International Journal of Food Microbiology 237 (2016) 10–16

Contents lists available at ScienceDirect

International Journal of Food Microbiology

journal homepage: www.elsevier.com/locate/ijfoodmicro

Mexican unpasteurised fresh cheeses are contaminated with Salmonella

spp., non-O157 Shiga toxin producing Escherichia coli and potential
uropathogenic E. coli strains: A public health risk
Rosa Guzman-Hernandez a,b, Araceli Contreras-Rodriguez b, Rosa Hernandez-Velez c, Iza Perez-Martinez a,
Ahide Lopez-Merino b, Mussaret B. Zaidi d, Teresa Estrada-Garcia a,⁎
a
Department of Molecular Biomedicine, CINVESTAV-IPN. Av. IPN #2508, Col. Zacatenco, Mexico City CP 07360, Mexico
b
Departmento de Microbiología, ENCB-IPN, Prolongación Carpio y Plan de Ayala S/N, Col. Casco de Santo Tomas, Mexico City CP 11340, Mexico
c
División de Estudios de Posgrado e Investigación, ITVH, Carretera VHSA-Frontera Km 3.5, Villahermosa, Tabasco, Mexico
d
Departamento de Investigación, Hospital General O'Horan. Av. Itzaes x Jacinto Canek, Mérida CP 97000, Yucatan, Mexico

a r t i c l e i n f o a b s t r a c t

Article history: Fresh cheeses are a main garnish of Mexican food. Consumption of artisanal fresh cheeses is very common and
Received 21 April 2016 most of them are made from unpasteurised cow milk. A total of 52 fresh unpasteurised cheeses of five different
Received in revised form 9 August 2016 types were purchased from a variety of suppliers from Tabasco, Mexico. Using the most probable number meth-
Accepted 11 August 2016
od, 67% and 63% of samples were positive for faecal coliforms and E. coli, respectively; revealing their low micro-
Available online 12 August 2016
biological quality. General hygienic conditions and practices of traditional cheese manufacturers were poor; most
Keywords:
establishments had unclean cement floors, all lacked windows and doors screens, and none of the food-handlers
Fresh cheeses wore aprons, surgical masks or bouffant caps. After analysing all E. coli isolates (121 strains) for the presence of 26
E. coli genes virulence genes, results showed that 9 (17%) samples were contaminated with diarrheagenic E. coli strains, 8
Non-O157 STEC harboured non-O157 Shiga toxin producing E. coli (STEC), and one sample contained both STEC and diffusely ad-
Salmonella herent E. coli strains. All STEC strains carried the stx1 gene. Potential uropathogenic E. coli (UPEC) strains were
UPEC isolated from 15 (29%) samples; the most frequent gene combination was fimA-agn43. Two samples were con-
taminated with Salmonella. The results demonstrated that unpasteurised fresh cheeses produced in Tabasco
are of poor microbiological quality and may frequently harbour foodborne pathogens. Food safety authorities
in Mexico need to conduct more rigorous surveillance of fresh cheeses. Furthermore, simple and inexpensive
measures as establishing programs emphasizing good hand milking practices and hygienic manufacturing proce-
dures may have a major effect on improving the microbiological quality of these food items.
© 2016 Elsevier B.V. All rights reserved.

1. Introduction
Foodborne diseases are a major public health problem worldwide
and carry a large burden of disease. In 2013, a total of 818 foodborne
outbreaks occurred in the United States (US) resulting in 13,360 ill-
nesses, 1062 hospitalizations, and 16 deaths (CDC, 2013). Dairy prod-
ucts were implicated in 10% of these outbreaks. Moreover, from 1998
to 2011, a total of 90 outbreaks were associated to cheese consumption.
Thirty-eight of these were linked to cheese made from unpasteurised
milk, and 40% of them, to soft cheeses imported from Mexico (Gould
et al., 2014). Few cheeseborne outbreaks have been reported in Mexico,
likely due to the lack of an active surveillance system for foodborne out-
breaks. Parrilla-Cerrillo et al. (1993), conducted a 9-year retrospective
study of foodborne outbreaks in Mexico. Seventeen (29%) of the 58 re-
ported outbreaks were associated with cheese consumption.
⁎ Corresponding author.
E-mail address: testrada@cinvestav.mx (T. Estrada-Garcia).
Microbial contamination can occur at any stage from cheese produc-
tion to consumption, rendering cheese an important vehicle of
foodborne illness, including diarrhoeal diseases, brucellosis and listerio-
sis (Cody et al., 1999; Farina et al., 2008; Koch et al., 2010; MacDonald et
al., 2005; Méndez Martínez et al., 2003). Salmonella spp., Campylobacter,
Brucella and diarrheagenic Escherichia coli (DEC), including E. coli
O157:H7, are the most frequent pathogens associated with cheese out-
breaks worldwide (Cody et al., 1999; Dominguez et al., 2009; Espie et al.,
2006; Gould et al., 2014; Honish et al., 2005).
DEC groups are generally associated with mild to severe diarrhoea in
humans. In addition to diarrhoeal illness, Shiga toxin producing E. coli
(STEC) such as E. coli O157:H7, non-O157 serotypes and E. coli O104:H4,
a hybrid DEC strain, can cause severe manifestations such as
haemorrhagic colitis and haemolytic uremic syndrome (HUS) (Frank et
al., 2011). DEC have been classified into several groups based on clinical,
epidemiological and virulence traits: enterotoxigenic E. coli (ETEC), typi-
cal and atypical enteropathogenic E. coli (tEPEC, aEPEC), enteroinvasive
E. coli (EIEC), enteroaggregative E. coli (EAEC), diffusely adherent E. coli

http://dx.doi.org/10.1016/j.ijfoodmicro.2016.08.018
0168-1605/© 2016 Elsevier B.V. All rights reserved.
 R. Guzman-Hernandez et al. / International Journal of Food Microbiology 237 (2016) 10–16 11

(DAEC) and STEC; the latter group also encompasses the entero-
haemorrhagic E. coli (EHEC) subgroup (Table 1) (Kaper et al., 2004;
Nataro and Kaper, 1998; Patzi-Vargas et al., 2015).
As in most countries worldwide, DECs are not routinely included in
the microbiological analyses of human clinical and food samples in
Mexico, despite the fact that these pathogens are the main causal agents
of diarrhoea in children less than five years of age (Patzi-Vargas et al.,
2015). Furthermore, non-O157 STEC and atypical EPEC (aEPEC) are
the most prevalent DEC groups isolated from food and beverages in
our country (Canizalez-Roman et al., 2013; Cerna-Cortes et al., 2012a,
2012b; Lopez-Saucedo et al., 2010).
Extraintestinal E. coli (ExPEC) is another E. coli group that commonly
causes serious illness and death worldwide. Urinary tract infection (UTI)
is the most common illness caused by ExPEC (Foxman, 2014). Most UTIs
can be attributed to a highly heterogeneous group of ExPEC known as
uropathogenic E. coli (UPEC). UPEC harbour specific virulence factors
that permit their successful transition from the intestine to the urinary
tract (Flores-Mireles et al., 2015). These include fimbrial adhesins and
iron acquisition systems that allow the establishment of infection in
the bladder or kidney, toxins that cause damage to host cells, and bio-
film formation and bacterial aggregates that contribute to UPEC persis-
tence (Anderson et al., 2003, 2010; Flores-Mireles et al., 2015; Travis et
al., 2008). In recent years, investigators have hypothesized that food
plays a major role in the transmission of ExPEC strains (Aslam et al.,
2014; Nordstrom et al., 2013; Vincent et al., 2010). However, their de-
tection in food items remains difficult as there are no specific markers
for UPEC, and isolation of the strain from the urine of a symptomatic pa-
tient remains the gold standard for identification.
Due to the paucity of data on the microbial contamination of cheese
in Mexico, we conducted the current study with the following aims: 1)
to evaluate the overall microbiological quality and prevalence of E. coli
and Salmonella in fresh cheeses produced in the state of Tabasco and
2) to identify the prevalence of diarrheagenic E. coli groups and poten-
tial uropathogenic E. coli strains.
2. Materials and methods
2.1. Location
Cheese samples were collected from 17 municipalities in Tabasco, a
state located in southeast Mexico. Tabasco has a hot and humid tropical
weather, with temperatures that reach up to 36 °C and 90% humidity
(http://www.cuentame.inegi.org.mx/monografias/informacion/tab/
territorio/clima.aspx?tema=me&e=27).
2.2. Sample collection
Between February and June 2011 a total of 52 local fresh cheeses
were purchased from municipal markets, convenience stores, tradition-
al cheese manufacturers and supermarkets. We recorded if cheeses
were stored in refrigeration or at room temperature. All samples were
transported in iceboxes to the laboratory and processed the same day;
pH was measured on arrival with a pH meter (HANNA, Rhode Island,
US). Four traditional cheese manufacturers (local cheese production es-
tablishments) were visited to evaluate general hygienic conditions and
practices.
2.3. Cheese characteristics
Five different types of artisanal local fresh cheeses that are
manufactured under similar conditions were analysed: 1) “Queso Fres-
co”, a high-moisture creamy cheese with a salty taste, 2) “Queso Crema”,
a soft cheese with a relatively high salt content, 3) “Queso Doble Crema”,
a soft creamy cheese, 4) “Queso Panela”, a cheese with high moisture
content and 5) “Queso Poro”, a cheese variety with a sour salty taste
that is limited to the state of Tabasco.
2.4. Microbiological analyses
2.4.1. Presence of faecal coliforms and E. coli
Each sample was tested for the presence of faecal coliforms (FC) and
E. coli using the Food and Drug Administration most-probable number
(MPN) method (FDA, 2002). Briefly, 10 g of cheese were added to
90 mL of a sterile phosphate-buffered saline and homogenized at low
speed in a sterile blender for 1 min. One millilitre of this homogenate
was used for preparing serial dilutions (10−2, 10−3) in 9 mL of sterile
phosphate-buffered saline. One millilitre of each dilution was inoculated
into lactose broth and fermentation tubes in triplicate. After incubation
at 37 °C for 48 h, a loopful of suspension from positive cultures (deter-
mined by turbidity and gas production) was transferred to tubes con-
taining Escherichia coli broth (EC) and incubated at 44.5 °C ± 0.2 °C/
48 h. Tubes with turbidity (growth) and gas production were considered
positive for FC. Positive EC broths were streaked onto Eosin Methylene
Blue Agar (EMB) and incubated at 37 °C/48 h. Metallic green colonies
were selected and biochemically characterised by the IMViC test for E.
coli confirmation. All confirmed E. coli colonies were further
characterised for the presence of genes that define each DEC group,
DEC toxins, and UPEC virulence genes (VG), as described below.
2.4.2. Salmonella
Salmonella was identified by procedures specified in both the Mexi-
can Official Standard Guidelines (Secretaria de Salud, 2010) and the FDA
Bacteriological Analytical Manual (FDA, 2014). Briefly, 25 g of the
cheese samples were added to 225 mL of buffered peptone water and
homogenized in a sterile blender for 1 min. The homogenized samples
were incubated at 37 °C for 24 h. After incubation, 1 mL of each sample
was transferred to 10 mL of both selenite broth and tetrathionate broth,
respectively. After incubation for another 24 h, a loopful of each broth
was streaked onto Hektoen enteric, Salmonella-Shigella, and xylose ly-
sine desoxycholate agars and incubated at 37 °C for 24 h. Three to five
typical Salmonella colonies were randomly chosen from each selective
medium and identified using urea broth, lysine iron agar and triple
sugar iron agar. Salmonella spp. were identified by serological analysis

Table 1
Phenotypic and genotypic characteristics used to identify diarrheagenic Escherichia coli groups (DEC).

DEC Defining characteristic(s) Target genes

tEPEC Presence of both intimin (as a marker of the pathogenic island LEE) and the BFP contained in the EAF plasmid eaeA, bfpA
aEPEC Presence of intimin (as a marker of LEE); absence of the EAF plasmid and Shiga toxins 1 and 2 eaeA
ETEC Presence of thermo labile (LT) or/and thermo stable (ST) toxins lt, st
EIEC Presence of the invasion-associated locus (IAL) of the invasion plasmid ial
STEC Presence of Shiga toxin 1 (STX1) and/or 2 (STX2) stx1, stx2
STEC/EHEC Presence of Shiga toxin 1 (STX1) and/or 2 (STX2); plus presence of intimin (as a marker of LEE) stx1, stx2, eaeA
EAEC Presence of AggR master regulon most genes associated with the aggregative adherence (AA) and EAEC virulence are controlled by this regulon. aggR
DAEC Presence of surface afimbrial adhesins as AfaE-I and AfaE-III, that are encoded on the Afa/dr/daa operon afaC

DEC: diarrheagenic Escherichia coli groups tEPEC: typical enteropathogenic E. coli, aEPEC: atypical enteropathogenic E. coli, ETEC: enterotoxigenic E. coli, EIEC: enteroinvasive E. coli, STEC:
Shiga toxin producing E. coli, EHEC: enterohaemorrhagic E. coli, EAEC: enteroaggregative E. coli, DAEC: diffusely adherent E. coli, LEE: locus of enterocyte effacement, BFP: bundle-forming
pilus, EAF: EPEC adherence factor plasmid, eaeA and afaC: genes encoding for intimin and Afa adhesin usher, respectively.
12 R. Guzman-Hernandez et al. / International Journal of Food Microbiology 237 (2016) 10–16

using somatic antigen polyvalent serum (Antiserum poly A-I and VI, BD
Bioxon, Mexico).
2.5. Bacterial lysates
For all PCR assays, bacterial lysates were prepared by resuspending a
single colony in 1 mL of deionized water in a polypropylene tube,
followed by boiling for 1 min and immediate cooling with ice for 5 min.
2.6. Multiplex PCRs for the identification of DEC groups and toxin genes and
UPEC virulence genes
All E. coli isolates were analysed by five multiplex PCR assays. Two
were for the identification of DEC groups, one for DEC toxin genes,
and two for UPEC virulence genes.
2.6.1. Multiplex PCRs for DEC group and toxin identification
All E. coli strains were characterised for the presence of genes that
define DEC groups by two PCRs. The first multiplex PCR assay as de-
scribed in Lopez-Saucedo et al. (2003) identifies the following loci:
heat-stable and heat-labile enterotoxins (st, lt) for ETEC, intimin
(eaeA) and bundle-forming pilus (bfpA) for EPEC, Shiga toxin 1 and 2
(stx1, stx2) for STEC, and invasion-associated loci (ial) for EIEC. The sec-
ond multiplex PCR assay targets 3 EAEC plasmid-borne virulence genes,
including the master regulon (aggR), dispersin (aap) and anti-aggrega-
tion transporter (aatA), as well as the Afa adhesin usher (afaC) charac-
teristic of DAEC strains (Patzi-Vargas et al., 2013). The amplified
products were analysed by electrophoresis in 2.5% agarose gels stained
with ethidium bromide. The gels were visualized under a UV transillu-
minator. All STEC isolates were also characterised for the expression of
the O157 lipopolysaccharide antigen and enterohaemolysin gene
(ehxA previously hlyA) using a latex particle agglutination kit (Oxoid
Limited, Basingstoke, UK), and PCR, respectively (Paton and Paton,
1998). Another multiplex PCR assay was used to identify the following
four DEC toxin genes: heat stable toxin 1 (astA), cytolethal distending
toxin (cdt), plasmid encoded toxin (pet) and a subtilase cytotoxin
(subAB), as previously described by Patzi-Vargas et al. (2015).
2.6.2. Multiplex PCRs for identification of UPEC virulence genes
We used two multiplex PCR assays developed in our laboratory for
the identification of UPEC virulence genes. The first (I) multiplex PCR,
identified six genes: hlyA (α-haemolysin), fyuA (yersiniabactin
siderophore receptor), cnf1 (cytotoxic necrotizing factor 1), fimA
(type-1-pili), papC (P fimbriae) and vat (vacuolizing toxin) (Table 2).
Each PCR tube contained 23 μL of reaction mix, comprised (in final con-
centrations) of Tris-HCl (10 mM, pH 8.3), KCl (50 mM), MgCl2 (1.8 mM),
gelatine (100 μg/mL), glycerol (5% v/v), dATP, dCTP, dGTP, and dTTP
(250 μM each), AmpliTaq polymerase (Invitrogen, Carlsbad, US)
(1.5 U), a mixture of the 12 primers (Table 2), and 2 μL of bacterial ly-
sates. The PCR tubes were then subjected to the following cycling condi-
tions: 95 °C/5 min (1 cycle); 94 °C/30 s, 63 °C/40 s, and 68 °C/3 min
(40 cycles); and a final extension step (72 °C/10 min). A second (II) mul-
tiplex PCR identified the following four genes: iroN (salmochelin
siderophore receptor), iutA (aerobactin siderophore receptor), group II
capsule (kpsMII) and antigen 43 (agn43) (Table 2). Each PCR tube
contained 23 μL of reaction mix, comprised (in final concentrations) of
Tris-HCl (10 mM, pH 8.3), KCl (50 mM), MgCl2 (2 mM), gelatine
(100 μg/mL), glycerol (5% v/v), dATP, dCTP, dGTP, and dTTP (250 μM
each), AmpliTaq polymerase (Invitrogen) (0.5 U), a mixture of the 8
primers (Table 2), and 2 μL of bacterial lysates. The solutions were
then subjected to the following cycling conditions: 95 °C/5 min
(1 cycle); 94 °C/30 s, 66 °C/40 s, and 68 °C/3 min (40 cycles); and a
final extension step (72 °C/10 min). References strains, for these 2 mul-
tiplex PCRs, included UPEC strains 2H25B and V7. The PCR products of
both assays (5 μL) were visualized after electrophoresis and ethidium
bromide staining. For this study, potential UPEC strains were defined
as those harbouring at least two of the aforementioned genes associated
with UPEC virulence.
2.7. DEC antibiotic susceptibility testing
Susceptibility to ten antimicrobial agents used to treat gram-nega-
tive infections in Mexico (ampicillin, ceftriaxone, ciprofloxacin,
chloramphenicol, tetracycline, amikacin, ceftazidime, nalidixic acid, sul-
famethoxazole-trimethoprim and gentamicin) was determined by the
disk diffusion method according to CLSI guidelines (CLSI, 2011).
3. Results
3.1. Characteristics of the samples and traditional cheese manufacturers
Five different types of artisanal fresh cheeses prepared from raw cow
milk were analysed in this study. The general characteristics of the 52
cheese samples collected are described in Table 3.

Table 2
UPEC virulence genes, primers, amplicon size, and primer concentration in the reaction mixture.

Multiplex Gene Primer sequence (5′-3′) Amplicon size (bp) Primer (pMol) in mix Reference

I hlyA F: AACAAGGATAAGCACTGTTCT 1177 1.5 Ruiz et al. (2002)

R: ACCATATAAGCGGTCATTCCC
papC F: GACGGCTGTACTGCAGGGTGTGGCG 328 1.5
R: ATATCCTTTCTGCAGGGATGCAATA
cnf1 F: AAGATGGAGTTTCCTATGCAGGAG 498 1.5
R: CATTCAGAGTCCTGCCCTCATTATT
fimA F: GTTGTTCTGTCGGCTCTGTC 447 10
R: ATGGTGTTGGTTCCGTTATTC
fyuA F: TGATTAACCCCGCGACGGGAA 785 1.5 Johnson and Stell (2000)
R: CGCAGTAGGCACGATGTTGTA
vat F: AGAGACGAGACTGTATTTGC 289 5 Xia et al. (2011)
R: GTCAGGTCAGTAACGAGCAC
II iroN F: AAGTCAAAGCAGGGGTTGCCCG 667 1.7
R: GACGCCGACATTAAGACGCAG
kpsMII F: GCGCATTTGCTGATACTGTTG 578 30 Johnson and O'Bryan (2004)
R: AGGTAGTTCAGACTCACACCT
agn43 F: CTGGAAACCGGTCTGCCCTT 433 2 Restieri et al. (2007)
R: CCTGAACGCCCAGGGTGATA
iutA F: GGCTGGACATCATGGGAACTGG 302 2.5 Johnson and Stell (2000)
R: CGTCGGGAACGGGTAGAATCG

Four base pairs (bp) were deleted from the original published forward and reverse primers hlyA (α-haemolysin), fyuA (yersiniabactin siderophore receptor), cnf1 (cytotoxic necrotizing
factor 1), fimA (type-1-pili), papC (P fimbriae), vat (vacuolizing toxin), iroN (salmochelin siderophore receptor), iutA (aerobactin siderophore receptor), group II capsule (kpsMII) and an-
tigen 43 (agn43).
 R. Guzman-Hernandez et al. / International Journal of Food Microbiology 237 (2016) 10–16 13

Table 3 Queso Panela samples were positive for both FC and E. coli compared
General characteristics of cheese samples, type, storage temperature, purchase location with only 30% of Doble Crema samples.
and pH.

Cheese/queso type Storage Purchase location pH pH

(no. of samples) temperature average range 3.3. Prevalence of DEC and Salmonella in fresh unpasteurised cheeses
Fresco RT = 8 MM = 5, TCM = 2, CS = 1 5.4 3.7–6.6
(n = 18) RF = 10 CS = 4, TCM = 3, SM = 2,
Of the 52 cheese samples, 11 (21%) were contaminated with an en-
MM = 1 teric pathogen, nine samples with DEC (eight samples with STEC and
Doble Crema RT = 5 CS = 3, TCM = 1, MM = 1 5.4 4.0–6.4 one harboured both STEC and DAEC strains) and two with Salmonella
(n = 11) RF = 6 CS = 3, SM = 2, MM = 1 spp. Enteric pathogens were identified in three types of cheese samples:
Crema (n = 10) RT = 7 MM = 5, CS = 2 5.2 3.4–6.6
in five (45%) of the 11 Queso Doble Crema samples, in 22% (4/18) of
RF = 3 MM = 1, CS = 1, TCM = 1
Panela (n = 8) RT = 5 TCM = 3, SM = 1, CS = 1 6.6 5.9–6.9 Queso Fresco and in 25% (2/8) of Queso Panela. Two (33%) of the six
RF = 3 TCM = 2, SM = 1 samples purchased in supermarkets harboured enteric pathogens, 31%
Poro (n = 5) RT = 4 MM = 3, TCM = 1 5.2 4.0–6.6 (4/13) from traditional cheese manufacturers, 19% (3/16) from conve-
RF = 1 CS = 1 nience stores and 12% (2/17) from municipal markets. General charac-
RF: refrigerated, RT: kept at room temperature, SM: supermarkets, CS: convenience stores, teristics of these samples are described in Table 5.
TCM: traditional cheese manufacturers, MM: municipal markets.

Four traditional cheese production sites were visited. One was locat-
ed in Villahermosa, the capital of Tabasco, and the other three, in the
municipalities of Jonuta, Jalapa and Teapa. The general hygienic condi-
tions at the four establishments were poor. Most establishments had
unclean cement floors; one had a dirt floor and lacked toilet facilities.
In all establishments, windows and door screens were lacking and the
cheese shovels were made of wood. Three of the establishments used
old plastic cheese moulds and one used wood moulds. None of the
food-handlers wore aprons, surgical masks or bouffant caps.
3.2. Microbiological quality of fresh unpasteurised cheeses
3.4. Prevalence of E. coli virulence genes among DEC isolates from fresh
unpasteurised cheeses
A total of 23 STEC strains were isolated from the 9 positive DEC sam-
ples. All STEC strains were positive for the stx1 gene and none was pos-
itive for the O157 serotype, or the EHEC enterohaemolysin (ehxA) gene
(Table 5). The gene for Type1 pili (fimA) was identified in 87%, dispersin
(aap) in 57%, antigen 43 (agn43) in 26%, group II capsule (kpsMII) in
13%, and EAST 1 toxin (astA) in 5%. Among all isolates, 48% and 22%, re-
spectively, had the stx1-aap-fimA and stx1-fimA-agn43 gene profiles.
The genes carried by the DAEC strain were afaC-aap-fimA-kpsMII. Over-
all, aap was the most frequently identified DEC virulence gene associat-
ed with STEC and DAEC strains.

Thirty-five of the 52 samples (67%) were positive for FC and 33

3.5. Prevalence of potential UPEC strains in fresh unpasteurised cheeses and
(63%) for E. coli. A total of 121 E. coli strains were isolated from the 33
their gene profile including DEC virulence genes
positive samples. As shown in Table 4: all samples purchased at super-
markets were positive for FC and E. coli compared with approximately
Potential UPEC strains were isolated from 15 (29%) cheese samples
50% of samples from municipal markets and convenience stores. All
and identified in four out of the five types of cheese samples as follows:
in five (63%) of the eight Queso Panela samples, in 33% (6/18) of Queso
Table 4 Fresco, in 27% (3/11) of Queso Doble Crema and in 20% (1/5) of Queso
Presence of faecal coliforms (FC) and E. coli based on purchase location and cheese type. Poro. Seven (54%) of the 13 samples bought from cheese manufacturers
Microorganisms Range of MPN/g Number of
harboured potential UPEC strains compared to only 6% (1/17) of cheese
positive samples from municipal markets. The pH and storage temperature of
Minimun Median Maximum
sample (%) each sample is shown in Table 6.
Purchase location A total of 31 potential UPEC strains were identified in the 15 cheese
(no. samples) samples. As shown in Table 6, all strains harboured the fimA gene, agn43
Municipal FC b3 b3 N1100 9 (53) was found in 68%, fyuA in 39%, kpsMII in 13%. The papC, iutA, hlyA genes
markets E. coli b3 3 N1100 7 (41)
were identified in b 10% of the isolates. Most of these potential UPEC iso-
(n = 17)
Convenience FC b3 b3 N1100 8 (50)
lates (68%) harboured fimA and antigen 43 simultaneously and 42% car-
stores E. coli b3 b3 N1100 8 (50) ried at least one gene encoding for a siderophore receptor. Some isolates
(n = 16) also carried DEC virulence genes as those encoding for dispersin, the
Supermarkets FC 75 N1100 N1100 6 (100) EAST 1 toxin, and cytholetal distending toxin. One strain isolated from
(n = 6) E. coli 53 N1100 N1100 6 (100)
Queso Panela carried 5 virulence genes (fimA-agn43-fyuA-iutA-papC-
Traditional FC b3 N1100 N1100 12 (92)
cheese E. coli b3 N1100 N1100 12 (92) cdt).
manufacturers
(n = 13)
3.6. Characteristics of E. coli isolates that were not classified as DEC or
Cheese/queso type potential UPEC
(no. samples)
Fresco FC b3 b3 N1100 11 (61)
(n = 18) E. coli b3 3 N1100 10 (56) Of the 121 isolated E. coli strains, 24 (20%) were DEC and 31 (26%)
Doble Crema FC b3 N1100 N1100 10 (91) were potential UPECs. Of the remaining 66 strains, 10 (8%) were nega-
(n = 11) E. coli b3 N1100 N1100 10 (91) tive for all the virulence genes (VG) analysed and 56 (46%) had at
Crema (n = 10) FC b3 b3 N1100 3 (30)
least one E. coli VG. Of these 56 strains, 48 carried only one VG; 40
E. coli b3 b3 N1100 3 (30)
Panela (n = 8) FC N1100 N1100 N1100 8 (100) were positive for fimA, 3 for agn43, 2 for astA, and fyuA, iutA, and aap
E. coli 20 N1100 N1100 8 (100) genes were only identified in one strain each. Finally, eight isolates car-
Poro (n = 5) FC b3 3 N1100 3 (60) ried two VG, three harboured (fimA-aap), two (agn43-aap), and three
E. coli b3 b3 27 2 (40) isolates carried the astA gene in different combinations (astA-fimA),
FC = faecal coliforms. (astA-agn43), and (astA-aap).
14 R. Guzman-Hernandez et al. / International Journal of Food Microbiology 237 (2016) 10–16

Table 5
Positive fresh cheese samples for Salmonella spp., diarrheagenic E. coli groups (DEC), and virulence genes (VG) profiles for DEC and UPEC.

Sample ID Cheese/queso type Sample pH Purchase location Storage temperature Pathogen identified No. of positive E. coli strains (VG profiles
for DEC and UPEC)

M16 Doble Crema 4.9 SM RF STEC 1 (stx1-fimA)

M46 Doble Crema 6.3 CS RF STEC 1 (stx1-aap-agn43)
M7.1 Doble Crema 5.5 MM RT STEC 1 (stx1)
1 (stx1-aap-fimA-agn43)
2 (stx1-aap-fimA)
M9.1 Doble Crema 4.0 MM RF STEC 1 (stx1-fimA)
1 (stx1-fimA-agn43)
M40 Doble Crema 6.2 TCM RT STEC 1 (stx1-fimA)
M35 Fresco 5.7 TCM RF STEC 1 (stx1-fimA-kpsMII)
1 (stx1-fimA-agn43)
DAEC 1 (afaC-aap-fimA-kpsMII)
M43 Fresco 6.3 TCM RT STEC 1 (stx1-fimA)
1 (stx1-fimA-agn43)
M50 Fresco 6.4 CS RF STEC 1 (stx1-aap)
1 (stx1-aap-fimA-agn43)
2 (stx1-aap-fimA-kpsMII)
2 (stx1-aap-fimA)
3 (stx1-aap-astA-fimA)
M31 Fresco 5.6 CS RF Salmonella spp. NA
M41 Panela 5.9 TCM RT STEC 1 (stx1-fimA)
M44 Panela 6.5 SM RT Salmonella spp. NA

NA: no applied, SM: supermarkets, CS: convenience stores, TCM: traditional cheese manufacturers, MM: municipal markets, RF: refrigerated, RT: kept at room temperature, STEC: Shiga
toxin producing E. coli, DAEC: diffusely adherent E. coli. Genes encoding for: stx1 (shiga toxin 1), fimA (Type 1 pili), aap (dispersin), agn43 (antigen 43), kpsMII (capsule group II), astA
(EAST1 toxin) and afaC (Afa adhesin usher gene).

3.7. DEC antibiotic susceptibility profile
Nineteen E. coli strains, each with a unique gene profile, were sub-
jected to antibiotic susceptibility testing. All were susceptible to ceftri-
axone, ciprofloxacin, amikacin, ceftazidime and gentamicin, while 26%
(5/19) of the isolates were resistant to tetracycline and 5% (1/19) to tri-
methoprim-sulfamethoxazole, ampicillin and nalidixic acid.
4. Discussion
Fresh cheeses and chilli sauces are the main garnish of Mexican food.
In this study, more than half of the 52 unpasteurised cheeses were pos-
itive for FC (67%) and E. coli (63%). Other studies conducted in middle-
income countries such as, Saudi Arabia and Egypt (Altalhi and Hassan,
2009; Ombarak et al., 2016), have found similar frequencies of FC and
E. coli in these food items.
The presence of FC and E. coli in food is considered an indicator of in-
adequate hygienic conditions during production and storage. This is
consistent with our own observations that the general hygienic condi-
tions of the cheese manufacturing sites were poor and 92% of all sam-
ples purchased from these sites were contaminated with FC and E. coli.
Surprisingly, all cheese samples purchased from supermarkets were
positive for FC and E. coli compared to approximately 50% of those from
municipal markets and convenience stores. Most cheese samples at su-
permarkets are stored for days or weeks in open refrigerator showcases
with a temperature range of 2–10 °C degrees. The minimum growth
temperature of E. coli is ≥ 7 °C; near or below this temperature and
with time cultures become heterogeneous with some cells elongating
into filaments (Jones et al., 2004). Furthermore, when temperatures in

Table 6
Positive fresh cheese samples for potential Uropathogenic E. coli (UPEC) and virulence genes (VG) profiles for DEC and UPEC.

Sample ID Cheese/ Sample pH Purchase location Storage temperature No. of positive potentially UPEC strains
queso type (VG profiles for DEC and UPEC)

M38 Doble Crema 5.8 CS RF 3 (fimA-fyuA)

2 (fimA-agn43)
1 (fimA-agn43-kpsMII)
M39 Doble Crema 5.4 CS RF 4 (fimA-agn43)
M46 Doble Crema 6.3 CS RF 1 (fimA-fyuA)
M5.1 Fresco 4.3 MM RT 3 (fimA-agn43)
M17 Fresco 5.3 SM RF 1 (fimA-agn43-iutA)
M31 Fresco 5.6 CS RF 3 (fimA-agn43)
M37 Fresco 5.9 TCM RF 1 (fimA-agn43-fyuA)
M35 Fresco 5.7 TCM RF 1 (fimA-kpsMII-aap)
M43 Fresco 6.3 TCM RT 1 (fimA-fyuA)
M6 Panela 6.7 TCM RF 1 (fimA-agn43)
1 (fimA-fyuA-hlyA-astA)
M34 Panela 6.5 TCM RF 2 (fimA-agn43-fyuA)
2 (fimA-fyuA-kpsMII)
M44 Panela 6.5 SM RT 1 (fimA-agn43)
M45 Panela 6.8 CS RT 1 (fimA-agn43-fyuA-iutA-papC-cdt)
M10.1 Panela 6.7 TCM RT 1 (fimA-papC-app)
M2 Poro 6.6 TCM RT 1 (fimA-agn43)

SM: supermarkets, CS: convenience stores, TCM: traditional cheese manufacturers, MM: municipal markets, RF: refrigerated, RT: kept at room temperature. Genes encoding for: fimA
(Type 1 pili), agn43 (antigen 43), kpsMII (capsule group II), fyuA (yersiniabactin receptor), iutA (aerobactin receptor), papC (P fimbriae), hlyA (UPEC haemolysin), cdt (cytholetal
distending toxin), astA (EAST1 toxin) and aap (dispersin).
 R. Guzman-Hernandez et al. / International Journal of Food Microbiology 237 (2016) 10–16
open refrigerator showcases rise from 6 °C to above 7 °C for b 45 min at
≤ 12 h intervals bacteria are able to elongate and divide (Jones et al.,
2004). In contrast, convenience stores and stalls at municipal markets
in Mexico are usually small family shops that store limited quantities
of products that are sold within a few days, usually within 24 to 48 h.
It is noteworthy, however, that Salmonella in our study was isolated
from a sample kept under refrigeration at a convenience store, similar
to E. coli, Salmonella can grow at low temperatures and form long fila-
ments at 4–8 °C (Humphrey, 2004).
In the present study, Salmonella spp. were isolated from only two
cheese samples (4%). Salmonella prevalence among these food items
have shown to varies in Mexico, while 27% of cheese samples from Gua-
dalajara, Jalisco, were contaminated with Salmonella serotypes none of
the 75 cheese samples collected in Culiacan, Sinaloa, were positive for
these pathogens (Soto-Beltran et al., 2015; Torres-Vitela et al., 2012).
The prevalence of Salmonella in different food items from Tabasco has
been shown to be low (0.44%) (Borbolla-Sala et al., 2004); even in raw
beef meat, that has a prevalence of 11%, compared with other regions
of the country where the prevalence ranges from 15.9% to 60.5%
(Hernández-Vélez et al., 2015; Zaidi et al., 2008).
Our prevalence of STEC (21%) among unpasteurised cheeses is
higher than that reported in other studies. Of 1039 unpasteurised
cheeses analysed in France, 136 (13%) harboured STEC strains, com-
pared to only three (6%) of 50 cheese samples examined in Brazil and
1 (2%) of 54 traditional cheeses in Egypt (Ombarak et al., 2016; Paneto
et al., 2007; Vernozy-Rozand et al., 2005). We isolated a total of 23
STEC strains, which were all positive for the stx1 gene (by PCR), and
none agglutinated with the O157 antiserum or harboured the ehxA
gene. It has been suggested that the presence of STEC in raw milk is
mainly due to contamination during the milking process (Fremaux et
al., 2006). In Mexico most artisanal fresh cheeses are produced with
unpasteurised cow milk obtained by hand milking (Cesin et al., 2007;
Gonzalez-Cordova et al., 2016).
Non-O157 STEC stx1 positive strains are the most prevalent bacteria
and DEC group isolated from street-vended food and beverages in Mex-
ico (Cerna-Cortes et al., 2012a, 2012b; Lopez-Saucedo et al., 2010). Sur-
prisingly, non-O157 STEC strains have not often been identified in
children with diarrheal illness in our country (Cortes-Ortiz et al., 2002,
Estrada-Garcia et al., 2005, 2009; Paniagua et al., 2007; Patzi-Vargas et
al., 2015). Notably, the prevalence of E. coli O157:H7 is remarkably
low despite multiple efforts to identify it from both patients and food
by extensive molecular characterisation of E. coli isolates
(Estrada-Garcia et al., 2005; Gómez-Aldapa et al., 2013; Paniagua et
al., 2007; Varela-Hernandez et al., 2007). Furthermore, when O157 E.
coli or O157:H7 strains were found, the majority of these isolates were
non-toxigenic (Gómez-Aldapa et al., 2013, Varela-Hernandez et al.,
2007).
All 19 DEC strains were susceptible to third-generation cephalosporins
and aminoglycosides, as well as to ciprofloxacin and chloramphenicol.
Overall these results suggest that in this region of the country dairy cattle
may receive less prophylactic antibiotic treatment than in other countries
(http://extension.psu.edu/animals/dairy/news/2004/antibiotic-usage-in-
dairy-herds-in-pa).
We found potential UPEC strains in 15 (29%) cheese samples. These
findings are extremely relevant since UPEC is the main cause of urinary
tract infections worldwide (Foxman, 2014). Moreover, there is increas-
ing evidence that a proportion of human UPEC strains may be acquired
through food (Nordstrom et al., 2013; Vincent et al., 2010). Of the 31 po-
tential UPEC strains isolated in the present study, the most frequent
gene combination was (fimA-agn43), which encodes for molecules in-
volved in UPEC adhesion and persistence (Flores-Mireles et al., 2015;
Ulett et al., 2007). Furthermore, 42% of our isolates carried at least one
siderophore gene, which allows these strains to survive in low iron en-
vironment of the bladder (Watts et al., 2012). We found a potential
UPEC strain that harboured 5 VG including papC (P fimbria), a gene
that has been associated with upper urinary tract infection, and cdt,
15
that encodes for a toxin that induces apoptosis (Jinadasa et al., 2011;
Wright and Hultgren, 2006). According to our definition of potential
UPEC, nine of the DEC strains also harboured UPEC VG. In line with
this observation, STEC and DAEC strains have been isolated from urinary
tract infections; this could be due to the fact that as we have shown they
carried UPEC VG (Abe et al., 2008; Herzog et al., 2014; Tarr et al., 1996;
Toval et al., 2014).
5. Conclusions
Our study showed that unpasteurised fresh cheeses produced in the
state of Tabasco, Mexico, are of poor microbiological quality and har-
bour potential human pathogens; thus their consumption may repre-
sent a public health risk. The most prevalent human pathogens
identified included the well-defined gastrointestinal pathogens, non-
O157 STEC, and potential UPEC strains. Food safety authorities in Mexi-
co need to conduct more rigorous surveillance of fresh cheeses. Further-
more, simple and inexpensive measures as establishing programs
emphasizing good hand milking practices and hygienic manufacturing
procedures may have a major effect on improving the microbiological
quality of these food items.
Acknowledgements
CONACYT (246640) and COFAA scholarships for R G-H. CONACYT
(367902) and SIP grants (20151815 and 201691292) and scholarship
COFAA for A C-R. CONACYT (128779) grant to T E-G. UPEC reference
strains 2H25B and V7 were kindly donated by Professor James R. John-
son, Minnesota University, US.
References
Abe, C.M., Salvador, F.A., Falsetti, I.N., Vieira, M.A.M., Blanco, J., Blanco, J.E., Blanco, M.,
Machado, A.M.O., Elias, W.P., Hernandes, R.T., Gomes, T.A.T., 2008. Uropathogenic
Escherichia coli (UPEC) strains may carry virulence properties of diarrhoeagenic E.
coli. FEMS Immunol. Med. Microbiol. 52, 397–406.
Altalhi, A.D., Hassan, S.A., 2009. Bacterial quality of raw milk investigated by Escherichia
coli and isolates analysis for specific virulence-gene markers. Food Control 20,
913–917.
Anderson, G.G., Palermo, J.J., Schilling, J.D., Roth, R., Heuser, J., Hultgren, S.J., 2003. Intracel-
lular bacterial biofilm-like pods in urinary tract infections. Science 301, 105–107.
Anderson, G.G., Goller, C.C., Justice, S., Hultgren, S.J., Seed, P.C., 2010. Polysaccharide cap-
sule and sialic acid-mediated regulation promote biofilm-like intracellular bacterial
communities during cystitis. Infect. Immun. 78, 963–975.
Aslam, M., Toufeer, M., Narvaez Bravo, C., Lai, V., Rempel, H., Manges, A., Diarra, M.S., 2014.
Characterization of extraintestinal pathogenic Escherichia coli isolated from retail
poultry meats from Alberta, Canada. Int. J. Food Microbiol. 177, 49–56.
Borbolla-Sala, M.E., Vidal-Pérez, M.R., Piña-Gutiérrez, O.E., Ramírez-Messner, I., Vidal-
Vidal, J.J., 2004. Contaminación de los alimentos por Vibrio cholerae, coliformes
fecales, Salmonella, hongos, levaduras y Staphylococcus aureus en Tabasco durante
2003. Salud Tabasco 10, 221–232.
Canizalez-Roman, A., Gonzalez-Nuñez, E., Vidal, J.E., Flores-Villaseñor, H., León-Sicairos,
N., 2013. Prevalence and antibiotic resistance profiles of diarrheagenic Escherichia
coli strains isolated from food items in northwestern Mexico. Int. J. Food Microbiol.
164, 36–45.
CDC (Centers for Disease Control and Prevention), 2013. Surveillance for Foodborne Dis-
ease Outbreaks-United States, 2013: Annual Report. (Available at: http://www.cdc.
gov/foodsafety/pdfs/foodborne-disease-outbreaks-annual-report-2013-508c.pdf
(accessed 25.03.16.)).
Cerna-Cortes, J.F., Gomez-Aldapa, C.A., Rangel-Vargas, E., Torres-Vitela Mdel, R., Villarruel-
Lopez, A., Castro-Rosas, J., 2012a. Presence of some indicator bacteria and
diarrheagenic E. coli pathotypes on jalapeno and serrano peppers from popular mar-
kets in Pachuca City, Mexico. Food Microbiol. 32, 444–447.
Cerna-Cortes, J.F., Vega-Negrete, W., Ortega-Villegas, M.A., Zaidi, M.B., Estrada-Garcia, T.,
2012b. Consumption of street-vended beverage a potential exposure risk for non-
O157 enterohemorrhagic Escherichia coli infection: the importance of testing for vir-
ulence loci. Clin. Infect. Dis. 54, 154–155.
Cesin, V.A., Aliphat, F.M., Ramirez, V.B., Herrera, J.G., Martinez, C.D., 2007. Family milk and
cheese production. A study in three communities in the municipality of Tetlatlahuca
in the state of Tlaxcala, Mexico. Técnica Pecuaria en México 45, 61–76.
CLSI, 2011. Performance standards for antimicrobial susceptibility testing. Twenty-first
Informational Supplement 31. Clinical and Laboratory Standards Institute M02-A10
and M07-A08.
Cody, S.H., Abbott, S.L., Marfin, A.A., Schulz, B., Wagner, P., Robbins, K., Mohle-Boetani, J.C.,
Vugia, D.J., 1999. Two outbreaks of multidrug-resistant Salmonella serotype
16 R. Guzman-Hernandez et al. / International Journal of Food Microbiology 237 (2016) 10–16
typhimurium DT104 infections linked to raw-milk cheese in northern California.
J. Am. Med. Assoc. 281, 1805–1810.
Cortes-Ortiz, I.A., Rodriguez-Angeles, G., Moreno-Escobar, E.A., Tenorio-Lara, J.M., Torres-
Mazadiego, B.P., Montiel-Vazquez, E., 2002. Outbreak caused by Escherichia coli in
Chalco, Mexico. Salud Publica Mex. 44, 297–302.
Dominguez, M., Jourdan-Da Silva, N., Vaillant, V., Pihier, N., Kermin, C., Weill, F.X., Delmas,
G., Kerouanton, A., Brisabois, A., De Valk, H., 2009. Outbreak of Salmonella enterica se-
rotype Montevideo infections in France linked to consumption of cheese made from
raw milk. Foodborne Pathog. Dis. 6, 121–128.
Espie, E., Vaillant, V., Mariani-Kurkdjian, P., Grimont, F., Martin-Schaller, R., De Valk, H.,
Vernozy-Rozand, C., 2006. Escherichia coli O157 outbreak associated with fresh un-
pasteurized goats' cheese. Epidemiol. Infect. 134, 143–146.
Estrada-Garcia, T., Cerna, J.F., Paheco-Gil, L., Velazquez, R.F., Ochoa, T.J., Torres, J., DuPont,
H.L., 2005. Drug-resistant diarrheogenic Escherichia coli, Mexico. Emerg. Infect. Dis.
11, 1306–1308.
Estrada-Garcia, T., Lopez-Saucedo, C., Thompson-Bonilla, R., Abonce, M., Lopez-
Hernandez, D., Santos, J.I., Rosado, J.L., DuPont, H.L., Long, K.Z., 2009. Association of
diarrheagenic Escherichia coli pathotypes with infection and diarrhea among Mexican
children and association of atypical enteropathogenic E. coli with acute diarrhea.
J. Clin. Microbiol. 47, 93–98.
Farina, F., Fuser, R., Rossi, M., Scotton, P.G., 2008. Brucellosis outbreak in Treviso province
caused by infected cheese from an endemic area. Infez. Med. 16, 154–157.
FDA (U.S. Food and Drug Administration), 2002. Bacteriological Analytical Manual Online.
(Chapter 4. Available at: http://www.fda.gov/Food/FoodScienceResearch/
LaboratoryMethods/ucm064948.htm (accessed 25.03.16.)).
FDA (U.S. Food and Drug Administration), 2014. Bacteriological Analytical Manual Online.
(Chapter 5. Available at: http://www.fda.gov/Food/FoodScienceResearch/
LaboratoryMethods/ucm070149.htm (accessed 25.03.16.)).
Flores-Mireles, A.L., Walker, J.N., Caparon, M., Hultgren, S.J., 2015. Urinary tract infections: ep-
idemiology, mechanisms of infection and treatment options. Nat. Rev. Microbiol. 13,
269–284.
Foxman, B., 2014. Urinary tract infection syndromes: occurrence, recurrence, bacteriolo-
gy, risk factors, and disease burden. Infect. Dis. Clin. North Am. 28, 1–13.
Frank, C., Werber, D., Cramer, J.P., Askar, M., Faber, M., Heiden, M.A.D., Bernard, H., Fruth,
A., Prager, R., Spode, A., Wadl, M., Zoufaly, A., Jordan, S., Kemper, M.J., Follin, P., Muller,
L., King, L.A., Rosner, B., Buchholz, U., Stark, K., Krause, G., 2011. Epidemic profile of
Shiga-toxin-producing Escherichia coli O104:H4 outbreak in Germany. N. Engl.
J. Med. 365, 1771–1780.
Fremaux, B., Raynaud, S., Beutin, L., Rozand, C.V., 2006. Dissemination and persistence of
Shiga toxin-producing Escherichia coli (STEC) strains on French dairy farms. Vet.
Microbiol. 117, 180–191.
Gómez-Aldapa, C.A., Diaz-Cruz, C.A., Cerna-Cortes, J.F., Torres-Vitela, M.R., Villarruel-
López, A., Rangel-Vargas, E., Castro-Rosas, A., 2013. Escherichia coli O157 in ground
beef from local retail markets in Pachuca, Mexico. J. Food Prot. 76, 680–684.
Gonzalez-Cordova, A.F., Yescas, C., Ortiz-Estrada, A.M., Rosa-Alcaraz, M.A.D., Hernandez-
Mendoza, A., Vallejo-Cordoba, B., 2016. Invited review: artisanal Mexican cheeses.
J. Dairy Sci. 99, 3250–3262.
Gould, L.H., Mungai, E., Behravesh, C.B., 2014. Outbreaks attributed to cheese: differences
between outbreaks caused by unpasteurized and pasteurized dairy products, United
States, 1998–2011. Foodborne Pathog. Dis. 11, 545–551.
Hernández-Vélez, R.M., Arroyo-Falconi, P., Guzmán-Hernández, R., Pacheco-Gil, L.,
Urrieta-Saltijeral, J.M., Estrada-García, T., 2015. Estudio de la susceptibilidad a los
antimicrobianos de Salmonella aisladas en carne molida de res en Tabasco.
Aportaciones al Estudio de las Ciencias Biotecnológicas y Alimentarias. Villahermosa,
Tabasco. pp. 105–110.
Herzog, K., Dusel, J.E., Hugentobler, M., Beutin, L., Sägesser, G., Stephan, R., Hächler, H.,
Nüesch-Inderbinen, M., 2014. Diarrheagenic enteroaggregative Escherichia coli caus-
ing urinary tract infection and bacteremia leading to sepsis. Infection 42, 441–444.
Honish, L., Predy, G., Hislop, N., Chui, L., Kowalewska-Grochowska, K., Trottier, L., Kreplin,
C., Zazulak, I., 2005. An outbreak of E. coli O157:H7 hemorrhagic colitis associated
with unpasteurized gouda cheese. Can. J. Public Health 96, 182–184.
Humphrey, T., 2004. Salmonella, stress responses and food safety. Nat. Rev. Microbiol. 2,
504–509.
Jinadasa, R.N., Bloom, S.E., Weiss, R.S., Duhamel, G.E., 2011. Cytolethal distending toxin: a
conserved bacterial genotoxin that blocks cell cycle progression, leading to apoptosis
of a broad range of mammalian cell lineages. Microbiology 157, 1851–1875.
Johnson, J.R., O'Bryan, T.T., 2004. Detection of the Escherichia coli group 2 polysaccharide
capsule synthesis gene kpsM by a rapid and specific PCR-based assay. J. Clin.
Microbiol. 42, 1773–1776.
Johnson, J.R., Stell, A.L., 2000. Extended virulence genotypes of Escherichia coli strains from
patients with urosepsis in relation to phylogeny and host compromise. J. Infect. Dis.
181, 261–272.
Jones, T., Gill, C.O., McMullen, L.M., 2004. The behaviour of log phase Escherichia coli at
temperatures that fluctuate about the minimum for growth. Lett. Appl. Microbiol.
39, 296–300.
Kaper, J.B., Nataro, J.P., Mobley, H.L., 2004. Pathogenic Escherichia coli. Nat. Rev. Microbiol.
2, 123–140.
Koch, J., Dworak, R., Prager, R., Becker, B., Brockmann, S., Wicke, A., Wichmann-Schauer, H.,
Hof, H., Werber, D., Stark, K., 2010. Large listeriosis outbreak linked to cheese made
from pasteurized milk, Germany, 2006–2007. Foodborne Pathog. Dis. 7, 1581–1584.
Lopez-Saucedo, C., Cerna, J.F., Villegas-Sepulveda, N., Thompson, R., Velazquez, F.R., Torres, J.,
Tarr, P.I., Estrada-Garcia, T., 2003. Single multiplex polymerase chain reaction to detect
diverse loci associated with diarrheagenic Escherichia coli. Emerg. Infect. Dis. 9, 127–131.
Lopez-Saucedo, C., Cerna, J.F., Estrada-Garcia, T., 2010. Non-O157 Shiga toxin producing
Escherichia coli is the most prevalent diarrheagenic E. coli pathotype in street-vended
taco dressings in Mexico City. Clin. Infect. Dis. 50, 450–451.
MacDonald, P.D., Whitwam, R.E., Boggs, J.D., MacCormack, J.N., Anderson, K.L., Reardon,
J.W., Saah, J.R., Graves, L.M., Hunter, S.B., Sobel, J., 2005. Outbreak of listeriosis
among Mexican immigrants as a result of consumption of illicitly produced Mexi-
can-style cheese. Clin. Infect. Dis. 40, 677–682.
Méndez Martínez, C., Páez Jiménez, A., Cortés-Blanco, M., Salmoral, C.E., Mohedano
Mohedano, E., Plata, C., Varo Baena, A., Martíinez Navarro, F., 2003. Brucellosis out-
break due to unpasteurized raw goat cheese in Andalucia (Spain), January–March
2002. Euro Surveill. 8, 164–168.
Nataro, J.P., Kaper, J.B., 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11, 142–201.
Nordstrom, L., Liu, C.M., Price, L.B., 2013. Foodborne urinary tract infections: a new para-
digm for antimicrobial-resistant foodborne illness. Front. Microbiol. 4, 1–6.
Ombarak, R.A., Hinenoya, A., Awasthi, S.P., Iguchi, A., Shima, A., Elbagory, A.-R.M.,
Yamasaki, S., 2016. Prevalence and pathogenic potential of Escherichia coli isolates
from raw milk and raw milk cheese in Egypt. Int. J. Food Microbiol. 221, 69–76.
Paneto, B.R., Schocken-Iturrino, R.P., Macedo, C., Santo, E., Marin, J.M., 2007. Occurrence of
toxigenic Escherichia coli in raw milk cheese in Brazil. Arquivo Brasileiro de Medicina
Veterinária e Zootecnia 59, 508–512.
Paniagua, G.L., Monroy, E., Garcia-Gonzalez, O., Alonso, J., Negrete, E., Vaca, S., 2007. Two
or more enteropathogens are associated with diarrhoea in Mexican children. Ann.
Clin. Microbiol. Antimicrob. 6, 17.
Parrilla-Cerrillo, M.C., Vázquez-Castellanos, J.L., Saldate-Castañeda, E.O., Nava-Fernández,
L.M., 1993. Brotes de toxiinfecciones alimentarias de origen microbiano y parasitario.
Salud Publica Mex. 35, 456–463.
Paton, A.W., Paton, J.C., 1998. Detection and characterization of Shiga toxigenic Escherichia
coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA,
rfbO111, and rfbO157. J. Clin. Microbiol. 36, 598–602.
Patzi-Vargas, S., Zaidi, M.B., Bernal-Reynaga, R., León-Cen, M., Michel, A., Estrada-Garcia,
T., 2013. Persistent bloody diarrhoea without fever associated with diffusely adherent
Escherichia coli in a young child. J. Med. Microbiol. 62, 1907–1910.
Patzi-Vargas, S., Zaidi, M.B., Perez-Martinez, I., León-Cen, M., Michel-Ayala, A., Chaussabel,
D., Estrada-Garcia, T., 2015. Diarrheagenic Escherichia coli carrying supplementary
virulence genes are an important cause of moderate to severe diarrhoeal disease in
Mexico. PLoS Negl. Trop. Dis. 9, 1–18.
Restieri, C., Garriss, G., Locas, M.C., Dozois, C.M., 2007. Autotransporter-encoding se-
quences are phylogenetically distributed among Escherichia coli clinical isolates and
reference strains. Appl. Environ. Microbiol. 73, 1553–1562.
Ruiz, J., Simon, K., Horcajada, J.P., Velasco, M., Barranco, M., Roig, G., Moreno-Martínez, A.,
Martínez, J.A., Jiménez de Anta, T., Mensa, J., Vila, J., 2002. Differences in virulence fac-
tors among clinical isolates of Escherichia coli causing cystitis and pyelonephritis in
women and prostatitis in men. J. Clin. Microbiol. 40, 4445–4449.
Secretaria de Salud, 2010. Productos y servicios. Leche, fórmula láctea, producto lácteo
combinado y derivados lácteos. Disposiciones y especificaciones sanitarias. Métodos de
prueba. (Available at: http://dof.gob.mx/nota_detalle.php?codigo=5160755&fecha=
27/09/2010 (accessed 25.03.16.)).
Soto-Beltran, M., Gerba, C.P., Porto Fett, A., Luchansky, J.B., Chaidez, C., 2015. Prevalence
and characterization of Listeria monocytogenes, Salmonella and Shiga toxin-producing
Escherichia coli isolated from small Mexican retail markets of queso fresco. Int.
J. Environ. Health Res. 25, 140–148.
Tarr, P.I., Fouser, L.S., Stapleton, A.E., Wilson, R.A., Kim, H.H., Vary, J.C., Clausen, C.R., 1996.
Hemolytic-uremic syndrome in a six-year-old girl after a urinary tract infection with
Shiga-toxin-producing Escherichia coli O103:H2. N. Engl. J. Med. 335, 635–638.
Torres-Vitela, M.R., Mendoza-Bernardo, M., Castro-Rosa, J., Gómez-Aldapa, C.A., Garay-
Martínez, L.E., Navarro-Hidalgo, V., Villarruel-López, A., 2012. Incidence of Salmonella,
Listeria monocytogenes, Escherichia coli O157:H7 and staphylococcal enterotoxin in
two types of Mexican fresh cheeses. J. Food Prot. 75, 79–84.
Toval, F., Köhler, C.-D., Vogel, U., Wagenlehner, F., Mellmann, A., Fruth, A., Schmidt, M.A.,
Karch, H., Bielaszewska, M., Dobrindt, U., 2014. Characterization of Escherichia coli iso-
lates from hospital inpatients or outpatients with urinary tract infection. J. Clin.
Microbiol. 52, 407–418.
Travis, J.W., Kulesus, R.R., Mulvey, M.A., 2008. Origins and virulence mechanisms of
uropathogenic Escherichia coli. Exp. Mol. Pathol. 85, 11–19.
Ulett, G.C., Valle, J., Beloin, C., Sherlock, O., Ghigo, J.-M., Schembri, M., 2007. Functional
analysis of antigen 43 in uropathogenic Escherichia coli reveals a role in long-term
persistence in the urinary tract. Infect. Immun. 75, 3233–3244.
Varela-Hernandez, J.J., Cabrera-Diaz, E., Cardona-Lopez, M.A., Ibarra-Velazquez, L.M., Rangel-
Villalobos, H., Castillo, A., Torres-Vitela, M.R., Ramirez-Alvarez, A., 2007. Isolation and
characterization of Shiga toxin-producing Escherichia coli O157:H7 and non-O157 from
beef carcasses at a slaughter plant in Mexico. Int. J. Food Microbiol. 113, 237–241.
Vernozy-Rozand, C., Montet, M.P., Berardin, M., Bavai, C., Beutin, L., 2005. Isolation and
characterization of Shiga toxin-producing Escherichia coli strains from raw milk
cheeses in France. Lett. Appl. Microbiol. 41, 235–241.
Vincent, C., Boerlin, P., Daignault, D., Dozois, C.M., Dutil, L., Galanakis, C., Reid-Smith, R.J.,
Tellier, P.-P., Tellis, P.A., Ziebell, K., Manges, A.R., 2010. Food reservoir for Escherichia
coli causing urinary tract infections. Emerg. Infect. Dis. 16, 88–95.
Watts, R.E., Totsika, M., Challinor, V.L., Mabbett, A.N., Ulett, G.C., Voss, J.J.D., Schembria,
M.A., 2012. Contribution of siderophore systems to growth and urinary tract coloni-
zation of asymptomatic bacteriuria Escherichia coli. Infect. Immun. 80, 333–344.
Wright, K.J., Hultgren, S.J., 2006. Sticky fibers and uropathogenesis: bacterial adhesins in
the urinary tract. Future Microbiol 1, 75–87.
Xia, X., Meng, J., McDermott, P.F., Zhao, S., 2011. Escherichia coli from retail meats carry
genes associated with uropathogenic Escherichia coli, but are weakly invasive in
human bladder cell culture. J. Appl. Microbiol. 110, 1166–1176.
Zaidi, M.B., Calva, J.J., Estrada-Garcia, M.T., Leon, V., Vazquez, G., Figueroa, G., Lopez, E.,
Contreras, J., Abbott, J., Zhao, S., McDermott, P., Tollefson, L., 2008. Integrated food
chain surveillance system for Salmonella spp. in Mexico. Emerg. Infect. Dis. 14,
429–435.