M. A. Augustin, “Nanoscale materials
development—a food industry perspective,” Trends in Food
Science & Technology, vol. 17, no. 10, pp. 547–556, 2006.
[92] S. Bhattacharya, J. Jang, L. Yang, D. Akin, and R. Bashir,
“BioMEMS and nanotechnology-based approaches for rapid
detection of biological entities,” Journal of Rapid Methods &
Automation in Microbiology, vol. 15, no. 1, pp. 1–32, 2007.
[93] A. L. Brody, “Case studies on nanotechnologies for food
packaging,” Food Technology, vol. 61, no. 7, pp. 102–107, 2007.
[94] B. Bugusu, C. Mejia, B. Magnuson, and S. Tafazoli, “Global
regulatory food policies on nanotechnology,” Food Technology,
vol. 63, no. 5, pp. 24–29, 2009.
[95] C.-F. Chau, S.-H. Wu, and G.-C. Yen, “The development of
regulations for food nanotechnology,” Trends in Food Science
and Technology, vol. 18, no. 5, pp. 269–280, 2007.
[96] L. Chen and M. Subirade, “Chitosan/𝛽-lactoglobulin core-shell
nanoparticles as nutraceutical carriers,” Biomaterials, vol. 26,
no. 30, pp. 6041–6053, 2005.
[97] P. H. M. Hoet, I. Brüske-Hohlfeld, and O. V. Salata,
“Nanoparticles—known and unknown health risks,” Journal of
Nanobiotechnology, vol. 2, article 12, 2004.
[98] A. Lopez-Rubio, R. Gavara, and J. M. Lagaron, “Bioactive pack-
aging: turning foods into healthier foods through biomaterials,”
Trends in Food Science and Technology, vol. 17, no. 10, pp. 567–
575, 2006.
 BioMed Research International 17

[99] S. Mannino and M. Scampicchio, “Nanotechnology and food [117] L. F. Qi, Z. R. Xu, X. Jiang, C. Hu, and X. Zou, “Preparation and
quality control,” Veterinary Research Communications, vol. 31, antibacterial activity of chitosan nanoparticles,” Carbohydrate
no. 1, pp. 149–151, 2007. Research, vol. 339, no. 16, pp. 2693–2700, 2004.
[100] H. S. Ribeiro, B.-S. Chu, S. Ichikawa, and M. Nakajima, “Prepa- [118] M. X. Quintanilla-Carvajal, B. H. Camacho-Dı́az, L. S. Meraz-
ration of nanodispersions containing 𝛽-carotene by solvent Torres et al., “Nanoencapsulation: a new trend in food engineer-
displacement method,” Food Hydrocolloids, vol. 22, no. 1, pp. 12– ing processing,” Food Engineering Reviews, vol. 2, no. 1, pp. 39–
17, 2008. 50, 2010.
[101] D. Tang, J. C. Sauceda, Z. Lin et al., “Magnetic nanogold [119] J.-W. Rhim and P. K. W. Ng, “Natural biopolymer-based
microspheres-based lateral-flow immunodipstick for rapid nanocomposite films for packaging applications,” Critical
detection of aflatoxin B2 in food,” Biosensors and Bioelectronics, Reviews in Food Science and Nutrition, vol. 47, no. 4, pp. 411–
vol. 25, no. 2, pp. 514–518, 2009. 433, 2007.
[102] M. Garcı́a, T. Forbe, and E. Gonzalez, “Potential applications [120] M. Scampicchio, D. Ballabio, A. Arecchi, S. M. Cosio, and S.
of nanotechnology in the agro-food sector,” Food Science and Mannino, “Amperometric electronic tongue for food analysis,”
Technology, vol. 30, no. 3, pp. 573–581, 2010. Microchimica Acta, vol. 163, no. 1-2, pp. 11–21, 2008.
[103] S. Sonkaria, S.-H. Ahn, and V. Khare, “Nanotechnology and its [121] H. D. Silva, M. Â. Cerqueira, and A. A. Vicente, “Nanoemul-
impact on food and nutrition: a review,” Recent Patents on Food, sions for food applications: development and characterization,”
Nutrition and Agriculture, vol. 4, no. 1, pp. 8–18, 2012. Food and Bioprocess Technology, vol. 5, no. 3, pp. 854–867, 2012.
[104] S. Stanley, “Biological nanoparticles and their influence on [122] I. Sondi and B. Salopek-Sondi, “Silver nanoparticles as antimi-
organisms,” Current Opinion in Biotechnology, vol. 28, pp. 69– crobial agent: a case study on E. coli as a model for Gram-
74, 2014. negative bacteria,” Journal of Colloid and Interface Science, vol.
275, no. 1, pp. 177–182, 2004.
[105] V. Rai, S. Acharya, and N. Dey, “Implications of nanobiosensors
in agriculture,” Journal of Biomaterials and Nanobiotchnology, [123] A. Cagri, Z. Ustunol, and E. T. Ryser, “Antimicrobial edible films
vol. 3, no. 2, pp. 315–324, 2012. and coatings,” Journal of Food Protection, vol. 67, no. 4, pp. 833–
848, 2004.
[106] S. Otles and B. Yalcin, “Nano-biosensors as new tool for
detection of food quality and safety,” LogForum, vol. 6, no. 4, [124] D. S. Cha and M. S. Chinnan, “Biopolymer-based antimicrobial
pp. 67–70, 2010. packaging: a review,” Critical Reviews in Food Science and
Nutrition, vol. 44, no. 4, pp. 223–237, 2004.
[107] S. Pandey, M. G. H. Zaidib, and S. K. Gururani, “Recent devel-
opments in clay-polymer nano composites,” Scientific Journal of [125] Y.-J. Cho, C.-J. Kim, N. Kim, C.-T. Kim, and B. Park, “Some
Review, vol. 2, no. 11, pp. 296–328, 2013. cases in applications of nanotechnology to food and agricultural
systems,” Biochip Journal, vol. 2, no. 3, pp. 183–185, 2008.
[108] C.-X. He, Z.-G. He, and J.-Q. Gao, “Microemulsions as drug
delivery systems to improve the solubility and the bioavailability [126] J. F. Graveland-Bikker and C. G. de Kruif, “Food nanotechnol-
of poorly water-soluble drugs,” Expert Opinion on Drug Deliv- ogy,” Trends in Food Science and Technology, vol. 17, no. 5, pp.
ery, vol. 7, no. 4, pp. 445–460, 2010. 196–203, 2006.
[127] B. Farhang, “Nanotechnology and applications in food safety,”
[109] S. Gupta and S. P. Moulik, “Biocompatible microemulsions and
Global Issues in Food Science and Technology, vol. 22, pp. 401–
their prospective uses in drug delivery,” Journal of Pharmaceu-
410, 2009.
tical Sciences, vol. 97, no. 1, pp. 22–45, 2008.
[128] S. Mazumder, D. Sarkar, and I. K. Puri, “Nanotechnology
[110] P. Bordes, E. Pollet, and L. Avérous, “Nano-biocomposites:
commercialization: prospects in India,” Journal of Materials
biodegradable polyester/nanoclay systems,” Progress in Polymer
Science and Nanotechnology, vol. 2, 2014.
Science, vol. 34, no. 2, pp. 125–155, 2009.
[111] J.-M. Nam, C. S. Thaxton, and C. A. Mirkin, “Nanoparticle-
based bio-bar codes for the ultrasensitive detection of proteins,”
Science, vol. 301, no. 5641, pp. 1884–1886, 2003.
[112] A. Arora and G. W. Padua, “Review: nanocomposites in food
packaging,” Journal of Food Science, vol. 75, no. 1, pp. R43–R49,
2010.
[113] B. Chen and J. R. G. Evans, “Thermoplastic starch-clay
nanocomposites and their characteristics,” Carbohydrate Poly-
mers, vol. 61, no. 4, pp. 455–463, 2005.
[114] M. Cushen, J. Kerry, M. Morris, M. Cruz-Romero, and E.
Cummins, “Nanotechnologies in the food industry—recent
developments, risks and regulation,” Trends in Food Science and
Technology, vol. 24, no. 1, pp. 30–46, 2012.
[115] A. Fujishima, T. N. Rao, and D. A. Tryk, “Titanium dioxide
photocatalysis,” Journal of Photochemistry and Photobiology C:
Photochemistry Reviews, vol. 1, no. 1, pp. 1–21, 2000.
[116] P.-C. Maness, S. Smolinski, D. M. Blake, Z. Huang, E. J.
Wolfrum, and W. A. Jacoby, “Bactericidal activity of photo-
catalytic TiO2 reaction: toward an understanding of its killing
mechanism,” Applied and Environmental Microbiology, vol. 65,
no. 9, pp. 4094–4098, 1999.
Hindawi Publishing Corporation
BioMed Research International
Volume 2015, Article ID 392872, 22 pages
http://dx.doi.org/10.1155/2015/392872

Review Article
Current and New Approaches in GMO Detection:
Challenges and Solutions

Marie-Alice Fraiture,1,2,3 Philippe Herman,1 Isabel Taverniers,2 Marc De Loose,2,4

Dieter Deforce,3 and Nancy H. Roosens1
1
Platform of Biotechnology and Molecular Biology (PBB) and Biosafety and Biotechnology Unit (SBB),
Scientific Institute of Public Health (WIV-ISP), J. Wytsmanstraat 14, 1050 Brussels, Belgium
2
Technology and Food Sciences Unit, Institute for Agricultural and Fisheries Research (ILVO), Burg. Van Gansberghelaan 115,
Bus 1, 9820 Merelbeke, Belgium
3
Laboratory of Pharmaceutical Biotechnology, Faculty of Pharmaceutical Sciences, Ghent University, Ottergemsesteenweg 460,
9000 Ghent, Belgium
4
Department of Plant Biotechnology and Bioinformatics, Faculty of Sciences, Ghent University, Technologiepark 927,
9052 Ghent, Belgium

Correspondence should be addressed to Nancy H. Roosens; nancy.roosens@wiv-isp.be

Received 17 July 2015; Accepted 7 September 2015

Academic Editor: Yiannis Kourkoutas

Copyright © 2015 Marie-Alice Fraiture et al. This is an open access article distributed under the Creative Commons Attribution
License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly
cited.

In many countries, genetically modified organisms (GMO) legislations have been established in order to guarantee the traceability
of food/feed products on the market and to protect the consumer freedom of choice. Therefore, several GMO detection strategies,
mainly based on DNA, have been developed to implement these legislations. Due to its numerous advantages, the quantitative PCR
(qPCR) is the method of choice for the enforcement laboratories in GMO routine analysis. However, given the increasing number
and diversity of GMO developed and put on the market around the world, some technical hurdles could be encountered with
the qPCR technology, mainly owing to its inherent properties. To address these challenges, alternative GMO detection methods
have been developed, allowing faster detections of single GM target (e.g., loop-mediated isothermal amplification), simultaneous
detections of multiple GM targets (e.g., PCR capillary gel electrophoresis, microarray, and Luminex), more accurate quantification
of GM targets (e.g., digital PCR), or characterization of partially known (e.g., DNA walking and Next Generation Sequencing
(NGS)) or unknown (e.g., NGS) GMO. The benefits and drawbacks of these methods are discussed in this review.

1. Introduction GMO labeling policies have been established in several

With the aim to improve the agricultural practices and nutri-
tional quality, plant breeding techniques have been developed
to produce genetically modified (GM) crops expressing inter-
esting traits such as herbicide tolerance, insect resistance, and
abiotic stress resistance [1]. To this end, new combinations of
their genetic material are created through the use of modern
biotechnology [2]. The first genetically modified organism
(GMO) approved for the commercialization was the Flavr-
Savr tomato in 1994. From that time, 181.5 million hectares
of planted GM plants in 28 countries were reported in
2014 [1]. Given that the “right to know” for the consumers,
countries around the world with a threshold of tolerance
varying between 0 and 5%. Therefore, the presence of GMO in
the food/feed chain is controlled by the competent authorities
[3]. To guarantee the GMO traceability, a key factor in
the implementation of these regulations, several strategies,
categorized as indirect (protein-based methods) or direct
(DNA-based methods), have been developed to detect GMO
in food/feed samples by using different technologies. Among
the protein-based approaches, which target proteins encoded
by the transgenes, several methods depend on the Enzyme-
Linked Immunosorbent Assay (ELISA) technique (Table 1)
[4–21]. A portable immunoassay system was also proposed
2 BioMed Research International

Known Partially known Unknown

DNA walking + Sanger sequencing

qPCR dPCR LAMP Sanger sequencing: shotgun
Plant genome Transgenic cassette
− + t35S p35S tNOS
− +
+ − + Junction
+ + − +
− − +
Multiplexing

+ − DNA walking + NGS

Standard Absolute Rapid, cheap, p35S tNOS tNOS
method quantification and portable
Suitable for p35S NGS: whole genome sequencing
PCR CGE Microarray Luminex GM mixture

Targeted NGS: enrichment target

Suitable for Referencegenome

Reference genome
GM mixture

Figure 1: Suitable application of GMO detection approaches regarding the adopted strategy as well as the available information about the
sequences of tested GMO.

Table 1: Representative examples illustrating protein-based meth- tissues and the plant developmental status. Moreover, the
ods targeting GMO. proteins are highly degraded or denatured by food process-
ing. Any modification in the targeted proteins could indeed
Technologies Targets References
alter the specificity and sensitivity of the assay. In addition,
CP4-EPSPS [4] this strategy is not applicable if the genetic modification has
Cry1Ab [10, 12, 15, 18, 20] no impact at the protein level [26, 27]. To overcome these
Cry1Ac [10, 14] issues, many DNA-based methods, targeting straightforward
Cry2A [10] transgenic integrated sequences, have been widely developed.
Cry2Ab [19] Even if quantitative PCR (qPCR) is the method of choice
Cry3A [10, 16] in GMO routine analysis, its inherent PCR properties imply
ELISA
Cry9C [10] some limitations. Therefore, to address these challenges,
nptII [5, 16, 22] some alternative approaches have been developed, allowing
CP4-EPSPS [6, 10, 13, 22]
notably providing faster detection of GM targets individually
amplified in both routine laboratory and field (e.g., loop-
pat [10, 11, 13, 22]
mediated isothermal amplification (LAMP)), simultaneous
Gox [17] detection of several GM targets (e.g., PCR capillary gel elec-
CpTI [21] trophoresis (CGE), microarray, and Luminex), more accurate
Cry1Ac [23] quantification of GM targets (e.g., digital PCR (dPCR)), or
Immuno-PCR p35S [24] characterization of partially known (e.g., DNA walking and
tNOS [24] Next Generation Sequencing (NGS)) or unknown (e.g., NGS)
CP4-EPSPS (5-enolpyruvylshikimate-3-phosphate synthase gene from GMO (Figure 1). These DNA-based approaches and their
Agrobacterium tumefaciens strain); CpTI (trypsin inhibitor in cowpea Vigna targets are described in this review. In addition, the most
unguiculata); Cry (gene encoding the Bacillus thuringiensis 𝛿-endotoxin); appropriate uses of these approaches are discussed according
Gox (glyphosate oxidoreductase gene); nptII (neomycin phosphotransferase to the adopted strategy of GMO detection as well as the
II gene); p35S (promoter of the 35 S cauliflower mosaic virus); tNOS
(terminator of the nopaline synthase gene). available information about the sequences of tested GMO.

2. GMO Detection Approaches

(Table 1) [22]. As an alternative, the immuno-PCR method
was used to identify GMO (Table 1) [23, 24].
Furthermore, protein-based methods include the use of
the mass spectrometry-based technology as a tool allow-
ing characterizing GM crops [25]. However, although they
present several advantages such as the rapidity and simplicity,
the protein-based methods depend on the expression level
of targeted proteins, which is variable according to the plant
2.1. qPCR Technology. The qPCR system, which is the most
common strategy, allows detecting, identifying, and quan-
tifying GMO via the SYBR Green or TaqMan chemistries
(Figure 1) [28]. Using a primer pair specific to the target,
these qPCR chemistries are both based on PCR amplifi-
cation recorded in real time with the fluorescence origi-
nated either from the asymmetrical cyanine dye binding to
BioMed Research International
double-stranded DNA (SYBR Green) or from the fluorogenic
probe specific to the targeted sequence (TaqMan) [29]. This
technology is suitable for both unprocessed and processed
food/feed matrices since amplicons of around 100 bp are
usually amplified. Even if numerous qPCR methods have
been reported, three main steps are typically followed in
GMO routine analysis [30]. First, the potential presence of
GMO is assessed via a screening approach targeting the most
common transgenic elements found in GMO, such as p35S
(35S promoter from cauliflower mosaic virus) and tNOS
(nopaline synthase terminator from Agrobacterium tumefa-
ciens). In addition, some markers more discriminative, such
as Cry3Bb, gat-tpinII, and t35S pCAMBIA, and taxon-specific
markers could also be used. This step allows establishing a
list of the potential GMO present in the tested samples and
preventing further unnecessary assays in the subsequent steps
(Table 2) [28, 30–34]. Several of these screening markers are
validated, based on minimum performance requirements, at
the EU level following ring trials and are included in the
Compendium of reference methods for GMO analysis [35].
According to the positive and negative signals observed for
the different screening markers tested, GM events potentially
detected are in a second step identified using construct-
specific or event-specific markers targeting, respectively, the
junction between two elements inside the transgenic cassette
or the junction between the transgenic cassette and the
plant genome. In order to properly discriminate each GM
event, the event-specific markers are currently favoured since
the unique transgenic integration sites are targeted. Finally,
the amount of identified GM events present in the tested
food/feed samples is determined. Using event-specific and
taxon-specific markers, this quantification step is carried
out on the basis of the number of copies belonging to the
transgene and to the endogen (Table 2) [30]. All the methods
used to identify the EU-authorized GMO as well as the
GMO for which the authorization is pending or is subjected
to be withdrawn in the case of low level presence (LLP)
have been provided by the applicants and are reported in
the Compendium of reference methods for GMO analysis
[35]. In combining several taxon-specific, event-specific, and
construct-specific TaqMan markers in a 96-well prespotted
plate, a real-time PCR based ready-to-use multitarget ana-
lytical system has been developed to allow the simultaneous
identification of thirty-nine GM events [36].
In spite of its flexibility, simplicity, rapidity, and high
analytical sensitivity, especially crucial to detect a low amount
of GM targets, the success of the qPCR strategy depends
however on some factors. For instance, the throughput of the
qPCR strategy is usually limited to one marker per reaction.
Due to the increasing number of GMO, additional markers
have continually to be developed and used to fully cover
their detection, which could thus make the laboratory work
and the analysis of the results quite complex and laborious
[32]. In addition, this a priori approach targets only known
sequences. Therefore, negative signals guarantee only the
absence of known GMO in the tested food/feed samples.
Similarly, in case of unexplained signals, in other words,
the obtaining of positive and negative signals that found
no correspondence with known GM events, the presence
3
of unknown GMO could only be suspected. Indeed, the
detection of GMO by qPCR is notably based on transgenic
elements originated from natural organisms, such as p35S
from CaMV and tNOS from Agrobacterium. For this reason,
the qPCR system provides merely an indirect proof of the
presence of GMO in a food/feed matrix since it could only
be confirmed by the sequence of their transgene flanking
regions. Concerning the quantification step, its achievement
depends on the availability of Certified Reference Materials
(CRM) [30, 33, 125]. Finally, the presence of inhibitors, such as
polysaccharides, polyphenols, pectin, xylan, or fat, could alter
the efficiency of the PCR reaction. Consequently, a later qPCR
signal than theoretically expected will be observed, inducing
an underestimation or even concealing the amount of GMO
present in the tested sample [126–128].
2.1.1. qPCR Analysis Tools. In order to facilitate the inter-
pretation of results, rapid and cost-efficient systems have
been developed via analytical tools integrating simultane-
ously several targets. To this end, the CoSYPS platform
(Combinatory SYBR Green qPCR Screening), which is a
decision support system (DSS) at the screening level, has been
successfully developed. For each tested food/feed matrix,
this DSS combines immediately the experimental 𝐶𝑡 and
𝑇𝑚 values obtained with the twenty SYBR Green methods,
running in a single 96-well plate and targeting plant gene,
taxon genes, and transgenic elements (Table 2). This selec-
tion of screening markers allows both covering at least all
the EU-authorized GMO and LLP cases (e.g., with p35S
and tNOS) and, as far as possible, discriminating between
themselves and some EU-unauthorized GMO (e.g., with t35S
pCAMBIA and gat-tpinII) in order to reduce the number
of identifications/quantifications to carry out downstream
[30, 33, 34, 129]. An alternative to interpret qPCR results
is provided by the GMOseek and GMOfinder databases,
containing reliable information on GMO. Following the
interpretation of the experimental results, obtained with
in-house or EU reference methods, the names of positive
elements are introduced in the databases to provide a list of
potentially detected GMO that will be then experimentally
verified [130, 131]. The truthfulness of these predictions is
however diminished since elements identically named can
possess different sequences and the detection methods used
are not taken into account. Indeed, to target the same
element, several methods could exist and could present
different PCR efficiencies which could generate variation in
the results. Most recently, the JRC-GMO-Matrix platform,
combining information from the GMOMETHODS database
(all reference methods for GMO analysis) and the Central
Core DNA Sequences Information System (several annotated
GMO sequences), was also proposed for the same purpose.
This platform integrates the positive and negative signals
experimentally observed with EU validated taxon-specific,
element-specific, construct-specific, and event-specific meth-
ods for any tested food/feed matrix in order to predict more
reliably the potential amplified GM events [28]. The JRC-
GMO-Matrix platform is also strengthened by the JRC GMO-
Amplicons database which contains publically available puta-
tive GMO-related sequences [132].
4 BioMed Research International

Table 2: Representative examples illustrating simplex qPCR methods targeting GMO. Those validated at the EU level are indicated by an
asterisk. Screening markers used in the CoSYPS are indicated by ∼.

Methods Chemistries Targets References

Screening markers
Plant-specific SYBR Green RBCL∼ [37]
Taxon-specific SYBR Green LEC∗∼ [35]
SYBR Green ADH∗∼ [37]
SYBR Green CRU∗∼ [37]
SYBR Green PLD∼ [37]
SYBR Green SAD1∼ [35]
SYBR Green GLU∼ [35]
Element-specific SYBR Green p35S∗∼ [31]
TaqMan p35S∗ [38]
SYBR Green tNOS∗∼ [31]
TaqMan tNOS∗ [38]
SYBR Green pFMV∼ [39]
TaqMan pFMV∗ [35]
SYBR Green pNOS∼ [39]
SYBR Green t35S∼ In-house
SYBR Green Cry1Ab/Ac∼ [40]
TaqMan Cry1A(b)∗ [35]
SYBR Green Cry3Bb∼ [34]
SYBR Green pat∗∼ [40]
TaqMan pat∗ [35]
SYBR Green bar∗∼ [40]
TaqMan bar∗ [35]
SYBR Green CP4-EPSPS∼ [40]
SYBR Green t35S pCAMBIA∼ [33]
SYBR Green nptII [35]
Construct-specific SYBR Green gat-tpinII∼ [34]
Virus-specific SYBR Green CRT∼ In-house
Event-specific methods
GM-specific TaqMan Maize (Zea mays) 3272∗ [35]
TaqMan Maize (Zea mays) 5307∗ [35]
TaqMan Maize (Zea mays) 98140∗ [35]
TaqMan Maize (Zea mays) Bt11∗ [35]
TaqMan Maize (Zea mays) Bt176∗ [35]
TaqMan Maize (Zea mays) DAS-40278-9∗ [35]
TaqMan Maize (Zea mays) DAS-59122-7∗ [35]
TaqMan Maize (Zea mays) GA21∗ [35]
TaqMan Maize (Zea mays) LY038∗ [35]
TaqMan Maize (Zea mays) MIR162∗ [35]
TaqMan Maize (Zea mays) MIR604∗ [35]
TaqMan Maize (Zea mays) MON810∗ [35]
TaqMan Maize (Zea mays) MON863∗ [35]
TaqMan Maize (Zea mays) MON87460∗ [35]
TaqMan Maize (Zea mays) MON88017∗ [35]
TaqMan Maize (Zea mays) MON89034∗ [35]
TaqMan Maize (Zea mays) NK603∗ [35]
TaqMan Maize (Zea mays) T25∗ [35]
TaqMan Maize (Zea mays) TC1507∗ [35]
TaqMan Soybean (Glycine max) A2704-12∗ [35]
BioMed Research International 5

Table 2: Continued.
Methods Chemistries Targets References
TaqMan Soybean (Glycine max) A5547-127∗ [35]
TaqMan Soybean (Glycine max) BPS-CV-127∗ [35]
TaqMan Soybean (Glycine max) DAS68416-4∗ [35]
TaqMan Soybean (Glycine max) DP-305423-1∗ [35]
TaqMan Soybean (Glycine max) DP-356043-5∗ [35]
TaqMan Soybean (Glycine max) FG72∗ [35]
TaqMan Soybean (Glycine max) GTS40-3-2∗ [35]
TaqMan Soybean (Glycine max) MON87701∗ [35]
TaqMan Soybean (Glycine max) MON87705∗ [35]
TaqMan Soybean (Glycine max) MON87708∗ [35]
TaqMan Soybean (Glycine max) MON87769∗ [35]
TaqMan Soybean (Glycine max) MON89788∗ [35]
TaqMan Cotton (Gossypium hirsutum) 281-24-236∗ [35]
TaqMan Cotton (Gossypium hirsutum) 3006-210-23∗ [35]
TaqMan Cotton (Gossypium hirsutum) GHB119∗ [35]
TaqMan Cotton (Gossypium hirsutum) GHB614∗ [35]
TaqMan Cotton (Gossypium hirsutum) LLCOTTON25∗ [35]
TaqMan Cotton (Gossypium hirsutum) MON531∗ [35]
TaqMan Cotton (Gossypium hirsutum) MON1445∗ [35]
TaqMan Cotton (Gossypium hirsutum) MON15985∗ [35]
TaqMan Cotton (Gossypium hirsutum) MON88913∗ [35]
TaqMan Cotton (Gossypium hirsutum) T304-40∗ [35]
TaqMan Oilseed rape (Brassica napus) 73496∗ [35]
TaqMan Oilseed rape (Brassica napus) GT73∗ [35]
TaqMan Oilseed rape (Brassica napus) MON88302∗ [35]
TaqMan Oilseed rape (Brassica napus) Ms1∗ [35]
TaqMan Oilseed rape (Brassica napus) Ms8∗ [35]
TaqMan Oilseed rape (Brassica napus) Rf1∗ [35]
TaqMan Oilseed rape (Brassica napus) Rf2∗ [35]
TaqMan Oilseed rape (Brassica napus) Rf3∗ [35]
TaqMan Oilseed rape (Brassica napus) T45∗ [35]
TaqMan Oilseed rape (Brassica napus) Topas 19/2∗ [35]
TaqMan Potato (Solanum tuberosum) EH92-527-1∗ [35]
TaqMan Rice (Oryza sativa) LLRICE62∗ [35]
TaqMan Sugar beet (Beta vulgaris) H7-1∗ [35]
ADH (alcohol dehydrogenase I gene from maize); bar (phosphinothricin-N-acetyltransferases gene from Streptomyces hygroscopicus); CP4-EPSPS (5-
enolpyruvylshikimate-3-phosphate synthase gene from Agrobacterium tumefaciens strain); CRT (reverse transcriptase gene from the cauliflower mosaic virus);
CRU (cruciferin gene from colza); Cry (gene encoding the Bacillus thuringiensis 𝛿-endotoxin); gat-tpinII (junction sequence between the glyphosate N-
acetyltransferase of Bacillus licheniformis and the terminator of the Solanum tuberosum proteinase inhibitor); GLU (glutamine synthetase gene from sugar beet);
LEC (lectin gene from soybean); nptII (neomycin phosphotransferase II gene); p35S (promoter of the 35 S cauliflower mosaic virus); pat (phosphinothricin-
N-acetyltransferases gene from Streptomyces viridochromogenes); pFMV (promoter of the figwort mosaic virus); phy (phytase gene from maize); PLD
(phospholipase D gene from rice); pNOS (promoter of the nopaline synthase gene); RBCL (ribulose-1,5-biphosphate carboxylase oxygenase); SAD1 (stearoyl-
acyl carrier protein desaturase gene from cotton); t35S (terminator of the cauliflower mosaic virus); t35S pCAMBIA (terminator of the cauliflower mosaic virus
from pCAMBIA vector); tNOS (terminator of the nopaline synthase gene).

2.1.2. Multiplex qPCR Strategy. With multiplex PCR-based
methods, several DNA targets can be detected in a single
reaction. It presents the advantage to decrease the number of
reactions necessary to test the potential presence of GMO in a
sample. Several multiplex qPCR TaqMan strategies have thus
been investigated, including mainly the screening markers
p35S and tNOS (Table 3) [38, 41, 43–49]. To provide a system
with a high GMO coverage, twenty-three triplex and one
duplex PCR were gathered on a 384-well plate to identify
forty-seven targets (Table 3) [42].
However, compared to simplex qPCR, the development of
optimal multiplex assays could be more challenging notably
in terms of primers and probes design as well as sensitivity
and reproducibility. Moreover, the throughput of this strategy
is relatively limited by the availability of dyes with an emission
and absorption spectrum of fluorescence sufficiently distinct
6 BioMed Research International

Table 3: Representative examples illustrating multiplex qPCR TaqMan methods targeting GMO. Those validated at the EU level are indicated
by an asterisk.

Multiplexing Methods Targets References

Duplex Element-specific p35S∗ and tNOS∗ [38]
Duplex Element-specific bar and pat [41]
Plant-specific TLC [42]
Duplex
Other IPC
Taxon-specific ADH [43]
Duplex
Event-specific Bt11
Taxon-specific ADH [43]
Duplex
Event-specific Bt176
Taxon-specific ADH [43]
Duplex
Event-specific MON810
Taxon-specific ADH [43]
Duplex
Event-specific T25
Triplex Element-specific p35S, tNOS, and CTP2/CP4-EPSPS [41]
Taxon-specific LEC and Zein [42]
Triplex
Other IPC
Taxon-specific Pro and PC [42]
Triplex
Other IPC
Taxon-specific ACC and FRUp [42]
Triplex
Other IPC
Taxon-specific SAD1 and FRUt [42]
Triplex
Other IPC
Element-specific p35S and pFMV [42]
Triplex
Other IPC
Element-specific tE9 and tNOS [42]
Triplex
Other IPC
Element-specific bar and CP4-EPSPS [42]
Triplex
Other IPC
Element-specific hpt and pat [42]
Triplex
Other IPC
Element-specific nptII and Cry1Ab/Ac [42]
Triplex
Other IPC
Construct-specific CBH351 and Bt176 [42]
Triplex
Other IPC
Construct-specific MON810 and T25 [42]
Triplex
Other IPC
Construct-specific Bt11 and MON863 [42]
Triplex
Other IPC
Construct-specific NK603 and GA21 [42]
Triplex
Other IPC
Construct-specific TC1507 and DAS-59122-7 [42]
Triplex
Other IPC
Construct-specific MIR604 and MON88017 [42]
Triplex
Other IPC
Construct-specific 98140 and MON89034 [42]
Triplex
Other IPC
Construct-specific 3272 and MIR162 [42]
Triplex
Other IPC
Construct-specific A2704-12 and GTS40-3-2 [42]
Triplex
Other IPC
BioMed Research International 7

Table 3: Continued.
Multiplexing Methods Targets References
Construct-specific DP-305423-1 and DP-356043-5 [42]
Triplex
Other IPC
Construct-specific MON87701 and MON89788 [42]
Triplex
Other IPC
Element-specific AHAS [42]
Triplex Construct-specific FG72
Other IPC [42]
Construct-specific Bt63 and A5547-127 [42]
Triplex
Other IPC
Element-specific Xa21
Triplex Construct-specific KMD1
Other IPC
Taxon-specific Zein [44]
Triplex
Construct-specific MON810 and GA21
Taxon-specific ADH [44]
Triplex
Construct-specific MON810 and GA21
Triplex Element-specific p35s, tNOS, and t35S [45]
Triplex Element-specific tE9, pRbcS4, and tORF23 [45]
Element-specific tpinII and tAHASL [45]
Triplex
Event-specific DP-305423-1
Tetraplex Element-specific pFMV, bar, pat, and CTP2/CP4-EPSPS [46]
Tetraplex Element-specific p35S, tNOS, pFMV, and bar [47]
Taxon-specific HMG and LEC
Pentaplex Element-specific p35S and tNOS [46]
Virus-specific CaMV
Pentaplex Element-specific p35S, tNOS, bar, pat, and CTP2/CP4-EPSPS [41]
Taxon-specific LEC [48]
Pentaplex
Event-specific MON87769, MON87708, MON87705, and FG72
Element-specific p35S, tNOS, and pFMV
Hexaplex Construct-specific SAMS and LY [49]
Other IPC
ACC (acetyl-CoA-carboxylase gene from colza); ADH (alcohol dehydrogenase I gene from maize); AHAS (AHAS fragment unique recombination
from BPS-CV-127); bar (phosphinothricin-N-acetyltransferases gene from Streptomyces hygroscopicus); CaMV (ORFIII from CaMV); CP4-EPSPS (5-
enolpyruvylshikimate-3-phosphate synthase gene from Agrobacterium tumefaciens strain); Cry (gene encoding the Bacillus thuringiensis 𝛿-endotoxin);
CTP2/CP4-EPSP (junction region between the chloroplast transit peptide 2 (CTP2) sequence from the Arabidopsis thaliana epsps gene and the CP4 epsps
gene from Agrobacterium tumefaciens (CP4-EPSPS)); FRUp (𝛽-fructosidase gene from potato); FRUt (𝛽-fructosidase gene from tomato); HMG (major high-
mobility group protein gene from maize); hpt (hygromycin phosphotransferase gene); IPC (internal positive control); LEC (lectin gene from soybean);
LS28 (choline kinase); LY (transition from Zea mays chloroplast transit peptide sequence for dihydrodipicolinate synthase to Corynebacterium glutamicum
dihydrodipicolinate synthase (cordapA) gene encoding for a lysine-insensitive dihydrodipicolinate synthase enzyme); nptII (neomycin phosphotransferase
II gene); p35S (promoter of the 35 S cauliflower mosaic virus); pat (phosphinothricin-N-acetyltransferases gene from Streptomyces viridochromogenes); PC
(phosphoenolpyruvate carboxylase gene from wheat); pFMV (promoter of the figwort mosaic virus); pRbcS4 (ribulose 1,5-bisphosphate carboxylase small
subunit promoter from A. thaliana); Pro (prolamin gene from rice); SAD1 (stearoyl-acyl carrier protein desaturase gene from cotton); SAMS (transition
from S-adenosyl-L-methionine synthetase (SAMS) promoter to Glycine max acetolactate synthase (gm-hra) gene); t35S (terminator of the cauliflower mosaic
virus); tAHASL (acetohydroxy acid synthase large subunit terminator from A. thaliana); tE9 (ribulose-1,5-bisphosphate carboxylase terminator E9 from
Pisum sativum); TLC (tRNA-Leu chloroplastic gene); tNOS (terminator of the nopaline synthase gene); tORF23 (open reading frame 23 terminator from A.
tumefaciens); tpinII (inhibitor II terminator from potato); Zein (Zein gene from maize), Xa21 (Xa21 gene from Oryza longistaminata).

to avoid overlaps of signals. The combination of different dyes
risks also increases the fluorescent background. Therefore,
the majority of the reported multiplex qPCR assays amplify
simultaneously only two or three targets. To date, a maximum
of six markers have been successfully combined in one
reaction to detect GMO [35, 49].
2.2. Alternative Multiplex Strategies. Still with the aim of
going further in the development of multiplex assays, several
methods not based on qPCR have been also developed using
notably the CGE, microarray, and Luminex technologies.
Two main steps are generally followed. Firstly, to guarantee a
sufficient sensitivity, the samples are amplified by PCR since
8 BioMed Research International

Table 4: Representative examples illustrating multiplex PCR CGE methods targeting GMO.

Multiplexing Methods Targets References

Taxon-specific Zein and LEC [50]
Tetraplex
Element-specific p35S and tNOS
Taxon-specific SAD1 [51]
Tetraplex
Element-specific Cry1Ac, p35S, and tNOS
Taxon-specific ADH [52]
Pentaplex
Event-specific Bt11, GA21, MON810, and NK603
Taxon-specific acp1 [53]
Hexaplex
Event-specific Bollgard, Bollgard II, RR, 3006-210-23, and 281-24-231
Taxon-specific HMG
Hexaplex [54, 55]
Event-specific DAS-59122-7, LY038, MON88017, MIR604, and 3272
Octaplex Event-specific Bt11, Bt176, Huanong No. 1, GTS40-3-2, T25, MON88913, MON1445, and MIR604 [56]
Taxon-specific LEC and ssIIb
Octaplex Element-specific pFMV and tNOS [56]
Event-specific TC1507, MON531, NK603, and GA21
Taxon-specific SAD1
Octaplex Element-specific bar, chy, pAct, CP4-EPSPS, and Cry1Ab [56]
Event-specific GT73 and OXY235
Taxon-specific HMG
Nonaplex [57, 58]
Event-specific T25, GA21, TC1507, MON863, MON810, NK603, Bt176, and Bt11
acp1 (acyl carrier protein 1 gene from cotton); ADH (alcohol dehydrogenase I gene from maize); bar (phosphinothricin-N-acetyltransferases gene from
Streptomyces hygroscopicus); Chy (chymopapain gene from papaya); CP4-EPSPS (5-enolpyruvylshikimate-3-phosphate synthase gene from Agrobacterium
tumefaciens strain); Cry (gene encoding the Bacillus thuringiensis 𝛿-endotoxin); HMG (major high-mobility group protein gene from maize); LEC (lectin gene
from soybean); p35S (promoter of the 35 S cauliflower mosaic virus); pAct (promoter region of rice actin gene); pFMV (promoter of the figwort mosaic virus);
SAD1 (stearoyl-acyl carrier protein desaturase gene from cotton); ssIIb (starch synthase IIb gene from maize); tNOS (terminator of the nopaline synthase gene);
Zein (Zein gene from maize).

the GM targets are potentially at trace level in food/feed
matrices. In a second step, the PCR products are analyzed
using the CGE, microarray, or Luminex platforms. Despite
the fact that these technologies present a higher throughput
than qPCR, their multiplexing level is still influenced by
the inherent properties of PCR which limit the number of
reactions at commonly ten targets per PCR assay [133, 134].
2.2.1. PCR Capillary Gel Electrophoresis Technology. In order
to detect simultaneously several targets, the use of the PCR
multiplex CGE, where fluorescently labelled primers allow
discriminating different amplicons of the same size, has been
also suggested to be applied in the GMO detection field
(Figure 1 and Table 4). Compared to the electrophoresis gel,
the resolution power of the CGE system to detect PCR prod-
ucts from a multiplex assay is clearly higher [134]. However,
the sensitivity of CGE system is weaker than the qPCR tech-
nology [135]. Using the PCR CGE system, eight GM maize
were identified via a nonaplex PCR including event-specific,
construct-specific, and taxon-specific methods (Table 4) [57,
58]. Similarly, one pentaplex PCR and two hexaplex PCR
were also developed to, respectively, detect specifically four
GM maize, five GM cotton, and five GM maize (Table 4)
[52–55]. Recently, a tetraplex targeting transgenic elements
and cotton-specific gene was also reported (Table 4) [51].
In addition, Guo et al., 2011 developed three octaplex PCR
using universally tailed primers to preamplify GM targets
under a short number of cycles. To increase the yield and
PCR efficiency, these amplicons, earlier submitted to a PCR
emulsion, are then enriched with universal primers. By this
way, twenty-four targets from fourteen GM events were
identified by the CGE system (Table 4) [56]. A variant of this
technique, which implies no fluorescent labels on primers,
is reported by Burrell et al., 2011. This study proposed a
tetraplex PCR composed of two species-specific methods and
two screening markers allowing detecting the presence of Bt11
maize and GTS40-3-2 soybean events using commercialized
electrophoresis instruments (Table 4) [50].
2.2.2. Microarrays Technology. With the microarray technol-
ogy applied to GMO detection, GM targets are amplified by
PCR, using target-specific and/or universal primers, prior
to being hybridized on the array, allowing the simultaneous
detection of more than 250 000 targets in one assay (Figure 1
and Table 5) [136]. Compared to the qPCR, the microarray
strategy presents thus a well higher throughput but a slightly
weaker sensitivity [133, 137]. One approach, called multiplex
quantitative DNA array-based PCR (MQDA-PCR), tested
on transgenic maize events, consists of a first PCR using
target-specific primers that harbor a universal tail allowing
using universal primers in the second PCR. The signal is
then detected after the hybridization of the PCR products
with the fluorescently labelled probes on the DNA array
(Table 5) [63]. Furthermore, using a padlock probe ligation-
microarray detection system (PPLMD), some GM maize,
cotton, and soybean events were detected. With the PPLMD
BioMed Research International 9

Table 5: Representative examples illustrating multiplex PCR microarray methods targeting GMO.

Multiplexing Techniques Methods Targets References

Duplex DualChip GMO Element-specific p35S and tNOS [59–61]
Construct-specific pNOS/nptII
Duplex DualChip GMO [59–61]
Virus-specific CaMV
Triplex DualChip GMO Element-specific pat, Cry1A(b), and CP4-EPSPS [59–61]
Taxon-specific IVR [62]
Triplex NAIMA
Element-specific p35S and tNOS
Taxon-specific IVR
Triplex NAIMA Element-specific p35S [62]
Event-specific MON810
Plant-specific RBCL [59–61]
Tetraplex DualChip GMO
Taxon-specific IVR, LEC, and CRU [63]
Taxon-specific HMG
Element-specific p35S and tNOS
Octaplex MQDA-PCR
Event-specific Bt176, Bt11, and MON810
other IPC
Taxon-specific SAD1, Zein, ACC, and LEC
Decaplex PPLMD Element-specific p35S, pFMV, and bar [64]
Event-specific MON1445, Bt176, and GTS40-3-2
Taxon-specific HMG
Element-specific p35S, tNOS, and Amp
Dodecaplex MQDA-PCR [63]
Event-specific Bt176, Bt11, MON810, T25, GA21, CBH351, and DBT418
Other IPC
ACC (acetyl-CoA-carboxylase gene from colza); Amp (ampicillin resistance gene); bar (phosphinothricin-N-acetyltransferases gene from Streptomyces
hygroscopicus); CaMV (ORFIII from CaMV); CP4-EPSPS (5-enolpyruvylshikimate-3-phosphate synthase gene from Agrobacterium tumefaciens strain); CRU
(cruciferin gene from colza); Cry (gene encoding the Bacillus thuringiensis 𝛿-endotoxin); HMG (major high-mobility group protein gene from maize); IPC
(internal positive control); IVR (invertase gene from maize); LEC (lectin gene from soybean); nptII (neomycin phosphotransferase II gene); p35S (promoter
of the 35 S cauliflower mosaic virus); pat (phosphinothricin-N-acetyltransferases gene from Streptomyces viridochromogenes); pFMV (promoter of the figwort
mosaic virus); pNOS (promoter of the nopaline synthase gene); RBCL (ribulose-1,5-biphosphate carboxylase oxygenase); SAD1 (stearoyl-acyl carrier protein
desaturase gene from cotton); tNOS (terminator of the nopaline synthase gene); Zein (Zein gene from maize).

system, the targets are initially hybridized to linear padlock
probes harboring target-specific and universal sequences to
be then amplified by PCR with universal primers (Table 5)
[64]. In addition, a nucleic acid sequence based amplification
implemented microarray (NAIMA) approach, using univer-
sal primers, has been tested on transgenic maize (Table 5)
[62, 137]. As an alternative to the potential issue related to the
use of fluorescent label, the DualChip GMO system was pro-
posed. So, after PCR amplification with biotinylated target-
specific primers, the amplicons hybridized on the arrays
are detected by a colorimetric reaction, allowing identifying
simultaneously some GM maize, soybean, and rapeseed
events. The performance of the DualChip GMO system,
targeting fourteen elements, was also validated through an
EU collaborative ring trial. An upgraded version of this
system (DualChip GMO V2.0) presents a higher GMO
coverage in targeting thirty elements (Table 5) [59–61, 133,
138]. Most recently, a multiplex amplification on a chip with
readout on an oligo microarray (MACRO) system, targeting
ninety-one targets to cover a broad spectrum of GMO, was
also reported [139].
2.2.3. Luminex Technology. Biotinylated targets amplified by
single or multiplex PCR assays could be analyzed with
the Luminex technology, potentially able to simultaneously
detect up to 500 different targets in one sample using
spectrally distinct sets of beads that are independently
coupled to unique nucleic acid probes. After hybridization
of biotinylated oligonucleotides to corresponding probe-
bead complexes, the reader device individually analyzes each
microsphere by flow cytometry in applying a laser excitation
of 635 nm and 532 nm allowing, respectively, identifying the
bead set and determining the presence or absence of the
target (Figure 1) [140]. This technology was firstly assessed
in GMO detection by Fantozzi et al., 2008 (Table 6). In this
study, the p35S and EPSPS elements, earlier individually
amplified by PCR from the GTS-40-3-2 soybean event,
were simultaneously detected [65]. Afterwards, the GM
stacked LS28 × Cry1Ac rice and 281-24-236 × 3006-210-23
cotton events were identified on the Luminex platform using
upstream, respectively, a pentaplex PCR or a hexaplex PCR
(Table 6) [67, 68]. This technology was also used to detect ten
GM maize events through four sets of multiplex PCR assays
(Table 6) [66]. Similarly, a liquid bead array approach allow-
ing identifying thirteen GM maize was recently developed
[141].
Due to its potential high throughput, the Luminex
technology seems to be a promising alternative in GMO
10
Table 6: Representative examples illustrating Luminex strategies targeting GMO.
Multiplexing Methods
Simplex Element-specific
Taxon-specific
Triplex
Event-specific
Tetraplex Event-specific
Tetraplex Event-specific
Taxon-specific
Pentaplex
Element-specific
Taxon-specific
Hexaplex Element-specific
Event-specific
CP4-EPSPS (5-enolpyruvylshikimate-3-phosphate synthase gene from Agrobacterium tumefaciens strain); Cry (gene encoding the Bacillus thuringiensis 𝛿-
endotoxin); LS28 (choline kinase); p35S (promoter of the 35 S cauliflower mosaic virus) SAD1 (stearoyl-acyl carrier protein desaturase gene from cotton);
SPS (sucrose phosphate synthase gene from rice); tNOS (terminator of the nopaline synthase gene); tORF23 (open reading frame 23 terminator from A.
tumefaciens); Zein (Zein gene from maize).
detection. Moreover, the liquid bead array is considered as
more sensitive and faster than the microarray system [67].
Nevertheless, the drawback linked to the PCR complicates the
setting of a unique multiplex assay targeting simultaneously
all GM events. Furthermore, as only few studies using this
technology in GMO detection have been reported to date,
experiments have still to be carried out in order to provide
effective and validated systems.
2.3. Digital PCR Technology. To resolve difficulties observed
during the relative quantification step in qPCR, especially
when the copy numbers of GMO are low and/or PCR
inhibitors are present, the digital PCR (dPCR) technology
has been tested in GMO detection (Figure 1). Based on the
binomial Poisson statistics, each partition of the fractionated
sample is determined as positive (amplified target observed)
or negative (no amplified target observed) by the dPCR
technology allowing absolutely quantifying the number of
nucleic acid targets from GMO present in any given sample.
Two approaches of this end-point PCR system have up till
now been used for this aim (Table 7). On the one hand, the
chamber dPCR (cdPCR), partitioning the sample in several
thousands of microfluidic chambers, was used to target GM
maize MON810 event using a duplex PCR composed of the
MON810 event-specific and maize taxon-specific methods.
The detection limits of this approach were also investigated
[72–74]. Moreover, a strategy based on the cdPCR system was
developed in order to cover a wide range of GMO by applying
individually twenty-eight element-specific, thirty-six event-
specific, and five taxon-specific methods (Table 7) [69].
Afterwards, this strategy was applied with forty-eight mark-
ers, including seven transgenic elements-specific, fourteen
event-specific, and five taxon-specific methods (Table 7) [70].
On the other hand, the droplet dPCR (ddPCR) approach,
implying several thousands of droplets generated by a water-
oil emulsion, was used in simplex or duplex PCR with the
MON810 event-specific and maize taxon-specific methods
[71]. Most recently, duplex assays, including one GMO-
specific marker with one soybean, maize, or rice taxon-
specific marker, were performed by using the ddPCR system
BioMed Research International
Targets References
p35S and CP4-EPSPS [65]
Zein [66]
MIR604 and MON88017
Bt176, MON810, NK603, and GA21 [66]
Bt11, T25, MIR162, and MON89034 [66]
SPS [67]
Cry1Ac, tNOS, p35S, and LS28
SAD1
Cry1Ac, Cry1F, and pat [68]
281-24-236 and 3006-210-23
to quantify twelve GM soybean, sixteen GM maize, and two
GM rice events (Table 7) [48, 75].
The dPCR technology could become a key tool in the
field of GMO detection, mainly because an absolute, and
not relative as in qPCR, quantification of the GM target is
provided. The measurement does not require necessarily the
use of reference material, solving issues related to the avail-
ability of an optimal reference material. Moreover, thanks
to the partitioning of the sample, the PCR efficiency is less
affected by the presence of inhibitors and allows reducing
the uncertainty in the measurement, especially at low copy
number, as observed with qPCR calibration curves generated
by serial dilutions of the target. However, validated qPCR
methods are not always simply transferable to the dPCR
technology. Indeed, some optimization has to be carried out
regarding, for instance, the design and the concentrations
of primers and probes. In addition, given that maximum
two different targets could be identified in one well, the low
throughput power of the dPCR technology highlights its
applicability more suitable at the identification/quantification
level than at the screening step [48, 71, 75, 142].
2.4. Loop-Mediated Isothermal Amplification. Due to its
rapidity, specificity, sensitivity, and simplicity, the loop-
mediated isothermal amplification (LAMP) method has been
proposed to detect GMO (Figure 1). To this end, four primers
specific to six distinct regions of the target are required,
allowing, under isothermal condition, initiating the reaction
and increasing the amplification speed by the formation
of a loop structure. The amplification can be then directly
visualized in the tube thanks to fluorescent dyes. Several
LAMP markers were thus developed for this approach to
target transgenic elements (Table 8) [76–91, 143].
The LAMP strategy presents the advantage to tolerate
several PCR inhibitors such as acidic polysaccharides [84].
Its implementation does also not require any sophisticate
devices. Indeed, the amplification could be carried out using
a water bath or heating block [90]. Some of the developed
LAMP methods have besides been successfully tested in
BioMed Research International 11

Table 7: Representative examples illustrating digital PCR strategies targeting GMO.

Multiplexing Techniques Methods Targets References

Taxon-specific HMG, LEC, GLU, and CRU
Element-specific p35S, tNOS, Cry1Ab, Cry1F, bar, CP4-EPSPS, Cry3Bb, nptII, Cry1A.105,
and Cry2Bb
MON531, MON88913, MON1445, MON15985, LLCOTTON25, GHB614,
Simplex cdPCR
3272, DAS-59122-7, Bt176, Bt11, GA21, MIR162, MIR604, MON810, [69]
Event-specific MON863, MON88017, MON89034, NK603, T25, TC1507, Ms1,
Topas19/2, OXY 235, Ms8, Rf3, GT73, T45, GTS40-3-2, A2704-12,
MON89788, MON87701, DP-356043-5, A5547-127, BPS-CV-127,
DP-305423-1, and TT51-1
Taxon-specific ADH, CRU, PLD, LEC, and adhC
Element-specific p35S, pFMV, tNOS, Cry1Ab, bar, pat, and nptII
Simplex cdPCR [70]
Event-specific 3272, Bt11, GA21, MON89034, MON810, MIR604, MON88017, TC1507,
Bt176, GTS40-3-1, DP-305423-1, DP-356043-5, H7-1, and GT73
Taxon-specific HMG
Simplex ddPCR [71]
Event-specific MON810
Taxon-specific HMG
Duplex cdPCR [72–74]
Event-specific MON810
Taxon-specific LEC
Duplex ddPCR DP-356043-5, DP-305423-1, MON89788, GTS40-3-2, A5547-127,
Event-specific [48, 75]
BPS-CV-127, A2704-12, MON87701, MON87708, MON87705, FG72,
and MON87769
Taxon-specific PLD
Duplex ddPCR [75]
Event-specific LLRICE62 and KMD1
Taxon-specific HMG
Bt176, Bt11, MON810, NK603, Starllink, MON863, GA21, DAS-59122-7,
Duplex ddPCR [75]
Event-specific MIR162, MIR604, 3272, T25, TC1507, MON88017, MON89034, and
DAS-40278-9
Taxon-specific HMG
Duplex ddPCR [71]
Event-specific MON810
ADH (alcohol dehydrogenase I gene from maize); adhC (alcohol dehydrogenase C gene from cotton); bar (phosphinothricin-N-acetyltransferases gene from
Streptomyces hygroscopicus); CP4-EPSPS (5-enolpyruvylshikimate-3-phosphate synthase gene from Agrobacterium tumefaciens strain); CRU (cruciferin gene
from colza); Cry (gene encoding the Bacillus thuringiensis 𝛿-endotoxin); GLU (glutamine synthetase gene from sugar beet); HMG (major high-mobility group
protein gene from maize); LEC (lectin gene from soybean); nptII (neomycin phosphotransferase II gene); p35S (promoter of the 35 S cauliflower mosaic virus);
pat (phosphinothricin-N-acetyltransferases gene from Streptomyces viridochromogenes); pFMV (promoter of the figwort mosaic virus); phy (phytase gene from
maize); PLD (phospholipase D gene from rice); pNOS (promoter of the nopaline synthase gene); tNOS (terminator of the nopaline synthase gene).

the fields [84]. Concerning the drawbacks, the design of four
primers per target, which guarantee the high specificity and
sensitivity of the LAMP, could be difficult. In addition, the
identification of several GM targets using a multiplex assay is
not applicable [28].
2.5. DNA Walking. In using PCR-based methods that
required prior knowledge, the observed results are mostly
generated in targeting elements derived from natural organ-
isms. Therefore, they constitute merely an indirect proof of
the presence of GMO in the tested food/feed matrices. In
addition, when the observed signals do not correspond to
known GMO, the presence of unknown GMO, containing at
least one known element, could be only suspected. The only
way to indubitably confirm the presence of GMO is provided
by the characterization of sequences from the junctions
between the transgenic cassette and the plant genome as well
as the unnatural associations of transgenic elements.
To get this crucial information, several strategies of DNA
walking, also called genome walking, have been reported
(Figure 1 and Table 9). More precisely, this molecular tech-
nique allows identifying unknown nucleotide sequences
adjacent to already known DNA regions in any given genome
using specific primers to the known sequence combined to
primers dictated by the DNA walking method used. Then,
the final PCR products are usually sequenced by Sanger
technology to be eventually analyzed with available databases
(e.g., NCBI and JRC GMO-Amplicons). Classically, three
main categories of DNA walking are established, based on the
characteristics of their first step [144].
First, the restriction-based methods involve a digestion of
the genomic DNA using appropriate restriction enzymes tar-
geting sites close to sequences of interest, such as the junction
between the known and unknown sequences. The obtained
restriction fragments are then either self-circularized or
ligated to DNA cassettes, named, respectively, inverted-PCR
12 BioMed Research International

Table 8: Representative examples illustrating simplex LAMP strate- and unnatural associations from transgenic Arabidopsis
gies targeting GMO. thaliana, tobacco, shallot, potato, barley, grapefruit, tomato,
banana, cotton (MON1445), colza (including GT73), soybean
Methods Targets References
(GTS40-3-2 and MON89788), wheat (B73-6-1, B72-8-11, and
ADH [76] B72-8-11b), rice (including TC-19, Bt Shanyou 63 (TT51-
LEC [77, 78] 1), KeFeng-6, and KeFeng-8), and maize (CHB-351, Bt176,
Taxon-specific
PLD [79] GA21, Bt11, MON88017, MON863 × NK603, MON863 ×
IVR [80] NK603 × MON810, T25, MON810, NK603, MON863, T25,
p35S [76, 81–86]
DAS-59122-7, LY038, and 3272) were characterized (Table 9)
[92–108, 145–168].
pFMV [83, 86]
Second, the extension-based methods are defined by
aadA [83] the extension of a sequence-specific primer. The resulting
uidA [83] single-stranded DNA is subsequently ligated to either a DNA
nptII [83, 86] cassette or 3󸀠 -tailing ([144] and references therein). This
Cry1Ab [87] strategy was successfully applied on GM maize (MON810),
tNOS [76, 78, 82, 84, 86]
rice (LLRICE62), soybean (A2704-12), rapeseed (T45), and
Element-specific cotton (LLCOTTON25) events in order to characterize their
pNOS [82]
transgenic cassettes and transgene flanking regions (Table 9)
bar [84, 86] [109, 110].
pat [86] Third, the primer-based methods combine combinato-
Cry1Ac [86] rial (random and/or degenerate) primers to target-specific
CP4-EPSPS [86] primers according to various PCR strategies ([144] and refer-
Cry2A [88]
ences therein). The transgenic Arabidopsis thaliana, tobacco,
potato, barley, apple, banana, soybean, wheat (B73-6-1),
Cry3A [88]
rice (including KeFeng-6 and KMD1), and maize (includ-
phy [89] ing MON863 and MIR162) were thereby identified via the
Construct-specific p35S/EPSPS [82] sequences of their transgene flanking regions and unnatural
Ms8 [82] associations of elements (Table 9) [111–116, 152, 154, 157, 169–
Rf3 [82] 174].
However, the implementation of most of these DNA
MON89788 [77, 78, 84]
walking methods by the enforcement laboratories presents
GTS 40-3-2 [77, 78, 84] some difficulties such as an insufficient specificity, sensitivity,
DAS-59122-7 [80, 84] or yield. Moreover, some of them use laborious, complex,
MON863 [80, 84] and lengthy techniques (e.g., fingerprinting by capillary
TC1507 [80, 84] electrophoresis and genomic DNA library via (unpredictable)
Event-specific restriction enzyme). Therefore, a DNA walking approach,
T25 [80, 90]
corresponding better to the need of enforcement labora-
Bt11 [80]
tories, has been developed and validated on unprocessed
Bt176 [80] and processed food matrices containing minute amounts of
MON810 [80] GM targets. As this DNA walking approach implies two
B73-6-1 [91] seminested PCR rounds, the yield and the specificity of
KMD1 [79] GM targets are increased, especially crucial in case of a
Kefeng-6 [79] low level presence of GMO. This approach, belonging to
the PCR-based method category, has also the advantage to
TT51-1 [79]
be fully integrated into the GMO routine analysis as the
aadA (aminoglycoside 3󸀠 -adenylyltransferase); ACC (acetyl-CoA- similar primers are used for the qPCR screening (detection
carboxylase gene from colza); ADH (alcohol dehydrogenase I gene from
maize); bar (phosphinothricin-N-acetyltransferases gene from Streptomyces
of potential GMO presence) and the DNA walking (GMO
hygroscopicus); CP4-EPSPS (5-enolpyruvylshikimate-3-phosphate synthase identification). So, this simple and rapid approach could
gene from Agrobacterium tumefaciens strain); Cry (gene encoding the easily be applied by the enforcement laboratories, without any
Bacillus thuringiensis 𝛿-endotoxin); IVR (invertase gene from maize); LEC significant additional cost and equipment, to confirm signals
(lectin gene from soybean); nptII (neomycin phosphotransferase II gene); previously obtained in qPCR (Table 9) [33, 117, 118].
p35S (promoter of the 35 S cauliflower mosaic virus); pat (phosphinothricin-
N-acetyltransferases gene from Streptomyces viridochromogenes); pFMV
Since DNA walking requires less prior knowledge about
(promoter of the figwort mosaic virus); phy (phytase gene from maize); the sequence of interest than conventional PCR-based meth-
PLD (phospholipase D gene from rice); pNOS (promoter of the nopaline ods previously described, GMO with entirely or partially
synthase gene); tNOS (terminator of the nopaline synthase gene); uidA known sequences could be characterized. Therefore, in tar-
(𝛽-glucuronidase). geting key elements, such as p35S and tNOS that are highly
frequent in GM crops, a broad range of GMO could be
and cassette PCR methods ([144] and references therein). characterized [96, 106, 110, 111, 113, 118, 156]. In order to
By this way, several sequences of transgene flanking regions especially identify unauthorized GMO in European Union, a
BioMed Research International 13

Table 9: Representative examples illustrating DNA walking strategies targeting GMO.

DNA walking approaches Characterized regions Targets References

Restriction-based methods
Inverse PCR Transgene flanking regions Bt11 [92, 93]
Transgene flanking regions GTS40-3-2 [94]
Transgene flanking regions GT73 [95]
Transgene flanking regions MON1445 [96]
Transgene flanking regions TC-19 [97]
Transgene flanking regions TT51-1 [98]
Transgene flanking regions KeFeng-6 [99]
Transgene flanking regions KeFeng-8 [100]
Transgene flanking regions B73-6-1 [101]
Transgene flanking regions B72-8-11 [102]
Transgene flanking regions B72-8-11b [103]
Transgene flanking regions LY038 [104]
Cassette PCR Transgene flanking regions MON89788 [104]
Transgene flanking regions 3272 [104]
Transgene flanking regions and unnatural element associations CHB-351 [105, 106]
Transgene flanking regions and unnatural element associations Bt176 [95, 106]
Transgene flanking regions and unnatural element associations GA21 [95, 106]
Transgene flanking regions and unnatural element associations Bt11 [95, 106]
Transgene flanking regions and unnatural element associations T25 [106, 107]
Transgene flanking regions and unnatural element associations MON810 [106, 108]
Transgene flanking regions and unnatural element associations DAS-59122-7 [104, 106]
Unnatural element associations MON88017 [106]
Unnatural element associations MON863 × NK603 [106]
Unnatural element associations MON863 × NK603 × [106]
Unnatural element associations MON810
Unnatural element associations NK603 [106]
Unnatural element associations MON863 [106]
Extension-based methods
Transgene flanking regions and unnatural element associations MON810 [109, 110]
Transgene flanking regions and unnatural element associations LLRICE62 [109, 110]
LT-RADE Transgene flanking regions and unnatural element associations T45 [110]
Transgene flanking regions and unnatural element associations A2704-12 [110]
Transgene flanking regions and unnatural element associations LLCOTTON25 [110]
PCR-based methods
Transgene flanking regions MON863 [111, 112]
TAIL-PCR Transgene flanking regions KeFeng-6 [113]
Transgene flanking regions B73-6-1 [114]
Transgene flanking regions KMD1 [115]
SiteFinding PCR
Unnatural element associations MIR162 [116]
APAgene GOLD Genome Transgene flanking regions and unnatural element associations Bt rice [33, 117, 118]
Walking Kit Transgene flanking regions and unnatural element associations MON863 [118]

DNA walking approach using primers specific to the element
t35S from the pCAMBIA vector, found in approximately 30%
of transgenic plants, was developed [33, 117]. However, the
DNA walking strategy is not suitable to GMO containing only
unknown elements.
2.6. Next Generation Sequencing Technologies. Despite their
higher throughput compared to qPCR, the multiplex strate-
gies described above require the prior knowledge of at least
a part of the GMO sequences. Once the information about
these sequences is collected, the development of methods,
14 BioMed Research International

Table 10: Representative examples illustrating NGS strategies targeting GMO.

NGS strategies NGS platforms Targets Target sizes References

HiSeq (Illumina) vip3Aa2 from MIR162 150 bp to 2 Kbp [116]
PacBio RS (Pacific Biosciences) vip3Aa2 from MIR162 150 bp to 2 Kbp [116]
454 system (Roche Applied Science) ssIIb 157 bp [119]
454 system (Roche Applied Science) Bt11 gene 324 bp [119]
454 system (Roche Applied Science) Bt176 gene 206 bp [119]
Targeted sequencing
454 system (Roche Applied Science) LEC 118 bp [119]
454 system (Roche Applied Science) p35S/CTP4 171 bp [119]
454 system (Roche Applied Science) CP4-EPSPS 498 bp [119]
454 system (Roche Applied Science) p35S 195 bp [119]
454 system (Roche Applied Science) tNOS 180 bp [119]
HiSeq (Illumina) MON17903 soybean 1115 Mbp [120]
HiSeq (Illumina) MON87704 soybean 1115 Mbp [120]
HiSeq (Illumina) FP967 flax 373 Mbp [121]
Whole genome sequencing HiSeq (Illumina) LLRICE62 rice 385 Mbp [122]
HiSeq (Illumina) TT51-1 rice 385 Mbp [123]
HiSeq (Illumina) T1c-19 rice 385 Mbp [123]
HiSeq (Illumina) Bt rice 385 Mbp [124]
CP4-EPSPS (5-enolpyruvylshikimate-3-phosphate synthase gene from Agrobacterium tumefaciens strain); CTP4 (chloroplast transit peptide 4 from the
Arabidopsis thaliana epsps gene); LEC (lectin gene from soybean); p35S (promoter of the 35 S cauliflower mosaic virus); ssIIb (starch synthase IIb gene from
maize); tNOS (terminator of the nopaline synthase gene); VIP3A (vegetative insecticidal protein 3A).

each one targeting indivdually one sequence of interest, is
carried out on a case-by-case basis. Then, the optimisation
of unbiased multiplex assays presenting equal analytical
performance compared to simplex assays remains laborious
and intricate. Furthermore, the issues related to the detection
of GMO containing no known sequences are still unsolved.
Recently, NGS, allowing a massive parallel DNA sequencing,
has been suggested to tackle these challenges. The NGS tech-
nology outperforms plainly the classical Sanger sequencing
in terms of rapidity and throughput. Indeed, the powerful
high throughput of NGS offers the possibility to sequence
simultaneously many different samples, discriminable in
using a wide range of barcodes [116, 124, 175]. Two main
strategies, sequencing samples that are earlier enriched with
sequences of interest (targeted sequencing approach) or not
(whole genome sequencing (WGS) approach), exist (Figure 1
and Table 10).
2.6.1. Targeted Sequencing. The targeted sequencing strategy
is especially beneficial to target regions of interest from large
and complex genomes, observed in most of plants. Even if
a minimum of prior knowledge on sequences is needed to
target the sequences of interest, it presents the advantage to
use exclusively all the energy, in terms of time and cost, on
the regions of interest. With this strategy, two substrategies
could be used, involving the sequencing of either DNA library
of PCR products (amplicon sequencing) or selected DNA
fragments from a whole genome library (target enrichment
sequencing) (Figure 1).
On the one hand, as the amplicon sequencing allows char-
acterizing DNA fragments of interest previously enriched
by PCR, this sequencing approach depends thus clearly on
the PCR strategy adopted upstream as well as its inherent
properties and performance. In order to detect GMO, Song et
al., 2014 generated amplicons by PCR, using primers targeting
maize endogen gene, Bt11 gene, Bt176 gene, soybean endo-
gen gene, 35S/CTP4 construct, CP4-EPSPS element, p35S
promoter, and tNOS terminator, from samples containing a
low amount of GM targets (1% of Bt11 maize, 2% of Bt176
maize, 2% of GTS40-3-2 soybean, 1% of GTS40-3-2 soybean,
0.1% of GTS40-3-2 soybean, or 0.01% of GTS40-3-2 soybean).
Then, each kind of amplicons was individually sequenced
using a variant of the 454 system called pyrosequencing on
portable photodiode-based bioluminescence sequencer that
is more sensitive, compact, and cost-efficient compared to
the original 454 technology (Roche) (Table 10) [119, 176]. This
approach is relatively similar to the PCR screening with the
additional value to provide, instead of positive or negative
signals, the sequence of the amplified fragments, which is
more reliable to prove the presence of GMO. Conversely
to this approach, Liang et al., 2014 suggest an amplicon
sequencing strategy allowing analyzing GMO for which the
sequence information is only partially known. To this end,
a DNA walking method (SiteFinding PCR), targeting the
vip3Aa20 sequence, was coupled to NGS technologies, using
the Illumina or Pacific Biosciences platforms, to characterize
the sequences of the MIR162 maize event (Table 10). Even
if the results were similar using the two different NGS plat-
forms, the PacBio system shows the advantage to sequence
DNA fragments with a size reaching up to 40 Kbp and to deal
with DNA fragments presenting different sizes. Therefore, the
PacBio system, in contrast to the Illumina technology, allows
in many cases avoiding a de novo assembly step as the shear-
ing of genomic DNA is not always required. Moreover, the use
of NGS instead of the Sanger technology allows considerably
BioMed Research International
increasing the throughput of DNA walking approaches.
Indeed, in order to guarantee the entire representativeness
of GMO present in a tested sample, all observed amplicons
should be analyzed. However, the purification of the potential
numerous amplicons excised from the electrophoresis gel and
the subsequent Sanger sequencing could be cumbersome,
especially in case of food/feed matrices containing several
GMO sharing common targeted elements [116, 118, 177].
On the other hand, the target enrichment sequencing
approach involves the selection of sequences of interest from
the whole genome DNA library. To capture them, appropriate
hybridization methods could be used relying on magnetic
beads or microarrays associated with specific probes. The
efficiency of the hybridization step is thus crucial for this
sequencing strategy. The DNA fragments containing entirely
or partially the known regions could be then sequenced.
However, even if this strategy has been applied to different
plants, no study has to date been reported to our knowledge
to detect GMO [178–181].
The analysis of preenriched DNA fragments of inter-
est with NGS technology allows proving the presence of
GMO in characterizing sequences entirely or partially known
beforehand. However, given its relative high cost, expected to
decrease over the time, and the prerequisite bioinformatics
expertise, the targeted NGS strategy could not reasonably be
currently applied routinely to all food/feed matrices by the
enforcement laboratories [116, 124, 175].
2.6.2. Whole Genome Sequencing. The WGS strategy allows
in principle characterizing a sample without any prior knowl-
edge (Figure 1). With this sequencing strategy, the entire
DNA library, consisting of sheared genomic DNA ligated to
adaptors, is sequenced. The generated reads are then treated
with bioinformatics tools based on prior knowledge of tested
GMO.
First, when no information about the transgenic cassette
is available, the insert and its transgene flanking regions
are identified by the analysis of all inferred contigs derived
from reads that partially matched or unmatched with the
endogenous plant-species reference genome [123]. This WGS
strategy was applied on the LLRICE62 event by using the
available reference genome of Oryza sativa ssp. Japonica.
As the results corresponded to the information from the
developer dossier, the characterization of GMO with an
unknown insert using NGS was thus demonstrated (Table 10)
[122]. Similarly, the T-DNA regions from the GM flax FP967
event and the transgenic rice TT51-1 and T1c-19 events were
also characterized (Table 10) [121, 123]. The success of this
strategy is thus linked to the availability of good reference
genomes for specific varieties and organisms. In case of no
reference genome available, a strategy of de novo assembly,
comparing all generated reads to find overlaps, has to be
applied. However, this remains quite cumbersome with the
large and complex plant genomes notably in terms of ploidy,
repeated regions, and heterozygosity and with mixtures of
different GMO [120, 182]. To facilitate even so the de novo
assembly, the strength of different NGS platforms can be
associated. For instance, short reads from Illumina technol-
ogy can be aligned to long reads generated by the PacBio
15
technology, constituting a substitute of reference genome
[183].
Second, with the condition that the sequence of at least
one transgenic element is known, the insert is de novo
assembled with reads that are matched and unmatched with
a DNA transgene sequence library containing frequently
used transgenic elements. This approach was tested on the
transgenic rice TT51-1 and T1c-19 events (Table 10) [123].
Third, if the sequence of the insert is known, two kinds
of bioinformatics analysis have been reported. On the one
hand, the reads, corresponding not entirely to the reference
genome, are mapped to the transgenic cassette sequence in
order to determine the number of inserts and their transgene
flanking regions. By this way, the GM rice TT51-1 and T1c-
19 events and the GM soybean MON17903 and MON87704
events were characterized (Table 10) [120, 123]. On the other
hand, Willems et al., 2016 have developed an analytical
workflow, including three different approaches. The detection
approach, consisting of comparing the reads to the reference
sequence of the insert, allows detecting the presence of
GMO in a given sample. To confirm the integration of the
transgenic cassette and provide a rough localization of its
flanking regions, the matched reads are then compared to the
reference sequence of the host genome in the proof approach.
By the simultaneous aligning of these selected reads to the
host genome and the transgenic cassette, the identification
approach allows determining precisely the localization of the
transgenic cassette and the sequence of its flanking regions.
This WGS strategy was initially assessed on pure transgenic
GM rice (100% Bt rice). Conversely to all the other WGS
strategies described above, food/feed matrices more likely to
be encountered in GMO routine analysis, such as a GM/non-
GM rice mixture (10% Bt rice) and a processed GM rice
(100% Bt noodles), have also been tested (Table 10) [124]. In
this study, a statistical framework, predicting the probability
to detect a sequence derived from a transgenic cassette and
validated with experimental data originated from WGS, was
also developed to estimate in silico the number of reads,
derived from Illumina HiSeq device, required to characterize
frequently encountered GMO. It was shown that samples
composed of GMO at 100%, except for GM wheat owning
a huge genome, could be wisely characterized at a standard
price range. A contrario, the detection, and identification of
GMO present at trace level are not reasonably achievable
by WGS [124]. Therefore, at the present time, only the
previously described targeted sequencing approach can be
applied on GM mixture containing GMO at trace level within
reason.
The NGS technology is thus a promising alternative
in the GMO detection field which offers the possibility to
prove straightforward the presence of GMO in food/feed
matrix via the characterization of their sequences. Moreover,
the sequences obtained from unknown GMO will allow
designing new PCR markers. Nevertheless, the implemen-
tation of NGS in GMO routine analysis by the enforcement
laboratories is still difficult due to its relatively high cost as
well as the requirement of adequate computer infrastructures
and qualified analysts in bioinformatics for dealing with the
generated data [116, 124, 175].
16
3. Conclusion
In GMO routine analysis, qPCR remains the method of
choice for the enforcement laboratories. However, as some
technical hurdles could be encountered with this technology,
alternative GMO detection methods have been developed to
raise some of these challenges. In order to exploit at best
the performance of all the above described strategies, their
applicability could be considered according to the adopted
strategy of GMO detection as well as the available informa-
tion about the sequences of tested GMO (Figure 1). In case of
fully characterized GMO, the methods based on conventional
PCR are absolutely appropriate to rapidly detect individually
GM targets low-prized (LAMP), to simultaneously detect
several GM targets (CGE, microarray, and Luminex) or to
precisely quantify the amount of GM targets without impact
of inhibitors (dPCR). However, when tested matrices contain
GMO for which only a part of their sequences is known,
these strategies could generate unexplained signals for which
the observed positive signals could not be related to known
GM events. In targeting key DNA sequences, such as the
elements p35S and tNOS that are frequently found in GM
plants, the use of DNA walking or targeted sequencing
by enrichment strategies allows indubitably confirming the
presence of GMO via the sequences of transgenes flanking
regions and unnatural associations of genetic elements. If no
information is available, at this moment, only the WGS is
conceivable to characterize this category of GMO.
Conflict of Interests
The authors declare that they have no competing interests.
Acknowledgment
The research that yielded these results was funded by the
Belgian Federal Public Service of Health, Food Chain Safety
and Environment through the contact UGMMONITOR
(convention RF 11/6242).
References
[1] C. James, “Global status of commercialized biotech/GM crops:
2014,” ISAAA Brief 49, 2014.
[2] Cartagena Protocol on Biosafety, http://bch.cbd.int/protocol/.
[3] S. Kamle and S. Ali, “Genetically modified crops: detection
strategies and biosafety issues,” Gene, vol. 522, no. 2, pp. 123–
132, 2013.
[4] G. J. Rogan, Y. A. Dudin, T. C. Lee et al., “Immunodiagnostic
methods for detection of 5-enolpyruvylshikimate-3-phosphate
synthase in Roundup Ready soybeans,” Food Control, vol. 10, no.
6, pp. 407–414, 1999.
[5] M. J. McKenzie, V. Mett, and P. E. Jameson, “Modified ELISA for
the detection of neomycin phosphotransferase ii in transformed
plant species,” Plant Cell Reports, vol. 19, no. 3, pp. 286–289,
2000.
[6] M. Lipp, E. Anklam, J. W. Stave et al., “Validation of an
immunoassay for detection and quantitation of a genetically
modified soybean in food and food fractions using reference
BioMed Research International
materials: interlaboratory study,” Journal of AOAC Interna-
tional, vol. 83, no. 4, pp. 919–927, 2000.
[7] C. R. Lipton, J. X. Dautlick, G. D. Grothaus et al., “Guidelines
for the validation and use of immunoassays for determination
of introduced proteins in biotechnology enhanced crops and
derived food ingredients,” Food and Agricultural Immunology,
vol. 12, no. 2, pp. 153–164, 2000.
[8] J. Fagan, B. Schoel, A. Haegert, J. Moore, and J. Beeby, “Perfor-
mance assessment under field conditions of a rapid immunolog-
ical test for transgenic soybeans,” International Journal of Food
Science and Technology, vol. 36, no. 4, pp. 357–367, 2001.
[9] E. Anklam, F. Gadani, P. Heinze, H. Pijnenburg, and G. Van
Den Eede, “Analytical methods for detection and determination
of genetically modified organisms in agricultural crops and
plant-derived food products,” European Food Research and
Technology, vol. 214, no. 1, pp. 3–26, 2002.
[10] J. W. Stave, “Protein immunoassay methods for detection of
biotech crops: applications, limitations, and practical considera-
tions,” Journal of AOAC International, vol. 85, no. 3, pp. 780–786,
2002.
[11] W. T. Xu, K. L. Huang, H. Zhao, and Y. B. Luo, “Application of
immunoaffinity column as cleanup tool for an enzyme linked
immunosorbent assay of phosphinothricin-N-acetyltransferase
detection in genetically modified maize and rape,” Journal of
Agricultural and Food Chemistry, vol. 53, no. 11, pp. 4315–4321,
2005.
[12] M. Ermolli, A. Fantozzi, M. Marini et al., “Food safety:
screening tests used to detect and quantify GMO proteins,”
Accreditation and Quality Assurance, vol. 11, no. 1-2, pp. 55–57,
2006.
[13] K. R. Emslie, L. Whaites, K. R. Griffiths, and E. J. Murby,
“Sampling plan and test protocol for the semiquantitative
detection of genetically modified canola (Brassica napus) seed
in bulk canola seed,” Journal of Agricultural and Food Chemistry,
vol. 55, no. 11, pp. 4414–4421, 2007.
[14] G. Shan, S. K. Embrey, and B. W. Schafer, “A highly spe-
cific enzyme-linked immunosorbent assay for the detection
of Cry1Ac insecticidal crystal protein in transgenic widestrike
cotton,” Journal of Agricultural and Food Chemistry, vol. 55, no.
15, pp. 5974–5979, 2007.
[15] C. Giovannoli, L. Anfossi, C. Baggiani, and G. Giraudi, “Binding
properties of a monoclonal antibody against the Cry1Ab from
Bacillus thuringensis for the development of a capillary elec-
trophoresis competitive immunoassay,” Analytical and Bioana-
lytical Chemistry, vol. 392, no. 3, pp. 385–393, 2008.
[16] D. S. Smith, P. W. Maxwell, and S. H. De Boer, “Evaluation
of neomycin phosphotransferase II and Cry3A as targets for
the serological detection of transgenic potato tubers,” American
Journal of Potato Research, vol. 85, no. 1, pp. 60–68, 2008.
[17] W. Xu, K. Huang, Z. Liang et al., “Application of stepwise
ammonium sulfate precipitation as cleanup tool for an enzyme-
linked immunosorbent assay of glyphosate oxidoreductase in
genetically modified rape of gt73,” Journal of Food Biochemistry,
vol. 33, no. 5, pp. 630–648, 2009.
[18] A. Székács, É. Lauber, E. Takács, and B. Darvas, “Detection
of Cry1Ab toxin in the leaves of MON 810 transgenic maize,”
Analytical and Bioanalytical Chemistry, vol. 396, no. 6, pp. 2203–
2211, 2010.
[19] S. Kamle, A. Ojha, and A. Kumar, “Development of an enzyme
linked immunosorbant assay for the detection of Cry2Ab
protein in transgenic plants,” GM Crops, vol. 2, no. 2, pp. 118–
125, 2011.
BioMed Research International
[20] X. Zhu, L. Chen, P. Shen, J. Jia, D. Zhang, and L. Yang, “High
sensitive detection of Cry1Ab protein using a quantum dot-
based fluorescence-linked immunosorbent assay,” Journal of
Agricultural and Food Chemistry, vol. 59, no. 6, pp. 2184–2189,
2011.
[21] G. Y. Tan, T. G. Nan, W. Gao, Q. X. Li, J. J. Cui, and B. M.
Wang, “Development of monoclonal antibody-based sensitive
sandwich ELISA for the detection of antinutritional factor
cowpea trypsin inhibitor,” Food Analytical Methods, vol. 6, no.
2, pp. 614–620, 2013.
[22] H.-J. Jang, I.-H. Cho, H.-S. Kim, J.-W. Jeon, S.-Y. Hwang, and S.-
H. Paek, “Development of a chemiluminometric immunosen-
sor array for on-site monitoring of genetically modified organ-
isms,” Sensors and Actuators, B: Chemical, vol. 155, no. 2, pp.
598–605, 2011.
[23] R. C. Allen, S. Rogelj, S. E. Cordova, and T. L. Kieft,
“An immuno-PCR method for detecting Bacillus thuringiensis
Cry1Ac toxin,” Journal of Immunological Methods, vol. 308, no.
1-2, pp. 109–115, 2006.
[24] S. Santiago-Felipe, L. A. Tortajada-Genaro, R. Puchades, and
A. Maquieira, “Recombinase polymerase and enzyme-linked
immunosorbent assay as a DNA amplification-detection strat-
egy for food analysis,” Analytica Chimica Acta, vol. 811, pp. 81–87,
2014.
[25] V. Garcı́a-Cañas, C. Simó, C. León, E. Ibáñez, and A. Cifuentes,
“MS-based analytical methodologies to characterize genetically
modified crops,” Mass Spectrometry Reviews, vol. 30, no. 3, pp.
396–416, 2011.
[26] D. Morisset, D. Stebih, K. Cankar, J. Zel, and K. Gruden,
“Alternative DNA amplification methods to PCR and their
application in GMO detection: a review,” European Food
Research and Technology, vol. 227, no. 5, pp. 1287–1297, 2008.
[27] M. Mazzara, C. Paoletti, P. Corbisier et al., “Kernel lot distri-
bution assessment (KeLDA): a comparative study of protein
and DNA-based detection methods for GMO Testing,” Food
Analytical Methods, vol. 6, no. 1, pp. 210–220, 2013.
[28] A. Angers-Loustau, M. Petrillo, L. Bonfini et al., “JRC GMO-
Matrix: a web application to support genetically modified
organisms detection strategies,” BMC Bioinformatics, vol. 15,
article 417, 2014.
[29] E. Navarro, G. Serrano-Heras, M. Castaño, and J. Solera, “Real-
time PCR detection chemistry,” Clinica Chimica Acta, vol. 439,
pp. 231–250, 2015.
[30] S. Broeders, N. Papazova, M. Van den Bulcke, and N. Roosens,
“Development of a molecular platform for GMO detection in
food and feed on the basis of ‘combinatory qPCR’ technology,”
in Polymerase Chain Reaction, chapter 18, pp. 363–404, InTech,
Rijeka, Croatia, 2012.
[31] E. Barbau-Piednoir, A. Lievens, G. Mbongolo-Mbella et al.,
“SYBR Green qPCR screening methods for the presence of ‘35S
promoter’ and ‘NOS terminator’ elements in food and feed
products,” European Food Research and Technology, vol. 230, no.
3, pp. 383–393, 2010.
[32] S. R. M. Broeders, S. C. J. de Keersmaecker, and N. H.
C. Roosens, “How to deal with the upcoming challenges in
GMO detection in food and feed,” Journal of Biomedicine and
Biotechnology, vol. 2012, Article ID 402418, 11 pages, 2012.
[33] M.-A. Fraiture, P. Herman, I. Taverniers, M. De Loose, D.
Deforce, and N. H. Roosens, “An innovative and integrated
approach based on DNA walking to identify unauthorised
GMOs,” Food Chemistry, vol. 147, pp. 60–69, 2014.
17
[34] S. Broeders, M. A. Fraiture, E. Vandermassen et al., “New
trait-specific qualitative SYBR Green qPCR methods to expand
the panel of GMO screening methods used in the CoSYPS,”
European Food Research and Technology, vol. 241, no. 2, pp. 275–
287, 2015.
[35] JCR GMOMETHODS, http://gmo-crl.jrc.ec.europa.eu/gmo-
methods/.
[36] M. Querci, M. Van den Bulcke, J. Žel, G. Van den Eede, and
H. Broll, “New approaches in GMO detection,” Analytical and
Bioanalytical Chemistry, vol. 396, no. 6, pp. 1991–2002, 2010.
[37] E. G. M. Mbella, A. Lievens, E. Barbau-Piednoir et al., “SYBR
Green qPCR methods for detection of endogenous reference
genes in commodity crops: a step ahead in combinatory screen-
ing of genetically modified crops in food and feed products,”
European Food Research and Technology, vol. 232, no. 3, pp. 485–
496, 2011.
[38] H.-U. Waiblinger, B. Ernst, A. Anderson, and K. Pietsch,
“Validation and collaborative study of a P35S and T-nos duplex
real-time PCR screening method to detect genetically modified
organisms in food products,” European Food Research and
Technology, vol. 226, no. 5, pp. 1221–1228, 2008.
[39] S. Broeders, E. Barbau-Piednoir, E. Vandermassen, F. Debode,
M. Mazzara, and N. Roosens, “New SYBR green methods
targeting promoter sequences used for screening of several GM
events pending for authorisation in Europe,” European Food
Research and Technology, vol. 236, no. 3, pp. 537–547, 2013.
[40] E. Barbau-Piednoir, P. Stragier, N. Roosens et al., “Inter-
laboratory testing of GMO detection by combinatory SYBR-
Green PCR screening (CoSYPS),” Food Analytical Methods, vol.
7, no. 8, pp. 1719–1728, 2014.
[41] I. Huber, A. Block, D. Sebah et al., “Development and validation
of duplex, triplex, and pentaplex real-time PCR screening assays
for the detection of genetically modified organisms in food and
feed,” Journal of Agricultural and Food Chemistry, vol. 61, no. 43,
pp. 10293–10301, 2013.
[42] G. Cottenet, C. Blancpain, V. Sonnard, and P. F. Chuah,
“Development and validation of a multiplex real-time PCR
method to simultaneously detect 47 targets for the identification
of genetically modified organisms,” Analytical and Bioanalytical
Chemistry, vol. 405, no. 21, pp. 6831–6844, 2013.
[43] M. Chaouachi, M. S. Zellama, N. Nabi, A. B. Hafsa, and K. Saı̈d,
“Molecular identification of four genetically modified maize
(Bt11, Bt176, Mon810 and T25) by duplex quantitative real-time
PCR,” Food Analytical Methods, vol. 7, no. 1, pp. 224–233, 2014.
[44] M. C. Samson, M. Gullı́, and N. Marmiroli, “Multiplex real-time
PCR assays for simultaneous detection of maize MON810 and
GA21 in food samples,” Food Control, vol. 30, no. 2, pp. 518–525,
2013.
[45] S.-B. Park, H.-Y. Kim, and J.-H. Kim, “Multiplex PCR system
to track authorized and unauthorized genetically modified
soybean events in food and feed,” Food Control, vol. 54, pp. 47–
52, 2015.
[46] R. Köppel, A. Sendic, and H.-U. Waiblinger, “Two quantitative
multiplex real-time PCR systems for the efficient GMO screen-
ing of food products,” European Food Research and Technology,
vol. 239, no. 4, pp. 653–659, 2014.
[47] H.-H. Dörries, I. Remus, A. Grönewald, C. Grönewald, and K.
Berghof-Jäger, “Development of a qualitative, multiplex real-
time PCR kit for screening of genetically modified organisms
(GMOs),” Analytical and Bioanalytical Chemistry, vol. 396, no.
6, pp. 2043–2054, 2010.
18
[48] R. Köppel, T. Bucher, A. Frei, and H. U. Waiblinger, “Droplet
digital PCR versus multiplex real-time PCR method for the
detection and quantification of DNA from the four transgenic
soy traits MON87769, MON87708, MON87705 and FG72, and
lectin,” European Food Research and Technology, vol. 241, no. 4,
pp. 521–527, 2015.
[49] C. Bahrdt, A. B. Krech, A. Wurz, and D. Wulff, “Validation of
a newly developed hexaplex real-time PCR assay for screening
for presence of GMOs in food, feed and seed,” Analytical and
Bioanalytical Chemistry, vol. 396, no. 6, pp. 2103–2112, 2010.
[50] A. Burrell, C. Foy, and M. Burns, “Applicability of three
alternative instruments for food authenticity analysis: GMO
identification,” Biotechnology Research International, vol. 2011,
Article ID 838232, 8 pages, 2011.
[51] S. Basak, N. Z. Ehtesham, B. Sesikeran, and S. Ghosh, “Detec-
tion and identification of transgenic elements by fluorescent-
PCR-based capillary gel electrophoresis in genetically modified
cotton and soybean,” Journal of AOAC International, vol. 97, no.
1, pp. 159–165, 2014.
[52] A. Nadal, A. Coll, J.-L. La Paz, T. Esteve, and M. Pla, “A new
PCR-CGE (size and color) method for simultaneous detection
of genetically modified maize events,” Electrophoresis, vol. 27,
no. 19, pp. 3879–3888, 2006.
[53] A. Nadal, T. Esteve, and M. Pla, “Multiplex polymerase chain
reaction-capillary gel electrophoresis: a promising tool for
GMO screening—assay for simultaneous detection of five
genetically modified cotton events and species,” Journal of
AOAC International, vol. 92, no. 3, pp. 765–772, 2009.
[54] A. Holck, B. O. Pedersen, and E. Heir, “Detection of five novel
GMO maize events by qualitative, multiplex PCR and fluo-
rescence capillary gel electrophoresis,” European Food Research
and Technology, vol. 231, no. 3, pp. 475–483, 2010.
[55] A. L. Holck and B. O. Pedersen, “Simple, sensitive, accu-
rate multiplex quantitative competitive PCR with capillary
electrophoresis detection for the determination of genetically
modified maize,” European Food Research and Technology, vol.
233, no. 6, pp. 951–961, 2011.
[56] J. Guo, L. Yang, L. Chen et al., “MPIC: a high-throughput ana-
lytical method for multiple DNA targets,” Analytical Chemistry,
vol. 83, no. 5, pp. 1579–1586, 2011.
[57] B. R. Heide, S. M. Drømtorp, K. Rudi, E. Heir, and A. L. Holck,
“Determination of eight genetically modified maize events
by quantitative, multiplex PCR and fluorescence capillary gel
electrophoresis,” European Food Research and Technology, vol.
227, no. 4, pp. 1125–1137, 2008.
[58] B. R. Heide, E. Heir, and A. Holck, “Detection of eight GMO
maize events by qualitative, multiplex PCR and fluorescence
capillary gel electrophoresis,” European Food Research and
Technology, vol. 227, no. 2, pp. 527–535, 2008.
[59] S. Leimanis, M. Hernández, S. Fernández et al., “A microarray-
based detection system for genetically modified (GM) food
ingredients,” Plant Molecular Biology, vol. 61, no. 1-2, pp. 123–
139, 2006.
[60] S. Leimanis, S. Hamels, F. Nazé et al., “Validation of the
performance of a GMO multiplex screening assay based on
microarray detection,” European Food Research and Technology,
vol. 227, no. 6, pp. 1621–1632, 2008.
[61] S. Hamels, T. Glouden, K. Gillard et al., “A PCR-microarray
method for the screening of genetically modified organisms,”
European Food Research and Technology, vol. 228, no. 4, pp. 531–
541, 2009.
BioMed Research International
[62] D. Morisset, D. Dobnik, S. Hamels, J. Žel, and K. Gruden,
“NAIMA: target amplification strategy allowing quantitative
on-chip detection of GMOs,” Nucleic Acids Research, vol. 36, no.
18, article e118, 2008.
[63] K. Rudi, I. Rud, and A. Holck, “A novel multiplex quantitative
DNA array based PCR (MQDA-PCR) for quantification of
transgenic maize in food and feed,” Nucleic Acids Research, vol.
31, no. 11, article e62, 2003.
[64] T. W. Prins, J. P. van Dijk, H. G. Beenen et al., “Optimised
padlock probe ligation and microarray detection of multiple
(non-authorised) GMOs in a single reaction,” BMC Genomics,
vol. 9, article 584, 2008.
[65] A. Fantozzi, M. Ermolli, M. Marini, B. Balla, M. Querci,
and G. Van den Eede, “Innovative application of fluorescent
microsphere based assay for multiple GMO detection,” Food
Analytical Methods, vol. 1, no. 1, pp. 10–17, 2008.
[66] X. Han, H. Wang, H. Chen et al., “Development and primary
application of a fluorescent liquid bead array for the simul-
taneous identification of multiple genetically modified maize,”
Biosensors and Bioelectronics, vol. 49, pp. 360–366, 2013.
[67] S. H. Choi, Y. T. Oh, J. Y. Kwon, S. N. Lee, B. D. Han, and
K. H. Ryu, “Development of detection system using multiplex
PCR and liquid beadarray for stacked genetically modified rice
event (LS28×Cry1Ac),” Journal of the Korean Society for Applied
Biological Chemistry, vol. 53, no. 5, pp. 639–646, 2010.
[68] S. H. Choi, “Hexaplex PCR assay and liquid bead array for
detection of stacked genetically modified cotton event 281-24-
236×3006-210-23,” Analytical and Bioanalytical Chemistry, vol.
401, no. 2, pp. 647–655, 2011.
[69] F. C. A. Brod, J. P. Van Dijk, M. M. Voorhuijzen et al.,
“A high-throughput method for GMO multi-detection using
a microfluidic dynamic array,” Analytical and Bioanalytical
Chemistry, vol. 406, no. 5, pp. 1397–1410, 2014.
[70] X. Li, Y. Wu, J. Li et al., “Development and validation of a
48-target analytical method for high-throughput monitoring
of genetically modified organisms,” Scientific Reports, vol. 5, p.
7616, 2015.
[71] D. Morisset, D. Štebih, M. Milavec, K. Gruden, and J. Žel,
“Quantitative analysis of food and feed samples with droplet
digital PCR,” PLoS ONE, vol. 8, no. 5, Article ID e62583, 2013.
[72] S. Bhat, J. Herrmann, P. Armishaw, P. Corbisier, and K. R.
Emslie, “Single molecule detection in nanofluidic digital array
enables accurate measurement of DNA copy number,” Analyt-
ical and Bioanalytical Chemistry, vol. 394, no. 2, pp. 457–467,
2009.
[73] P. Corbisier, S. Bhat, L. Partis, V. R. D. Xie, and K. R. Emslie,
“Absolute quantification of genetically modified MON810 maize
(Zea mays L.) by digital polymerase chain reaction,” Analytical
and Bioanalytical Chemistry, vol. 396, no. 6, pp. 2143–2150, 2010.
[74] M. J. Burns, A. M. Burrell, and C. A. Foy, “The applicability
of digital PCR for the assessment of detection limits in GMO
analysis,” European Food Research and Technology, vol. 231, no.
3, pp. 353–362, 2010.
[75] R. Köppel and T. Bucher, “Rapid establishment of droplet digital
PCR for quantitative GMO analysis,” European Food Research
and Technology, vol. 241, no. 3, pp. 427–439, 2015.
[76] G. Kiddle, P. Hardinge, N. Buttigieg et al., “GMO detection
using a bioluminescent real time reporter (BART) of loop
mediated isothermal amplification (LAMP) suitable for field
use,” BMC Biotechnology, vol. 12, article 15, 2012.
[77] X. Guan, J. Guo, P. Shen, L. Yang, and D. Zhang, “Visual and
rapid detection of two genetically modified soybean events
BioMed Research International
using loop-mediated isothermal amplification method,” Food
Analytical Methods, vol. 3, no. 4, pp. 313–320, 2010.
[78] H. Di, L. Shi, H. Shen et al., “Rapid detection of genetically
modified ingredients in soybean products by real-time loop-
mediated isothermal amplification,” Journal of Food and Nutri-
tion Research, vol. 2, no. 7, pp. 363–368, 2014.
[79] X. Chen, X. Wang, N. Jin et al., “Endpoint visual detection
of three genetically modified rice events by loop-mediated
isothermal amplification,” International Journal of Molecular
Sciences, vol. 13, no. 11, pp. 14421–14433, 2012.
[80] L. Chen, J. Guo, Q. Wang, G. Kai, and L. Yang, “Development
of the visual loop-mediated isothermal amplification assays for
seven genetically modified maize events and their application
in practical samples analysis,” Journal of Agricultural and Food
Chemistry, vol. 59, no. 11, pp. 5914–5918, 2011.
[81] S. Fukuta, Y. Mizukami, A. Ishida et al., “Real-time loop-
mediated isothermal amplification for the CaMV-35S promoter
as a screening method for genetically modified organisms,”
European Food Research and Technology, vol. 218, no. 5, pp. 496–
500, 2004.
[82] D. Lee, M. La Mura, T. R. Allnutt, and W. Powell, “Detection
of genetically modified organisms (GMOs) using isothermal
amplification of target DNA sequences,” BMC Biotechnology,
vol. 9, article 7, 2009.
[83] G. J. Randhawa, M. Singh, D. Morisset, P. Sood, and J. Žel,
“Loop-mediated isothermal amplification: rapid visual and
real-time methods for detection of genetically modified crops,”
Journal of Agricultural and Food Chemistry, vol. 61, no. 47, pp.
11338–11346, 2013.
[84] M. Zhang, Y. Liu, L. Chen et al., “One simple DNA extraction
device and its combination with modified visual loop-mediated
isothermal amplification for rapid on-field detection of geneti-
cally modified organisms,” Analytical Chemistry, vol. 85, no. 1,
pp. 75–82, 2013.
[85] C. Zahradnik, C. Kolm, R. Martzy et al., “Detection of the
35S promoter in transgenic maize via various isothermal
amplification techniques: a practical approach,” Analytical and
Bioanalytical Chemistry, vol. 406, no. 27, pp. 6835–6842, 2014.
[86] C. Wang, R. Li, S. Quan et al., “GMO detection in food and
feed through screening by visual loop-mediated isothermal
amplification assays,” Analytical and Bioanalytical Chemistry,
vol. 407, no. 16, pp. 4829–4834, 2015.
[87] Q. Li, J. Fang, X. Liu et al., “Loop-mediated isothermal ampli-
fication (LAMP) method for rapid detection of cry1Ab gene in
transgenic rice (Oryza sativa L.),” European Food Research and
Technology, vol. 236, no. 4, pp. 589–598, 2013.
[88] F. Li, W. Yan, L. Long, X. Qi, C. Li, and S. Zhang, “Development
and application of loop-mediated isothermal amplification
assays for rapid visual detection of cry2Ab and cry3A genes in
genetically-modified crops,” International Journal of Molecular
Sciences, vol. 15, no. 9, pp. 15109–15121, 2014.
[89] X. Huang, L. Chen, J. Xu, H.-F. Ji, S. Zhu, and H. Chen, “Rapid
visual detection of phytase gene in genetically modified maize
using loop-mediated isothermal amplification method,” Food
Chemistry, vol. 156, pp. 184–189, 2014.
[90] J. Xu, Q. Zheng, L. Yu et al., “Loop-mediated isothermal
amplification (LAMP) method for detection of genetically
modified maize T25,” Food Science & Nutrition, vol. 1, no. 6, pp.
432–438, 2013.
[91] Y. Cheng, M. Zhang, K. Hu et al., “Loop-mediated isothermal
amplification for the event-specific detection of wheat B73-6-1,”
Food Analytical Methods, vol. 7, no. 2, pp. 500–505, 2014.
19
[92] A. Zimmermann, J. Lüthy, and U. Pauli, “Event specific
transgene detection in Bt11 corn by quantitative PCR at the
integration site,” LWT—Food Science and Technology, vol. 33, no.
3, pp. 210–216, 2000.
[93] S. B. Rønning, M. Vaı̈tilingom, K. G. Berdal, and A. Holst-
Jensen, “Event specific real-time quantitative PCR for geneti-
cally modified Bt11 maize (Zea mays),” European Food Research
and Technology, vol. 216, no. 4, pp. 347–354, 2003.
[94] P. Windels, I. Taverniers, A. Depicker, E. Van Bockstaele, and
M. De Loose, “Characterisation of the Roundup Ready soybean
insert,” European Food Research and Technology, vol. 213, no. 2,
pp. 107–112, 2001.
[95] I. Taverniers, P. Windels, M. Vaı̈tilingom et al., “Event-specific
plasmid standards and real-time PCR methods for transgenic
Bt11, Bt176, and GA21 maize and transgenic GT73 canola,”
Journal of Agricultural and Food Chemistry, vol. 53, no. 8, pp.
3041–3052, 2005.
[96] P. Akritidis, K. Pasentsis, A. S. Tsaftaris, P. V. Mylona, and A.
N. Polidoros, “Identification of unknown genetically modified
material admixed in conventional cotton seed and development
of an event-specific detection method,” Electronic Journal of
Biotechnology, vol. 11, no. 2, pp. 76–83, 2008.
[97] B. B. Majhi, J. M. Shah, and K. Veluthambi, “A novel T-DNA
integration in rice involving two interchromosomal transloca-
tions,” Plant Cell Reports, vol. 33, no. 6, pp. 929–944, 2014.
[98] Y. Cao, G. Wu, Y. Wu, S. Nie, L. Zhang, and C. Lu, “Characteri-
zation of the transgenic rice event TT51-1 and construction of a
reference plasmid,” Journal of Agricultural and Food Chemistry,
vol. 59, no. 16, pp. 8550–8559, 2011.
[99] C. Su, J. Xie, X. Wang, and Y. Peng, “Integrated structure and
event-specific real-time detection of transgenic cry1Ac/SCK
rice Kefeng 6,” European Food Research and Technology, vol. 232,
no. 2, pp. 351–359, 2011.
[100] W.-X. Wang, T.-H. Zhu, F.-X. Lai, and Q. Fu, “Event-specific
qualitative and quantitative detection of transgenic rice Kefeng-
8 by characterization of the transgene flanking sequence,”
European Food Research and Technology, vol. 234, no. 3, pp. 477–
484, 2012.
[101] M. H. Zhang, N. Huo, Y. Liu et al., “Event-specific detection
of genetically modified wheat B73-6-1 based on the 3󸀠 -flanking
sequence,” European Food Research and Technology, vol. 235, no.
6, pp. 1149–1159, 2012.
[102] M. Zhang, Y. Yu, X. Gao et al., “Event-specific quantitative
detection of genetically modified wheat B72-8-11 based on the
3󸀠 flanking sequence,” European Food Research and Technology,
vol. 240, no. 4, pp. 775–782, 2015.
[103] P. Zhang, J. Xu, Q. Zheng, F. Luan, J. Cao, and H. Hou,
“Flanking sequence determination and event specific detection
of transgenic wheat B72-8-11b strain,” Applied Biochemistry and
Biotechnology, vol. 169, no. 5, pp. 1523–1530, 2013.
[104] Q. Trinh, H. Shi, W. Xu, J. Hao, Y. Luo, and K. Huang, “Loop-
linker PCR: an advanced PCR technique for genome walking,”
IUBMB Life, vol. 64, no. 10, pp. 841–845, 2012.
[105] P. Windels, S. Bertrand, A. Depicker, W. Moens, E. Bockstaele,
and M. Loose, “Qualitative and event-specific PCR real-time
detection methods for StarLink maize,” European Food Research
and Technology, vol. 216, no. 3, pp. 259–263, 2003.
[106] P. Raymond, L. Gendron, M. Khalf et al., “Detection and iden-
tification of multiple genetically modified events using DNA
insert fingerprinting,” Analytical and Bioanalytical Chemistry,
vol. 396, no. 6, pp. 2091–2102, 2010.
 20
[107] C. Collonnier, A. Schattner, G. Berthier et al., “Characterization
and event specific-detection by quantitative real-time PCR of
T25 maize insert,” Journal of AOAC International, vol. 88, no. 2,
pp. 536–546, 2005.
[108] A. Holck, M. Va, L. Didierjean, and K. Rudi, “5󸀠 -Nuclease
PCR for quantitative event-specific detection of the genetically
modified Mon810 MaisGard maize,” European Food Research
and Technology, vol. 214, no. 5, pp. 449–453, 2002.
[109] R. Spalinskas, M. Van den Bulcke, G. Van den Eede, and
A. Milcamps, “LT-RADE: an efficient user-friendly genome
walking method applied to the molecular characterization of
the insertion site of genetically modified maize MON810 and
rice LLRICE62,” Food Analytical Methods, vol. 6, no. 2, pp. 705–
713, 2013.
[110] R. Spalinskas, M. Van den Bulcke, and A. Milcamps, “Efficient
retrieval of recombinant sequences of GM plants by Cauliflower
Mosaic Virus 35S promoter-based bidirectional LT-RADE,”
European Food Research and Technology, vol. 237, no. 6, pp.
1025–1031, 2013.
[111] L. Yang, S. Xu, A. Pan et al., “Event specific qualitative and
quantitative polymerase chain reaction detection of genetically
modified MON863 maize based on the 5󸀠 -transgene integration
sequence,” Journal of Agricultural and Food Chemistry, vol. 53,
no. 24, pp. 9312–9318, 2005.
[112] A. Pan, L. Yang, S. Xu et al., “Event-specific qualitative and
quantitative PCR detection of MON863 maize based upon the
3󸀠 -transgene integration sequence,” Journal of Cereal Science,
vol. 43, no. 2, pp. 250–257, 2006.
[113] W.-X. Wang, T.-H. Zhu, F.-X. Lai, and Q. Fu, “Event-specific
qualitative and quantitative detection of transgenic rice Kefeng-
6 by characterization of the transgene flanking sequence,”
European Food Research and Technology, vol. 232, no. 2, pp. 297–
305, 2011.
[114] J. Xu, J. Cao, D. Cao et al., “Flanking sequence determination
and event-specific detection of genetically modified wheat B73-
6-1,” Acta Biochimica et Biophysica Sinica, vol. 45, no. 5, pp. 416–
421, 2013.
[115] R. Babekova, T. Funk, S. Pecoraro, K.-H. Engel, and U. Busch,
“Development of an event-specific Real-time PCR detection
method for the transgenic Bt rice line KMD1,” European Food
Research and Technology, vol. 228, no. 5, pp. 707–716, 2009.
[116] C. Liang, J. P. van Dijk, I. M. J. Scholtens et al., “Detect-
ing authorized and unauthorized genetically modified organ-
isms containing vip3A by real-time PCR and next-generation
sequencing,” Analytical and Bioanalytical Chemistry, vol. 406,
no. 11, pp. 2603–2611, 2014.
[117] M.-A. Fraiture, P. Herman, I. Taverniers et al., “Validation of
a sensitive DNA walking strategy to characterise unauthorised
GMOs using model food matrices mimicking common rice
products,” Food Chemistry, vol. 173, pp. 1259–1265, 2015.
[118] M. A. Fraiture, P. Herman, L. Lefèvre et al., “Integrated DNA
walking system to characterize a broad spectrum of GMOs in
food/feed matrices,” BMC Biotechnology, vol. 15, article 76, 2015.
[119] Q. Song, G. Wei, and G. Zhou, “Analysis of genetically modified
organisms by pyrosequencing on a portable photodiode-based
bioluminescence sequencer,” Food Chemistry, vol. 154, pp. 78–
83, 2014.
[120] D. Kovalic, C. Garnaat, L. Guo et al., “The use of next generation
sequencing and junction sequence analysis bioinformatics to
achieve molecular characterization of crops improved through
modern biotechnology,” The Plant Genome, vol. 5, no. 3, pp. 149–
163, 2012.
BioMed Research International
[121] L. Young, J. Hammerlindl, V. Babic et al., “Genetics, struc-
ture, and prevalence of FP967 (CDC Triffid) T-DNA in flax,”
SpringerPlus, vol. 4, article 146, 2015.
[122] D. Wahler, L. Schauser, J. Bendiek, and L. Grohmann, “Next-
generation sequencing as a tool for detailed molecular char-
acterisation of genomic insertions and flanking regions in
genetically modified plants: a pilot study using a rice event
unauthorised in the EU,” Food Analytical Methods, vol. 6, no.
6, pp. 1718–1727, 2013.
[123] L. Yang, C. Wang, A. Holst-Jensen, D. Morisset, Y. Lin, and D.
Zhang, “Characterization of GM events by insert knowledge
adapted re-sequencing approaches,” Scientific Reports, vol. 3,
article 2839, 2013.
[124] S. Willems, M. Fraiture, D. Deforce et al., “Statistical framework
for detection of genetically modified organisms based on Next
Generation Sequencing,” Food Chemistry, vol. 192, pp. 788–798,
2016.
[125] A. Holst-Jensen, Y. Bertheau, M. de Loose et al., “Detecting
un-authorized genetically modified organisms (GMOs) and
derived materials,” Biotechnology Advances, vol. 30, no. 6, pp.
1318–1335, 2012.
[126] T. Demeke and G. R. Jenkins, “Influence of DNA extraction
methods, PCR inhibitors and quantification methods on real-
time PCR assay of biotechnology-derived traits,” Analytical and
Bioanalytical Chemistry, vol. 396, no. 6, pp. 1977–1990, 2010.
[127] K. L. Opel, D. Chung, and B. R. McCord, “A study of PCR
inhibition mechanisms using real time PCR,” Journal of Forensic
Sciences, vol. 55, no. 1, pp. 25–33, 2010.
[128] C. Schrader, A. Schielke, L. Ellerbroek, and R. Johne, “PCR
inhibitors—occurrence, properties and removal,” Journal of
Applied Microbiology, vol. 113, no. 5, pp. 1014–1026, 2012.
[129] M. Van den Bulcke, A. Lievens, E. Barbau-Piednoir et al., “A
theoretical introduction to ‘combinatory SYBR Green qPCR
Screening’, a matrix-based approach for the detection of mate-
rials derived from genetically modified plants,” Analytical and
Bioanalytical Chemistry, vol. 396, no. 6, pp. 2113–2123, 2010.
[130] A. Block, F. Debode, L. Grohmann et al., “The GMOseek
matrix: a decision support tool for optimizing the detection of
genetically modified plants,” BMC Bioinformatics, vol. 14, article
256, 2013.
[131] L. Gerdes, U. Busch, and S. Pecoraro, “GMOfinder-a GMO
screening database,” Food Analytical Methods, vol. 5, no. 6, pp.
1368–1376, 2012.
[132] JRC GMO-Amplicons, http://gmo-crl.jrc.ec.europa.eu/
jrcgmoamplicons/.
[133] A. Pla, V. Nadal, C. Baeten et al., “New multiplexing tools
for reliable GMO detection,” in Genetically Modified and Non-
Genetically Modified Food Supply Chains: Co-Existence and
Traceability, pp. 333–366, Wiley, Oxford, UK, 2013.
[134] E. D. Vega and M. L. Marina, “Characterization and study of
transgenic cultivars by capillary and microchip electrophoresis,”
International Journal of Molecular Sciences, vol. 15, no. 12, pp.
23851–23877, 2014.
[135] M. Milavec, D. Dobnik, L. Yang, D. Zhang, K. Gruden, and J.
Žel, “GMO quantification: valuable experience and insights for
the future,” Analytical and Bioanalytical Chemistry, vol. 406, no.
26, pp. 6485–6497, 2014.
[136] H. I. Nakaya, E. M. Reis, and S. Verjovski-Almeida, “Concepts
on microarray design for genome and transcriptome analyses,”
in Nucleic Acids Hybridization Modern Applications, pp. 265–
307, Springer, Dordrecht, The Netherlands, 2007.
 BioMed Research International
[137] D. Dobnik, D. Morisset, and K. Gruden, “NAIMA as a solution
for future GMO diagnostics challenges,” Analytical and Bioan-
alytical Chemistry, vol. 396, no. 6, pp. 2229–2233, 2010.
[138] F. Von Götz, “See what you eat—broad GMO screening with
microarrays,” Analytical and Bioanalytical Chemistry, vol. 396,
no. 6, pp. 1961–1967, 2010.
[139] N. Shao, S.-M. Jiang, M. Zhang et al., “MACRO: a combined
microchip-PCR and microarray system for high-throughput
monitoring of genetically modified organisms,” Analytical
Chemistry, vol. 86, no. 2, pp. 1269–1276, 2014.
[140] Luminex, https://www.luminexcorp.com/.
[141] K. Fu, W. Huang, T. Deng, F. Li, H. Liu, and Y. Chen, “Multiplex
PCR assay and liquid bead array for detection of 13 lines
genetically modified maize,” Journal of Chinese Institute of Food
Science and Technology, vol. 15, no. 1, pp. 188–197, 2015.
[142] M. C. Strain, S. M. Lada, T. Luong et al., “Highly precise
measurement of HIV DNA by droplet digital PCR,” PLoS ONE,
vol. 8, no. 4, Article ID e55943, 2013.
[143] M. Liu, Y. Luo, R. Tao et al., “Sensitive and rapid detection of
genetic modified soybean (Roundup Ready) by loop-mediated
isothermal amplification,” Bioscience, Biotechnology and Bio-
chemistry, vol. 73, no. 11, pp. 2365–2369, 2009.
[144] C. Leoni, M. Volpicella, F. De Leo, R. Gallerani, and L. R. Ceci,
“Genome walking in eukaryotes,” FEBS Journal, vol. 278, no. 21,
pp. 3953–3977, 2011.
[145] I. Theuns, P. Windels, S. de Buck, A. Depicker, E. Van Bock-
staele, and M. de Loose, “Identification and characterization of
T-DNA inserts by T-DNA fingerprinting,” Euphytica, vol. 123,
no. 1, pp. 75–84, 2002.
[146] S. An, S. Park, D.-H. Jeong et al., “Generation and analysis of
end sequence database for T-DNA tagging lines in rice,” Plant
Physiology, vol. 133, no. 4, pp. 2040–2047, 2003.
[147] A. Sallaud, D. Meynard, J. van Boxtel et al., “Highly efficient
production and characterization of T-DNA plants for rice
(Oryza sativa L.) functional genomics,” Theoretical and Applied
Genetics, vol. 106, no. 8, pp. 1396–1408, 2003.
[148] P. Windels, S. De Buck, E. Van Bockstaele, M. De Loose, and
A. Depicker, “T-DNA integration in Arabidopsis chromosomes.
Presence and origin of filler DNA sequences,” Plant Physiology,
vol. 133, no. 4, pp. 2061–2068, 2003.
[149] Y. Yuanxin, A. Chengcai, L. Li, G. Jiayu, T. Guihong, and C.
Zhangliang, “T-linker-specific ligation PCR (T-linker PCR):
an advanced PCR technique for chromosome walking or for
isolation of tagged DNA ends,” Nucleic acids research, vol. 31,
no. 12, article e68, 2003.
[150] C. Sallaud, C. Gay, P. Larmande et al., “High throughput T-DNA
insertion mutagenesis in rice: a first step towards in silico reverse
genetics,” The Plant Journal, vol. 39, no. 3, pp. 450–464, 2004.
[151] H. Salvo-Garrido, S. Travella, L. J. Billiam, W. A. Harwood, and
J. W. Snape, “The distribution of transgene insertion sites in
barley determined by physical and genetic mapping,” Genetics,
vol. 167, no. 3, pp. 1371–1379, 2004.
[152] M.-J. Côté, A. J. Meldrum, P. Raymond, and C. Dollard,
“Identification of genetically modified potato (Solanum tubero-
sum) cultivars using event specific polymerase chain reaction,”
Journal of Agricultural and Food Chemistry, vol. 53, no. 17, pp.
6691–6696, 2005.
[153] M. Rai, “Refinement of the Citrus tristeza virus resistance gene
(Ctv) positional map in Poncirus trifoliata and generation of
transgenic grapefruit (Citrus paradisi) plant lines with candi-
date resistance genes in this region,” Plant Molecular Biology,
vol. 61, no. 3, pp. 399–414, 2006.
21
[154] E. Santos, S. Remy, E. Thiry, S. Windelinckx, R. Swennen, and L.
Sági, “Characterization and isolation of a T-DNA tagged banana
promoter active during in vitro culture and low temperature
stress,” BMC Plant Biology, vol. 9, article 77, 2009.
[155] J. Ji and J. Braam, “Restriction site extension PCR: a novel
method for high-throughput characterization of tagged DNA
fragments and genome walking,” PLoS ONE, vol. 5, no. 5, Article
ID e10577, 2010.
[156] T. Ruttink, R. Demeyer, E. van Gulck et al., “Molecular toolbox
for the identification of unknown genetically modified organ-
isms,” Analytical and Bioanalytical Chemistry, vol. 396, no. 6,
pp. 2073–2089, 2010.
[157] D. Cullen, W. Harwood, M. Smedley, H. Davies, and M.
Taylor, “Comparison of DNA walking methods for isolation of
transgene-flanking regions in GM potato,” Molecular Biotech-
nology, vol. 49, no. 1, pp. 19–31, 2011.
[158] A. Taheri, S. J. Robinson, I. Parkin, and M. Y. Gruber, “Revised
selection criteria for candidate restriction enzymes in genome
walking,” PLoS ONE, vol. 7, no. 4, Article ID e35117, 2012.
[159] Q. Trinh, W. Xu, H. Shi, Y. Luo, and K. Huang, “An A-T linker
adapter polymerase chain reaction method for chromosome
walking without restriction site cloning bias,” Analytical Bio-
chemistry, vol. 425, no. 1, pp. 62–67, 2012.
[160] Q. L. Trinh, P. Zhu, H. Shi et al., “A-T linker adapter polymerase
chain reaction for determining flanking sequences by rescuing
inverse PCR or thermal asymmetric interlaced PCR products,”
Analytical Biochemistry, vol. 466, no. 1, pp. 24–26, 2014.
[161] G. N. Rudenko, C. M. T. Rommens, H. J. J. Nijkamp, and J. Hille,
“Supported PCR: an efficient procedure to amplify sequences
flanking a known DNA segment,” Plant Molecular Biology, vol.
21, no. 4, pp. 723–728, 1993.
[162] S. Knapp, Y. Larondelle, M. Roßberg, D. Furtek, and K. Theres,
“Transgenic tomato lines containing Ds elements at defined
genomic positions as tools for targeted transposon tagging,”
MGG Molecular & General Genetics, vol. 243, no. 6, pp. 666–
673, 1994.
[163] M. Devic, S. Albert, M. Delseny, and T. J. Roscoe, “Efficient
PCR walking on plant genomic DNA,” Plant Physiology and
Biochemistry, vol. 35, no. 4, pp. 331–339, 1997.
[164] D. Spertini, C. Béliveau, and G. Bellemare, “Screening of
transgenic plants by amplification of unknown genomic DNA
flanking T-DNA,” BioTechniques, vol. 27, no. 2, pp. 308–314,
1999.
[165] S. Balzergue, B. Dubreucq, S. Chauvin et al., “Improved PCR-
walking for large-scale isolation of plant T-DNA borders,”
BioTechniques, vol. 30, no. 3, pp. 496–504, 2001.
[166] A. Cottage, A. Yang, H. Maunders, R. C. de Lacy, and N. A.
Ramsay, “Identification of DNA sequences flanking T-DNA
insertions by PCR-walking,” Plant Molecular Biology Reporter,
vol. 19, no. 4, pp. 321–327, 2001.
[167] S.-J. Zheng, B. Henken, E. Sofiari, E. Jacobsen, F. A. Krens,
and C. Kik, “Molecular characterization of transgenic shallots
(Allium cepa L.) by adaptor ligation PCR (AL-PRC) and
sequencing of genomic DNA flanking T-DNA borders,” Trans-
genic Research, vol. 10, no. 3, pp. 237–245, 2001.
[168] F. Samson, V. Brunaud, S. Balzergue et al., “FLAGdb/FST: a
database of mapped flanking insertion sites (FSTs) of Arabidop-
sis thaliana T-DNA transformants,” Nucleic Acids Research, vol.
30, no. 1, pp. 94–97, 2002.
[169] K. V. Myrick and W. M. Gelbart, “Universal Fast Walking for
direct and versatile determination of flanking sequence,” Gene,
vol. 284, no. 1-2, pp. 125–131, 2002.
 22 BioMed Research International

[170] G. Tan, Y. Gao, M. Shi et al., “SiteFinding-PCR: a simple and

efficient PCR method for chromosome walking,” Nucleic Acids
Research, vol. 33, no. 13, article e122, 2005.
[171] H. Wang, J. Fang, C. Liang, M. He, Q. Li, and C. Chu,
“Computation-assisted sitefinding-PCR for isolating flanking
sequence tags in rice,” BioTechniques, vol. 51, no. 6, pp. 421–423,
2011.
[172] J.-L. Yao, S. Tomes, and A. P. Gleave, “Transformation of apple
(Malus× domestica) using mutants of apple acetolactate synthase
as a selectable marker and analysis of the T-DNA integration
sites,” Plant Cell Reports, vol. 32, no. 5, pp. 703–714, 2013.
[173] J. G. Bartlett, M. A. Smedley, and W. A. Harwood, “Analysis
of T-DNA/host-plant DNA junction sequences in single-copy
transgenic barley lines,” Biology, vol. 3, no. 1, pp. 39–55, 2014.
[174] J. Ma, Y. P. Wang, S. Ren, Z. Zhang, S. Lu, and P. W. Wang,
“Cloning flanking sequence by single-primer PCR in transgenic
plants,” Genetics and Molecular Research, vol. 13, no. 4, pp. 8403–
8410, 2014.
[175] H. P. J. Buermans and J. T. den Dunnen, “Next generation
sequencing technology: advances and applications,” Biochimica
et Biophysica Acta: Molecular Basis of Disease, vol. 1842, no. 10,
pp. 1932–1941, 2014.
[176] H. Wu, W. Wu, Z. Chen et al., “Highly sensitive pyrosequencing
based on the capture of free adenosine 5󸀠 phosphosulfate with
adenosine triphosphate sulfurylase,” Analytical Chemistry, vol.
83, no. 9, pp. 3600–3605, 2011.
[177] PacBio, http://www.pacificbiosciences.com.
[178] L. Zhou and J. A. Holliday, “Targeted enrichment of the black
cottonwood (Populus trichocarpa) gene space using sequence
capture,” BMC Genomics, vol. 13, article 703, 2012.
[179] A. J. Dubose, S. T. Lichtenstein, N. Narisu et al., “Use of
microarray hybrid capture and next-generation sequencing to
identify the anatomy of a transgene,” Nucleic Acids Research, vol.
41, no. 6, article e70, 2013.
[180] W. E. Clarke, I. A. Parkin, H. A. Gajardo et al., “Genomic
DNA enrichment using sequence capture microarrays: a novel
approach to discover sequence nucleotide polymorphisms
(SNP) in Brassica napus L,” PLoS ONE, vol. 8, no. 12, Article ID
e81992, 2013.
[181] M. G. Dasgupta, V. Dharanishanthi, I. Agarwal, K. V. Krutovsky,
and S. K. Parida, “Development of genetic markers in eucalyp-
tus species by target enrichment and exome sequencing,” PLoS
ONE, vol. 10, no. 1, Article ID e0116528, 2015.
[182] M. C. Schatz, J. Witkowski, and W. R. McCombie, “Current
challenges in de novo plant genome sequencing and assembly,”
Genome Biology, vol. 13, no. 4, article 243, 2012.
[183] K. F. Au, J. G. Underwood, L. Lee, and W. H. Wong, “Improving
PacBio long read accuracy by short read alignment,” PLoS ONE,
vol. 7, no. 10, Article ID e46679, 2012.
Hindawi Publishing Corporation
BioMed Research International
Volume 2015, Article ID 150603, 7 pages
http://dx.doi.org/10.1155/2015/150603

Research Article
Structure and Antioxidant Activity of Soy Protein
Isolate-Dextran Conjugates Obtained by TiO2 Photocatalysis

Bei Jin,1,2,3 Xiaosong Zhou,1,3 Bing Li,2 Caiyan Chen,1 Xiaosa Zhang,1 and Siqiao Chen1
1
School of Chemistry and Chemical Engineering and Institute of Food Science & Engineering, Lingnan Normal University,
Zhanjiang 524048, China
2
Engineering Research Center of Starch and Vegetable Protein Processing, South China University of Technology,
Ministry of Education, Guangzhou 510640, China
3
Development Center for New Materials Engineering and Technology, Lingnan Normal University, Zhanjiang 524048, China

Correspondence should be addressed to Bei Jin; jinbeikim2013@163.com

Received 29 January 2015; Accepted 31 March 2015

Academic Editor: Nikos Chorianopoulos

Copyright © 2015 Bei Jin et al. This is an open access article distributed under the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

The aim of this study was to investigate the structural characteristics and antioxidant activities of soy protein isolate- (SPI-) dextran
conjugates obtained by TiO2 photocatalysis treatment. Results revealed that the UV-vis absorption and the fluorescence intensity
increased as the photocatalytic power increased (𝑃 < 0.05). Higher photocatalytic power could promote the extent of glycation
and the formation of high molecular weight SPI-dextran conjugates, which were evidenced by free amino group content and
sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. The Fourier transform infrared (FT-IR) spectra
suggested that the amide I, II, and III bands of SPI were altered by the glycation induced by TiO2 photocatalysis. Moreover,
significant changes of secondary structure occurred in SPI-dextran conjugates. The 𝛼-helix, 𝛽-sheet, 𝛽-turns, and random coil
were changed from approximately 10.6%, 37.9%, 12.9%, and 38.6% to 3.8%, 10.4%, 17.7%, and 68.8%, respectively, after treatment
at photocatalytic power of 1000 W. In addition, SPI-dextran conjugates obtained by TiO2 photocatalysis treatment exhibited high
hydroxyl radical scavenging activity and possessed increased reducing power. All data indicated that TiO2 photocatalysis was an
efficient method for promoting protein-polysaccharide copolymerisation.

1. Introduction classical glycation reactions, such as dry heating method and

Many modified technologies such as alkylation, esterifica-
tion, amidination, deamidination, covalent attachment of
carbohydrates and fatty acids, thiol-disulfide exchange, and
enzymatic modification can effectively improve the func-
tional properties of proteins [1]. Maillard-type protein-pol-
ysaccharide conjugates, the product of nonenzymatic brown-
ing reaction which is one of the major food protein modifying
reactions occurring during thermal food processing, can
contribute markedly to the aroma, taste, and colour, as well
as to antioxidant potential of stored and processed foods
[2]. In addition, Maillard products can be added to foods
as functional ingredients to improve the emulsion, gelation,
appearance, and texture of food products [3]. However,
protein-polysaccharide glycation reaction is time consuming
and it is difficult to control the reaction process when using
wet heating method [1, 4]. Thus, it is necessary to find a novel
technology to improve the efficiency of glycation reactions.
Novel physical technologies such as gamma irradiation
[5] and pulsed electric field [6] and high intensity ultrasound
[7] have been investigated as full or partial alternatives to
conventional heat treatment because these technologies can
greatly speed up the glycation reaction and improve the
functional properties of proteins. There is a growing scientific
interest in the influence of photocatalysis on synthesis of
compounds with improved properties. Photocatalysis pro-
vides a green chemical route for organic functional group
transformation under mild conditions. In the past two
decades, it has been successfully applied to organic synthesis
such as polymerization, hydroxylation of aromatic, oxidation
of amine, epoxidation of olefins, and carbonylation [8–12].
In these reactions, no other chemical reagents are introduced
2 BioMed Research International
and there is no need to control temperature, and the reaction
time is shortened. However, the effect of TiO2 photocatalysis
on the glycation reaction has scarcely been reported. Thus,
this study aims to prepare SPI-dextran conjugate induced by
TiO2 photocatalysis treatment and evaluate the antioxidant
activities and the structural changes of the resulting conju-
gates.
2. Materials and Methods
2.1. Chemicals. Dextran (MW: 60,000–90,000) was pur-
chased from Chanshou Biological Co., Ltd. (Jiashu Province,
China). SPI was obtained from Wonderful Tech. Co.
(Shandong Province, China), containing (on dry basis)
6.5% moisture, 1.0% ash, 0.2% lipid, and 90.2% protein
(determined by Kjeldahl method, N×6.25). 1, 1-Diphenyl-2-
picrylhydrazyl (DPPH), o-phthaldialdehyde (OPA), and 8-
anilino-1-naphthalenesulfonic acid (ANS) were purchased
from Sigma Chemical Co. (St. Louis, MO, USA). Acrylamide
(99%) was purchased from Sigma (Deisenhofen, Germany)
and HMF (98%) was from Acros (Geel, Belgium). All other
chemicals used were of analytical grade and procured from
Merck (Darmstadt, Germany).
2.2. Preparation of SPI-Dextran Conjugates. The photocat-
alytic conjugation was conducted in a 50 mL cylindrical glass
vessel fixed in a XPA-II photochemical reactor (Nanjing
Xujiang Machine-electronic Plant). The filter system com-
prises a house-made filter mounted on the lamp to eliminate
infrared irradiation and a UV filter which can absorb the
light with wavelength less than 400 nm. The mixtures of soy
protein and dextran in the weight ratio of 1 : 1 were dissolved
in 20 mM potassium phosphate buffer (pH 8). Then, the
solution was stirred for 3 h at an ambient temperature until
soy protein and dextran completely dissolved. The pH of
the solution was adjusted to 8.0 by adding 0.1 N HCl or
0.2 N NaOH. The SPI-dextran solution was ready for the
photocatalytic reaction tests. For each test, 20 mL soy protein-
dextran solution was placed in a 50 mL jacketed vessel with
a constant flow of 4 ± 2∘ C circulation water at a rate of
0.6 L/min to maintain a sample temperature below 40∘ C. The
SPI-dextran solutions were treated at photocatalytic power of
500 (TP1) and 1000 W (TP2) for 2 h. As a contrast, thermal
treated samples were prepared under 40 ± 2∘ C for 2 h with
the same soy protein-dextran mixture (control samples). All
samples were kept at 4∘ C before chemical analysis within 24 h
or freeze-dried and then stored at −20∘ C for further analysis.
Further details of photocatalytic reactor could be found in
[13].
2.3. Spectrophotometric Analyses and Spectrofluorimetry
Measurements. The UV-absorbance and browning of SPI-
dextran conjugates were measured according to the method
of Rao et al. [5] with a slight modification. The absorbance
at 294 was measured in 20-fold diluted samples and 420 nm
was measured in undiluted samples by a UV-2550 spec-
trophotometer (Shimadzu, Kyoto, Japan) for detecting UV-
absorbance and browning intensity, respectively. Fluo-
rescence measurements were performed using F4500
fluorescence-spectrophotometre (Hitachi Co., Japan). The
fluorescence of the glycation products was measured at an
excitation wavelength of 290 nm and an emission wavelength
300–450 nm in protein samples of 0.5 𝜇M in 20 mM
potassium phosphate buffer (pH 7.2).
2.4. Determination of Free Amino Groups Content. The con-
tent of free amino groups was determined by the OPA
method. The OPA reagent was prepared according to Caillard
et al. [14]. OPA (80 mg) was dissolved in 2 mL 95% ethanol
and mixed with 50 mL 0.1 M sodium tetraborate buffer
solution at pH 9.5, 5 mL of 20% (W/V) SDS, and 0.2 mL 2-
mercaptoethanol. The mixtures were then diluted with water
to 100 mL for forming the OPA reagent. The OPA reagent
was prepared freshly before use. 1 mL OPA reagent was added
to 50 𝜇L of the treated soy protein-dextran conjugates and
incubated in the dark at 35∘ C for 2 min, and the absorption
at 340 nm was measured immediately in order to obtain the
free amino groups.
2.5. Determination of Hydroxyl Radical Scavenging Activity
and Reducing Power. The hydroxyl radical scavenging activ-
ity of the SPI-dextran conjugates was determined according
to the method of You et al. [15]. A mix of 600 𝜇L of 1,10-
phenanthroline (5.0 mM), 600 𝜇L of FeSO4 (5.0 mM), and
600 𝜇L of ethylenediaminetetraacetic acid (EDTA) (15 mM)
was mixed with 400 𝜇L of sodium phosphate buffer (0.2 M,
pH 7.4). Then 600 𝜇L of samples (2.0 mg/mL) and 800 𝜇L
of H2 O2 (0.01%) were added. The mixture was incubated
at 37∘ C for 60 min, and the absorbance was measured at
536 nm (UV754, Xianjian Scientific Instrument Co., Shang-
hai, China). Results were determined using the following
equation:
Hydroxyl radical scavenging activity (%)
100 (1)
= (𝐴 𝑠 − 𝐴 0 ) × ,
(𝐴 𝑐 − 𝐴 0 )
where 𝐴 𝑠 is the absorbance of the sample, 𝐴 0 is the
absorbance of the blank solution using distilled water instead
of sample, and 𝐴 𝑐 is the absorbance of a control solution in
the absence of H2 O2 .
The reducing power of conjugation was determined
according to the method of Zheng et al. [16] with some
modification. Briefly, 2.0 mL of sample was mixed with
2.0 mL of 0.2 M sodium phosphate buffer (pH = 6.6) and
2.0 mL of 1% (w/v) potassium ferricyanide. The mixture
solution was incubated at 50∘ C for 20 min followed by the
addition of 2.0 mL of 10% trichloroacetic acid. The mixtures
were centrifuged at 3000 r/min for 10 min. 2.0 mL of the
supernatant was collected and mixed with 2.0 mL of distilled
water and 0.4 mL of 0.1% (w/v) FeCl3 . After standing at
room temperature for 10 min, the absorbance of the reaction
mixture was measured spectrophotometrically at 700 nm. An
equivalent volume of distilled water instead of the sample
was used as the blank. Increased absorbance of the reactions
mixture indicated increased reducing power.
BioMed Research International
2.6. Electrophoresis. SDS-polyacrylamide gel electrophoresis
(SDS-PAGE) was examined by vertical gel electrophoresis
equipment (Mini-Protean II; Bio-Rad Laboratories, Rich-
mond, CA) [17]. The sample (10 𝜇g) was added with laemmli
buffer in the presence of 2% 𝛽-mercaptoethanol and heated at
100∘ C for 5 min before loading into gel. The electrophoresis
was carried out at a constant current of 15 mA using 4%
stacking gel and 10% running gel. After separation, Gels were
stained with 0.2% Coomassie Brilliant Blue R-250 in 25%
methanol and 10% acetic acid. Destaining was conducted
with a solution of 40% methanol and 10% acetic acid. Then,
the gels were scanned and analyzed.
2.7. Fourier Transform Infrared (FT-IR) Measurement. The
infrared analysis was performed using the FT-IR technique
according to the method described by Gao et al. [18] with a
slight modification. FTIR spectra were measured on a FT-IR
spectrometer (NICOLET NEXUS470, DTGS) with a 4 cm−1
resolution and 32 scans between wavenumbers of 4000 cm−1
and 400 cm−1 . The freeze-dried samples were prepared as KBr
disks with 1 mg of the samples in 100 mg of KBr. Background
noise was corrected with pure KBr data. The spectra were
averaged and smoothed, and their baselines were calibrated
with the Spectra Manager software (Jasco Inc., Easton, MD,
USA).
2.8. CD Spectra Measurements and CD Spectra Analysis. The
secondary structure of proteins was determined by CD at
25∘ C in the far UV (from 190 to 250 nm) using a CD6
Jobin-Yvon dichrograph. Spectra were recorded at a protein
concentration of 0.5 mg/mL in 20 mM PBS (pH 7.2) after the
centrifugation at 5,000 ×g to remove any insoluble residue
using a 2 mm path length quartz cuvette. Secondary structure
was estimated using the CONTIN software. Four secondary
structures: 𝛼-helix, 𝛽-sheet, 𝛽-turns, and unordered coil,
were calculated. Data were the means of triplicate measure-
ments.
2.9. Statistical Analysis. All analyses were done in triplicate,
and data are reported as means ± standard deviation. Dif-
ferences between the variables were tested for significance
by one-way ANOVA accompanied with Tukey’s post hoc
test using Origin 7.5. A value of 𝑃 < 0.05 was considered
significant.
3. Results and Discussion
3.1. Changes in 𝐴 294 , Browning Intensity and Fluorescence
Intensity. The changes of 𝐴 294 and browning intensity of SPI-
dextran model solution with different photocatalytic power
levels are shown in Figure 1. Both 𝐴 294 and browning changed
significantly (𝑃 < 0.05) at photocatalytic power of 500 and
1000 W within 2 h. The 𝐴 294 of SPI-dextran solution in-
creased from approximately 0.28 to 0.84 and 1.06 as photo-
catalytic power of 500 and 1000 W, respectively; in the case
of 𝐴 420 , it increased from approximately 0 to 0.21 and 0.36
at photocatalytic power of 500 and 1000 W, respectively. The
brown pigment development, indicated by 𝐴 420 , coincided
with the colourless intermediate formation evidenced by
3
1.4
1.2
Absorbance at 294 nm and 420 nm
1.0
0.8
0.6
0.4
0.2
0.0
SPI Control sample TP1 TP2
A 294 nm
A 420 nm
Figure 1: 𝐴 294 and browning intensity analysis of SPI and SPI-
dextran solution treated by heat and TiO2 photocatalysis (control
sample, TP1 and TP2). The data with different lowercase letters in
the same test are significantly (𝑃 < 0.05) different.
increased 𝐴 294 , suggesting that the brown pigments were
formed in parallel to the generated intermediate products.
However, higher increase in 𝐴 294 , comparing to increase in
𝐴 420 , suggests high photocatalytic power could dominate the
early stage of the Maillard reaction. In general, we hoped to
reduce the formation of melanoidins and increase the yield of
uncolored products with better functional properties.
The Maillard reaction is also associated with the devel-
opment of fluorescent compounds. In the present study,
formation of fluorescent compounds was observed at pho-
tocatalyzed SPI-dextran solution suggesting the formation of
the resulting conjugate. Photocatalyzed samples have shown
increased fluorescence with maximum at about 331 nm when
excited at 290 nm originating from glycation products. Fluo-
rescence of Maillard products was the highest in SPI-dextran
solution at photocatalytic power of 1000 W (Figure 2) and
in accordance with spectrophotometric properties of tested
samples. The results suggested that photocatalysis can lead to
breakage of glycosidic bonds in dextran and so more number
of carbonyl groups are available for formation of SPI-dextran
conjugate, similar to those induced by irradiation resulting in
obvious increase in UV-absorbance and fluorescence [5].
3.2. Changes of Free Amino Groups Content. Changes in free
amino group content of SPI-dextran solution after different
photocatalytic power treatments are depicted in Figure 3.
The free amino groups content in the SPI-dextran model
system at photocatalytic power of 500 and 1000 W was
reduced by 14.7% and 21.1%, respectively, while little changes
were observed in control tests. These results suggested that
photocatalysis at higher power could promote the interaction
between free amino groups of SPI and carbonyl group
of dextran to form glycated product. From the results, it
is obvious that the decrease in free amino group was in
4 BioMed Research International

30 and reducing power were used as the standards to assess the

28 antioxidative activity of SPI-dextran solution and the result
26 is shown in Figure 4. Hydroxyl radical-scavenging activity
24
ratio of SPI-dextran conjugates was significantly increased
22
20
from approximately 0.81% to 11.5% and 14.2% at photocat-
Intensity (a.u.)

18 alytic power of 500 and 1000 W, respectively. However, no

16 significant changes were found in the control tests within
14 all the reactions (𝑃 > 0.05). The reducing power of SPI-
12 dextran conjugates (Figure 4(b)) showed similar trends with
10 those of radical scavenging activity. The results indicate
8
that SPI-dextran conjugates were free radical inhibitors and
6
4
reducing agents as well as their concentration increased with
2 photocatalytic power. Our findings are in agreement with an
0 earlier report on antioxidant activity of other model systems,
as a result of conjugates induced by gamma radiation in nisin
320 340 360 380 400 420 440 460
model system [20].
Wavelength (nm)
SPI TP1 3.4. Changes in Protein Pattern. SDS-PAGE was performed
Control sample TP2 to further confirm the covalent coupling of dextran and SPI
Figure 2: Fluorescence analysis of SPI and SPI-dextran solution after different photocatalytic power treatment as shown in
treated by heat and TiO2 photocatalysis (control sample, TP1 and Figure 5. Initially, the dextran components in the reaction
TP2). mixtures were not obtained by Coomassie blue staining; only
the soy protein subunits were observed. The soy protein
subunit bands in the control test are slightly lighter than
the untreated sample. On the other hand, photocatalytic
100 power exhibited a pronounced effect on crosslinking. More
soy protein subunits disappeared as the photocatalytic power
intensity increased. The new faint bands with much higher
Free amino acid groups content (%)

80 molecular weight on the top of the gel were observed in

60
40
20
0
SPI
Figure 3: Changes in free amino groups content of SPI and SPI-
dextran solution treated by heat and TiO2 photocatalysis (control
sample, TP1 and TP2). The data with different lowercase letters in
the same test are significantly (𝑃 < 0.05) different.
accordance with only a small increase in browning at 420 nm
(Figure 1), which was in accordance with the report of
Xu et al. [19] who reported that free amino groups in 𝛽-
conglycinin-dextran model system was decreased during the
Maillard reaction. Therefore the effect of photocatalysis on
the browning reaction and the loss of free amino groups are
actually ideal for the glycation of protein and polysaccharides.
3.3. Changes in Hydroxyl Radical Scavenging Activity and
Reducing Power. The hydroxyl radical scavenging abilities
SPI-dextran conjugates by TiO2 photocatalysis, indicating
that a large amount of new amino groups was exposed
and reacted with carbonyl groups to form Maillard-based
aggregates gradually because most noncovalent interactions
are generally disrupted in SDS-PAGE; this was shown in
the browning and free-amino analysis. These materials and
the high molecular weight may be related to its reducing
power and hydroxyl radical-scavenging activity. Similar SDS-
PAGE was found by Zhang et al., who reported that covalent
conjugating compounds were produced in 𝛽-conglycinin-
dextran model system treated by heating [21].
Control sample TP1 TP2 3.5. FT-IR Analysis. The spectroscopic analysis of poly-
meric molecules, including proteins, is complex due to the
molecular vibrations arising from numerous atoms. FT-IR
spectroscopy is a particularly useful technique for the study
of protein-carbohydrate systems, as there are several readily
identifiable regions of the mid-infrared spectrum where the
chemical fingerprints of carbohydrates and proteins do not
overlap significantly. As shown in Figure 6, a major band at
3299 cm−1 was observed in the spectra of SPI. This peak was
denoted to the stretching of hydrogen-bonded O–H groups.
Meanwhile, SPI exhibited two characteristic bands at 1649
(amide I, C=O stretching) and 1535 cm−1 (amide II, N–H
bending) [22]. For SPI-dextran conjugates, the regions of
1649 cm−1 and 1535 cm−1 , which are referred to as C–O and
C–N stretching from amide I and II, were modified by the
Maillard reaction (Figure 6). Compared with intact SPI, the
SPI-dextran conjugates at at photocatalytic power of 1000 W
rendered the lowest intensity. It might be expected that the
BioMed Research International 5

1.0
16

14
0.8
Radical scavenging activity (%)

12

10 0.6

A 700
8
0.4
6

4
0.2
2

0 0.0
SPI Control sample TP1 TP2 SPI Control sample TP1 TP2

Hydroxyl radical scavenging activity Reducing power

(a) (b)

Figure 4: Changes in hydroxyl radical scavenging activity (a) and reducing power (b) of SPI and SPI-dextran solution treated by heat and
TiO2 photocatalysis (control sample, TP1 and TP2). The data with different lowercase letters in the same test are significantly (𝑃 < 0.05)
different.

400

350

300

250
T (%)

200

150

100

50

500 1000 1500 2000 2500 3000 3500 4000 4500

(a) (b) (c)
Figure 5: SDS-PAGE of protein patterns of SPI and SPI-dextran
conjugates obtained by heat and TiO2 photocatalysis. ((a) SPI; (b)
control sample; (c) TP1; (d) TP2).
–OH group in dextran and the amino groups in SPI are
consumed in reaction mixture under TiO2 photocatalysis
treatment. Su et al. [22] found a gradual decrease in the
intensity of the bands at 1600–1400 cm−1 during the Maillard
reaction between carboxymethyl cellulose (CMC) and soy
protein isolate (SPI). For carbohydrates, a series of overlap-
ping peaks located in the region of 1180–953 cm−1 results from
vibration modes such as the stretching of C–C and C–O and
the bending mode of C–H bonds. These are often referred to
as the “saccharide” bands and are the most intense bands in
the mid-infrared spectrum. These absorptions are weak in the
spectra of most proteins [23]. The absorptions in the region of
(d) Wavelength (cm−1 )
SPI TP1
Dextran TP2
Control sample
Figure 6: Infrared spectra of SPI, dextran, and SPI-dextran conju-
gates obtained by heat and TiO2 photocatalysis (control sample, TP1
and TP2).
1180–953 cm−1 were stronger in SPI-dextran conjugate at the
different photocatalytic power and the control sample than in
SPI and weaker than dextran, indicating that there seemed to
be a saccharide attached to the SPI. In addition, in proteins,
there is an amide III band at 1300–1200 cm−1 . This band
is known to be very complex and mainly arises from C–N
stretching and N–H deformation. The entire spectral features
of the amide III band for the SPI-dextran solution at 500
and 1000 W (Figure 6) showed a decrease in intensity com-
pared to SPI and control sample. It might be expected that
6 BioMed Research International
Table 1: Secondary structure distribution of SPI and SPI-dextran
conjugates obtained by heat and TiO2 photocatalysis (control
sample, TP1 and TP2). Values with the same lowercase letters are
not significantly different (𝑃 > 0.05).
𝛼-helix 𝛽-sheet 𝛽-turns Random
(%) (%) (%) coil (%)
SPI 10.6 ± 0.2 37.9 ± 0.4 12.9 ± 0.1 38.6 ± 0.3
Control
10.3 ± 0.2 31.5 ± 0.3 18.3 ± 0.2 40.1 ± 0.4
sample
TP1 5.9 ± 0.1 20.3 ± 0.2 14.5 ± 0.4 59.8 ± 0.4
TP2 3.8 ± 0.1 10.4 ± 0.2 17.7 ± 0.4 68.8 ± 0.5
the chemical changes accompanying the Maillard reaction in
SPI would lead to several changes in the IR spectrum as a
result of the consumption of some functional groups (–NH2 ).
3.6. Secondary Structure Changes. The secondary structures
of dispersions of SPI and SPI-dextran conjugates under
classical heating or TiO2 photocatalysis conditions were
measured, and the detailed data of 𝛼-helix, 𝛽-sheet, 𝛽-
turns, and random coil levels are shown in Table 1. Native
dispersions of SPI contained approximately 10.6% 𝛼-helix,
39.9% of 𝛽-sheet, 10.9% of 𝛽-turns, and 38.6% of random
coil. Significant changes were observed after it was treated at
different photocatalytic power. The 𝛼-helix, 𝛽-sheet, 𝛽-turns,
and random coil were changed to approximately 5.9%, 20.3%,
14.5%, and 59.8% after being treated at 500 W. With increasing
photocatalytic power, 𝛼-helix, 𝛽-sheet, and random coil
changed remarkably to approximately 3.8%, 10.4%, and 68.8%
at 1000 W, whereas 𝛽-turns had only a slight change. How-
ever, slight but not significant changes were found in the
control tests. Higher photocatalytic power is more effective
in changing the secondary structure of soy protein in the
presence of dextran. Increasing photocatalytic power can
provide a larger degree of glycation, as also evidenced by
the loss of free amino groups, so that more dextran was
conjugated to soy protein, resulting in an increased content
of disordered structure. It proved that unordered structure
was dominant in the secondary structure for the glycated SPI.
These changes suggested that conjugating polysaccharides
to protein by covalent bonds (as shown by SDS-PAGE) can
lead to conformational changes to the secondary structure of
protein-polysaccharide conjugates.
4. Conclusion
SPI-dextran conjugate was successfully formed by TiO2
photocatalysis treatment. In particular, higher photocatalytic
power prompted glycation. Significant increases were found
in the antioxidant properties of SPI by its conjugation with
dextran after TiO2 photocatalysis treatment. Moreover, the
measured increase in antioxidant activity coincided with
an increase in the UV-vis absorption and fluorescence
intensity and a decrease in free amino group content. The
SDS-PAGE showed that a new high molecular mass was
produced and original soy protein subunits disappeared
after the conjugation induced by TiO2 photocatalysis. The
spectroscopic analysis using the FT-IR technique indicated
that the amide I, II, and III bands of SPI were modified
by dextran after TiO2 photocatalysis treatment. Additionally,
CD spectroscopy result further confirmed that glycation
could change soy protein secondary structure at higher
TiO2 photocatalytic power. These results suggested that TiO2
photocatalysis could potentially be applied as an effective way
for forming protein and polysaccharide conjugates. Further
work on conjugation between SPI and polysaccharides with
TiO2 photocatalysis treatment will be conducted to elucidate
the conjugating mechanism.
Conflict of Interests
The authors declare that there is no conflict of interests
regarding the publication of this paper.
Acknowledgments
We are grateful for the financial support from the Non-
Funding programs for Science and Technology Development
of Zhanjiang (no. 2013B01053), Supported by the Open
Project Program of Process of Starch and Vegetable Protein
Engineering Research Center of Ministry of Education (2013-
ERC-01), and China Spark Program (2014GA780072).
References
[1] L. X. Mu, M. M. Zhao, B. Yang, H. F. Zhao, C. Cui, and Q.
Z. Zhao, “Effect of ultrasonic treatment on the graft reaction
between soy protein isolate and gum acacia and on the physic-
ochemical properties of conjugates,” Journal of Agricultural and
Food Chemistry, vol. 58, no. 7, pp. 4494–4499, 2010.
[2] W. Z. Sun, M. M. Zhao, C. Cui, Q. Z. Zhao, and B. Yang, “Effect
of Maillard reaction products derived from the hydrolysate
of mechanically deboned chicken residue on the antioxidant,
textural and sensory properties of Cantonese sausages,” Meat
Science, vol. 86, no. 2, pp. 276–282, 2010.
[3] X. Zhang, J.-R. Qi, K.-K. Li et al., “Characterization of soy 𝛽-
conglycinin-dextran conjugate prepared by Maillard reaction in
crowded liquid system,” Food Research International, vol. 49, no.
2, pp. 648–654, 2012.
[4] J. A. Rufián-Henares, G. Arribas-Lorenzo, and F. J. Morales,
“Acrylamide content of selected Spanish foods: survey of bis-
cuits and bread derivatives,” Food Additives and Contaminants,
vol. 24, no. 4, pp. 343–350, 2007.
[5] M. S. Rao, S. P. Chawla, R. Chander, and A. Sharma, “Antioxi-
dant potential of Maillard reaction products formed by irradia-
tion of chitosan-glucose solution,” Carbohydrate Polymers, vol.
83, no. 2, pp. 714–719, 2011.
[6] Y.-G. Guan, H. Lin, Z. Han et al., “Effects of pulsed electric field
treatment on a bovine serum albumin-dextran model system,
a means of promoting the Maillard reaction,” Food Chemistry,
vol. 123, no. 2, pp. 275–280, 2010.
[7] D. Stanic-Vucinic, I. Prodic, D. Apostolovic, M. Nikolic, and
T. C. Velickovic, “Structure and antioxidant activity of 𝛽-lac-
toglobulin-glycoconjugates obtained by high-intensity-ultra-
sound-induced Maillard reaction in aqueous model systems
under neutral conditions,” Food Chemistry, vol. 138, no. 1, pp.
590–599, 2013.
BioMed Research International 7

[8] Y. Wang, L. Li, K. Yang, L. A. Samuelson, and J. Kumar, “Na- [23] F. L. Gu, J. M. Kim, S. Abbas, X. M. Zhang, S. Q. Xia, and Z.
nocrystalline TiO2 -catalyzed solid-state polymerization of dia- X. Chen, “Structure and antioxidant activity of high molecular
cetylene in the visible region,” Journal of the American Chemical weight Maillard reaction products from casein-glucose,” Food
Society, vol. 129, no. 23, pp. 7238–7239, 2007. Chemistry, vol. 120, no. 2, pp. 505–511, 2010.
[9] Y. Ide, N. Nakamura, H. Hattori et al., “Sunlight-induced effi-
cient and selective photocatalytic benzene oxidation on TiO2 -
supported gold nanoparticles under CO2 atmosphere,” Chemi-
cal Communications, vol. 47, no. 41, pp. 11531–11533, 2011.
[10] X. J. Lang, W. H. Ma, Y. B. Zhao, C. C. Chen, H. W. Ji,
and J. C. Zhao, “Visible-light-induced selective photocatalytic
aerobic oxidation of amines into imines on TiO2 ,” Chemistry—
A European Journal, vol. 18, no. 9, pp. 2624–2631, 2012.
[11] V. H. Nguyen, H. Y. Chan, J. C. S. Wu, and H. Bai, “Direct gas-
phase photocatalytic epoxidation of propylene with molecular
oxygen by photocatalysts,” Chemical Engineering Journal, vol.
179, no. 1, pp. 285–294, 2012.
[12] R. Chong, J. Li, X. Zhou et al., “Selective photocatalytic conver-
sion of glycerol to hydroxyacetaldehyde in aqueous solution on
facet tuned TiO2 -based catalysts,” Chemical Communications,
vol. 50, no. 2, pp. 165–167, 2014.
[13] X. Zhou, F. Peng, H. Wang, H. Yu, and Y. Fang, “Carbon nitride
polymer sensitized TiO2 nanotube arrays with enhanced visible
light photoelectrochemical and photocatalytic performance,”
Chemical Communications, vol. 47, no. 37, pp. 10323–10325, 2011.
[14] R. Caillard, G. E. Remondetto, and M. Subirade, “Physicochem-
ical properties and microstructure of soy protein hydrogels co-
induced by Maillard type cross-linking and salts,” Food Research
International, vol. 42, no. 1, pp. 98–106, 2009.
[15] L. You, M. Zhao, J. M. Regenstein, and J. Ren, “Changes in the
antioxidant activity of loach (Misgurnus anguillicaudatus) pro-
tein hydrolysates during a simulated gastrointestinal digestion,”
Food Chemistry, vol. 120, no. 3, pp. 810–816, 2010.
[16] L. Zheng, G. Su, J. Ren, L. Gu, L. You, and M. Zhao, “Isolation
and characterization of an oxygen radical absorbance activity
peptide from defatted peanut meal hydrolysate and its antiox-
idant properties,” Journal of Agricultural and Food Chemistry,
vol. 60, no. 21, pp. 5431–5437, 2012.
[17] U. K. Laemmli, “Cleavage of structural proteins during the
assembly of the head of bacteriophage T4,” Nature, vol. 227, no.
5259, pp. 680–685, 1970.
[18] Z.-M. Gao, L.-P. Zhu, X.-Q. Yang et al., “Soy lipophilic protein
nanoparticles as a novel delivery vehicle for conjugated linoleic
acid,” Food and Function, vol. 5, no. 6, pp. 1286–1293, 2014.
[19] C. H. Xu, S. J. Yu, X. Q. Yang, J. R. Q. Lin, and Z. G. Zhao,
“Emulsifying properties and structural characteristics of 𝛽-
conglycinin and dextran conjugates synthesised in a pressurised
liquid system,” International Journal of Food Science and Tech-
nology, vol. 45, no. 5, pp. 995–1001, 2010.
[20] S. R. Muppalla, R. Sonavale, S. P. Chawla, and A. Sharma, “Func-
tional properties of nisin-carbohydrate conjugates formed by
radiation induced Maillard reaction,” Radiation Physics and
Chemistry, vol. 81, no. 12, pp. 1917–1922, 2012.
[21] J.-B. Zhang, N.-N. Wu, X.-Q. Yang, X.-T. He, and L.-J. Wang,
“Improvement of emulsifying properties of Maillard reaction
products from 𝛽-conglycinin and dextran using controlled
enzymatic hydrolysis,” Food Hydrocolloids, vol. 28, no. 2, pp.
301–312, 2012.
[22] J.-F. Su, Z. Huang, X.-Y. Yuan, X.-Y. Wang, and M. Li, “Structure
and properties of carboxymethyl cellulose/soy protein isolate
blend edible films crosslinked by Maillard reactions,” Carbohy-
drate Polymers, vol. 79, no. 1, pp. 145–153, 2010.
Hindawi Publishing Corporation
BioMed Research International
Volume 2015, Article ID 948297, 6 pages
http://dx.doi.org/10.1155/2015/948297

Research Article
A Novel Reference Plasmid for the Qualitative Detection of
Genetically Modified Rice in Food and Feed

Liang Li, Mei Dong, Na An, Lixia Liang, Yusong Wan, and Wujun Jin
Biotechnology Research Institute, Chinese Academy of Agricultural Sciences-Inspection and Testing Center for
Environmental Risk Assessment of Genetically Modified Plant-Related Microorganism (Beijing), Ministry of Agriculture,
No. 12 Zhongguancun South Street, Haidian District, Beijing 100081, China

Correspondence should be addressed to Wujun Jin; jinwujun@caas.cn

Received 10 June 2015; Revised 30 July 2015; Accepted 23 August 2015

Academic Editor: Aspasia Nisiotou

Copyright © 2015 Liang Li et al. This is an open access article distributed under the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Rice is one of the most important food crops in the world. Genetically modified (GM) technology has been used in rice to confer
herbicide tolerance and pathogen or insect resistance. China invests heavily in research on GM rice. By the end of 2014, at least 250
transgenic rice lines had been developed in China. To monitor the presence of GM rice in food and feed, we collected information on
foreign elements from 250 transgenic rice lines and found 5 elements, including the Agrobacterium tumefaciens nopaline synthase
terminator (T-NOS), the cauliflower mosaic virus 35S promoter (CaMV35S), the ubiquitin gene (Ubi), the bar gene, and the
hygromycin phosphotransferase gene (Hpt), that are commonly present in GM rice. Therefore, we constructed a novel plasmid
(pBJGMM001) that contains fragments of these elements and two endogenous reference genes (the sucrose phosphate synthase
gene, SPS, and the phosphoenolpyruvate carboxylase gene, PEPC). pBJGMM001 can serve as a standard for detecting 96% of
GM rice lines in China. The primers, amplicons, reaction mixture, and PCR program were developed based on Chinese National
Standards. The protocol was validated and determined to be suitable for practical use in monitoring and identifying GM rice.

1. Introduction Rice is a staple crop, and many consumer concerns have

Rice (Oryza sativa L.), which is one of the most important
cereal crops in the world, is a fundamental food source that
provides nutrition for nearly half of the global population
[1]. Genetic transformation of rice has progressed rapidly in
recent decades to meet specific requirements, and a number
of agronomically important traits, including enhancement of
resistance to insects and diseases [2], tolerance to herbicides,
quality improvement [3], and increased nutritional value [4],
have been introduced into rice. Since the first transgenic rice
plant was obtained by Toriyama et al. in 1988, transformation
of rice has been an important issue in transgenic research
in the field of modern agricultural biotechnology [5–7]. In
August 2009, two insect-resistant rice varieties, Huahui 1
(TT51-1) and Bt Shanyou 63, obtained security certificates
allowing their production in Hubei province. Therefore,
China is likely to begin commercially cultivating GM rice
very soon [8].
arisen regarding the existence of transgenes in such crops
and the food chain in general. Consumers are also concerned
about the probable commercial release of GM crops in the
future. GM rice varieties developed in China are soon to be
approved for agricultural cultivation and production [9]. In
China, rice accounts for more than 20% of the total planted
area and high harvest yields of conventional rice are achieved
through heavy use of herbicides and pesticides. The use of
GM rice varieties conferring resistance to pests or tolerance
to herbicides will help to reduce the use of chemicals for
crop protection [10]. Although GM rice may increase the
efficiency of modern agriculture and provide other benefits,
not all global markets fully accept GM products for a variety
of reasons, including the introduction of new allergens, the
possible development of antibiotic-resistant bacterial strains,
and the modification of environmental biodiversity [11]. To
monitor and verify the presence and distribution of GM
rice, there is a need for GM detection methods that are
2 BioMed Research International

Table 1: Primer information for pBJGMM001.

Target Primers Sequences (5󸀠 -3󸀠 ) Amplicon (bp) Source

SPS-F ATCTGTTTACTCGTCAAGTGTCATCTC
SPS 287 MOA 1861-1-2012 [26]
SPS-R GCCATGGATTACATATGGCAAGA
PEPC-F TCCCTCCAGAAGGTCTTTGTGTC
PEPC 271 MOA 1861-1-2012 [26]
PEPC-R GCTGGCAACTGGTTGGTAATG
NOS-F GAATCCTGTTGCCGGTCTTG
T-NOS 180 MOA 953-6-2007 [27]
NOS-R GAATCCTGTTGCCGGTCTTG
35S-F GCTCCTACAAATGCCATCATTGC
CaMV35S 195 MOA 953-6-2007 [27]
35S-R GATAGTGGGATTGTGCGTCATCCC
Ubi-F CCGTAATAAATAGACACCC
Ubi 314 SN/T 1943-2007 [28]
Ubi-R AACACTGGCAAGTTAGCAAT
Bar-F GCTGCCAGAAACCCACGTCAT
Bar 430 SN/T 1197-2003 [29]
Bar-R ACCATCGTCAACCACTACACCG
Hpt-F TCGCCTCGCTCCAGTCAATG
Hpt 472 MOA 1782-2-2012 [30]
Hpt-R GTTCACAGGGTGTCACGTTGC

accurate, fast, and inexpensive. Various methodologies have
been developed to analyze and/or detect the presence of
GMOs in food products using PCR [12], enzyme-linked
immunosorbent assays (ELISAs) [13], microarrays [14], and
electrophoresis [15]. These DNA- or protein-based methods
are versatile, sensitive, specific, and precise.
PCR has become the technique of choice for the determi-
nation of GMOs in a sample [16, 17]. PCR-based techniques
that target well-chosen, specific transgenic DNA segments
have been demonstrated to be among the most adequate and
efficient methods for the qualification and quantification of
transgenic crops. This is primarily due to the stable nature of
the DNA molecule as well as the extreme sensitivity of PCR
technology [18]. PCR methods depend on certified reference
materials, which are used for the calibration or quality control
of GMO measurements. Plasmids have been demonstrated to
be a good alternative to reference materials for GMO detec-
tion [19, 20]. Currently, single- or multiple-target plasmids,
containing either one GM-specific or endogenous sequence
or several specific GM elements from one species, have
been developed as reference materials [20–25]. However, few
standard reference molecules containing GM elements from
rice have been reported.
The aims of this study were to develop a reference plasmid
for greater coverage of the possible GM ingredients in food
or feed products using the following steps: (I) investigation
of the status of transgenic rice in China, (II) construction
and validation of a reference plasmid, and (III) application
to practical sample analysis. Additionally, the novel standard
reference molecule developed in this study, which includes
rice endogenous reference genes and sequences of GM
elements from rice, was demonstrated to be a valid substitute
for certified positive reference materials in GM rice detection.
2. Material and Methods
2.1. Plant Samples and Reagents. To prepare samples con-
taining the exogenous and endogenous target sequences,
genuine seeds from the GM rice varieties TT51-1, Kangyou97,
Kefeng6, Kefeng8, KMD1, Bar68-1, and Bar66-1 as well
as nontransgenic rice seeds were collected by members
of our laboratory. Plant genomic DNA was isolated from
rice flour using the Wizard Magnetic DNA Purification
System for Food according to the manufacturer’s instructions
(Promega, Madison, WI, USA). The DNA pellets were dis-
solved in 100 𝜇L of nuclease-free water. DNA quantification
was performed using a PicoGreen assay (Quant-iT PicoGreen
dsDNA Kit, Invitrogen, Carlsbad, CA, USA), and the samples
were diluted to a 50 ng/𝜇L working stock, which was stored in
aliquots at −80∘ C. Restriction enzymes were purchased from
New England Biolabs (Ipswich, MA). DNA synthesis, primer
synthesis, and DNA sequencing were performed by Genewiz,
Inc. (Suzhou, China).
2.2. Construction of the pBJGMM001 Plasmid. To efficiently
construct the plasmid, the exogenous and endogenous frag-
ments were cloned into the EcoRV site of a pUC57 vector.
We used validated PCR-based methods to amplify exogenous
and endogenous genes using Chinese National Standard
PCR primers (Table 1), amplification reaction mixtures (a
25 𝜇L reaction volume containing GoTaq Green Master Mix
(2x) 12.5 𝜇L, each primer 0.5 𝜇L (10 𝜇M), DNA template
(25 ng/𝜇L) 2.0 𝜇L, and ddH2 O 9.5 𝜇L), and amplification
cycling parameters (initial denaturation at 94∘ C for 5 min, 40
cycles of denaturation at 94∘ C for 30 sec, annealing at 58∘ C
for 30 sec, extension at 72∘ C for 30 sec, and final extension at
72∘ C for 10 min and cooling to 4∘ C). The ampicillin-resistant
plasmid was transformed into Escherichia coli, and the
transformed strain was stored at −80∘ C. Five liters of Luria-
Bertani (LB) medium containing 100 𝜇g/mL ampicillin was
inoculated with 5 mL of a preculture of E. coli containing the
plasmid pBJGMM001 and was shaken vigorously overnight
at 37∘ C. The culture was then centrifuged at 4∘ C, and the
plasmid DNA was isolated and purified using the PureYield
Plasmid Midiprep System (Promega, Madison, WI, USA)
according to the manufacturer’s protocol. Plasmid samples
were stored in Axygen tubes (1 ng/𝜇L pBJGMM001 in 500 𝜇L
of buffer (1 mM Tris, 0.01 mM EDTA, pH 8.0); 106 copies/𝜇L).
BioMed Research International 3

2.3. Purification and Characterization of the Reference Plasmid Table 2: Probability statistics of the screening detection of GM
pBJGMM001. As a reference molecule, pBJGMM001 was rice. P-35S, cauliflower mosaic virus 35S promoter; T-NOS, Agrobac-
processed as follows. terium tumefaciens nopaline synthase terminator; Hpt, hygromycin
phosphotransferase gene; Ubi, ubiquitin gene; Bar, bar gene.
(a) Plasmid DNA isolated from the transformed E. coli
Elements Frequency Total Coverage
cells was sequenced completely to verify that all target
DNAs were present and correctly cloned. P-35S 181 250 72.40%
P-35S + T-NOS 209 250 83.60%
(b) The concentration and purity of the plasmid DNA P-35S + T-NOS + Hpt 228 250 91.20%
preparation were measured via UV spectrophotom-
P-35S + T-NOS + Hpt + Ubi 237 250 94.80%
etry. The purity of the nucleic acid was assessed spec-
P-35S + T-NOS + Hpt + Ubi + Bar 240 250 96.00%
trophotometrically by comparing the UV absorbance
of the sample at 260 nm to that at 280 nm. Taking
MCS
into account the generally accepted mean extinction EcoRV
coefficients for double-stranded DNA at 260 nm and APr PEPC
280 nm, pure nucleic acid samples are expected to
have an A260/A280 ratio of approximately 1.8 and an SPS
A260/A230 ratio above 2.0 [31].
(c) The purity of plasmid pBJGMM001 was analyzed by P-CaMV35S
pBJGMM001
agarose gel electrophoresis.
5078 bp T-NOS

3. Results and Discussion REP

3.1. Investigation of GM Rice Development in China. GM
rice in China was investigated using the following tools:
the Chinese National Knowledge Infrastructure database
(http://www.cnki.net/), the Wanfang database (http://www
.wanfangdata.com.cn/), scientific papers (Elsevier, Springer,
ACS, and others), the GMO Detection Method database
(http://gmdd.shgmo.org/), and Detection and Monitoring of
GM Crops of China (http://www.gmcrop.cn/). We summa-
rized the available information on exogenous genes, regula-
tory elements, and screening markers in GM rice. Based on
this information, a statistical analysis was performed to select
the genes that appear most frequently in GM rice.
When designing the novel plasmid, we aimed to use
fewer elements to achieve greater detection coverage. As
a first step toward this goal, we investigated the status of
GM rice development in China from 1989 to 2014. Based
on a database search, we determined that the total number
of papers published on GM rice varieties is approximately
250 (Supplementary Table S1 in Supplementary Materi-
als available online at http://dx.doi.org/10.1155/2015/948297).
These varieties include TT51-1, which received a biosafety
certificate, and other GM lines undergoing field trials and
lines that are currently in the development stage in China.
The investigation revealed a large number of commonly
occurring transgenic elements, including the following: the
cauliflower mosaic virus 35S promoter (CaMV35S), the
Agrobacterium tumefaciens nopaline synthase terminator (T-
NOS), the hygromycin phosphotransferase gene (Hpt), the
ubiquitin gene (Ubi), the 𝛽-glucuronidase gene (GUS), the
bar gene (Bar), the actin promoter (P-Act), the Agrobac-
terium tumefaciens nopaline synthase promoter (P-NOS),
the neomycin phosphotransferase II gene (NPTII), and the
cauliflower mosaic virus 35S terminator (T-35S).
Due to this large number of common elements, most
of the GMO detection laboratories around the world have
started performing initial PCR-based screens followed by
Bar
MCS Ubi
EcoRV Hpt
Figure 1: Schematic diagram of the integrated fragments in
pBJGMM001. The image of the plasmid structure was generated
using WinPlas 2.7 software (Rich Goldstein).
more specific identification and quantification assays (when
appropriate and required by legislation). The use of initial
screens that target elements common to multiple GM events
can facilitate rapid and cost-effective discrimination of GMO
and GMO-free samples [32]. Based on the investigation
results, we selected five exogenous genes (CaMV35S, T-NOS,
Ubi, Bar, and Hpt) as the detection targets, which achieved
detection coverage of 96% (Table 2).
3.2. Construction and Purification of pBJGMM001. The
pBJGMM001 plasmid contained DNA sequences from part
of the rice taxon-specific SPS gene, the PEPC gene, and the
exogenous elements CaMV35S, T-NOS, Ubi, Bar, and Hpt
(Figure 1). The exogenous and endogenous gene fragments
were cloned into the EcoRV site of the pUC57 vector. In vitro
DNA synthesis of the entire target fragment saves time and is
easier compared to traditional overlapping PCR. Using gene
synthesis, researchers save money on the reagents needed
for plasmid construction, cloning, and sequencing and can
also save time by outsourcing the synthesis of gene sequences
that are difficult to clone, thereby avoiding repeated cloning
failures. Moreover, ∼10 bp was added to both amplicons to
increase the amplification efficiency.
Plasmid pBJGMM001 was fully sequenced by three
independent laboratories. The results were consistent with
expectations (data not shown). The sequence analysis did
4 BioMed Research International

Table 3: Results of the practical screening test. “+” indicates

theoretically positive; “−” indicates theoretically negative.

Targets in pBJGMM001
Events
SPS PEPC P-CaMV35S T-NOS Bar Ubi Hpt
TT51-1
Elements + + − + − − −
Results + + − + − − −
Kangyou 97
Figure 2: Validation of the specific sequences of endogenous rice Elements + + − + − − +
reference genes and exogenous genes. The image shows 2.0% agarose Results + + − + − − +
gel electrophoresis of the amplification products obtained via PCR. Kefeng6
M, ladder; lanes 1–7: SPS (287 bp; lane 1), PEPC (271 bp; lane 2), T- Elements + + + + − + +
NOS (180 bp; lane 3), CaMV35S (195 bp; lane 4), Ubi (314 bp; lane 5),
Bar (430 bp; lane 6), and Hpt (472 bp; lane 7). Results + + + + − + +
Kefeng8
Elements + + − + − + −
not reveal the presence of a mixed population of plasmids. Results + + − + − + −
The A260/A280 and A260/A230 ratios measured for the KMD1
plasmid solution were 1.90±0.04 and 2.12±0.03, respectively, Elements + + + + − + +
indicating sufficient DNA purity; however, such values do not Results + + + + − + +
exclude the possibility that traces of contaminating protein Bar68-1
may be present. Because no smear was visible in the plasmid Elements + + + + + − −
preparation and no RNA band was visible, it can be concluded Results + + + + + − −
that the plasmid preparation was not contaminated with
Bar66-1
external genomic DNA or a large amount of RNA (data not
Elements + + + + + − −
shown). However, traces of genomic DNA or RNA from
host bacterial cells cannot be excluded in the final plasmid Results + + + + + − −
preparation. Such traces do not influence the detection of Non-GM
target sequences. Elements + + − − − − −
Amplified fragments of SPS (287 bp), PEPC (271 bp), T- Results + + − − − − −
NOS (180 bp), CaMV35S (195 bp), Ubi (314 bp), Bar (430 bp),
and Hpt (472 bp) were observed when pBJGMM001 DNA
was used as a template for amplification (Figure 2). The as a staple food for nutrition and caloric intake. Due to
primer pairs were designed to specifically amplify a region the importance of rice to humans, major efforts have been
containing both a trait gene and a regulatory gene, such as a made to improve its properties through genetic alterations
terminator. [11]. The newly developed screening plasmid pBJGMM001
permits greater coverage of food and feed products that may
3.3. Application Assay. In this study, to investigate the utility contain GM ingredients. The results of the tests performed in
of pBJGMM001 in practical samples, we tested samples from the current study can be compared with the results obtained
all potential commercial GM rice lines, including TT51-1, using existing PCR targets in the Chinese National Standards.
Kangyou97, Kefeng6, Kefeng8, KMD1, Bar68-1, and Bar66-1. The plasmid provides better coverage of the GM elements that
Only the positive samples contained the target elements, and could be present in a sample and will facilitate advancements
amplification signals were not observed for the non-GM rice in the detection of unauthorized/unknown GM rice. The
(Table 3). reduced need for subsequent identification tests makes the
The GM rice materials used in the application assay use of this plasmid a cost-beneficial strategy. Indeed, this
are currently undergoing testing and are therefore not yet novel plasmid represents an upgrade due to its many useful
available for human consumption. Many other GM rice screening elements, including promoter and terminator frag-
varieties are also in development. However, trace amounts of ments. pBJGMM001 will be certified as a reference material
these GM varieties have been found in the food supplies in in China. The data reported here regarding GM rice in China
Europe and China [33]. Our test results are consistent with and GMOs are valuable tools that can assist in the detection
databases and other references, and the amplification results of accidentally introduced unauthorized GM events in the
indicated that the pBJGMM001 plasmid developed in this global food and supply chain. The reported plasmid facilitates
study is suitable for use in practical analyses of rice samples. efficient, rapid, and cost-effective preliminary screening by
eliminating the need for the development of specific testing
4. Conclusions methodologies for GM rice.
pBJGMM001 was designed after considerable investiga-
Rice is one of the most important food crops worldwide, tion and will be used as a certified reference material. The
and most people in developing countries depend on rice detection coverage of pBJGMM001 reached 96% in all GM
BioMed Research International
rice lines in China. Furthermore, the developed assays were
successfully used to test six practical samples from different
GM rice lines. All of the results indicated that the established
plasmid is a convenient, rapid, and low-cost method for the
routine detection of GM rice. The sequence of pBJGMM001
is available from NCBI under accession number KR493382.
Conflict of Interests
The authors declare no conflict of interests.
Acknowledgment
This work was supported by the National Major Spe-
cial Project for the Development of Transgenic Organisms
(2014ZX08012-003 and 2014ZX08012-01B).
References
[1] B.-R. Lu and A. A. Snow, “Gene flow from genetically modified
rice and its environmental consequences,” BioScience, vol. 55,
no. 8, pp. 669–678, 2005.
[2] J. Huang, R. Hu, S. Rozelle, and C. Pray, “Insect-resistant GM
rice in farmers’ fields: assessing productivity and health effects
in China,” Science, vol. 308, no. 5722, pp. 688–690, 2005.
[3] T. Ariizumi, S. Kishitani, R. Inatsugi, I. Nishida, N. Murata,
and K. Toriyama, “An increase in unsaturation of fatty acids
in phosphatidylglycerol from leaves improves the rates of
photosynthesis and growth at low temperatures in transgenic
rice seedlings,” Plant and Cell Physiology, vol. 43, no. 7, pp. 751–
758, 2002.
[4] J. A. Paine, C. A. Shipton, S. Chaggar et al., “Improving the
nutritional value of Golden Rice through increased pro-vitamin
A content,” Nature Biotechnology, vol. 23, no. 4, pp. 482–487,
2005.
[5] K. Toriyama, Y. Arimoto, H. Uchimiya, and K. Hinata, “Trans-
genic rice plants after direct gene transfer into protoplasts,”
Nature Biotechnology, vol. 6, no. 9, pp. 1072–1074, 1988.
[6] H. M. Zhang, H. Yang, E. L. Rech et al., “Transgenic rice
plants produced by electroporation-mediated plasmid uptake
into protoplasts,” Plant Cell Reports, vol. 7, no. 6, pp. 379–384,
1988.
[7] W. Zhang and R. Wu, “Efficient regeneration of transgenic
plants from rice protoplasts and correctly regulated expression
of the foreign gene in the plants,” Theoretical and Applied
Genetics, vol. 76, no. 6, pp. 835–840, 1988.
[8] Ministry of Agriculture of the People’s Republic of China
(MOA), “The second list of approved security certif-
icates of agricultural GMOs,” 2009, http://www.stee.agri.gov
.cn/biosafety/spxx/.
[9] D. Mäde, C. Degner, and L. Grohmann, “Detection of geneti-
cally modified rice: a construct-specific real-time PCR method
based on DNA sequences from transgenic Bt rice,” European
Food Research and Technology, vol. 224, no. 2, pp. 271–278, 2006.
[10] S. Bajaj and A. Mohanty, “Recent advances in rice biotech-
nology—towards genetically superior transgenic rice,” Plant
Biotechnology, vol. 3, no. 3, pp. 275–307, 2005.
[11] A. Bakshi, “Potential adverse health effects of genetically mod-
ified crops,” Journal of Toxicology and Environmental Health,
Part B: Critical Reviews, vol. 6, no. 3, pp. 211–225, 2003.
5
[12] I. Taverniers, E. Van Bockstaele, and M. De Loose, “Cloned
plasmid DNA fragments as calibrators for controlling GMOs:
different real-time duplex quantitative PCR methods,” Analyt-
ical and Bioanalytical Chemistry, vol. 378, no. 5, pp. 1198–1207,
2004.
[13] H.-J. Brunnert, F. Spener, and T. Börchers, “PCR-ELISA for
the CaMV-35S promoter as a screening method for genetically
modified roundup ready soybeans,” European Food Research
and Technology, vol. 213, no. 4-5, pp. 366–371, 2001.
[14] J. Wang, “Survey and summary from DNA biosensors to gene
chips,” Nucleic Acids Research, vol. 28, no. 16, pp. 3011–3016,
2000.
[15] P. J. Obeid, T. K. Christopoulos, and P. C. Ioannou, “Rapid anal-
ysis of genetically modified organisms by in-house developed
capillary electrophoresis chip and laser-induced fluorescence
system,” Electrophoresis, vol. 25, no. 6, pp. 922–930, 2004.
[16] D. Rodrı́guez-Lázaro, B. Lombard, H. Smith et al., “Trends in
analytical methodology in food safety and quality: monitoring
microorganisms and genetically modified organisms,” Trends in
Food Science and Technology, vol. 18, no. 6, pp. 306–319, 2007.
[17] D. S. Elenis, D. P. Kalogianni, K. Glynou, P. C. Ioannou,
and T. K. Christopoulos, “Advances in molecular techniques
for the detection and quantification of genetically modified
organisms,” Analytical and Bioanalytical Chemistry, vol. 392, no.
3, pp. 347–354, 2008.
[18] E. Anklam, F. Gadani, P. Heinze, H. Pijnenburg, and G. D. van
den Eede, “Analytical methods for detection and determination
of genetically modified organisms in agricultural crops and
plant-derived food products,” European Food Research and
Technology, vol. 214, no. 1, pp. 3–26, 2002.
[19] L. Yang, A. Pan, K. Zhang et al., “Qualitative and quantitative
PCR methods for event-specific detection of genetically modi-
fied cotton Mon1445 and Mon531,” Transgenic Research, vol. 14,
no. 6, pp. 817–831, 2005.
[20] H. Kuribara, Y. Shindo, T. Matsuoka et al., “Novel reference
molecules for quantitation of genetically modified maize and
soybean,” Journal of AOAC International, vol. 85, no. 5, pp. 1077–
1089, 2002.
[21] M. Burns, P. Corbisier, G. Wiseman et al., “Comparison of
plasmid and genomic DNA calibrants for the quantification of
genetically modified ingredients,” European Food Research and
Technology, vol. 224, no. 2, pp. 249–258, 2006.
[22] L. Yang, J. Guo, A. Pan et al., “Event-specific quantitative
detection of nine genetically modified maizes using one novel
standard reference molecule,” Journal of Agricultural and Food
Chemistry, vol. 55, no. 1, pp. 15–24, 2007.
[23] X. Wang, D. Teng, D. Xi, Q. Guan, and J. Wang, “Construction
of a reference plasmid containing ten targets for the detection of
genetically modified crops,” Plasmid, vol. 69, no. 1, pp. 108–113,
2013.
[24] X. Wang, Q. Tang, L. Dong et al., “Construction of a standard
reference plasmid containing seven target genes for the detec-
tion of transgenic cotton,” Plasmid, vol. 74, pp. 39–44, 2014.
[25] L. Li, X. Zhang, Y. Wan, and W. Jin, “Development of a novel
reference plasmid for accurate quantification of genetically
modified Kefeng6 rice DNA in food and feed samples,” BioMed
Research International, vol. 2013, Article ID 134675, 7 pages,
2013.
[26] Ministry of Agriculture of the People’s Republic of China
(MOA), “Detection of genetically modified plants and derived
products—target-taxon-special qualitative PCR method for
rice,” Chinese National Standards 1861-1-2012, MOA, 2012.
6 BioMed Research International

[27] Ministry of Agriculture of the People’s Republic of China

(MOA), “Detection of genetically modified plants and their
derived products—qualitative PCR method for pest transgenic
for Bt gene,” Chinese National Standards MOA 953-6-2007,
Ministry of Agriculture of the People’s Republic of China
(MOA), 2007.
[28] Administration of Quality Supervision-Inspection and Quar-
antine (AQSIQ), “Protocol of the polymerase chain reaction
and real-time PCR for qualitative detecting genetically modified
components in transgenic wheat,” Chinese National Standards
SN/T 1943-2007, 2007.
[29] Administration of Quality Supervision-Inspection and Quar-
antine (AQSIQ), “Protocol of the polymerase chain reaction
for detecting genetically modified components in rapeseeds,”
Chinese National Standards SN/T 1197-2003, 2003.
[30] Ministry of Agriculture of the People’s Republic of China
(MOA), “Detection of genetically modified plants and derived
products—qualitative PCR method for the marker genes NPT
II, HPT and PMI,” Chinese National Standards MOA 1782-2-
2012, Ministry of Agriculture of the People’s Republic of China
(MOA), 2012.
[31] P. Held, “Measure your purity: assessment of nucleic acid purity
via UV absorbance,” G.I.T. Laboratory Journal, vol. 12, pp. 9–11,
2008.
[32] G. J. Randhawa, D. Morisset, M. Singh, and J. Žel, “GMO matrix:
a cost-effective approach for screening unauthorized genetically
modified events in India,” Food Control, vol. 38, no. 1, pp. 124–
129, 2014.
[33] B. Huggett, “EU to monitor for Chinese GM rice,” Nature
Biotechnology, vol. 26, no. 5, p. 478, 2008.
Hindawi Publishing Corporation
BioMed Research International
Volume 2015, Article ID 835151, 10 pages
http://dx.doi.org/10.1155/2015/835151

Research Article
Effect of Chitosan Coating with Cinnamon Oil on the Quality
and Physiological Attributes of China Jujube Fruits

Yage Xing,1 Hongbin Lin,1 Dong Cao,1 Qinglian Xu,1 Wenfeng Han,2 Ranran Wang,1
Zhenming Che,1 and Xihong Li3
1
Key Laboratory of Grain and Oil Processing and Food Safety under the Supervision of Sichuan Province,
College of Food and Bioengineering, Xihua University, Chengdu 610039, China
2
School of Food Engineering, Luohe College of Vocational Technology, Luohe 462000, China
3
School of Food Engineering and Biotechnology, Tianjin University of Science & Technology, Tianjin 300457, China

Correspondence should be addressed to Qinglian Xu; 775938414@qq.com

Received 22 May 2015; Revised 29 July 2015; Accepted 30 July 2015

Academic Editor: Nikos Chorianopoulos

Copyright © 2015 Yage Xing et al. This is an open access article distributed under the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Effects of chitosan coating with cinnamon oil on the physiological attributes and preservation quality of China jujube fruits during
storage at 4∘ C for 60 days were investigated. Results indicated that weight loss and decay of jujube fruits were significantly reduced
by chitosan-oil coating during the period of 60-day storage, which also exhibited a quite beneficial effect on maintaining the sensory
quality for jujube fruits. Meanwhile, the contents of vitamin C and titratable acid decreased to 3.08 mg⋅g−1 and 0.342% for the fruits
treated by chitosan-oil coating (1.0% + 0.10%), respectively. Polyphenol oxidase, superoxide dismutase, and peroxidase activities
were 13.40 U⋅g−1 , 14.53 U⋅g−1 , and 63.6 U⋅g−1 at the end of storage, respectively. The contents of total soluble phenolics and MDA were
34.51 mg⋅g−1 and 19.43 𝜇mol⋅g−1 for the combined coating treated samples and control fruits, respectively. These results suggested
that the chitosan-oil coating might be recognized as one efficiency technology on the preservation quality of jujube fruits during
the storage time.

1. Introduction as the application of chitosan and essential oils, which has

Jujube is a native fruit in China with the long history of
over 2500 years [1–3]. Lingwu Long Jujube fruit (Ziziphus
jujuba Mill cv.), one of the local colored fresh-eat jujube
fruits in Ningxia, has the special flavor and could provide
various sources of nutrition for costumer. However, the
further industrial and economic development of jujube fruit
is limited because of its short shelf-life, only 15-day storage
at room temperature, and severe losses during storage [3–
5]. Moreover, the ripening and accelerated senescence could
induce the short storage life and bad quality of jujubes for the
long time of storage. Although the utilization of fungicides
is the primary means of controlling postharvest diseases and
decay, the problems of negative impact for using excessively
on the costumer health have prompted awareness recently.
The investigation for the safe alternatives by many researchers
is increasing on the storage of fruits and vegetables, such
been widely used due to its beneficial effects for delaying
senescence and maintaining quality [5].
The possibility of edible coating to carry essential oil is
being studied because the oil as antimicrobial agent can be
released slowly from coating carriers to the food surface and
maintain the option oil concentrations in the microenviron-
ment. Chitosan is a natural carbohydrate biopolymer with
different functional groups (primary -OH, secondary -OH,
and NH) [6, 7], which is applied widely in the storage of fruits
and vegetables because of its film-forming and antimicrobial
activities [8]. As the result reported by Romanazzi et al. [9],
blue mold rots of sweet cherry were reduced and controlled
by chitosan dipping. The investigation of Chien et al. [10]
demonstrated that the treatment of chitosan coating on the
citrus fruit exhibited the controlling effect on the decay of
fruit during the storage time. Furthermore, essential oils
incorporated into the chitosan coating as the carrier could
2 BioMed Research International
greatly enhance its antimicrobial property for application on
the storage of fruits [11, 12].
Application of essential oils, such as cinnamon oil and
clove oil, has attracted increasing interest due to its better
antimicrobial activity against bacteria, yeasts, and moulds
and higher safety to environment and costumer [12–16].
Xing et al. [17] reported that the treatment of chitosan-
oil coating could provide the better effect on the quality
and decay of sweet peppers during storage. Furthermore,
the conidial germination and mycelial growth of all fungi
on banana could also be inhibited by cinnamon oil [12].
The investigation of Xing et al. [3] also reported that, in
the in vivo study, Penicillium citrinum growth on wound
inoculated fruits could be completely controlled by the
coating with cinnamon oil at 2.0% [3]. As reported by Xing
et al. [16], the combined application of antibrowning agents,
oil fumigation, and moderate vacuum packaging (MVP)
was reported to delay the microbiological deterioration and
prolonged the shelf-life of lotus root slices [16]. However,
there is no published investigation regarding the effect of
chitosan coating with cinnamon oil on the physiological
attributes and preservation quality of jujube fruits without
wound inoculation during the storage period.
The objective of this investigation was to evaluate the
effects of chitosan-oil coating on physiological attributes
and preservation quality of Lingwu Long Jujube fruits. The
decay, weight loss, sensory acceptability, titratable acidity,
and vitamin C content were determined for jujube fruits
with different treatments during storage at 4∘ C for 60 days,
respectively. Furthermore, peroxidase (POD), polyphenol
oxidase (PPO) and superoxide dismutase (SOD) activity,
the total soluble phenolic content, malondialdehyde (MDA)
content, and membrane permeability in fruits were also
evaluated during the whole storage time, respectively.
2. Materials and Methods
2.1. Preparation of Chitosan-Based Coating. The chitosan
coating was prepared as the method reported by Xing et
al. [3] and Xing et al. [17]. The chitosan (1.0%) solution
contained glycerol (0.75%) and acetic acid (0.5%) was stirred
at room temperature for 1 h (chitosan, deacetylated ≥95%,
Jinan Haidebei Marline Bioengineering Co. Ltd., Jinan,
China). Then, cinnamon oil (Xianghui Biotechnology Co.
Ltd., Shanghai, China) with the concentration of 0 and 0.10%
mixed with Tween 80 (0.2%) was added and stirred for
another 30 min, respectively. Food grade dimethyl silicon oil
(0.1%) was added as an antifoaming agent. The final solution
was homogenized at 21600 rpm under aseptic conditions for
1 min. The solution without the addition of cinnamon oil and
chitosan was prepared as the control coating. The obtained
coating could be used after standing for 1 h.
The harvested Lingwu Jujube fruits (Ziziphus jujuba
Mill cv.) were chosen with absence of disease infection or
physical injuries firstly. These chosen fruits were divided
into four groups (1200 fruits/each group) after being surface-
disinfected with sodium hypochlorite (2%, w/v) for 3 min,
air-dried, and precooled at 0∘ C for 12 h. Jujube fruits were
dipped into four different treatment coating solutions for
5 min (1, control; 2, chitosan coating (1.0%); 3, oil (0.10%)
treatment; 4, chitosan (1.0%) + oil (0.10%)), respectively.
Furthermore, the coated fruits were well dispersed in the tray
and packaged with a polypropylene film (80 cm × 60 cm, 120
fruits/bag). And then the packaged fruits were stored at 4∘ C
after being kept over a plastic sieve for 5 min and air-dried for
60 min.
2.2. Determination of Inhibitory Zone of Chitosan-Oil Coating
and Cinnamon Oil. The antimicrobial activity of different
coating was evaluated using the agar diffusion method,
respectively [4, 15, 18, 19]. For Escherichia coli and Staphy-
lococcus aureus, the sample disc (𝐷 = 10 mm) impregnated
with 10 𝜇L different solution was placed on LB plate, which
had been spread with 100 𝜇L bacterial suspension with 104 –
105 CFU⋅mL−1 of tested bacteria, respectively. For antifungal
activity, the disc (𝐷 = 10 mm) impregnated with 10 𝜇L
different solution was placed on potato dextrose agar plate,
which had been spread with 100 𝜇L bacterial suspension
with 104 –105 conidia⋅mL−1 of Rhizopus nigricans, Penicil-
lium citrinum, Aspergillus flavus, and Penicillium expansum,
respectively. The plates were incubated at 37∘ C for 24 h for
bacteria and at 28∘ C for 72 h for fungi in the incubation
chamber, respectively, and then the diameters of “inhibition
zone” were measured.
2.3. Morphological Observation by Atomic Force Microscopy
and Scanning Electron Microscopy. The dried coating piece
sample was observed by AFM with a 3.51 𝜇m vertical range
and an 80 mm × 80 mm scan size (atomic force microscopy)
in tapping mode using a multimode JSPM-5200 AFM (JEOL,
Japan), which was equipped with the Si3N4 cantilevered
scanner [17, 20]. Furthermore, after being placed on the
stub using two-sided adhesive tapes and Pt sputtering, the
dried coating was also observed by SEM (scanning electron
microscopy) at a voltage of 5 kV acceleration [2].
2.4. Fruits Decay Rate, Sensory Acceptability, Weight Loss,
Titratable Acidity, and Vitamin C Content. The total count
and decayed count of fruits were counted during the storage
time, respectively. The decay rate was calculated as follows:
fruit decay rate (%) = (the decayed count of fruits × 100/the
total count of fruits) [3]. On the other hand, after being
surfaced and disinfected and air-dried, sensory acceptability
of jujube fruits was evaluated and rated on a nine-point
hedonic scale (9, excellent; 7, very good; 5, good; 3, fair; and
1, poor) by six panelists in random [3, 21]. The weight loss,
titratable acidity, and vitamin C in samples were determined
as the method developed by Xing et al. [17], Odriozola-
Serrano et al. [22], and Xing et al. [16].
2.5. PPO, POD, and SOD Activities. The PPO activity in
jujube fruits was determined according to the method
conducted by Xing et al. [3] and Xing et al. [17]. Fruits
tissue (1.0 g) was homogenized in an ice bath with 2.0 mL
extraction buffer (sodium phosphate buffer with 20 g⋅kg−1
BioMed Research International
polyvinylpolypyrrolidone, 0.2 mol⋅L−1 , pH 6.8, 4∘ C) for
4 min. The obtained solution was centrifuged at 4∘ C with
13,000 g for 15 min. The reaction solution consisted of 2.9 mL
substrate solution (0.02 mol⋅L−1 catechol in 0.05 mol⋅L−1
phosphate buffer, pH 6.5) and 0.1 mL crude extract. The
catechol oxidation rate was evaluated at 420 nm for 2 min at
room temperature. And the activity unit was defined as an
increase of 0.0001 in absorbance for one minute.
POD and SOD activities were evaluated as the method
reported by Xu et al. (2009) and Xing et al. (2011a) [17, 23].
2.5 g Fruit tissue was homogenized in 10 mL PBS (25 mmol⋅L−1,
pH 7.8, containing 1 mmol⋅L−1 EDTA and 0.8 g⋅L−1 PVPP)
and then centrifuged at 4∘ C with 13,000 g for 20 min. For
the determination of POD activity in fruits, 0.5 mL enzyme
extract was incubated at 30∘ C in 2 mL buffered substrate
(pH 6.4, 100 mmol⋅L−1 sodium phosphate and 8 mmol⋅L−1
guaiacol) for 5 min and the absorbance measured at 465 nm
every 30 s for 120 s after adding 1 mL of H2 O2 with the con-
centration of 24 mmol⋅L−1 . POD activity in jujube fruits was
expressed as U⋅g−1 (U = 0.01 D-absorbance465 nm min−1 ). For
SOD determination, the reaction mixture (3 mL) consisted
of 13 mmol⋅L−1 methionine, 50 mmol⋅L−1 sodium phosphate
buffer (pH 7.8), 10 𝜇mol⋅L−1 EDTA, 75 𝜇mol⋅L−1 nitrob-
lue tetrazolium, 2 𝜇mol⋅L−1 riboflavin, and 0.1 mL enzyme
extract. The mixtures solutions were illuminated for 10 min by
light (60 𝜇mol⋅m−2 ⋅s−1 ). Identical solutions held in the dark
served as blanks. The absorbance was measured at 560 nm
and SOD activity was expressed as U⋅g−1 . One enzyme unit
was recognized as the enzyme volume corresponding to 50%
inhibition of nitroblue tetrazolium reduction at 560 nm.
2.6. Total Soluble Phenolics Content, MDA Content, and Mem-
brane Permeability Determination. Total soluble phenolics
content in jujube fruit was determined according to the
method of Xing et al. [3]. 1 g fruit tissue was homogenized and
centrifuged at 12,000 g for 15 min after being frozen in 2.5 mL
of 95% ethanol for 72 h. 1 mL obtained supernatant was mixed
with 5 mL distilled water, 1 mL 95% ethanol, and 0.5 mL of
50% (1 N) Folin-Ciocalteu phenol reagent. Furthermore, 1 mL
of 5% (w/v) sodium carbonate was added and followed by
brief vortexing to mix after being incubated at room temper-
ature for 5 min. And then, the absorbance at 725 nm of the
reaction mixture was determined and converted to mg⋅g−1
(phenolics) tissue after being vortexed and incubated for 1 h
in the dark. In this investigation, total phenolics content was
standardized against gallic acid. On the other hand, TBARS
expressed as MDA equivalents and membrane permeability
as relative leakage rate were determined according to the
method of Xing et al. [17]. The further details of determined
method were not described here.
2.7. Statistical Analysis. The obtained values were calculated
as mean ± S.D. (𝑛 = 3). The data for antimicrobial activity
and fruits decay rate were analyzed by SPSS 13.0 software with
one-way analysis of variance and Student-Newman-Keuls
test. The differences were recognized as significant (𝑃 < 0.05).
3
18
A A A
Zone of growth inhibition (D, mm)
16 B A
B B B
B
14 B
12
C C
10
8
6
4
2
0
P. citrinum
P. expansum
R. nigricans
A. flavus
E. coli
S. aureus
Cinnamon oil (0.10%)
Chitosan-oil coating (1.0% + 0.10%)
Figure 1: Antimicrobial activity of cinnamon oil and chitosan-oil
coating.
3. Results and Discussion
3.1. Antimicrobial Activity of Chitosan-Oil Coating. Antimi-
crobial properties of different coating against fungi and
bacteria were investigated. As shown in Figure 1, the zone
diameters of inhibition of chitosan-oil coating and cinnamon
oil coating against A. flavus, P. expansum, R. nigricans, and P.
citrinum were 14.23 mm, 13.60 mm, 11.97 mm, 13.48 mm and
14.80 mm, 14.47 mm, 12.37 mm, and 16.46 mm, respectively.
Furthermore, the diameters of inhibition zone of chitosan-
oil coating against E. coli and S. aureus were 15.39 mm and
15.59 mm, respectively, which were 16.03 mm and 16.46 mm
for cinnamon oil coating. Result indicated that the activity of
different coating against bacteria might be higher than that
against fungi in this investigation. The lowest and highest
activities of chitosan-oil coating and cinnamon oil coating
were observed against R. nigricans and S. aureus, respectively.
Better quality without decay is one of the key factors for
evaluating the effect of fruits storage [16, 24]. The application
of chitosan coating as the carrier could be due to its good
antimicrobial activity and film-forming property with micro-
pores [3, 25]. The investigation of Xing et al. [3] demonstrated
that the chitosan-oil coating exhibited the best control effect
against the growth of P. citrinum on wound inoculated fruits.
Result also suggested that the antimicrobial properties of
chitosan coating were significantly improved by the addition
of cinnamon oil [3, 15, 23]. The result reported by Tzortzakis
[14] also indicated that the controlled effects of cinnamon oil
on the spore germination in Rhizopus stolonifer were related
to the oil concentration. Xing et al. [15] also showed that
cinnamon oil exhibited the good antifungal activity against
A. flavus, P. expansum, and R. nigricans. Furthermore, the
investigation of Xing et al. [15] indicated that cinnamon
oil (2.0%) showed complete control on the growth of fungi
inoculated in wound jujube fruits. These results revealed that
the chitosan-oil coating has a good potential to be a natural
antimicrobial agent on the applications of fruit storage.
4 BioMed Research International

1.6 50
1.4 A
40

Fruits decay rate (%)

1.2
Weight loss (%)

1.0 30 B
0.8
C
0.6 20
D
0.4
10
0.2
0.0 0
0 15 30 45 60

Control

Chitosan coating

Cinnamon oil coating

Chitosan-oil coating
Storage time (days)
Control Cinnamon oil coating
Chitosan coating Chitosan-oil coating

(a) (b)
10.0
Sensory acceptability (scores)

8.0

6.0

4.0

2.0

0.0
0 15 30 45 60
Storage time (days)
Control Cinnamon oil coating
Chitosan coating Chitosan-oil coating
(c)

Figure 2: Weight loss (a), disease incidence (b), and sensory acceptability (c) of the samples during 60-day storage at 4∘ C.

3.2. Weight Loss, Fruit Decay, and Sensory Acceptability. The samples treated by chitosan-oil coating exhibited the
Water loss as the main part of weight loss is one of the quite highest sensory acceptability (5.43) among all the treatments.
important reasons that could affect the quality of fresh fruit But the sensory acceptability of the control samples was only
products [24]. According to the result in Figure 2(a), jujube 2.07.
fruits treated by the combined coating presented the lowest Result indicated that the chitosan-oil coating could pro-
weight loss (0.53%) after 60 days of storage at 4∘ C. However, vide the better control effect on the weight loss and fruit decay
the control fruits presented the highest weight loss (1.39%) and provide better sensory acceptability for fruits during
after storage. Moreover, the effect of different coating on the storage. The fruit samples treated by the combined coating
postharvest decay of jujube fruits is shown in Figure 2(b). presented lower weight loss than that of the control fruits.
The control jujube fruits started decaying before day 15 (data Chitosan coating could serve as a protective layer for water
was not shown) and reached 41.6% for the decay rate of fruits loss during the storage of postharvest fruits [3, 17, 26]. The
at the end of storage. Meanwhile, the jujube with chitosan- microstructure of chitosan coating was observed by SEM
oil coating showed little fruit decay during the first 15 days and AFM. This is because micropores as the microperforated
of storage. The fruit decay rate of fruits treated by chitosan- panels for chitosan coating used to wrap jujube fruits, as
oil coating was only 13.83%, which was significantly lower shown in Figure 3, could moderate probably letting O2
than that of the control on day 60. On the other hand, result and CO2 to pass through and prevent the quick loss of
shown in Figure 2(c) indicated that the chitosan coatings water molecules from the surface of fruits. These results
enriched with cinnamon oil at 0.10% could not produce unde- were consistent with the observation of Xing et al. [3]; the
sirable sensory properties for fruits during the whole storage. minimum weight loss was found to occur in the fruits treated
BioMed Research International 5

(a) (b)

Figure 3: Microstructure of chitosan coating observed by SEM and AFM.

0.50 4.0
Titratable acidity content (%)

0.45
3.5
Vitamin C (mg·g−1 )

0.40
3.0
0.35

2.5
0.30

0.25 2.0
0 15 30 45 60 0 15 30 45 60
Storage time (days) Storage time (days)
Control Cinnamon oil coating Control Cinnamon oil coating
Chitosan coating Chitosan-oil coating Chitosan coating Chitosan-oil coating
(a) (b)

Figure 4: Titratable acidity contents (a) and vitamin C contents (b) in the samples during 60-day storage at 4∘ C.

with the combined coating with chitosan and cinnamon oil. quality scores of fresh-cut lotus root at the end of storage
The combined coating could help in slowing the ripening rate [15, 32]. Furthermore, Xing et al. [17] also reported that the
and reducing the weight loss of fruits [27, 28]. Liu et al. [29] chitosan-oil coating could keep the sensory quality of sweet
reported that the control effect of chitosan on blue mold was peppers. In conclusion, chitosan coating with cinnamon oil
also observed in tomato fruit [29]. Our study also showed at appropriate dose could be considered as a safe alternative
that the controlling activity of chitosan coating on disease for keeping fruits quality.
decay was enhanced by the addition of cinnamon oil [3, 12, 14,
15]. This combined beneficial function for controlling decay 3.3. Titratable Acidity and Vitamin C Content. The effects
of jujube fruits could be due to the antimicrobial activity of different coating on the titratable acidity (TA) in jujube
of chitosan-oil coating and the control effect of chitosan fruits were shown in Figure 4(a). Results revealed that
coating as a barrier on the loss of cinnamon oil [10, 30, 31]. titratable acidity in fruit samples was found to decrease along
On the other hand, the appearance of fruits is a primary the storage time. TA content in the control samples was
factor in quality judgment for the consumers concerned. significantly lower than the initial value at the end of storage
As reported by Ojagh et al. [13], the chitosan-based coating at 4∘ C. After 60 days of storage, the untreated jujube fruits
incorporated with cinnamon oil was found to keep the good presented the highest decrease in TA, while the fruits treated
quality on the fish samples during storage. The investigation with the combined coating showed the lowest decrease. TA
of Xing et al. [15] reported that the samples treated by content in fruits treated by the chitosan-oil coating was
chitosan coating and MAP exhibited the highest overall visual only 0.34% at day 60. Furthermore, the effect of chitosan-oil
6 BioMed Research International
coating on the vitamin C content was also evaluated during
the storage time. The results in Figure 4(b) illustrated that
a significant decrease in vitamin C values of chitosan-oil
coated fruits was observed along with the storage period.
After storage at 4∘ C for 60 days, vitamin C values of the fruits
tread with the chitosan-oil coating and the control samples
were 3.08 mg⋅g−1 and 2.55 mg⋅g−1 , respectively. The decrease
rate in vitamin C was significantly lower in coated fruits
compared to that in the control samples.
These results illustrated that the contents of TA and
vitamin C in jujube fruits with chitosan-oil coating were the
highest among all treatments during the storage time. The
high TA content could be attributed to the chitosan coating,
which could control the permeability of CO2 and O2 and
further slow the ripening rate of fruits. The relation between
TA and ripening rate could be further investigated in the
next word [16, 24]. Chitosan-based oil coating could reduce
the ripening rate of fruits and the substrate for respiration
responses such as organic acids [16, 24, 26]. Xing et al. [16]
reduced respiration rate of fruits that may be reflected in
lower changes in titratable acidity [33, 34]. Furthermore, the
reason for high vitamin C content in coated fruits during the
storage time could be attributed to the combined function of
chitosan and cinnamon oil coating, which could significantly
slow the ripening rate and provide the preserve for vitamin C
in jujube fruits [3, 17]. According to the investigation of Xing
et al. [16], the loss of vitamin C can be greatly favored by the
presence of O2 . This is because chitosan coating could reduce
O2 content in the microenvironment and cinnamon oil as the
antibrowning agents provide better preserve on the vitamin
C contents in fruits. These similar results have been reported
for other cultivars such as carrot and fresh vegetable juice
[35]. Also, vitamin C in the jujube fruits might be protected
by antioxidant activity of cinnamon oil [36–38]. As reported
by Xing et al. [17], at the end of storage, the highest vitamin
C content was observed in peppers treated by chitosan-oil
coating. Cinnamon oil in the chitosan coating as the carrier
could inhibit the vitamin C loss by acting as an abiotic elicitor
[3, 15, 17, 39–41].
3.4. PPO, POD, and SOD Activity in Jujube Fruits. PPO,
POD, and SOD activities in jujube fruits treated by different
coating during storage at 4∘ C for 60 days were investigated.
Result presented in Figure 5(a) illustrated that, at zero time,
high PPO activity was observed (29.10 U⋅g−1 ). While after 60
days of storage at 4∘ C, the activity of the control samples
was 20.53 U⋅g−1 , which decreased to 13.40 U⋅g−1 in the jujube
fruits treated with the chitosan-oil coating. Furthermore,
as revealed in Figure 5(b), POD activity increased in both
control and chitosan-oil coating treated fruits during the
storage time. The higher POD activity in chitosan-oil treated
fruit at the end of storage indicated that chitosan coating
can effectively inhibit the POD activity during the stor-
age time. At zero time, high POD activity was observed
(35.23 U⋅g−1 ). While after 60 days of storage at 4∘ C, the
activities were 40.63 U⋅g−1 and 63.60 U⋅g−1 in control samples
and the jujube fruits treated with the chitosan-oil coating,
respectively. Senescence is considered to be associated with
the defensive system, such as SOD enzymes, in the fruits
during storage. As can be seen in Figure 5(c), SOD activities
in the all treated groups showed an increased trend first
and decreased thereafter. However, SOD activity was higher
than that in the coating treated fruits after 60 days, which
indicates that chitosan coating can effectively inhibit the SOD
activity during the storage time. As shown in Figure 5(c), the
SOD activity reached 9.27 U⋅g−1 in jujube fruits before being
treated. However, the activity was 14.53 U⋅g−1 in the jujube
fruits treated with the chitosan-oil coating, which was only
9.07 U⋅g−1 in the control fruit samples at the end of storage.
Chitosan (1.0%) coating with cinnamon oil (0.10%) was the
most active one in enhancing the SOD activity in fruit.
The results revealed that the effect of chitosan-oil treat-
ments on the PPO activity in the jujube fruit was found. This
phenomenon was consistent with the observation reported by
Badawy and Rabea [8], who reported that chitosan coating
could provide the ability to remove the metal ions and has
the potential effect used to inhibit the PPO activity in litchi
fruit [8, 42, 43]. The coordinated action of SOD and POD,
two important oxyradical detoxification enzymes in fruits,
could help to reduce the oxidative damage in regeneration of
ascorbate and glutathione metabolites [44–46]. The increased
activities of SOD and POD in jujube fruits may be induced
by the complex coating of chitosan and cinnamon oil, which
could possibly be of benefit to induce the disease resistance in
fruits during the storage time [17, 30, 44]. Chitosan coating
could induce the activities of defense-related enzymes and
promote the protection for fruits [30]. Moreover, the lower
PPO activity may be also due to the antioxidant activity of
cinnamon oil in the chitosan coating carrier [14, 38, 43, 47]. In
the investigation conducted by Xing et al. [32], the inhibitory
effect on PPO activity in the treated samples should be due to
the cinnamon oil incorporated into chitosan-based coating
[37].
3.5. Total Soluble Phenolics Content. Changes of total soluble
phenolics content in jujube fruits treated with different coat-
ing are shown in Figure 6. The total phenolics in all treatments
accumulated gradually except for the control samples during
the storage time at 4∘ C for the first 30 days. However, it was
decreased for total phenolics content in fruits after 30 days
of storage. Total phenolics content in jujube fruit was up to
34.51 mg⋅g−1 of tissue in the samples treated with chitosan-oil
coating, which was only 17.95 mg⋅g−1 of tissue for the control
fruits. The complex coating of chitosan and cinnamon oil
might be the most active one in increasing the total soluble
phenolic content of jujube fruits during the storage period.
The first increased trend of total soluble phenolic com-
pounds in chitosan-treated jujube fruits might be because
chitosan has an effect on the activation of plant defense
responses [8]. The increase in phenolic substances following
chitosan application has been observed by other researchers.
Xing et al. [16] reported that, during the storage of fruits,
the content of some phenolic compounds as the substrates of
PPO was found to decrease because of the oxidation by PPO
[3]. This similar result was in agreement with the observations
of Liu et al. [29]. These results also suggested that the increase
 BioMed Research International 7

30 80

26 70

POD activity (U·g−1 )

PPO activity (U·g−1 )

60
22
50
18
40
14
30

10 20
0 15 30 45 60 0 15 30 45 60
Storage time (days) Storage time (days)
Control Cinnamon oil coating Control Cinnamon oil coating
Chitosan coating Chitosan-oil coating Chitosan coating Chitosan-oil coating
(a) (b)
18

16
SOD activity (U·g−1 )

14

12

10

6
0 15 30 45 60
Storage time (days)
Control Cinnamon oil coating
Chitosan coating Chitosan-oil coating
(c)

Figure 5: PPO (a), POD (b), and COD (c) activities in the samples during 60-day storage at 4∘ C.

40 of phenolic compounds and antioxidant enzyme activities in

fruits induced by chitosan-oil coating might be of benefit to
Total soluble phenolic (mg·g−1 )

35 improve the disease resistance for jujube fruits [44]. On the

other hand, the first increased trend of total soluble phenolic
30
compounds might be also due to the other component in
25
chitosan coating, cinnamon oil, which could be able to
delay, retard, or prevent oxidation processes of phenolic
20 compounds by reacting with free radicals, chelating metals,
and acting as oxygen scavengers [37].
15
3.6. MDA Content and Relative Conductivity. Malondialde-
10 hyde (MDA) as the final product of lipid peroxidation is
0 15 30 45 60
always used as one index for oxidative damage of fruit
Storage time (days)
tissue cell [44]. The continuous increase in MDA content
Control Cinnamon oil coating was observed both in control and in the coating treated
Chitosan coating Chitosan-oil coating fruits during storage at 4∘ C (Figure 7(a)). However, at the
Figure 6: Total soluble phenolic contents in the samples during 60- end of storage, the MDA content in control samples and
day storage at 4∘ C. the chitosan-oil coated fruits were up to 29.13 𝜇mol⋅g−1 and
8 BioMed Research International

30 40

35

Membrane permeability (%)

25
MDA content (𝜇mol·g−1 )

30
20
25
15
20

10
15

5 10
0 15 30 45 60 0 15 30 45 60
Storage time (days) Storage time (days)
Control Cinnamon oil coating Control Cinnamon oil coating
Chitosan coating Chitosan-oil coating Chitosan coating Chitosan-oil coating
(a) (b)

Figure 7: MDA content (a) and relative conductivity (b) in the samples during 60-day storage at 4∘ C.

19.43 𝜇mol⋅g−1 , respectively. During the storage time, MDA decay and maintain the good sensory acceptability of jujube
content in the jujube fruits treated with chitosan-oil coating fruits. Moreover, during the storage time, the treatment
increased slower than in the pulp of the control and the of chitosan-oil coating might be to maintain the quality
chitosan coating treated fruits. Similar results were obtained attributes and induce the defense reaction system of jujube
from the electrolyte leakage contents of jujube fruit samples, fruits. The chitosan-based coating with cinnamon oil could
as shown in Figure 7(b). There was a continuous increase be recognized as the better treatment with regard to inducing
in MDA content, both in control and coating-treated fruits several host defense mechanisms. These results in this inves-
during storage period (Figure 7(b)). The relative conductivity tigation suggested that chitosan-oil coating (1.0% + 0.10%)
reached 36.87% and 28.93% in the control samples and kept great quality maintenance and extended the shelf-life of
fruits treated with chitosan-oil coating at the end of storage, jujube fruit storage at 4∘ C for 60 days.
respectively.
This result may be due to the chitosan coating, which has
a potential for inducing defense system. This is also because
Conflict of Interests
of the antioxidant activity of cinnamon extracted oil. Similar The authors declare that there is no conflict of interests
results were obtained by Xu et al. [44]; MDA content in regarding the publication of this paper.
the fruit treated with grapefruit seed extract was found to
increase slower than that in the control fruit. Membrane
permeability, as an indicator of membrane integrity, was Authors’ Contribution
also investigated in order to have more information on the
stability of cell membrane in fruit tissue [44]. Chitosan- Yage Xing and Hongbin Lin contributed equally to this work.
oil coating treated fruits had significantly lower relative
leakage rates than the control, indicating that the higher Acknowledgments
membrane integrity was maintained for fruits during the
storage time. This result was consistent with the observation This investigation was supported by the Key Laboratory Open
by Xing et al. [17]; the application of chitosan-oil coating Research Fund of Grain and Oil Processing and Food Safety
could significantly delay the increase of MDA and electrolyte of Xihua University (szjj2015-003, szjj2014-003, and szjj2014-
leakage in sweet peppers during the storage time. Results 002), Chunhui Research Project Program of Education Min-
reported by Xing et al. [32] also illustrated that the effect of the istry of China, and Xihua University Young Scholars Training
treatment combining chitosan-based coating with modified Program (01201413).
atmosphere packaging was observed in the controlling of
MDA accumulation and reducing the oxidative damage of
References
fresh-cut lotus root during storage [48].
[1] J.-W. Li, L.-P. Fan, S.-D. Ding, and X.-L. Ding, “Nutritional com-
4. Conclusion position of five cultivars of Chinese jujube,” Food Chemistry, vol.
103, no. 2, pp. 454–460, 2007.
This investigation revealed that the complex coating of [2] H. Li, F. Li, L. Wang et al., “Effect of nano-packing on
chitosan and cinnamon oil could directly control the disease preservation quality of Chinese jujube (Ziziphus jujuba Mill. var.
BioMed Research International
inermis (Bunge) Rehd),” Food Chemistry, vol. 114, no. 2, pp. 547–
552, 2009.
[3] Y. Xing, Q. Xu, Z. Che, X. Li, and W. Li, “Effects of chitosan-
oil coating on blue mold disease and quality attributes of jujube
fruits,” Food & Function, vol. 2, no. 8, pp. 466–474, 2011.
[4] X. Li, Y. Xing, Y. Jiang, Y. Ding, and W. Li, “Antimicrobial
activities of ZnO powder-coated PVC film to inactivate food
pathogens,” International Journal of Food Science and Technol-
ogy, vol. 44, no. 11, pp. 2161–2168, 2009.
[5] X. Meng, J. Han, Q. Wang, and S. Tian, “Changes in physiology
and quality of peach fruits treated by methyl jasmonate under
low temperature stress,” Food Chemistry, vol. 114, no. 2-3, pp.
1028–1035, 2009.
[6] H. Li and T. Yu, “Effect of chitosan on incidence of brown rot,
quality and physiological attributes of postharvest peach fruit,”
Journal of the Science of Food and Agriculture, vol. 81, no. 2, pp.
269–274, 2001.
[7] N. A. Abbasi, Z. Iqbal, M. Maqbool, and I. A. Hafiz, “Postharvest
quality of mango (Mangifera indica L.) fruits as affected by
coating,” Pakistan Journal of Botany, vol. 41, no. 1, pp. 343–357,
2009.
[8] M. E. I. Badawy and E. I. Rabea, “Potential of the biopolymer
chitosan with different molecular weights to control postharvest
gray mold of tomato fruit,” Postharvest Biology and Technology,
vol. 51, no. 1, pp. 110–117, 2009.
[9] G. Romanazzi, F. Nigro, and A. Ippolito, “Short hypobaric
treatments potentiate the effect of chitosan in reducing storage
decay of sweet cherries,” Postharvest Biology and Technology,
vol. 29, no. 1, pp. 73–80, 2003.
[10] P.-J. Chien, F. Sheu, and H.-R. Lin, “Coating citrus (Murcott
tangor) fruit with low molecular weight chitosan increases
postharvest quality and shelf life,” Food Chemistry, vol. 100, no.
3, pp. 1160–1164, 2007.
[11] P. Tripathi and N. K. Dubey, “Exploitation of natural products
as an alternative strategy to control postharvest fungal rotting
of fruit and vegetables,” Postharvest Biology and Technology, vol.
32, no. 3, pp. 235–245, 2004.
[12] N. K. K. Win, P. Jitareerat, S. Kanlayanarat, and S. Sangchote,
“Effects of cinnamon extract, chitosan coating, hot water
treatment and their combinations on crown rot disease and
quality of banana fruit,” Postharvest Biology and Technology, vol.
45, no. 3, pp. 333–340, 2007.
[13] S. M. Ojagh, M. Rezaei, S. H. Razavi, and S. M. H. Hosseini,
“Effect of chitosan coatings enriched with cinnamon oil on the
quality of refrigerated rainbow trout,” Food Chemistry, vol. 120,
no. 1, pp. 193–198, 2010.
[14] N. G. Tzortzakis, “Impact of cinnamon oil-enrichment on
microbial spoilage of fresh produce,” Innovative Food Science
and Emerging Technologies, vol. 10, no. 1, pp. 97–102, 2009.
[15] Y. Xing, X. Li, Q. Xu, J. Yun, and Y. Lu, “Antifungal activities
of cinnamon oil against Rhizopus nigricans, Aspergillus flavus
and Penicillium expansum in vitro and in vivo fruit test,”
International Journal of Food Science and Technology, vol. 45, no.
9, pp. 1837–1842, 2010.
[16] Y. Xing, X. Li, J. Yun, and Y. Lu, “Extending the shelf-life of
fresh-cut lotus root with antibrowning agents, cinnamon oil
fumigation, and moderate vacuum packaging (MVP),” Journal
of Food Process Engineering, vol. 35, no. 4, pp. 505–521, 2012.
[17] Y. Xing, X. Li, Q. Xu, J. Yun, Y. Lu, and Y. Tang, “Effects of
chitosan coating enriched with cinnamon oil on qualitative
properties of sweet pepper (Capsicum annuum L.),” Food
Chemistry, vol. 124, no. 4, pp. 1443–1450, 2011.
9
[18] M.-C. Chen, G. H.-C. Yeh, and B.-H. Chiang, “Antimicrobial
and physicochemical properties of methylcellulose and chi-
tosan films containing a preservative,” Journal of Food Processing
and Preservation, vol. 20, no. 5, pp. 379–390, 1996.
[19] Y. Pranoto, V. M. Salokhe, and S. K. Rakshit, “Physical and
antibacterial properties of alginate-based edible film incorpo-
rated with garlic oil,” Food Research International, vol. 38, no. 3,
pp. 267–272, 2005.
[20] V. Darrort, M. Troyon, J. Ebothé, C. Bissieux, and C. Nicollin,
“Quantitative study by atomic force microscopy and spec-
trophotometry of the roughness and brightness of electrode-
posited nickel in the presence of additives,” Thin Solid Films, vol.
265, no. 1-2, pp. 52–57, 1995.
[21] P. J. Chien, F. Sheu, and F. H. Yang, “Effect of edible chitosan
on quality and shelf life of sliced mango fruit,” Journal of Food
Engineering, vol. 29, no. 1, pp. 23–29, 2005.
[22] I. Odriozola-Serrano, T. Hernández-Jover, and O. Martı́n-
Belloso, “Comparative evaluation of UV-HPLC methods and
reducing agents to determine vitamin C in fruits,” Food Chem-
istry, vol. 105, no. 3, pp. 1151–1158, 2007.
[23] S.-Y. Wang, P.-F. Chen, and S.-T. Chang, “Antifungal activities
of essential oils and their constituents from indigenous cinna-
mon (Cinnamomum osmophloeum) leaves against wood decay
fungi,” Bioresource Technology, vol. 96, no. 7, pp. 813–818, 2005.
[24] S. L. S. Bico, M. F. J. Raposo, R. M. S. C. Morais, and A. M. M. B.
Morais, “Combined effects of chemical dip and/or carrageenan
coating and/or controlled atmosphere on quality of fresh-cut
banana,” Food Control, vol. 20, no. 5, pp. 508–514, 2009.
[25] E. I. Rabea, M. E.-T. Badawy, C. V. Stevens, G. Smagghe, and W.
Steurbaut, “Chitosan as antimicrobial agent: applications and
mode of action,” Biomacromolecules, vol. 4, no. 6, pp. 1457–1465,
2003.
[26] P. C. Srinivasa, R. Baskaran, M. N. Ramesh, K. V. Harish
Prashanth, and R. N. Tharanathan, “Storage studies of mango
packed using biodegradable chitosan film,” European Food
Research and Technology, vol. 215, no. 6, pp. 504–508, 2002.
[27] G. Romanazzi, F. M. Gabler, and J. L. Smilanick, “Preharvest
chitosan and postharvest UV irradiation treatments suppress
gray mold of table grapes,” Plant Disease, vol. 90, no. 4, pp. 445–
450, 2006.
[28] A. EI-Ghaouth, J. Arul, J. Grenier, and A. Asselin, “Antifungal
activity of chitosan on two post-harvest pathogens of straw-
berry fruits,” Phytopathology, vol. 82, no. 4, pp. 398–402, 1992.
[29] J. Liu, S. P. Tian, X. H. Meng, and Y. Xu, “Effects of chitosan on
control of postharvest diseases and physiological responses of
tomato fruit,” Postharvest Biology and Technology, vol. 44, no. 3,
pp. 300–306, 2007.
[30] X. Meng, B. Q. Li, J. Liu, and S. P. Tian, “Physiological responses
and quality attributes of table grape fruit to chitosan preharvest
spray and postharvest coating during storage,” Food Chemistry,
vol. 106, no. 2, pp. 501–508, 2008.
[31] A. Ghaouth, J. Arul, R. Ponnampalam, and M. Boulet, “Use of
chitosan coating to reduce weight loss and maintain quality of
cucumber and bell pepper fruits,” Journal of Food Processing and
Preservation, vol. 15, no. 5, pp. 359–368, 1991.
[32] Y. Xing, X. Li, Q. Xu, Y. Jiang, J. Yun, and W. Li, “Effects of
chitosan-based coating and modified atmosphere packaging
(MAP) on browning and shelf life of fresh-cut lotus root
(Nelumbo nucifera Gaerth),” Innovative Food Science and Emerg-
ing Technologies, vol. 11, no. 4, pp. 684–689, 2010.
[33] F. S. Kittur, N. Saroja, Habibunnisa, and R. N. Tharanathan,
“Polysaccharide-based composite coating formulations for
10 BioMed Research International

shelf-life extension of fresh banana and mango,” European Food

Research and Technology, vol. 213, no. 4-5, pp. 306–311, 2001.
[34] G. I. Olivas and G. V. Barbosa-Cánovas, “Edible coatings for
fresh-cut fruits,” Critical Reviews in Food Science and Nutrition,
vol. 45, no. 7-8, pp. 657–670, 2005.
[35] S. N. Hajare, V. S. Dhokane, R. Shashidhar, A. Sharma, and J. R.
Bandekar, “Radiation processing of minimally processed carrot
(Daucus carota) and cucumber (Cucumis sativus) to ensure
safety: effect on nutritional and sensory quality,” Journal of Food
Science, vol. 71, no. 3, pp. S198–S203, 2006.
[36] D. M. Hodges, C. J. Andrews, D. A. Johnson, and R. I. Hamilton,
“Antioxidant compound responses to chilling stress in differen-
tially sensitive inbred maize lines,” Physiologia Plantarum, vol.
98, no. 4, pp. 685–692, 1996.
[37] G. K. Jayaprakasha, P. S. Negi, B. S. Jena, and L. J. M. Rao,
“Antioxidant and antimutagenic activities of Cinnamomum
zeylanicum fruit extracts,” Journal of Food Composition and
Analysis, vol. 20, no. 3-4, pp. 330–336, 2007.
[38] H. Du and H. Li, “Antioxidant effect of Cassia essential oil on
deep-fried beef during the frying process,” Meat Science, vol. 78,
no. 4, pp. 461–468, 2008.
[39] A. D. N. Simões, J. A. Tudela, A. Allende, R. Puschmann, and M.
I. Gil, “Edible coatings containing chitosan and moderate modi-
fied atmospheres maintain quality and enhance phytochemicals
of carrot sticks,” Postharvest Biology and Technology, vol. 51, no.
3, pp. 364–370, 2009.
[40] S. R. Kanatt, R. Chander, and A. Sharma, “Chitosan and mint
mixture: a new preservative for meat and meat products,” Food
Chemistry, vol. 107, no. 2, pp. 845–852, 2008.
[41] D. Georgantelis, I. Ambrosiadis, P. Katikou, G. Blekas, and
S. A. Georgakis, “Effect of rosemary extract, chitosan and 𝛼-
tocopherol on microbiological parameters and lipid oxidation
of fresh pork sausages stored at 4 ∘ C,” Meat Science, vol. 76, no.
1, pp. 172–181, 2007.
[42] A. J. McEvily, R. Iyengar, and W. S. Otwell, “Inhibition of
enzymatic browning in foods and beverages,” Critical Reviews
in Food Science and Nutrition, vol. 32, no. 3, pp. 253–273, 1992.
[43] L. S. Jahnke, M. R. Hull, and S. P. Long, “Chilling stress and oxy-
gen metabolizing enzymes in Zea mays and Zea diploperennis,”
Plant, Cell and Environment, vol. 14, no. 1, pp. 97–104, 1991.
[44] W.-T. Xu, X.-L. Peng, Y.-B. Luo, J.-A. Wang, X. Guo, and K.-L.
Huang, “Physiological and biochemical responses of grapefruit
seed extract dip on ‘Redglobe’ grape,” LWT—Food Science and
Technology, vol. 42, no. 2, pp. 471–476, 2009.
[45] C. H. Foyer and G. Noctor, “Oxygen processing in photosyn-
thesis: regulation and signalling,” New Phytologist, vol. 146, no.
3, pp. 359–388, 2000.
[46] S. Kochhar, C. B. Watkins, P. L. Conklin, and S. K. Brown, “A
quantitative and qualitative analysis of antioxidant enzymes in
relation to susceptibility of apples to superficial scald,” Journal
of the American Society for Horticultural Science, vol. 128, no. 6,
pp. 910–916, 2003.
[47] E. R. Kitazuru, A. V. B. Moreira, J. Mancini-Filho, H. Delincée,
and A. L. C. H. Villavicencio, “Effects of irradiation on natural
antioxidants of cinnamon (Cinnamomum zeylanicum N.),”
Radiation Physics and Chemistry, vol. 71, no. 1-2, pp. 37–39, 2004.
[48] Q. Xu, Y. Xing, Z. Che et al., “Effect of chtiosan coating and oil
fumigation on the microbiological and quality safety of fresh-
cut pear,” Journal of Food Safety, vol. 33, no. 2, pp. 179–189, 2013.