DNA Electrophoresis

Methods in
Molecular Biology 2119
Katsuhiro Hanada Editor
DNA
Electrophoresis
Methods and Protocols
METHODS IN MOLECULAR BIOLOGY
Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, UK
For further volumes:

http://www.springer.com/series/7651
For over 35 years, biological scientists have come to rely on the research protocols and
methodologies in the critically acclaimed Methods in Molecular Biology series. The series was
the first to introduce the step-by-step protocols approach that has become the standard in all
biomedical protocol publishing. Each protocol is provided in readily-reproducible step-by-
step fashion, opening with an introductory overview, a list of the materials and reagents
needed to complete the experiment, and followed by a detailed procedure that is supported
with a helpful notes section offering tips and tricks of the trade as well as troubleshooting
advice. These hallmark features were introduced by series editor Dr. John Walker and
constitute the key ingredient in each and every volume of the Methods in Molecular Biology
series. Tested and trusted, comprehensive and reliable, all protocols from the series are
indexed in PubMed.
DNA Electrophoresis
Methods and Protocols
Edited by
Katsuhiro Hanada
Clinical Engineering Research Center, Faculty of Medicine, Oita University, Yufu, Oita, Japan
Editor
Katsuhiro Hanada
Clinical Engineering Research Center
Faculty of Medicine, Oita University
Yufu, Oita, Japan
ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-0716-0322-2 ISBN 978-1-0716-0323-9 (eBook)
https://doi.org/10.1007/978-1-0716-0323-9
© Springer Science+Business Media, LLC, part of Springer Nature 2020
This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply,
even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations
and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
express or implied, with respect to the material contained herein or for any errors or omissions that may have been made.
The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Cover Caption: Image courtesy of Dr. Luca Zardoni and Dr. Giordano Liberi.
This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer
Nature.
The registered company address is: 233 Spring Street, New York, NY 10013, U.S.A.
Preface
Gel electrophoresis of DNA is one of many routine laboratory methods in molecular biology
and is used for the analysis and purification of DNA fragments. To date, electrophoresis has
been used for the analysis of various DNA reactions in vitro, such as polymerase chain
reaction (PCR), restriction enzyme digestion, characterization of enzymes involved in DNA
reactions, and sequencing. There is no doubt that electrophoresis has contributed to
biological studies, particularly the understanding of single gene function(s). A recent
trend in molecular biology is to endeavor to understand the genome-wide functions of
biochemical DNA reactions within cells including the detection of intermediate DNA
structures. To address this, many new techniques have been developed, among them new
applications for DNA electrophoresis. For successful genome-wide analysis, it is important
that the technical aspects of electrophoresis and DNA sample preparation are considered.
Therefore, I have collected step-by-step protocols covering these aspects that are applicable
to various species including bacteria, yeasts, and mammalian cells.
Finally, I would like to thank all the contributors that have enabled the publication of
this book, especially to those scientists who have shared their hands-on expertise through
their publications. Without their contribution, this book would not have been possible.
Yufu, Oita, Japan Katsuhiro Hanada
v
Contents
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
1 Introduction and Perspectives of DNA Electrophoresis . . . . . . . . . . . . . . . . . . . . . . 1

Katsuhiro Hanada
2 Two-Dimensional Gel Electrophoresis to Resolve DNA Topoisomers . . . . . . . . . 15
Elizabeth G. Gibson, Alexandria A. Oviatt, and Neil Osheroff
3 Using Two-Dimensional Intact Mitochondrial DNA (mtDNA)
Agarose Gel Electrophoresis (2D-IMAGE) to Detect Changes
in Topology Associated with Mitochondrial Replication,
Transcription, and Damage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25
Jill E. Kolesar and Brett A. Kaufman
4 2D Gel Electrophoresis to Detect DNA Replication and Recombination
Intermediates in Budding Yeast . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43
Luca Zardoni, Eleonora Nardini, and Giordano Liberi
5 Neutral–Neutral 2-Dimensional Agarose Gel Electrophoresis
for Visualization of E. coli DNA Replication Structures . . . . . . . . . . . . . . . . . . . . . . 61
Karla A. Mettrick, Georgia M. Weaver, and Ian Grainge
6 Alkali Comet Assay in Genotoxicity Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73
Maya Ueda
7 Analysis of DNA Interstrand Cross-Links and their Repair
by Modified Comet Assay . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
Lonnie P. Swift, Lianne Castle, and Peter J. McHugh
8 Analysis of Chromosomal DNA Fragmentation in Apoptosis
by Pulsed-Field Gel Electrophoresis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89
Takeshi Terabayashi, Asako Tokumaru, Toshimasa Ishizaki,
and Katsuhiro Hanada
9 Detection of DNA Damage-Induced DSBs by the Contour-Clamped
Homogeneous Electric Field (CHEF) System in Mammalian Cells . . . . . . . . . . . . 101
Yuri Takiguchi, Ryo Kariyazono, and Kunihiro Ohta
10 Investigation of DNA Double-Strand Breaks Induced in Host
Cells Following Infection with Genotoxic Bacteria . . . . . . . . . . . . . . . . . . . . . . . . . . 111
Rie Teshima
11 Monitoring of DNA Replication and DNA Double-Strand Breaks
in Saccharomyces cerevisiae by Pulsed-Field Gel Electrophoresis (PFGE) . . . . . . . 123
Kenji Keyamura and Takashi Hishida
12 Pulsed-Field Gel Electrophoresis for Detecting Chromosomal
DNA Breakage in Fission Yeast . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 135
Takatomi Yamada, Hiroshi Murakami, and Kunihiro Ohta
vii
viii Contents
13 Detection of DNA Double-Strand Breaks by Pulsed-Field

Gel Electrophoresis of Circular Bacterial Chromosomes . . . . . . . . . . . . . . . . . . . . . 145
Ichizo Kobayashi and Katsuhiro Hanada
14 Detection of Bleomycin-Induced DNA Double-Strand Breaks
in Escherichia coli by Pulsed-Field Gel Electrophoresis Using
a Rotating Gel Electrophoresis System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 155
Naomi Inoue, Hisashi Narahara, Yoshihiro Nishida,
15 Circle-Seq: Isolation and Sequencing of Chromosome-Derived
Circular DNA Elements in Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 165
Henrik Devitt Møller
16 Chromatin Pull-Down Methodology Based on DNA Triple
Helix Formation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 183
Asako Isogawa, Robert P. Fuchs, and Shingo Fujii
17 DNA Fragment Agarose Gel Electrophoresis for Chromatin
Immunoprecipitation (ChIP). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 201
Mayu Isono and Satoru Hashimoto
18 Postlabeling/PAGE Method for Detection of DNA Adducts. . . . . . . . . . . . . . . . . 213
Kazuhiro Shiizaki
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 227
Contributors
LIANNE CASTLE • Department of Oncology, MRC Weatherall Institute of Molecular

Medicine, University of Oxford, Oxford, UK
ROBERT P. FUCHS • Marseille Medical Genetics, Aix-Marseille University, Inserm, Marseille,
France
SHINGO FUJII • DNA Damage Tolerance, CNRS, Marseille, France; Inserm, CRCM,
Marseille, France; Institut Paoli-Calmettes, Marseille, France; Aix-Marseille University,
Marseille, France
ELIZABETH G. GIBSON • Department of Pharmacology, Vanderbilt University School of
Medicine, Nashville, TN, USA
IAN GRAINGE • School of Environmental and Life Sciences, University of Newcastle,
Callaghan, NSW, Australia
KATSUHIRO HANADA • Clinical Engineering Research Center, Faculty of Medicine,
Oita University, Yufu, Oita, Japan
SATORU HASHIMOTO • Department of Genetics, Research Institute of Environmental
Medicine, Nagoya University, Nagoya, Japan
TAKASHI HISHIDA • Department of Molecular Biology, Graduate School of Science,
Gakushuin University, Tokyo, Japan
NAOMI INOUE • Department of Obstetrics and Gynecology, Faculty of Medicine,
TOSHIMASA ISHIZAKI • Department of Pharmacology, Faculty of Medicine, Oita University,
Yufu, Oita, Japan
ASAKO ISOGAWA • DNA Damage Tolerance, CNRS, Marseille, France; Inserm, CRCM,
Marseille, France; Institut Paoli-Calmettes, Marseille, France; Aix-Marseille University,
Marseille, France
MAYU ISONO • Department of Genetics, Research Institute of Environmental Medicine,
Nagoya University, Nagoya, Japan
RYO KARIYAZONO • Department of Life Sciences, Graduate School of Arts and Sciences,
The University of Tokyo, Tokyo, Japan
BRETT A. KAUFMAN • Division of Cardiology, Department of Medicine, Center for
Metabolism and Mitochondrial Medicine and the Vascular Medicine Institute,
University of Pittsburgh, Pittsburgh, PA, USA
KENJI KEYAMURA • Department of Molecular Biology, Graduate School of Science,
Gakushuin University, Tokyo, Japan
ICHIZO KOBAYASHI • Kyorin University School of Medicine, Tokyo, Japan
JILL E. KOLESAR • Department of Animal Biology, University of Pennsylvania, Philadelphia,
PA, USA
GIORDANO LIBERI • Istituto di Genetica Molecolare, CNR, Pavia, Italy; IFOM Foundation,
Milan, Italy
PETER J. MCHUGH • Department of Oncology, MRC Weatherall Institute of Molecular
KARLA A. METTRICK • School of Environmental and Life Sciences, University of Newcastle,
ix
x Contributors
HENRIK DEVITT MØLLER • Department of Biology, Faculty of Science, University of

Copenhagen, Copenhagen, Denmark; Department of Biology, Institute of Biochemistry,
ETH Zurich, Switzerland
HIROSHI MURAKAMI • Department of Biological Sciences, Faculty of Science and Engineering,
Chuo University, Tokyo, Japan
HISASHI NARAHARA • Department of Obstetrics and Gynecology, Faculty of Medicine,
ELEONORA NARDINI • Istituto di Genetica Molecolare, CNR, Pavia, Italy
YOSHIHIRO NISHIDA • Department of Obstetrics and Gynecology, Faculty of Medicine,
KUNIHIRO OHTA • Department of Life Sciences, Graduate School of Arts and Sciences,
NEIL OSHEROFF • Department of Biochemistry, Vanderbilt University School of Medicine,
Nashville, TN, USA; Department of Medicine (Hematology/Oncology), Vanderbilt
University School of Medicine, Nashville, TN, USA; VA Tennessee Valley Healthcare System,
Nashville, TN, USA
ALEXANDRIA A. OVIATT • Department of Biochemistry, Vanderbilt University School of
Medicine, Nashville, TN, USA
KAZUHIRO SHIIZAKI • Department of Applied Biosciences, Faculty of Life Sciences,
Toyo University, Itakura, Gunma, Japan
LONNIE P. SWIFT • Department of Oncology, MRC Weatherall Institute of Molecular
YURI TAKIGUCHI • Department of Life Sciences, Graduate School of Arts and Sciences,
TAKESHI TERABAYASHI • Department of Pharmacology, Faculty of Medicine, Oita University,
Yufu, Oita, Japan
RIE TESHIMA • Shirokuma Dental Clinic, Beppu, Oita, Japan
ASAKO TOKUMARU • Department of Pharmacology, Faculty of Medicine, Oita University,
Yufu, Oita, Japan
MAYA UEDA • BioSafety Research Center Inc. (BSRC), Shizuoka, Japan
GEORGIA M. WEAVER • School of Environmental and Life Sciences, University of Newcastle,
TAKATOMI YAMADA • Department of Biological Sciences, Faculty of Science and Engineering,
Chuo University, Tokyo, Japan; Department of Life Sciences, Graduate School of Arts and
Sciences, The University of Tokyo, Tokyo, Japan
LUCA ZARDONI • Istituto di Genetica Molecolare, CNR, Pavia, Italy; Scuola Universitaria
Superiore, IUSS, Pavia, Italy
Chapter 1
Introduction and Perspectives of DNA Electrophoresis

Katsuhiro Hanada
Abstract
Gel electrophoresis of DNA is one of the most frequently used techniques in molecular biology. Typically, it
is used in the following: the analysis of in vitro reactions and purification of DNA fragments, analysis of PCR
reactions, characterization of enzymes involved in DNA reactions, and sequencing. With some ingenuity
gel electrophoresis of DNA is also used for the analysis of cellular biochemical reactions. For example, DNA
breaks that accumulate in cells are analyzed by the comet assay and pulsed-field gel electrophoresis (PFGE).
Furthermore, DNA replication intermediates are analyzed with two-dimensional (2D) gel electrophoresis.
Moreover, several new methods for analyzing various chromosomal functions in cells have been developed.
In this chapter, a brief introduction to these is given.
Key words Mobility, Size and shape, Pulsed-field gel electrophoresis, 2-dimentional electrophoresis,
In vivo biochemistry, Intermediate structures of DNAs
1 Introduction
Gel electrophoresis is one of the methods used to separate charged

molecules, such as DNAs, RNAs, and proteins, based on the differ-
ence of their migration speed in a gel matrix under an electric field.
Gel electrophoresis is a classical technique and still the most fre-
quently used for the identification and purification of DNA frag-
ments [1, 2]. DNA fragments are separated based on their size and
shape, and its resolution is favorable compared with other methods,
such as a liquid chromatography and gradient centrifugation. An
advantage of gel electrophoresis is that even low concentration of
DNA can be detected by staining with fluorescent intercalators. For
example, 25 picograms (pg) of DNA is detected by cyber-gold
staining [3]. A standard application of DNA electrophoresis is to
analyze double-stranded DNAs (dsDNAs) with nearly neutral
(around pH 8.0) buffer, such as tris–acetate buffer with ethylene-
diamine tetraacetate (EDTA), often called TAE buffer, and tris–
borate buffer with EDTA, called TBE [4]. For analysis of denatured
single-stranded DNAs (ssDNAs), alkaline gel electrophoresis is the
Katsuhiro Hanada (ed.), DNA Electrophoresis: Methods and Protocols, Methods in Molecular Biology, vol. 2119,
https://doi.org/10.1007/978-1-0716-0323-9_1, © Springer Science+Business Media, LLC, part of Springer Nature 2020
1
2 Katsuhiro Hanada
most commonly used [5, 6]. Electrophoresis is widely used for gene
engineering in vitro, such as purification and cloning of DNA
fragments that are used in the construction of various vectors for
gene expression and gene targeting. It has also been established as a
routine laboratory technique for genetic and biochemical analysis
(e.g., functional analysis of enzymes involved in DNA reactions and
analysis of PCR products [4]).
Combined with a hybridization technique or PCR, it has been
used for the analysis of gene mutations, polymorphisms, and gene
expression. In particular, the most ambitious application of electro-
phoresis is to analyze in cells the intermediate structures of DNA
involved in the various DNA reactions, such as DNA replication,
DNA repair, recombination, transcription, and chromosome parti-
tion and segregation [7, 8]. DNA intermediate structures are usu-
ally unstable, especially in cells. Therefore, elaborate protocols have
been developed that consider the preparation of DNA samples
through to their fractionation with electrophoresis.
In this book, methods of DNA electrophoresis are featured
with an emphasis on genome-wide analysis of intermediate struc-
tures of DNA reactions in cells. 2D gel electrophoresis is widely
used to understand the mechanism of DNA replication, recombi-
nation, and chromosome dynamics. The comet assay, a method of
single cell electrophoresis, and PFGE are used to analyze DNA
damage, in particular DNA breaks. Here these strategies are briefly
introduced.
2 2D Gel Electrophoresis
The theoretical model of mobility during electrophoresis has been

discussed previously. The following section introduces the most
classical and simplest model of the principle of electrophoresis.
Several excellent reviews that summarize the kinetic model of
DNA electrophoresis are found elsewhere [2, 9–11]. When a
charged particle is placed in an electric field, it is accelerated and
its speed increases until its resistance becomes equal to the electric
force. When the electric force and the resistance become equal, the
speed of the particle becomes constant, which is often called steady
state. In this case, electric force and resistance force are equal.
At this time,
Electric force ¼ Electric charge ðQ Þ
Strength of the electric field ðE Þ
Resistance force ¼ Speed ðvÞ Frictional coefficient ð f Þ
Therefore,
Perspective of DNA Electrophoresis 3
v ¼ QE=f
Then mobility (μ) of the particle is

μ ¼ v=E ¼ Q =f
Frictional coefficient ( f ) is dependent on the size of the particle

and the nature of the medium. Therefore,
f ¼ k η. Coefficient (k) of the particle, viscosity coefficient (η).
If the particle is a sphere, k ¼ 6 πr (r is the radius of the sphere)
μ ¼ Q =6πr η
The coefficient (k) of the particle is smallest when the particle is

a sphere. The more the shape of the particle is distorted from the
sphere, the larger the coefficient (k) becomes. In general, the
intramolecular rotation of particles is much faster than the speed
of electrophoresis, meaning that nonspherical particles also behave
like spherical particles with a larger radius. This suggests that
mobility is determined by the length of DNA molecules as long as
the shape of DNAs are the same. Based on this, electrophoresis
through polyacrylamide or agarose gels was developed to fraction-
ate DNA and RNA molecules by their molecular size, and is now a
standard method for the analysis and purification of DNA and RNA
fragments. Small DNA fragments from one nucleotide to 500 bp
are effectively separated by polyacrylamide gel electrophoresis
(PAGE), and a wide range of DNA fragments from 100 bp to
approximately 50 kb in length can be separated in agarose gels of
various concentrations.
The shape of molecules affects their mobility during electro-
phoresis. Even for DNA molecules of the same length, the mobi-
lities of circular DNAs are different from that of the linear DNA
because their potential for intramolecule rotation is different. The
mobility of circular DNA is quite complex. Open circular DNA has
a relatively large potential for intramolecular rotation, whereas
supercoiled-circular DNA loses the potential for intramolecular
rotation due to the tension of the supercoil, resulting in a reduced
coefficient (k). This reduction in k is in inverse proportion to the
number of supercoils, meaning that supercoiled DNAs display a
higher mobility than open circular and linear DNAs (Fig. 1a, b).
The elements that affect DNA mobility, their size and shape were
often not treated differently. Using these two different parameters
to separate DNA molecules has given rise to 2D gel electrophoresis.
The combinations of those parameters depend on the need.
Typical examples are as follows:
1. Two different concentrations of agarose gels. To detect small and
large DNA fragments at the same time, two different concen-
trations of agarose can be combined. For the first dimension a
low concentration of agarose gel, less than 0.7%, is used to
4 Katsuhiro Hanada
Open circular DNA,

Nicked circular DNA
Mobility
Linear DNA
Coverntly colsed circular

DNA (cccDNA)
B
Open circular DNA
Lk = 0
Mobility
Lk = 1
Lk = 2
Lk = 3 Supercoiled
・ DNA
・
・
Lk = N
C
Agarose gel electrophoresis
in the presence of EtBr
2nd dimension
1st dimension
Native agarose gel electrophoresis
Fig. 1 Schematic representation of gel electrophoresis of DNAs separated

according to their shape. (a) Differences in the mobility of covalently closed
circular DNA (cccDNA), linear DNA, and open circle DNA. (b) Schematic
representation of the mobility of supercoiled DNAs. The linking number affects
the mobility during gel electrophoresis. (c) Schematic representation of the
detection of DNA replication structures by 2D gel electrophoresis. Replication
intermediates, Y arc, and bubble structures of the restriction fragment can be
analyzed by 2D gel electrophoresis, fractionated by native and ethidium
bromide-containing gels
separate larger DNAs. In the second dimension, a higher con-

centration of agarose, typically more than 1.5%, is used for
smaller fragments.
2. Native and intercalator-containing gels. To analyze different
DNA shapes, native gels and intercalator-containing gels are
often combined. In the first dimension, DNA is fractionated by
a native gel. Here, DNA fragments are separated according to
their size. In the second dimension, DNA is fractionated in the
presence of an intercalator and the fragments are separated
according to their shape. This results in the fractionation of
various DNA structures. This method can be used to analyze
various intermediate structures that accumulate in cells such as
supercoiled DNAs [12], DNA replication forks, and recombi-
nation intermediates (Fig. 1b, c) [13, 14]. As an intercalator,
ethidium bromide is often used, and chloroquine may be used
for the detection of supercoiled DNAs.
3. Native and denaturing gels. To detect single-strand breaks
(SSBs) on dsDNAs, native and denaturing gels are combined.
In the first dimension, dsDNAs are separated in a neutral
buffer, such as TAE and TBE, and in the second dimension,
alkaline denatured ssDNAs are separated using an alkaline
buffer. This method has been used for studies of DNA replica-
tion and recombination [7, 8].
The work of many researchers has led to the successful detec-
tion of various DNA structures, such as supercoiled DNAs
[14, 15], intermediate structures of DNA replication and recombi-
nation [13, 16], and chromosome segregation [17].
3 Comet Assay
The comet assay is a technique to quantify DNA breaks in individual

cells and is used for evaluating genotoxicity, DNA repair, and
genome instability. This technique was originally developed by
Östling and Johansson [18]. The method that they developed is
known as “neutral comet assay.” In their method, electrophoresis
was performed in a neutral buffer, and DNA fragments as a result of
DSBs were preferentially detected. Later, Singh and his coworkers
modified this technique resulting in an alkaline comet assay, which
is performed in alkaline denaturing conditions [19]. In the alkaline
comet assay, both SSBs and DSBs in the cells can be detected,
leading to enhanced sensitivity to detect DNA breaks compared
with that of the neutral comet assay. However, a disadvantage of the
alkaline comet assay is its inability to distinguish between DSBs and
SSBs. In the comet assay, cells are fixed in an agarose gel on a glass
microscope slide, and the cellular membrane is lysed in the gel. In
6 Katsuhiro Hanada
A Intact DNA
Normal cell
Damaged cell
Intact DNA Broken DNA
B Step 1. Plug preparation
Step 2. PFGE
Intact DNA
Broken DNA
Chromosomal DNA
fragmentation in
apoptosis
Fig. 2 Schematic representation of DSB detection by the comet assay and PFGE.
(a) Detection of DSBs by comet assay. After electrophoresis, intact DNA remains
packed in the nucleus, but broken DNA migrates into the gel, forming a “comet”
shaped tail. (b) Detection of DSBs by PFGE. To avoid shearing of chromosome
DNAs by pipetting, cells are lysed in agarose plugs. Then DSBs are fractionated
by PFGE. Intact DNA stays in the wells (plugs), whereas broken DNA migrates
into the gel
the neutral comet assay, samples are fractionated by electrophoresis

in neutral buffer, whereas in the alkaline comet assay, denatured
DNAs are fractionated by alkaline electrophoresis. In both cases,
damaged DNA fragments are fractionated and subsequently eval-
uated by microscopy. Intact DNA does not migrate into the agarose
gel and stays in the nucleus due to its large molecular size. Dam-
aged DNA migrates to anode of the agarose gel. This results in an
image with a distinct head and tail, which resembles a comet
(Fig. 2a), hence the name for this assay. The head is composed of
intact DNA, while the tail consists of broken pieces of DNA. The
standard application of the comet assay is to detect DNA breaks,
such as DSBs and SSBs [20]. However, it is also capable of analyz-
ing abasic sites, oxidative base damage [21], and DNA cross-linking
[22]. The comet assay is also used to monitor DNA repair by living
cells.
Here two distinct applications of the comet assay are described;

one is to quantify DNA damage in cells in Chapter 6 [23], and the
other is to evaluate DNA repair of interstrand DNA cross-links
(ICLs) in Chapter 7 [22].
4 Analysis of DSBs by PFGE
Normal gel electrophoresis, including the comet assay, is not suit-

able for evaluating large DNAs greater than 50 kb in length.
However, Schwartz and coworkers succeeded in separating DNA
fragments greater than 100 kb using PFGE system. Since PFGE can
separate large DNAs between 10 kb and 10 Mb in length, PFGE
has been used to purify and visualize large DNA constructs, such as
bacterial artificial chromosomes (BACs) [24], phage artificial chro-
mosomes (PACs) [25], and yeast artificial chromosomes (YACs)
[26]. PFGE is also used to analyze chromosomal DNAs in various
species, one example of which is the chromosomal typing of bacte-
ria called “PFGE-typing” [27]. As with the comet assay, PFGE is
widely used as a technique to quantify DSBs (Fig. 2b) [28, 29]. The
advantage of PFGE is its ability to analyze DSBs across various
species, from bacteria to humans [30–32].
In normal agarose gel electrophoresis, it is impossible to sepa-
rate large DNA molecules (Fig. 3a). During electrophoresis, DNA
molecules are stretched and migrate in the agarose matrix to the
anode. At the beginning of electrophoresis, DNAs are stacked in
the matrix and form U-shapes. Such stacked molecules are drawn in
one direction, with one end of the DNA molecules taking priority.
As a result, DNAs are fully stretched, and one of the DNA ends (the
leading end) is drawn toward the anode and the other becomes the
trailing end and is drawn toward the cathode [33]. However, if the
direction of electric field is changed by more than 90 , the trailing
end becomes the leading end and start moving toward the end of
the gel (Fig. 3b). This phenomenon is called “reorientation.” To
induce reorientation, the angle of the electric charge is important.
If the angle is more than 90 , a trailing end of DNA molecule may
become a leading one. If the angle is less than 90 , the initial
leading end continues being a leading one [33]. Even if the direc-
tion of the electric field is changed, elongated DNA structures are
still retained. This phenomenon, the reorientation of stretched
DNA molecules, is crucial for the separation of large molecules
because the length of stretched DNA during reorientation
enhances the separation of large DNA molecules (Fig. 3b). If
large DNAs are stretched, the distance from the head to the tail is
also long, whereas the distance from the head to the tail of small
DNAs is less. Continuous pulse switching results in the enhanced
separation of large DNA molecules. A number of adaptations to
PFGE have been developed; for example, pulsed-field gradient
8 Katsuhiro Hanada
A Normal agarose gel electrophoresis

Lage DNAs large DNA
in the well Small DNA
large DNA
Small DNA
Agarose gel E E
B PFGE
Lage DNAs
in the well large DNA
Start PFGE Small DNA
Agarose gel E1
Wel
large DNA
Small DNA
Angle change E2 E2
Wel
large DNA
Small DNA
Angle change E3 E3
Fig. 3 Schematic representation of DNA fractionation during gel electrophoresis.

(a) Schematic representation of DNA fractionation in normal agarose gel elec-
trophoresis. DNA molecules are stretched and move to the anode. (b) Schematic
representation of DNA fractionation during PFGE. DNA molecules are stretched
and move to the anode. When the direction of electric field is changed more than
90 , reorientation of migration occurs, resulting in enhanced separation of large
DNA molecules
electrophoresis, orthogonal field-alternating gel electrophoresis,

transverse alternating-field electrophoresis, and field inverse gel
electrophoresis. However, only two systems, clamped homoge-
neous electric field (CHEF) (Bio-Rad Laboratories, USA) and
rotating gel electrophoresis (RGE) (Analytik Jena AG, Germany),
are now commercially available (Fig. 4). In PFGE, separation of
A CHEF
sis Ele
phore ctr
oph
o
ctr ore
+ Ele sis +
+ Agarose gel Agarose gel +
+ +
+ +
B RGE
is Ele
hores ctr
oph
+ op ore +
ctr sis
+ Ele +
+ Agarose gel Agarose gel +
+ +
+ +
Fig. 4 Systems of PFGE that are currently commercially available. (a) Clamped
homogeneous electric field (CHEF) system (Bio-Rad Laboratories, USA). (b)
Rotating gel electrophoresis (RGE) system (Analytik Jena AG, Germany)
DNA is determined by several parameters, such as the strength of

the electric field (voltage), pulse time, the angles of the electric
fields, gel concentration, and temperature [33].
1. Electric field strength. PFGE is typically performed at a voltage
of 6 V/cm. A stronger electric field is required for better
separation of larger molecules. However, to separate extremely
large molecules, up to 5 Mb in length, PFGE is performed with
a moderate electric field (typically between 1 and 2 V/cm) and
for a longer duration (typically more than 100 h). RGE (Ana-
lytik Jena AG) can vary the strength of the electric field using a
gradient.
2. Pulse time. Longer pulse time leads to the better separation of
larger molecules. CHEF DRIII and mapper XA (Bio-Rad
Laboratories), and RGE can vary pulse time during
electrophoresis.
3. Angle of the electric fields. Smaller angles between the two fields
increase the speed of migration. The angles of CHEF and RGE
are usually set between 110 and 120 .
4. Gel concentration. A lower concentration increases the speed of
migration and higher gel concentrations lead to better
separation.
10 Katsuhiro Hanada
5. Temperature. Higher temperatures increase the migration rate

but decrease separation. Since PFGE is usually performed with
a strong electric field, the temperature of the buffer easily rises.
To keep temperature constant, a device to cool the buffer and
gel is necessary.
The theoretical model of PFGE is not widely appreciated.
Researchers need to optimize the parameters through practice. In
addition, preparation of the DNA sample is also critical for PFGE
because large DNA molecules are easily sheared during the process;
for example, by pipetting and mixing and during DNA extraction.
Therefore, cells are lysed and proteins are removed from the DNA
in an agarose plug (Fig. 2b). In this way, DNA preparation requires
no pipetting and mixing. Some organisms have cell walls that
protect cells from detergents. To analyze chromosomes of such
organisms, additional steps are required to lyse the cells. These
complexities certainly became an “entry barrier” for PFGE. To
overcome this barrier, I have asked expert scientists to share their
experiences. The procedures for DNA sample preparation are dif-
ferent between species, and parameter settings are different
between CHEF and RGE systems. In this book, detailed protocols
of both CHEF and RGE systems are presented for various species,
with an emphasis on the detection of DSBs that have accumulated
in cells after treatment with DNA damaging agents.
5 Other Applications
Trends in molecular biology are now shifting from understanding

the functions of single genes to genome-wide analysis of gene
regulation and other chromosomal reactions. Therefore, cutting-
edge techniques for DNA electrophoresis are frequently developed
for genome-wide studies (e.g., chromatin regulation including epi-
genetics, dynamics of DNA replication, DNA damage and repair on
chromosomes, and characterization of cis- and trans-acting ele-
ments on transcription and DNA replication [34–37]). Methods
in genome-wide analysis for the identification of DNA replication
origins, analysis of chromatin state, and activity of DNA repair are
presented here. Technical breakthroughs in these methods have
enriched the knowledge of intermediate structures in vitro. The
techniques have the potential to unravel novel processes in chro-
mosomal DNA reactions that are currently under study. The hope is
that with increased interest generated by potential discoveries more
novel methods will be developed in the next decade.
In addition, one method to analyze DNA adducts by PAGE is
also included in this book because of the importance of the
genome-wide analysis of DNA adducts [38]. This particular analy-
sis is used in risk assessments for environmental and public health
policies as well as studies in toxicology. At present, DNA adducts in

cells are analyzed by liquid chromatography–tandem mass spec-
trometry, but the methodology for genome-wide analysis of these
adducts has not yet established due to insufficient knowledge about
them [39]. Many technical difficulties still remain. First, it is not
easy to purify DNA adducts, especially rare ones. Second, it is not
easy to prepare adducts in vitro because the formation of some
DNA adducts requires the function of cytochrome P450. Even if
the manipulation of a particular DNA adduct is successful, it is not
easy to determine their structures. In many cases, the structure of
the adduct is determined by nuclear magnetic resonance and
requires substantial and expensive equipment. However, it remains
important to accumulate knowledge about DNA adducts, and
current efforts will strive for the development of new technologies
to analyze DNA adducts in future.
Acknowledgments
I thank Dominic James, PhD, from Edanz Group (www.

edanzediting.com/ac) for editing a draft of the manuscript.
References
1. Aaij C, Borst P (1972) The gel electrophoresis 8. Hunter N, Kleckner N (2001) The single-end
of DNA. Biochim Biophys Acta 269 invasion: an asymmetric intermediate at the
(2):192–200 double-strand break to double-Holliday junc-
2. Roberts GA, Dryden DT (2013) DNA electro- tion transition of meiotic recombination. Cell
phoresis: historical and theoretical perspectives. 106(1):59–70
Methods Mol Biol 1054:1–9 9. Lerman LS, Frisch HL (1982) Why does the
3. Noites IS, O’Kennedy RD, Levy MS, Abidi N, electrophoretic mobility of DNA in gels vary
Keshavarz-Moore E (1999) Rapid quantitation with the length of the molecule? Biopolymers
and monitoring of plasmid DNA using an 21(5):995–997
ultrasensitive DNA-binding dye. Biotechnol 10. Zimm BH, Levene SD (1992) Problems and
Bioeng 66(3):195–201 prospects in the theory of gel electrophoresis of
4. Makovets S (2013) Basic DNA electrophoresis DNA. Q Rev Biophys 25(2):171–204
in molecular cloning: a comprehensive guide 11. Stellwagen NC (2009) Electrophoresis of
for beginners. Methods Mol Biol 1054:11–43 DNA in agarose gels, polyacrylamide gels and
5. Sambrook J, Russell DW (2006) Alkaline again free solution. Electrophoresis 30(Suppl 1):
rose gel electrophoresis. CSH Protoc 2006(1) S188–S195
6. Hanada K, Budzowska M, Davies SL, van 12. Cebrian J, Kadomatsu-Hermosa MJ, Castan A,
Drunen E, Onizawa H, Beverloo HB, Martinez V, Parra C, Fernandez-Nestosa MJ,
Maas A, Essers J, Hickson ID, Kanaar R Schaerer C, Martinez-Robles ML,
(2007) The structure-specific endonuclease Hernandez P, Krimer DB, Stasiak A, Schvartz-
Mus81 contributes to replication restart by man JB (2015) Electrophoretic mobility of
generating double-strand DNA breaks. Nat supercoiled catenated and knotted DNA mole-
Struct Mol Biol 14(11):1096–1104 cules. Nucleic Acids Res 43(4):e24
7. Allers T, Lichten M (2001) Differential timing 13. Liberi G, Maffioletti G, Lucca C, Chiolo I,
and control of noncrossover and crossover Baryshnikova A, Cotta-Ramusino C,
recombination during meiosis. Cell 106 Lopes M, Pellicioli A, Haber JE, Foiani M
(1):47–57 (2005) Rad51-dependent DNA structures
12 Katsuhiro Hanada
accumulate at damaged replication forks in 22. Bhagwat N, Olsen AL, Wang AT, Hanada K,
sgs1 mutants defective in the yeast ortholog Stuckert P, Kanaar R, D’Andrea A, Niedernho-
of BLM RecQ helicase. Genes Dev 19 fer LJ, McHugh PJ (2009) XPF-ERCC1 parti-
(3):339–350 cipates in the Fanconi anemia pathway of cross-
14. Ashley RE, Dittmore A, McPherson SA, Turn- link repair. Mol Cell Biol 29(24):6427–6437
bough CL Jr, Neuman KC, Osheroff N (2017) 23. Kasamoto S, Masumori S, Tanaka J, Ueda M,
Activities of gyrase and topoisomerase IV on Fukumuro M, Nagai M, Yamate J, Hayashi M
positively supercoiled DNA. Nucleic Acids (2017) Reference control data obtained from
Res 45(16):9611–9624 an in vivo comet-micronucleus combination
15. Tan TL, Essers J, Citterio E, Swagemakers SM, assay using Sprague Dawley rats. Exp Toxicol
de Wit J, Benson FE, Hoeijmakers JH, Kanaar Pathol 69(4):187–191
R (1999) Mouse Rad54 affects DNA confor- 24. Shizuya H, Birren B, Kim UJ, Mancino V,
mation and DNA-damage-induced Rad51 foci Slepak T, Tachiiri Y, Simon M (1992) Cloning
formation. Curr Biol 9(6):325–328 and stable maintenance of 300-kilobase-pair
16. Alzu A, Bermejo R, Begnis M, Lucca C, fragments of human DNA in Escherichia coli
Piccini D, Carotenuto W, Saponaro M, using an F-factor-based vector. Proc Natl Acad
Brambati A, Cocito A, Foiani M, Liberi G Sci U S A 89(18):8794–8797
(2012) Senataxin associates with replication 25. Sternberg N (1990) Bacteriophage P1 cloning
forks to protect fork integrity across RNA-po- system for the isolation, amplification, and
lymerase-II-transcribed genes. Cell 151 recovery of DNA fragments as large as 100 kilo-
(4):835–846 base pairs. Proc Natl Acad Sci U S A 87
17. Kolesar JE, Wang CY, Taguchi YV, Chou SH, (1):103–107
Kaufman BA (2013) Two-dimensional intact 26. Murray AW, Szostak JW (1983) Construction
mitochondrial DNA agarose electrophoresis of artificial chromosomes in yeast. Nature 305
reveals the structural complexity of the mam- (5931):189–193
malian mitochondrial genome. Nucleic Acids 27. Ferrari RG, Panzenhagen PHN, Conte-Junior
Res 41(4):e58 CA (2017) Phenotypic and genotypic eligible
18. Ostling O, Johanson KJ (1984) Microelectro- methods for Salmonella Typhimurium source
phoretic study of radiation-induced DNA tracking. Front Microbiol 8:2587
damages in individual mammalian cells. Bio- 28. De Silva IU, McHugh PJ, Clingen PH, Hartley
chem Biophys Res Commun 123(1):291–298 JA (2000) Defining the roles of nucleotide
19. Singh NP, McCoy MT, Tice RR, Schneider EL excision repair and recombination in the repair
(1988) A simple technique for quantitation of of DNA interstrand cross-links in mammalian
low levels of DNA damage in individual cells. cells. Mol Cell Biol 20(21):7980–7990
Exp Cell Res 175(1):184–191 29. Hanada K, Uchida T, Tsukamoto Y, Watada M,
20. Kohara A, Matsumoto M, Hirose A, Yamaguchi N, Yamamoto K, Shiota S,
Hayashi M, Honma M, Suzuki T (2018) Muta- Moriyama M, Graham DY, Yamaoka Y (2014)
genic properties of dimethylaniline isomers in Helicobacter pylori infection introduces DNA
mice as evaluated by comet, micronucleus and double-strand breaks in host cells. Infect
transgenic mutation assays. Genes Environ Immun 82(10):4182–4189
40:18 30. Fukuda E, Kaminska KH, Bujnicki JM,
21. Warpman Berglund U, Sanjiv K, Gad H, Kobayashi I (2008) Cell death upon epigenetic
Kalderen C, Koolmeister T, Pham T, genome methylation: a novel function of
Gokturk C, Jafari R, Maddalo G, Seashore- methyl-specific deoxyribonucleases. Genome
Ludlow B, Chernobrovkin A, Manoilov A, Biol 9(11):R163
Pateras IS, Rasti A, Jemth AS, Almlof I, 31. Keyamura K, Arai K, Hishida T (2016) Srs2
Loseva O, Visnes T, Einarsdottir BO, Gaugaz and Mus81-Mms4 prevent accumulation of
FZ, Saleh A, Platzack B, Wallner OA, Vallin KS, toxic inter-homolog recombination intermedi-
Henriksson M, Wakchaure P, Borhade S, ates. PLoS Genet 12(7):e1006136
Herr P, Kallberg Y, Baranczewski P, Homan 32. Kawashima Y, Yamaguchi N, Teshima R,
EJ, Wiita E, Nagpal V, Meijer T, Schipper N, Narahara H, Yamaoka Y, Anai H, Nishida Y,
Rudd SG, Brautigam L, Lindqvist A, Hanada K (2017) Detection of DNA double-
Filppula A, Lee TC, Artursson P, Nilsson JA, strand breaks by pulsed-field gel electrophore-
Gorgoulis VG, Lehtio J, Zubarev RA, sis. Genes Cells 22(1):84–93
Scobie M, Helleday T (2016) Validation
and development of MTH1 inhibitors for 33. Nassonova ES (2008) Pulsed field gel electro-
treatment of cancer. Ann Oncol 27 phoresis: theory, instruments and application.
(12):2275–2283 Cell Tissue Biol 2:557
34. Denker A, de Laat W (2016) The second Maretty L, Hansen AJ, Snyder MP,
decade of 3C technologies: detailed insights Pilegaard H, Lam HYK, Regenberg B (2018)
into nuclear organization. Genes Dev 30 Circular DNA elements of chromosomal origin
(12):1357–1382 are common in healthy human somatic tissue.
35. Gregoire MC, Leduc F, Morin MH, Cave T, Nat Commun 9(1):1069
Arguin M, Richter M, Jacques PE, Boisson- 38. Shiizaki K, Kawanishi M, Yagi T (2017) Mod-
neault G (2018) The DNA double-strand ulation of benzo[a]pyrene-DNA adduct for-
“breakome” of mouse spermatids. Cell Mol mation by CYP1 inducer and inhibitor. Genes
Life Sci 75(15):2859–2872 Environ 39:14
36. Isogawa A, Fuchs RP, Fujii S (2018) Versatile 39. Kanaly RA, Hanaoka T, Sugimura H, Toda H,
and efficient chromatin pull-down methodol- Matsui S, Matsuda T (2006) Development of
ogy based on DNA triple helix formation. Sci the adductome approach to detect DNA dam-
Rep 8(1):5925 age in humans. Antioxid Redox Signal 8
37. Moller HD, Mohiyuddin M, Prada-Luengo I, (5–6):993–1001
Sailani MR, Halling JF, Plomgaard P,
Chapter 2
Two-Dimensional Gel Electrophoresis to Resolve DNA

Topoisomers
Elizabeth G. Gibson, Alexandria A. Oviatt, and Neil Osheroff
Abstract
Agarose gel electrophoresis is one of the most straightforward techniques that can be used to differentiate
between topoisomers of closed circular DNA molecules. Generally, the products of reactions that monitor
the interconversion of DNA between negatively supercoiled and relaxed DNA or positively supercoiled and
relaxed DNA can be resolved by one-dimensional gel electrophoresis. However, in more complex reactions
that contain both positively and negatively supercoiled DNA, one-dimensional resolution is insufficient. In
these cases, a second dimension of gel electrophoresis is necessary. This chapter describes the technique of
two-dimensional agarose gel electrophoresis and how it can be used to resolve a spectrum of DNA
topoisomers.
Key words Gel electrophoresis, Two-dimensional, DNA, DNA topoisomers, DNA supercoiling,
DNA intercalation, Positive supercoiling, Negative supercoiling, Relaxed DNA
1 Introduction
The superhelicity of DNA can have a profound effect on a number

of DNA processes including replication, transcription, and recom-
bination [1–7]. Therefore, it is important to be able to distinguish
DNA molecules that are underwound (negatively supercoiled),
contain no torsional stress (relaxed), and overwound (positively
supercoiled). The easiest way to resolve supercoiled and relaxed
DNA topoisomers is by agarose gel electrophoresis. In order to
maintain the topological state of DNA during electrophoresis, the
molecules must be in a “closed” system (i.e., the ends cannot have
free-rotation). Therefore, this method applies primarily to circular
DNA molecules.
Because the charges on DNA come from the phosphate groups
in the DNA backbone, all DNA molecules have the same charge-to-
mass ratio. Thus, in a vacuum, DNA topoisomers would all migrate
Elizabeth G. Gibson and Alexandria A. Oviatt contributed equally to this work.
15
16 Elizabeth G. Gibson et al.
Relaxation Supercoiling
Supercoiling Relaxation
Positively Negatively
Supercoiled Supercoiled
Fig. 1 Interconversion of DNA topoisomers. DNA that is not under torsional stress
is referred to as “relaxed” (center), while over- and underwinding results in DNA
that is positively (left) or negatively (right) supercoiled, respectively. The term
“supercoiled” is derived from the fact that when under torsional stress, some of
the stress is alleviated by the DNA forming superhelical twists about itself
at the same rate. However, when subjected to electrophoresis

through a gel matrix, smaller or more compact molecules migrate
more readily through the medium than a molecule that has more
volume. When DNA is in a “relaxed” state, in which there is no
torsional stress on the molecule, it maintains a more open structure
(Fig. 1). Thus, it has a wide diameter. However, when torsional
stress is applied to the molecule by increasing or decreasing the
number of turns of the double helix, free DNA converts ~75% of
the torsional stress to axial stress [1], which is manifested by the
double helix wrapping around itself to form “superhelical twists.”
As seen in Fig. 1, superhelical twisting leads to a more compact
structure of DNA; the greater the superhelical twisting
(or supercoiling), the more compact the structure. Therefore, the
more supercoiled the DNA molecule, the faster it will migrate
through an agarose gel toward the cathode. Superhelical twists
occur in discrete units (i.e., molecules will have 1, 2, 3, . . . etc.
DNA nodes or crossovers). Individual DNA topoisomers (i.e.,
plasmids with a specific number of DNA nodes or superhelical
twists) will run as distinct bands.
When monitoring reactions in which a DNA molecule is being
converted from relaxed to negatively or positively supercoiled, or
from supercoiled to relaxed, one-dimensional electrophoresis is
generally sufficient to resolve topoisomers (Fig. 2). In these cases,
all of the intermediate DNA topoisomers will contain a number of
supercoils ranging from that of the substrate to that of the product.
In the example shown in Fig. 2, the time course follows a reaction
in which a relaxed plasmid is converted to a negatively supercoiled
molecule by an enzyme known as DNA gyrase [5, 6, 8]. Hence, all
of the individual DNA bands that are visualized contain either no
supercoils (relaxed) or some number of negative supercoils.
In contrast to the reaction shown in Fig. 2, some reactions are
more complex. For example, Fig. 3 shows a time course for the
conversion of positively to negatively supercoiled DNA by gyrase
[9–11]. In this case, positive supercoils are removed to produce
Two-Dimensional Gel Electrophoresis 17
Time (min)
0 5 10 20 30
Rel
(-)SC
Fig. 2 One-dimensional resolution of relaxed and negatively supercoiled DNA

topoisomers. A time course for the conversion of relaxed plasmid to negatively
supercoiled molecules by Staphylococcus aureus gyrase is shown. Reaction
products were resolved by one-dimensional agarose gel electrophoresis and
DNA bands were visualized by mid-range ultraviolet light following staining with
ethidium bromide. The positions of relaxed (Rel) and negatively supercoiled [( )
SC] DNA are indicated on the gel
Time (s) Time (min)

0 15 30 45 60 90 120 5 10 15 20
Rel
(-)SC
(+)SC
Fig. 3 One-dimensional resolution of negatively and positively supercoiled DNA

topoisomers. A time course for the conversion of positively supercoiled plasmid
to negatively supercoiled molecules by S. aureus gyrase is shown. Reaction
products were resolved by one-dimensional agarose gel electrophoresis and
DNA bands were visualized by mid-range ultraviolet light following staining with
ethidium bromide. The positions of relaxed (Rel), positively supercoiled [(+)SC],
and negatively supercoiled [( )SC] DNA are indicated on the gel
relaxed DNA followed, by the introduction of negative supercoils.

Positively supercoiled DNA is slightly more compact [1] than its
negatively supercoiled counterpart and therefore migrates slightly
further on an agarose gel [12]. However, one-dimensional electro-
phoresis is insufficient to determine whether the intermediate
bands are positively or negatively supercoiled. Thus, it is necessary
to use two-dimensional electrophoresis to resolve this issue.
The first dimension in two-dimensional gel electrophoresis
separates DNA topoisomers as described above. To distinguish
positive from negative intermediate topoisomers, the gel is then
soaked in chloroquine, a DNA intercalative agent. DNA intercala-
tors locally unwind the double helix. Because the number of turns
of the double helix is invariant in a closed circular system [1, 2], the
local underwinding (which is constrained by the presence of the
intercalator) is compensated by a global overwinding [13–15].
Hence, negatively supercoiled molecules will tend to look less

negatively supercoiled (or even fully relaxed) in the presence of an
intercalator and relaxed DNA will tend to look positively super-
coiled. Because molecules that already contain a high level of posi-
tive superhelical twists cannot absorb very much intercalator,
positively supercoiled DNA changes very little in the presence of a
DNA intercalator [12, 13]. Similarly, the migration of nicked DNA
changes relatively little in the presence of an intercalator. This is
because the presence of the nick opens the topological system and
the absorption of an intercalator does not lead to compensatory
overwinding. In the example described below, the amount of chlo-
roquine that is added is sufficient to make negatively supercoiled
DNA appear to be fully relaxed and relaxed DNA to be fully
positively supercoiled. Once the gel is soaked in chloroquine, it is
turned 90 clockwise and is subjected to electrophoresis once again
(Fig. 4). Fully relaxed DNA, which comigrates with nicked DNA in
the first dimension, migrates considerably further in the second
dimension, as it appears to be positively supercoiled. Conversely,
the migration of negatively supercoiled DNA (which now appears
to be relaxed) in the second dimension is greatly retarded compared
to positively supercoiled DNA. The addition of the second dimen-
sion allows positively and negatively supercoiled topoisomers to be
readily resolved from one another; intermediate positively super-
coiled molecules run in an arc between fully positively supercoiled
DNA and the apex band of relaxed DNA, whereas intermediately
negatively supercoiled DNA runs on an arc between relaxed and
fully negatively supercoiled molecules (Fig. 4).
When samples that correspond to those shown in the
one-dimensional gel in Fig. 3 are subjected to two-dimensional
gel electrophoresis (Fig. 5), it becomes obvious that all of the
2nd Dimension
Nicked Relaxed
1st Dimension
(–)SC
(+)SC
Fig. 4 Schematic depicting the migration of DNA topoisomerases following

two-dimensional agarose gel electrophoresis. The positions of nicked, relaxed,
negatively supercoiled [( )SC], and positively supercoiled [(+)SC] DNA are
shown as black bands. Gray bands represent DNA topoisomers of intermediate
supercoiling. Partially negatively supercoiled molecules migrate as the arc
between relaxed and ( )SC DNA and partially positively supercoiled molecules
migrate as the arc between (+)SC and relaxed DNA
2nd Dimension
Nicked Rel Nicked Rel Nicked Rel
(-)SC (+)SC (-)SC (+)SC (-)SC (+)SC

1st Dimension
0s 30 s 60 s
Nicked Rel Nicked Rel Nicked Rel
(-)SC (+)SC (-)SC (+)SC (-)SC (+)SC
90 s 5m 20 m
Fig. 5 Two-dimensional resolution of negatively and positively supercoiled DNA topoisomers. A time course for
the conversion of positively supercoiled plasmid to negatively supercoiled molecules by S. aureus gyrase is
shown. Reaction products were resolved by two-dimensional agarose gel electrophoresis and DNA bands
were visualized by mid-range ultraviolet light following staining with ethidium bromide. Samples at the
reaction times shown are from the time course depicted in Fig. 3. The positions of nicked, relaxed (Rel),
positively [(+)SC], and negatively supercoiled [( )SC] DNA are indicated on the gel and methods are described
below
intermediate bands observed at 30 s are positively supercoiled, that

a mixed population is seen at 90 s, and that all of the intermediate
bands observed at 5 min are negatively supercoiled topoisomers.
2 Materials
Prepare all reagents at room temperature using deionized water and

analytical grade reagents.
1. Electrophoresis Buffer 10 Stock: 1 M Tris-borate, pH 8.3,
and 20 mM EDTA. Add 121.1 g of Tris-base, 61.8 g of boric
acid, and 5.85 g of EDTA to approximately 600 mL of H2O
and stir until dissolved. Transfer the solution to a graduated
cylinder, add H2O to a final volume of 1 L, and mix thoroughly
(see Notes 1–3). Store at room temperature.
2. Loading Buffer: 60% sucrose, 10 mM Tris–HCl, pH 7.9, 0.5%
bromophenol blue, and 0.5% xylene cyanol FF. Add 6 g of
sucrose and 100 μL of 1 M Tris–HCl, pH 7.9, to 6–8 mL of
H2O in a graduated cylinder and mix (see Note 4). Add 0.05 g
of bromophenol blue, 0.05 g of xylene cyanol FF, and H2O to
a final volume of 10 mL and mix thoroughly. Store in 1 mL
aliquots. For long-term storage (>1 month), store aliquots at

20 C.
3. Chloroquine: 10 mg/mL solution. Add 50 mg of chloroquine
to a graduated cylinder, bring the final volume to 5 mL with
H2O, and mix thoroughly. Store in a light-proof container at
4 C (see Note 5).
4. Ethidium bromide: 10 mg/mL. Add 50 mg of ethidium bro-
mide to a graduated cylinder, bring the final volume to 5 mL
with H2O, and mix thoroughly. Store in a light-proof container
at 4 C (see Notes 5 and 6).
3 Methods
1. Preparation of agarose gel: mix 80 mL of Electrophoresis

Buffer 10 Stock with 720 mL of H2O to yield 1 Electro-
phoresis Buffer. Add 1 g of molecular biology grade agarose to
100 mL of 1 Electrophoresis Buffer in a 250 mL Erlenmeyer
flask. Heat the mixture in a microwave until the agarose is
completely dissolved (heat for 1 min on high, swirl the mixture,
and heat on high for an additional 30–45 s until the mixture has
reached a low boil, see Note 7). Swirl the mixture to make sure
it is fully dissolved and place it in a 50 C water bath until ready
to pour. Gently pour the liquid agarose mixture into a
14 14 cm gel box (avoid trapping bubbles in the gel) and
insert a comb ~1 cm from the top of the gel. For the procedure
below, a 16 well comb is used. If two combs are used, insert the
second comb ~7 cm from the top of the gel. Each comb can
support up to three samples. Allow the gel to harden at room
temperature. It will take ~10–15 min (see Note 8). Cover the
solid gel with 1 Electrophoresis Buffer such that the buffer
level is ~8–10 mm above the top surface of the gel and carefully
remove the comb(s). This protocol will result in a gel that is
~7 mm in depth. The wells that are left following removal of
the combs should be ~5–6 mm deep, ~1.5 mm high, and
~5 mm wide.
2. The example used in this chapter represents a time course for
the conversion of positively supercoiled plasmid DNA
(pBR322) (see Note 9) to negatively supercoiled plasmid
DNA in a reaction mixture containing S. aureus gyrase
[11]. This electrophoresis protocol can be used to separate
supercoiled/relaxed DNA topoisomers from virtually any
reaction.
3. For the purposes of the gel electrophoresis, 25 μL samples are
used that contain 2 μL of loading buffer (see Note 10). Samples
should contain a minimum of 0.3 μg of DNA for visibility.
Samples (20 μL of the DNA samples described above) (see

Note 11) should be loaded slowly into the wells using a
20 μL micropipette (see Note 12). If three samples are run on
the gel, they should be loaded into lanes 1, 6, and 11 of a
16 well comb. If a second comb is used, a single gel can
accommodate up to six samples.
4. Electrophoresis should be carried out at 150 V (~100 mA).
The anode should be at the top of the gel. Electrophoresis
should be carried out for ~2 h or until the bromophenol blue
dye front has moved ~halfway down the length of the gel.
5. Turn off the voltage and carefully transfer the gel to a pan
containing ~200 mL of 1 Electrophoresis Buffer containing
4.5 μg/mL chloroquine. The chloroquine-containing solution
is prepared by adding 450 μL of 10 mg/mL chloroquine,
100 mL of Electrophoresis Buffer 10 Stock, and H2O to a
final volume of 1 L. Make sure that the gel is covered with the
chloroquine-containing buffer and soak it for 2 h with gentle
agitation.
6. Turn the gel 90 clockwise from its original position and place
it back into the electrophoresis apparatus. Add a sufficient
volume of 1 Electrophoresis Buffer containing 4.5 μg/mL
chloroquine to cover the gel (once again, by ~8–10 mm), and
subject the gel to electrophoresis for 2 h at 120 V (~80 mA).
7. Turn off the voltage and carefully transfer the gel to a pan
containing sufficient H2O to cover and soak the gel for
~15 min with gentle agitation. This step removes excess chlo-
roquine, which will allow the ethidium bromide to intercalate
more efficiently.
8. To stain the gel in order to be able to visualize the DNA bands,
transfer it to a pan containing sufficient H2O containing 1 μg/
mL ethidium bromide to cover and soak for ~30 min with
gentle agitation. The ethidium bromide-containing solution
is prepared by adding 30 μL of 10 mg/mL ethidium bromide
to 300 mL of H2O.
9. Destain the gel to remove excess ethidium bromide by trans-
ferring the gel to a pan containing sufficient H2O to cover for
10–20 min with gentle agitation (see Note 13).
10. DNA bands are observed using medium-range ultraviolet light
(see Notes 14 and 15).
4 Notes
1. When mixed together, the Tris-borate-EDTA mixture should

have a pH of ~8.3 with no further adjustment.
2. It is preferable to use EDTA, as opposed to NaEDTA, when
making the Electrophoresis Buffer 10 Stock. In the presence
of Na+ ions, some of the borate in the buffer can be converted
to a borax complex, which tends to precipitate out of solution
over time. Even when using EDTA, some precipitate may form
over several weeks.
3. If the Electrophoresis Buffer 10 Stock is going to be stored
for more than a month, it is desirable to filter it through a
0.22 μm sterilizing filter, which further deters precipitation.
4. If the sucrose has difficulty dissolving in the Tris–HCl, heat it at
37 C for 5–10 min. Before adding the dyes, cool the solution
to room temperature.
5. Chloroquine and ethidium bromide are light-sensitive com-
pounds. If a light-proof container is unavailable, the vessel
can be wrapped in aluminum foil to protect the solution from
light-induced degradation.
6. Ethidium bromide is a mild carcinogen. Therefore, appropriate
caution should be used when handling the compound (includ-
ing using personal protective equipment), and solutions con-
taining ethidium bromide should be disposed of according to
proper safety protocols.
7. When heating the agarose gel solution, it is critical to make sure
that the container is properly vented to avoid a potential pres-
sure explosion.
8. The clear liquid agarose solution will become opaque upon
solidifying.
9. The described protocol is tailored for use with plasmid
pBR322, which is 4363 bp in length. Because all DNA mole-
cules have the same charge-to-mass ratio, electrophoretic sepa-
ration is based on the size of the plasmid and its topology.
Therefore, electrophoresis times or the percentage of agarose
in gels may need to be modified if plasmids that are substan-
tially longer or shorter than pBR322 are used. A slightly higher
percentage of agarose can be used with shorter plasmids (which
will migrate faster than pBR322), and a lower agarose percent-
age can be used for longer plasmids (which will migrate
slower).
10. Sucrose is present in the loading buffer to increase the density
of the samples so that they will sink to the bottom of the well.
Therefore, the loading buffer should comprise at least 8% of
the total sample volume. Doing so ensures that samples will

stay in the wells following loading and that the DNA bands will
remain tight. Two dyes, bromophenol blue and xylene cyanol
FF, are included in the loading buffer to monitor the electro-
phoresis. The dyes run differentially when subjected to electro-
phoresis in the agarose gel. Bromophenol blue migrates more
quickly and will move as the dye front ahead of the migrating
DNA. Xylene cyanol FF migrates more slowly and follows
the DNA.
11. Even though the assay samples are 25 μL in volume, we gener-
ally load only 20 μL into the wells. This keeps the wells from
being overloaded and ensures that a consistent volume can be
added into each well.
12. To keep DNA bands from diffusing, it is best to load wells
when the power is on. As long as the gel is loaded rapidly, there
is no discernible difference in electrophoretic mobility between
the first and last samples that are loaded. Although the low level
of current poses no danger, it is best to wear gloves while
loading.
13. Even though intercalated ethidium bromide fluoresces consid-
erably more brightly than free molecules, background fluores-
cence can be seen in the gel. Thus, the destaining step is
recommended to decrease background levels of fluorescence.
14. Ethidium bromide fluoresces with an orange color under
medium-wave ultraviolet light. Therefore, an orange filter is
generally used when imaging gels. This results in DNA bands
that appear as white on a black background.
15. The topological state of plasmid DNA affects the amount of
ethidium bromide that can be intercalated. Nicked or linear
DNA can absorb the most ethidium bromide because torsional
stress on the DNA induced by intercalation is unconstrained.
Other DNA topoisomers absorb ethidium bromide in the
following order: negatively supercoiled > relaxed > positively
supercoiled. Consequently, the same amount of nicked DNA
will fluoresce more brightly than negatively supercoiled, which
will fluoresce more brightly than relaxed DNA, which will
fluoresce more brightly than positively supercoiled DNA.
Thus, images containing different DNA topoisomers should
be considered qualitative, and levels of DNA in each band
cannot necessarily be compared directly with one another in a
quantitative manner.
Acknowledgments
Work in the laboratory of the senior author (N.O.) was supported

by National Institutes of Health grant GM126363 and US Veterans
Administration Merit Review award I01 Bx002198. E.G.G was
supported by a Pharmacology Training Grant (5T32GM007628)
from the National Institutes of Health and predoctoral fellowships
from the PhRMA Foundation and the American Association of
Pharmaceutical Scientists. A.A.O. was a trainee under National
Institutes of Health grant T32-CA009582.
References
1. Bates AD, Maxwell A (2005) DNA topology. positively supercoiled DNA. Nucleic Acids
Oxford University Press, New York Res 45(16):9611–9624
2. Deweese JE, Osheroff MA, Osheroff N (2008) 10. Ashley RE, Blower TR, Berger JM, Osheroff N
DNA topology and topoisomerases: teaching a (2017) Recognition of DNA supercoil geome-
"knotty" subject. Biochem Mol Biol Educ 37 try by Mycobacterium tuberculosis gyrase. Bio-
(1):2–10 chemistry 56(40):5440–5448
3. Nitiss JL (2009) DNA topoisomerase II and its 11. Gibson EG, Bax B, Chan PF, Osheroff N
growing repertoire of biological functions. Nat (2019) Mechanistic and structural basis for
Rev Cancer 9(5):327–337 the actions of the antibacterial gepotidacin
4. Liu Z, Deibler RW, Chan HS, Zechiedrich L against Staphylococcus aureus gyrase. ACS
(2009) The why and how of DNA unlinking. Infect Dis 5(4):570–581
Nucleic Acids Res 37(3):661–671 12. McClendon AK, Rodriguez AC, Osheroff N
5. Chen SH, Chan NL, Hsieh TS (2013) New (2005) Human topoisomerase IIα rapidly
mechanistic and functional insights into DNA relaxes positively supercoiled DNA: implica-
topoisomerases. Annu Rev Biochem tions for enzyme action ahead of replication
82:139–170 forks. J Biol Chem 280(47):39337–39345
6. Bush NG, Evans-Roberts K, Maxwell A (2015) 13. Fortune JM, Velea L, Graves DE, Osheroff N
DNA topoisomerases. EcoSal Plus 6(2) (1999) DNA topoisomerases as targets for the
7. Pommier Y, Sun Y, Huang SN, Nitiss JL anticancer drug TAS-103: DNA interactions
(2016) Roles of eukaryotic topoisomerases in and topoisomerase catalytic inhibition. Bio-
transcription, replication and genomic stability. chemistry 38:15580–15586
Nat Rev Mol Cell Biol 17(11):703–721 14. Chaires JB (1990) Biophysical chemistry of the
8. Gellert M, Mizuuchi K, O’Dea MH, Nash HA daunomycin-DNA interaction. Biophys Chem
(1976) DNA gyrase: an enzyme that intro- 35(2–3):191–202
duces superhelical turns into DNA. Proc Natl 15. Graves DE (1999) Drug-DNA interactions.
Acad Sci U S A 73:3872–3876 In: Bjornsti M-A, Osheroff N (eds) Protocols
9. Ashley RE, Dittmore A, McPherson SA, Turn- in DNA topology and DNA topoisomerases,
bough CL Jr, Neuman KC, Osheroff N (2017) vol 2. Humana Press. Inc, Newark, New Jersey,
Activities of gyrase and topoisomerase IV on pp 785–792
Chapter 3
Using Two-Dimensional Intact Mitochondrial DNA (mtDNA)

Agarose Gel Electrophoresis (2D-IMAGE) to Detect Changes
in Topology Associated with Mitochondrial Replication,
Transcription, and Damage
Jill E. Kolesar and Brett A. Kaufman
Abstract
The study of mitochondrial DNA (mtDNA) integrity and how replication, transcription, repair, and
degradation maintain mitochondrial function has been hampered due to the inability to identify mtDNA
structural forms. Here we describe the use of 2D intact mtDNA agarose gel electrophoresis, or
2D-IMAGE, to identify up to 25 major mtDNA topoisomers such as double-stranded circular mtDNA
(including supercoiled molecules, nicked circles, and multiple catenated species) and various forms contain-
ing single-stranded DNA (ssDNA) structures. Using this modification of a classical 1D gel electrophoresis
procedure, many of the identified mtDNA species have been associated with mitochondrial replication,
damage, deletions, and possibly transcription. The increased resolution of 2D-IMAGE allows for the
identification and monitoring of novel mtDNA intermediates to reveal alterations in genome replication,
transcription, repair, or degradation associated with perturbations during mitochondrial stress.
Key words Mitochondrial DNA (mtDNA), Topoisomers, 1D agarose gel electrophoresis, 2D agarose
gel electrophoresis, mtDNA deletions, mtDNA separation, ethidium bromide, mtDNA damage,
ssDNA
1 Introduction
Mammalian mitochondrial DNA (mtDNA) is a small circular

genome (~16 kb) that encodes transfer RNAs (tRNA), ribosomal
RNAs (rRNA), and specific subunits of complexes I, III, IV, and V
required for oxidative phosphorylation. Oxidative phosphorylation
is essential to adenosine triphosphate (ATP) production in aerobic
organisms; therefore, the maintenance of mtDNA integrity is cru-
cial for cellular function. As such, defects in mtDNA and conse-
quent ATP insufficiency have been identified in numerous
conditions, including primary mitochondrial disorders [1], type
2 diabetes [2], cancer [3, 4], neurodegenerative diseases [5, 6],
25
26 Jill E. Kolesar and Brett A. Kaufman
autoimmunity [7, 8], musculoskeletal disorders [9], and aging

[10, 11].
Hundreds to thousands of copies of the mitochondrial genome
are present in cells and are organized into protein-DNA structures
called nucleoids within the mitochondrial matrix. Each nucleoid
may contain 1 or 2 copies of mtDNA [12]. Not all genomes are
dedicated to the same task: for example, different subsets of
nucleoids may be replicating or undergoing transcription at any
given time [13, 14]. Thus, the partition of mtDNA-level tasks, such
as transcription, replication, turnover, and quiescence could be
determined at the whole genome/nucleoid level. Furthermore,
how mtDNA changes in response to physiological stimuli or stress
is poorly understood. One approach to investigating the dynamic
mitochondrial genome is to observe mtDNA organization in asso-
ciation with these different processes and stressors [15].
As a biochemical approach, 1D gel electrophoresis has been
used successfully to separate mtDNA according to size in several
studies, including those that examined mtDNA size as a proxy for
damage in isolated HeLa cell mitochondria [16, 17], ciprofloxin
toxicity effects on mtDNA replication [18], and measuring changes
associated with transient knockdown or induced expression of the
mtDNA organizing and transcription factor TFAM [19]. These
mtDNA structures can be further interrogated by enzymatic treat-
ment or the addition of an orthogonal electrophoresis step. Indeed,
separation of intact mtDNA in two dimensions resolves approxi-
mately 25 structures that include ssDNA molecules and variants.
The similarity of mtDNA structural forms between human and
mouse mtDNA molecules will likely facilitate better understanding
of mtDNA molecules in human health and diseases.
2 Materials
General instructions: All enzymes should be stored at 20 C,

unless otherwise indicated by the manufacturer. Most reagents
can be maintained as stock solutions. All tissue culture supplies
should be sterile, and microfuge tubes should be RNase- and
DNase-free. All biohazard and radioactive waste should be disposed
of in accordance with appropriate local institutional policies. Deio-
nized water (18 M Ohm) should be used. Stock solutions are
prepared from reagent grade or better chemicals in advance and
are either filter-sterilized or autoclaved to increase shelf life. Subsets
of these stock solutions are considered reagents in this protocol.
Pipettors and pipette tips are assumed to be readily available.
Detection of Changes in mtDNA Topology using 1 and 2-D Gels 27
2.1 Cultured Cells or 1. Stock solutions.

Tissue Collection (a) Phosphate buffer saline (PBS): 10 mM Na2HPO4,
and Storage 1.8 mM KH2PO4, 2.7 mM KCl, and 137 mM NaCl
(Sigma).
2. Plasticware.
(a) Sterile 15 mL conical tubes.
(b) 1.5–1.7 mL microfuge tubes.
3. Tools or equipment.
(a) Liquid nitrogen (LN2) or dry ice in the appropriate
container.
(b) Cryogloves.
(c) Tongs or dipper for tube collection for LN2.
2.2 DNA Isolation 1. Stock solutions.

(a) 1 M Tris–HCl pH 8.5 and pH 8.0.
(b) 0.5 M EDTA pH 8.0.
(c) 5 M NaCl.
(d) 10% sodium dodecyl sulfate (SDS).
(e) 100% ethanol.
(f) Beta mercaptoethanol (BME; Sigma).
2. Reagents.
(a) Proteinase K (ProK) buffer: 100 mM Tris–HCl, pH 8.5,
5 mM EDTA, 0.2% SDS, 200 mM NaCl made from stock
components.
(b) Cold 70% ethanol (store at 20 C).
(c) GlycoBlue (Ambion; store at 20 C).
(d) TE buffer: 10 mM Tris–HCl pH 8.0, 1 mM EDTA
pH 8.0.
(e) Dimethylurea (Sigma): 100 mM stock.
(f) Proteinase K (ProK; VWR): Resuspend Proteinase K pow-
der at 20 mg/mL in water. Aliquot and freeze at 20 C.
Avoid numerous freeze–thaw cycles.
(g) RNase A (Thermofisher; 20 mg/mL). Aliquot and freeze
at 20 C.
3. Plasticware.
(a) Sterile microfuge tubes.
(a) Scalpels or scissors for cutting tissues.
(b) 2 mL glass tissue homogenizer (such as a Dounce
homogenizer).
2.3 1D 1. Stock solutions or chemicals.

and 2D-IMAGE (a) Ethidium bromide (EtBr): 10 mg/mL stock.
(b) Sea Kem Gold agarose (Lonza).
(c) Loading Dye (6, Fermentas).
2. Reagents and kits.
(a) Running Buffer: 2 L of 0.5 TBE (without EtBr). To a
2 L graduated cylinder containing 1800 mL water, add
200 mL 5 TBE. Cover the cylinder with 2 layers of
Parafilm and mix well.
3. Plasticware.
(a) 10 mL pipettes.
(b) Funnel.
(c) 2 L graduated cylinder.
(d) 1.6–2.0 mL screw-cap tubes for labeling radioactive
probe.
(a) 20 25 cm gel tray and 20-well comb. Described here is
for the Gibco-BRL Horizon 20–25.
(b) Lab tape.
(c) 1 L Erlenmeyer flask.
(d) 9-inch 13-inch glass dishes.
(e) Aluminum foil.
(f) Parafilm.
(g) Plastic wrap.
(h) Razor blade.
(i) Plastic ruler.
(j) Spatula.
2.4 Southern Blotting 1. Stock solutions or chemicals.

(Transfer (a) 20 SSC (Thermofisher).
and Hybridization)
(b) 50 Denhardt’s solution (Thermofisher).
(c) Salmon sperm DNA (ssDNA; Thermofisher).
(d) 1 M Na2HPO4 (Sigma): 71 g anhydrous Na2HPO4 plus
4 mL H3PO4 adjusted to 1 L with water.
(e) 20% SDS (Thermofisher).
2. Reagents.
(a) Nicking solution: Add 16.5 mL HCl to ~1480 mL water
(1.5 L total volume). Cover and store at 22 C (make fresh
daily; can be used for multiple gels).
(b) Denaturation solution: Add 30 g NaOH and 131.4 g

NaCl to 1200 mL water; bring up to 1.5 L in a graduated
cylinder. Cover and store at 22 C (make fresh daily; can
be used for multiple gels).
(c) Neutralization solution: Add 131.4 g NaCl, 90.75 g Tris,
51 mL HCl to 1200 mL water; bring up to 1.5 L in a
graduated cylinder. Cover and store at 22 C (make fresh
daily; can be used for multiple gels).
(d) Transfer solution: Transfer in 10 SSC (made from a 1:1
dilution of 20 SSC). Cover and store at 22 C.
(e) Church and Gilbert Hybridization (Hyb) solution: For
50 mL, add 12 mL of 1 M Na2HPO4, 8.75 mL of 20%
SDS, 1 mL of ssDNA (boiled and snap-cooled), 1 mL of
50 Denhardt’s, 100 μL of 0.5 M EDTA pH 8.0 and
6 mL of water. Use the same day.
(f) Church and Gilbert Wash solution: For 1 L, combine
100 mL of 1 M Na2HPO4, 100 mL of 20% SDS, and
800 mL of water. Store at room temperature.
(g) MegaPrime DNA labeling kit (GE Healthcare): match the
kit to radiolabel selected.
(h) Radiolabel [alpha P32]-dCTP (provider varies):
[alpha-32P] dCTP at 3000 Ci/mmol is commonly used.
Replace often to maintain signal strength.
(i) Double-stranded mtDNA template (can be generated by
PCR).
(j) Dimethyl Uridine (DMU; Sigma). Resuspend in water at
100 mM to use as a 50x solution.
3. Plasticware.
(a) 10 mL pipette.
(b) Screw-cap tubes.
4. Tools or supplies.
(a) Thin gel blot paper: Cut 8 sheets of thin blot paper (What-
man 3MM or similar generic brand such as Denville
Hyblot 3A) to 19.75 cm 25 cm.
(b) Thick gel blot paper: Cut 4 sheets of thick blot paper
(Denville Hyblot 30) to 19.75 cm 25 cm.
(c) Nylon membrane: Cut 1 sheet of Hybond N+
(GE Healthcare) to 19.75 cm 25 cm.
(d) Wick paper (long sheet of thin gel blot paper that drapes
across the platform holding the gel; edges dip into transfer
solution). Size will vary upon the equipment selected.
(e) 20 25 cm support (rigid foam or thick cardboard
rectangle).
(f) Paper towels and plastic wrap.

(g) Hybridization oven, hybridization tubes.
(h) UV cross-linker (such as Stratalinker 1800).
(i) Phosphorimager screen and reader (GE healthcare) with
associated software.
(j) Long forceps.
(k) Nanodrop spectrophotometer (ThermoFisher).
3 Methods
It is not necessary to purify mitochondria for this assay, although

this can be done. Thus, cells or tissues may be snap-frozen prior to
preparation. General information: Carry out all procedures at room
temperature unless otherwise noted.
3.1 Collection Tissues

of Tissues and Cells
1. Tissues collected rapidly at the time of euthanasia and collected
(see Fig. 1)
in RNase-free cryovials, immediately immersed in liquid nitro-
gen, and stored at 80 C for later analysis of DNA, RNA,
protein, or enzyme activity.
Cells
2. Adherent cultured cells require dissociation by trypsinization
or scraping prior to collection. Once adherent or nonadherent
cells are collected, cells are centrifuged at low speed (centrifuge
and cell line dependent, 200 g for 5 min may serve as a
starting point). Remove media (Fig. 1a).
3. Resuspend cells in cold PBS and transfer to microfuge tube;
spin at 200 g for 5 min at 4 C. Carefully aspirate supernatant
and snap-freeze in LN2 or dry ice (Fig. 1b). Samples should be
stored at 80 C.
iii. PBS,
A. resuspend ii. store at -80 C
ii. aspirate iv. transfer B. i. aspirate,
i. spin v. spin snap freeze
+
dry ice/ LN2
Fig. 1 Sample collection. (a) Example shown for cultured cells. Cells are pelleted in a conical tube by
centrifugation and the supernatant removed by aspiration. The cell pellet is washed once by resuspending
cells in PBS, transferred to a microfuge tube, and pelleted. (b) The supernatant is removed without disturbing
the cell pellet. The pellet should be snap-frozen on dry ice or in LN2 and stored at 80 C
A. B. i. Add salt, iii. transfer iv. Add C. Remove

invert GlycoBlue + supernatant, add
i. Add ii. 55C ON 100% EtOH 70% EtOH, spin
buffer +
D. Remove sup,
PK + + air dry
30' ice
E. Resuspend
ii. spin at 4C v. spin at 4C and Nanodrop
Fig. 2 DNA preparation. (a) Frozen pellets are thawed by resuspending in the Proteinase K buffer with
proteinase K added. After resuspension, samples are digested at 55 C overnight with protection from light. (b)
The following morning, samples are processed by adding salt, inverting, and placing samples on ice for
30 min. Following centrifugation, supernatants are transferred into a fresh microfuge tube, followed by
addition of GlycoBlue and 100% EtOH, then spun at 4 C. (c) The supernatant is removed, pellet rinsed with
70% EtOH, and spun. (d) The supernatant is removed and pellets air dried while protected from light. Samples
are resuspended and stored at 20 C. The DNA concentration of thawed samples is determined by OD260 in
a NanoDrop
3.2 DNA Isolation 1. Premix Proteinase K digestion buffer with Proteinase K and
from Tissues or Cells beta-mercaptoethanol (BME) (250 μL for tissues, 500 μL for
(see Fig. 2) cells):
(a) Tissues: 240.5 μL ProK buffer +7.5 μL Proteinase
K + 2 μL 1:100 BME (diluted in water). Continue to
step 2.
(b) Cells: 481 μL ProK buffer+15 μL Proteinase K, +4 μL
1:100 BME. Continue to step 4.
2. For tissues, cut a small piece of tissue (1–5 mm3) on a precooled
glass dish sitting on dry ice. Add tissue to a glass homogenizer
containing 125 μL of the premixed digestion buffer that
includes ProK and BME. Homogenize lightly (~10 passes) on
ice, being sure to expose maximal surface area of tissue to the
pestle. Transfer homogenate to a microfuge tube (see Note 1).
3. Rinse the homogenizer with an additional 125 μL digestion
buffer and combine with the lysate in the microfuge tube.
Continue to step 6.
4. For cells, grow until ~80% confluent, pellet trypsinized cells in a
15 mL conical tube at ~200 g for 5 min, aspirate medium.
Resuspend in 500–1000 μL PBS, transfer to microfuge tube,
and spin at 4 C at ~200 g for 5 min, aspirate PBS. Flash-
freeze pellet on dry ice.
5. Add the premixed Proteinase K buffer + Proteinase K + BME to
the cell pellet by using the point of the pipette tip to loosen the
cell pellet at the bottom of the tube before adding the digestion
buffer. Pipet up and down gently a few times, and flick or invert
the tubes to ensure even distribution of buffer to cells (see
Note 2). Lysis should be obvious and within 5 min. Do not
vortex.
6. Digest overnight at 55 C, with lid on water bath closed to

protect samples from light.
7. The following morning:
(a) For tissues, dilute samples to a final volume of 500 μL
Proteinase K buffer if currently at 250 μL.
(b) For tissues and cells, supplement samples with another
10 μL Proteinase K. Flick tubes to mix (do not vortex).
Incubate for 1 h at 55 C.
8. Add 170 μL of 5 M NaCl to each 500 μL sample, invert or
rotate tube for 5 min to ensure complete distribution of NaCl
(see Note 3).
9. Centrifuge at maximum speed for 15 min at 4 C.
10. Transfer supernatant to fresh tube (see Note 4).
11. Add 1 mL 100% EtOH and 1 μL GlycoBlue coprecipitate to
the supernatant. Invert several times to mix.
12. Centrifuge at max speed for 15 min at 4 C.
13. Aspirate ethanol off manually or with vacuum suction
(be careful not to disturb the pellet).
14. Wash pellet carefully in 500 μL cold 70% EtOH.
15. Spin 5 min at max speed at 4 C.
16. Aspirate ethanol off, air-dry pellet by placing the open tube in a
drawer (protected from light). For same day processing, see
Note 5.
17. Resuspend pellets from tissues in 48 μL TE + 1 μL RNAse
A + 1 μL DMU. For pellets from cells, resuspend in 97 μL
TE + 2 μL RNAse A + 2 μL DMU overnight in the dark. RNase
A digests ribonucleic acids, and dimethyl urea is added as a
radical scavenger. For optimization of resuspension (see
Note 6).
18. Incubate at room temp in the dark overnight.
19. Freeze DNA at 20 C (confirm that samples are frozen). This
step helps to break up local high concentrations of DNA.
20. Quantitate by NanoDrop.
21. Add 2–10 μg DNA to a microfuge tube and add water to 40 μL
and an appropriate volume of loading dye (8 μL 6 loading dye
(Fermentas). Mix by flicking, not pipetting. Store at 20 C
protected from light; avoid multiple freeze–thaw cycles.
3.3 1D- and Based on your application and desired resolution, the experiments
2D-IMAGE (see Fig. 3) may be 1D or 2D, and samples may be treated with enzymes for
further investigation. This section describes the process of running
the gels and will identify branch points in the procedures.
A.
i. load
ii. run ON
1D-IMAGE
soak gel
in EtBr
B. i. cut out gel transfer

EtBr
lanes ii. rotate iii. cast
lanes 90 gel
~9.5 cm
2D-IMAGE
iv. run ON
Fig. 3 1D and 2D-IMAGE. (a) For either format: (i) use a pipette to load samples
into wells of the agarose gel (load every other lane for 2D-IMAGE), and (ii) run at
40 V for 16 h. If running 1D-IMAGE, proceed to gel transfer. (b) If running
2D-IMAGE, soak gel in EtBr, then: (i) cut out gel lanes, (ii) rotate 4 lanes 90
with wells to the left, (iii) cast second dimension gel (containing EtBr) around
lanes, and then (iv) run overnight
3.3.1 First Dimension 1. Treatment of DNA may be desired. A list of several enzymes
(Day 1) (see Fig. 3a) and expected effects is provided in Table 1. Be sure to stop the
reaction but avoid denaturation-based approaches. If no treat-
ment is desired, continue to step 2.
2. Tape the ends of a 20 25 cm gel tray with two layers of lab
tape, being sure to seal the overlapping segments. Add a
20-well comb and place on level surface. A bubble level is
recommended.
3. Prepare the 0.5 TBE running buffer as described in Subhead-
ing 2.3.
4. Prepare gel: 0.4% agarose in 500 mL 0.5 TBE. Confirm that
the microwave is large enough for a 1 L Erlenmeyer flask. Add
250 mL 0.5 TBE to the flask. Weigh 2 g agarose, add to the
TBE in flask and microwave for 3 min, or until the solution is
boiling rapidly (see Note 7). Add stir bar. While mixing and still
hot, add final 250 mL 0.5 TBE.
5. Cast the gel when the flask is no longer too hot to touch with
gloves. Ensure no air bubbles surround the teeth of the comb.
6. Pour the remainder of the 0.5 TBE into the gel tank.
Table 1
Enzymes used to examine mtDNA topoisomers
Manufacturer
Enzyme used to treat total genomic and reaction
DNA Expected result after enzyme treatment conditions
RNase A: Digests ss and ds RNA after U Removal of abundant RNA species Ambion
and C bases in low salt, present in DNA associated with mtDNA that interfere 2 μL at 24 C for
preparations before 1D gel with interpretation 1h
electrophoresis
RNase H: Digests RNA in RNA–DNA Increase in circular and linear ssDNA Fermentas
hybrid duplex 15 U at 37 C for
30 min
BglII or SalI: Cleaves circular form Location of linearized product in the gel Fermentas
mtDNA once (mouse or human, marks the position of genome length 4 U at 37 C for
respectively) linear mtDNA in the undigested 30 min
profile.
Topoisomerase 1: Cuts one of the two When used as a comparison with an Invitrogen
strands of DNA, relaxes all supercoils untreated sample, reveals position in 20 U at 37 C for
from DNA molecule, and reanneals the gel of maximally supercoiled mtDNA 1h
strand. ATP-independent and does not molecules
separate catenated molecules
DNA gyrase: Increases the degree of Confirms location of supercoiled New England
supercoiling of closed circular DNA. mtDNA molecules Biolabs
Catalyzes the ATP-dependent negative 10 U at 37 C for
supercoiling of ds closed-circular DNA 1h
to condense the chromosome
Type II topoisomerases (topoisomerase Decatenates or relaxes supercoiled Topoisomerase II:
II and IV): Make ds breaks that allow molecules but leaves concatemers USB Affymetrix
one duplex to pass through the other (head to tail dimers) intact 40 U at 37 C for
and reseals the break. Requires ATP. 1h
Remove supercoiling 2 twists at time, Topoisomerase
resulting in a relaxed circle IV: Inspiralis
20 U at 37 C for
1h
S1 nuclease: Digests ssDNA, dsDNA at Identifies hybridization between single Promega (part #)
nicks or gaps, and RNA strands of DNA and/or RNA. 0.9 U at 37 C for
30 min.
E. coli exonuclease 1: Hydrolyzes ssDNA Digests ssDNA in a 30 ! 50 direction. NewEngland
stepwise in a 30 ! 50 direction. It does Does not digest dsDNA. biolabs
not degrade dsDNA or DNA-RNA 20 U at 37 C for
hybrids 30 min.
ds ¼ double-stranded; ss ¼ single-stranded
7. Take the tape off the ends of the gel tray by pulling the tape
downward at a 90 angle, not outward (see Note 8).
8. Place the gel tray in the tank, and carefully remove the comb.
Rinse wells with running buffer using 1 mL pipettor.
9. Gel loading.
(a) FOR 1D-IMAGE: Load the gel with ladder (any;
1 kb + ladder is convenient) and samples using conven-
tional DNA loading buffers.
(b) FOR 2D-IMAGE: Load the gel with ladder and samples in
every other odd numbered lane, as the gel will be cut in
the center of the even numbered wells later in the
procedure.
10. Connect the electrodes to the power supply and cover the gel
tank with foil. Run the gel at 40 V for 16 h (see Note 9).
3.3.2 Second Dimension If performing 1D-IMAGE, skip to Subheading 3.4.

(Day 2) (see Fig. 3b)
1. Transfer the first dimension gel to a 9 13-inch glass dish, or
other appropriate-sized dish that can hold enough buffer to
submerge the gel in its tray (see Note 9).
2. Pour 1.4 L running buffer from the gel tank into a 2 L
graduated cylinder in the sink using a funnel to prevent
spillover.
3. Pour the TBE into the glass dish while adding 40.5 μL EtBr
(10 mg/mL stock) to the stream of TBE coming out of the
cylinder as you pour (see Note 10).
4. Cover the dish in foil and shake gently for 25 min.
5. Remove gel and set in a container. Collect and dispose of
buffer + EtBr. Briefly rinse the gel under a slow stream of
distilled water to remove as much EtBr as possible. Be sure to
place a hand over each open end of the tray to avoid the gel
sliding out.
6. Place the gel tray on a benchtop with the wells on the right;
with a clean razor blade or scalpel, make a cut parallel to the
wells ~9.5 cm away using a ruler to guide the razor blade.
7. Use the ruler to make cuts perpendicular to the wells in every
other lane of the gel (samples were loaded in odd wells so cuts
are made in the center of even wells; up to 4 gel lanes can be
placed in the second dimension gel).
8. Transfer cut gel slices to a covered dish using the spatula; rotate
gel slices so the wells are now on the left (this is how they will be
placed in the gel tray for the second dimension). Wrap the dish
in foil and keep at 4 C until the second dimension gel is ready
to be poured.
9. Tape the ends of a clean, dry gel tray with 2 layers of tape, being
sure the overlapping portions are well sealed.
10. Prepare the 0.4% agarose in 0.5 TBE in 500 mL (prepared as
in Subheading 3.3.1), but add 15 μL EtBr when cool to the
touch. Mix well.
11. Cast the second dimension gel around the gel slices when the
flask is no longer too hot to touch with gloves; pour slowly to
avoid moving gel slices.
12. If the gel slices move during pouring, use a P1000 pipette tip
to reposition them.
13. Cover the gel tray with foil during polymerization to protect
from light.
14. Prepare 2 L 0.5 TBE as above.
15. Pour the buffer into the tank while adding 60 μL EtBr to the
stream of TBE coming out of the cylinder.
16. Once fully polymerized, take the tape off the ends of the gel
tray by pulling the tape downward, not outward (see Note 11).
17. Place the gel in the tank, connect the electrodes, and cover the
tank with foil. Run the gel for 16 h at 40 V.
3.4 Gel Transfer 1. Prepare nicking solution, denaturation solution, neutralization

(Day 3) (see Fig. 4) solution, and transfer solution as described above.
2. Prepare 8 sheets of thin gel blot paper, 4 sheets of thick gel blot
paper and 1 nylon membrane as described above.
3. Prepare gel: see Fig. 4a.
(a) Rinse the gel under deionized water briefly and soak it in
its gel tray in nicking solution in a glass dish for 25 min
with gentle shaking.
(b) Rinse the gel briefly (in tray for support), then soak in
denaturation solution for 25 min with gentle shaking on
platform shaker.
(c) Rinse, soak in neutralization solution for 25 min with
gentle shaking.
4. Place a large piece of plastic wrap on the benchtop and smooth
out any bubbles. Briefly rinse the gel in its gel tray under
deionized water and gently slide the gel off the tray and onto
the left half of the plastic wrap (see Note 12).
5. Rinse the empty gel tray under deionized water and set aside.
Fill a glass dish with 10 SSC to a depth of ~2 cm.
6. Holding the gel tray in your right hand, dip the wick paper
(long blotting paper that will fit on your support) into the 10
SSC with your left hand and drape it over the gel tray, making
sure the ends of the wick paper overhang the gel tray evenly.
Use a 10 mL pipette to smooth away any bubbles under the
wick paper (see Note 13).
7. Place 3 sheets of thin gel blot paper on top of the gel and pat
gently to initiate adherence between the papers and the gel.
A.
soak
i. Nicking solution
ii. Denaturing solution
quick rinse iii. Neutralization solution
B.
place blotting paper with blotting paper
support on top on bottom
flip
weight
C. gel tray
paper towels
blotting papers
nylon membrane wick paper
gel
blotting paper plastic wrap
~2cm SSC
Fig. 4 Gel transfer. (a) For the nonelectrophoretic transfer of nucleic acids from
1D and/or 2D IMAGE gels to nylon membranes, the gel is soaked in nicking
solution, denaturing solution, and neutralizing solution for 25 min with a brief
water rinse between steps. (b) A piece of blotting paper (the same size as the
gel) is placed on top of the gel and the gel then flipped using a support; this leads
to the blotting paper being on the bottom. (c) Assemble the transfer stack in a
glass or plastic dish. A support to lift the transfer stack out of the buffer, such as
an upside-down gel tray, is required. On that support, stack (from bottom to top):
wicking paper, blot paper + gel, nylon membrane, thin blotting paper, thick
blotting paper, paper towels, gel tray, and weight
Fold the right half of the plastic wrap over the top of the
gel + paper and pull it taut.
8. Place a 20 25 cm support (rigid packing foam, plexiglass or
cardboard) on top of the plastic-wrapped gel and flip the
gel + blotting paper over by lifting the two edges of plastic
wrap up while supporting the top of the gel with your right
hand on the support.
9. Pull the plastic wrap off the top and slide your hands between
the blot paper and plastic wrap on the bottom. Support under
the left and right side of the gel + blot paper (now face down).
Gently lift the gel and place it onto the wick paper/gel tray
assembly in the glass dish.
10. Smooth away bubbles using the 10 mL pipette. Be careful to
not gouge the soft gel.
11. Rinse the Hybond membrane with deionized water and place
onto the top of the gel. Smooth away bubbles with pipette.
12. Add 8 sheets of thin gel blot paper and 4 sheets of thick gel blot
paper, followed by paper towels stacked about 5 cm high.
13. Cover the whole transfer assembly with plastic wrap, place a
square dish or the gel tray on top, and make sure the tray is
level. Finally, place a modest weight (such as a 250 mL solu-
tion) on top of the square dish to apply even pressure on the
paper towels.
14. Allow to transfer overnight.
3.5 Hybridization Instructions are provided for Church and Gilbert hybridization of a
(Day 4) double stranded probe only. Other hybridization methods can
be used.
3.5.1 Prehybridization 1. Disassemble the transfer stack, leaving one piece of thin blot
paper on top of the membrane. Peel back the upper right
corner of the paper and membrane slightly, then use a pencil
to note pertinent identifying information such as the date the
gel was initiated and the name of the samples.
2. Place the membrane (face up) onto a piece of dry thin gel blot
paper and UV-cross-link the DNA to the membrane in the
cross-linker before the membrane completely dries. The
cross-linker should be automatically set for “1200” on the
“energy” setting.
3. Roll the dry membrane into a tube, starting from right to left,
and place it in a large, dry, glass hybridization tube.
4. Add 25 mL Church and Gilbert Hyb solution; pre-hyb at
65 C for at least 2 h with rotation.
5. Make the probe during the pre-hyb step (see Subheading
3.5.2).
6. Do not add probe directly to the hyb tube; predilute it in about
500 μL of pre-hyb solution and add the pre-hyb + probe to the
center of the hyb tube.
7. Incubate overnight at 65 C with rotation.
3.5.2 Probe Synthesis 1. Thaw mtDNA probe template (5 ng/μL). Add 5 μL (for a total
of 25 ng) to a screw-cap tube.
2. Add 5 μL random primer solution from the MegaPrime DNA
labeling kit.
3. Place the lid on the tube and heat at 95 C for 5 min.
4. Add 23 μL water, 10 μL labeling buffer, 5 μL 32
P dCTP, and
2 μL Klenow enzyme (see Note 14).
5. Incubate at 37 C for 20 min.
6. Stop the reaction by adding 5 μL 0.2 M EDTA (diluted from

0.5 M stock; can also use 1 μL of 0.5 M stock).
7. Immediately prior to adding probe to hyb tubes, denature
probe by heating at 95 C for 5 min then placing on ice for
5 min to make single stranded.
3.5.3 Blot Washing 1. Pour the hyb solution into an appropriate liquid waste con-
tainer (see Note 14). Be sure to dab a small paper towel strip
onto the lip of the hyb tube to absorb any drops of hyb that
have collected there during pouring (this will avoid spreading
raw hyb solution around the outside neck of the hyb tube,
which could then contaminate the threads of the plastic lid).
2. Add ~150 mL Church and Gilbert wash solution, replace the
lid on the tube and rinse the membrane by gently tilting the
tube left and right while rolling it back and forth. Pour the
rinse into the liquid waste container.
3. Add 150 mL wash solution and wash at 65 C with rotation for
30 min.
4. Pour the first wash into the liquid waste container.
5. Wash twice more for 30 min each; the second and third washes
can be disposed of in the sink with running water (if this is
within an acceptable range according to institutional
guidelines).
6. After the last wash, remove the membrane from the tube with
long forceps. If necessary, crinkle the top edge of the mem-
brane by pushing it downward slightly with the forceps to
create a surface that the forceps can grasp. Dry the membrane
on a large piece of thin gel blot paper until the surface of the
membrane is no longer shiny.
7. Place the membrane on a piece of plastic wrap (DNA-side
down) and fold over three sides. Use a paper towel to smooth
away any bubbles in the plastic wrap and fold the fourth side of
the plastic closed.
8. Spray a paper towel with 70% ethanol and wipe down both
sides of the plastic-wrapped membrane to dissipate static
electricity.
9. Place the membrane in a phosphorimager cassette, taping it in
place, and scan 2 days later. An example of how to interpret the
results is provided in Fig. 5.
4 Notes
1. Cryo-pulverizing of tissue improves the representativeness of a

small sample and increases surface area during extraction. Pul-
verization improve detergent accessibility increases yield and
A.
hybridization interpretation
o. high molecular weight DNA
i. >1n mtDNA
ii. relaxed circles
iii. linear
iv. supercoiled
hybridization interpretation
B. o
i
i. catenated and concatenated mtDNA
ii. 1n nicked circular mtDNA
ii
iii iia. single-stranded circular mtDNA
iii. 1n linear mtDNA
iva iiib iiia. 1n single stranded linear mtDNA

iv iiib. <1n linear mtDNA
iv. maximally supercoiled mtDNA
iia iiia
iva. covalently closed relaxed circular mtDNA
Fig. 5 Example results for 1D- and 2D-IMAGE. Diagram of molecules resolved by
(a) 1D-IMAGE signal and interpretation. (b) 2D IMAGE. Molecular species are
identified according to the key to the right of each gel. o ¼ origin
decreases degradation. Beyond pulverization, increased DNA

recovery can be obtained by additional use of a glass
homogenizer.
2. It is essential that a cell pellet be completely solubilized or
excessive mtDNA damage will occur through sample degrada-
tion. Pipetting up and down forcefully is not recommended.
DO NOT VORTEX THE TUBES AT ANY TIME!
3. This step is very important for achieving proper precipitation of
protein and membrane components. Do not aggressively mix,
just invert frequently during 5 min incubation.
4. Be careful to not pull up white material. If some precipitate is
recovered, spin a second time. If a large number of samples are
being prepared, it is not uncommon to need to respin the last
half of the samples a second time as the precipitate may begin to
loosen.
5. To dry pellets for same-day processing, strive to remove all
ethanol without risking pellet loss, then place tubes at 37 C
in hybridization oven to dry. Depending on successful removal
of ethanol by aspiration, the pellets may be dry (no longer
shiny) after 30–60 min.
6. Balance between the volume required for good resuspension

and maintaining volume low enough for gel loading may vary
for each sample. Be prepared to modify, but always keep the
total DNA concentration above 1 ng/μL to prevent DNA loss
through adhesion to the microfuge tube.
7. Be careful when removing the flask from the microwave, as the
agarose can begin boiling again due to agitation. While swirling
the flask, add another 250 mL 0.5 TBE to expedite cooling.
8. The gel is a very low percentage and relatively large, making it
easily broken. When handling the gel tray, always place a hand
at each open end of the tray to prevent the gel from sliding out.
9. Consider plugging the power supply into an uninterruptible
power source to prevent any power fluctuations from shutting
off the power supply during the night and ruining the run.
10. Do not pour TBE directly on top of the gel, as it could tear.
Never add EtBr to a graduated cylinder as the plastic will
absorb EtBr over time.
11. Be very careful during this step, as there is not a comb in place
to hold the gel in the tray.
12. Be sure to hold the gel tray slightly above the plastic wrap so it
does not touch the benchtop (the tray will stick to the plastic
wrap). Pull the plastic wrap taut to disperse any bubbles under
the gel. Stretching the wrap prior to placing the gel and secur-
ing the wrap with lab tape may help.
13. Once the wick paper is soaked in SSC, it cannot be repositioned
easily, as it will tear.
14. All of these steps should be performed behind a shield. Follow
institution protocols and procedures for monitoring
workspace.
Acknowledgments
This work was support by NIH grants GM110424, MH119335

and HD099666 to B.A.K. The authors wish to recognize the
efforts of Petra Langer-Cravens, Ph.D. who provided writing assis-
tance for the manuscript.
References
1. Whittaker RG, Schaefer AM, McFarland R et al death in human cancer cells. Oncotarget
(2007) Prevalence and progression of diabetes 6:25466–25483. https://doi.org/10.18632/
in mitochondrial disease. Diabetologia oncotarget.4510
50:2085–2089. https://doi.org/10.1007/ 3. Ye C, Shu X-O, Wen W et al (2008) Quantita-
s00125-007-0779-9 tive analysis of mitochondrial DNA 4977-bp
2. Gibellini L, Pinti M, Bartolomeo R et al (2015) deletion in sporadic breast cancer and benign
Inhibition of Lon protease by triterpenoids breast diseases. Breast Cancer Res Treat
alters mitochondria and is associated to cell
108:427–434. https://doi.org/10.1007/ 13. Van Laar VS, Arnold B, Howlett EH et al

s10549-007-9613-9 (2018) Evidence for compartmentalized axo-
4. Meierhofer D, Mayr JA, Foetschl U et al nal mitochondrial biogenesis: mitochondrial
(2004) Decrease of mitochondrial DNA con- DNA replication increases in distal axons as an
tent and energy metabolism in renal cell carci- early response to Parkinson’s disease-relevant
noma. Carcinogenesis 25:1005–1010. https:// stress. J Neurosci 38:7505–7515. https://doi.
doi.org/10.1093/carcin/bgh104 org/10.1523/JNEUROSCI.0541-18.2018
5. Lezi E, Swerdlow RH (2012) Mitochondria in 14. Lewis SC, Uchiyama LF, Nunnari J (2016)
neurodegeneration. Adv Exp Med Biol ER-mitochondria contacts couple mtDNA
942:269–286. https://doi.org/10.1007/ synthesis with mitochondrial division in
978-94-007-2869-1_12 human cells. Science 353:aaf5549. (80- ).
6. Pinto M, Moraes CT (2014) Mitochondrial https://doi.org/10.1126/science.aaf5549
genome changes and neurodegenerative dis- 15. Kolesar JE, Wang CY, Taguchi YV et al (2013)
eases. Biochim Biophys Acta Mol basis Dis Two-dimensional intact mitochondrial DNA
1842:1198–1207 agarose electrophoresis reveals the structural
7. Boyapati RK, Tamborska A, Dorward DA, Ho complexity of the mammalian mitochondrial
G-T (2017) Advances in the understanding of genome. Nucleic Acids Res 41:e58–e58.
mitochondrial DNA as a pathogenic factor in https://doi.org/10.1093/nar/gks1324
inflammatory diseases. F1000Res 6:169. 16. Singh G, Hauswirth WW, Ross WE, Neims AH
https://doi.org/10.12688/f1000research. (1985) A method for assessing damage to
10397.1 mitochondrial DNA caused by radiation and
8. Nakayama H, Otsu K (2018) Mitochondrial epichlorohydrin. Mol Pharmacol 27:167–170
DNA as an inflammatory mediator in cardio- 17. Higuchi Y, Linn S (1995) Purification of all
vascular diseases. Biochem J 475:839–852. forms of HeLa cell mitochondrial DNA and
https://doi.org/10.1042/bcj20170714 assessment of damage to it caused by hydrogen
9. Ahmed N, Ronchi D, Pietro CG (2015) Genes peroxide treatment of mitochondria or cells. J
and pathways involved in adult onset disorders Biol Chem 270:7950
featuring muscle mitochondrial DNA instabil- 18. Hangas A, Aasumets K, Kek€al€ainen NJ et al
ity. Int J Mol Sci 16:18054–18076 (2018) Ciprofloxacin impairs mitochondrial
10. Pinto M, Moraes CT (2015) Mechanisms link- DNA replication initiation through inhibition
ing mtDNA damage and aging. Free Radic Biol of topoisomerase 2. Nucleic Acids Res
Med 85:250–258 46:9625–9636. https://doi.org/10.1093/
nar/gky793
11. Sun N, Youle RJ, Finkel T (2016) The mito-
chondrial basis of aging. Mol Cell 61:654–666 19. Pohjoism€aki JLO, Wanrooij S, Hyv€arinen AK
et al (2006) Alterations to the expression level
12. Kukat C, Wurm CA, Spåhr H et al (2011) of mitochondrial transcription factor a, TFAM,
Super-resolution microscopy reveals that mam- modify the mode of mitochondrial DNA repli-
malian mitochondrial nucleoids have a uniform cation in cultured human cells. Nucleic Acids
size and frequently contain a single copy of Res 34:5815–5828. https://doi.org/10.
mtDNA. Proc Natl Acad Sci U S A 1093/nar/gkl703
108:13534–13539. https://doi.org/10.
1073/pnas.1109263108
Chapter 4
2D Gel Electrophoresis to Detect DNA Replication

and Recombination Intermediates in Budding Yeast
Luca Zardoni, Eleonora Nardini, and Giordano Liberi
Abstract
The two-dimensional agarose gel electrophoresis (2D gel) is a powerful method used to detect and analyze
rare DNA replication and recombination intermediates within a genomic DNA preparation. The 2D gel
method has been extensively applied to the budding yeast Saccharomyces cerevisiae due to its small and well-
characterized genome to analyze replication fork dynamics at single DNA loci under both physiological and
pathological conditions. Here we describe procedures to extract genomic DNA from in vivo UV-psoralen
cross-linked yeast cells, to separate branched DNA replication and recombination intermediates by neu-
tral–neutral 2D gel method and to visualize 2D gel structures by Southern Blot.
Key words 2D agarose gel electrophoresis, Psoralen DNA cross-linking, CTAB DNA extraction,
Saccharomyces cerevisiae, DNA replication, DNA recombination, Southern blot
1 Introduction
The neutral–neutral 2D gel method has been originally developed

to assess the activity of DNA replication origins in the yeast Saccha-
romyces cerevisiae [1] and later adapted to map replication initiation
events in a variety of organisms of all three domains of life [2–
8]. Although the 2D gel method has been mainly applied to study
origin activation in small genomes or in amplified DNA loci within
the more complex genomes of insects and mammals, it has been
demonstrated to be sensitive enough to analyze replication inter-
mediates at single-copy DHFR locus in Chinese hamster ovary
cells [9].
In Saccharomyces cerevisiae, the 2D gel method has been also
extensively used to analyze pathological replication fork dynamic at
single DNA loci in response to DNA damage or at both natural and
engineered fork barriers [10–16]. This approach has been instru-
mental to predict the structure of replication-dependent sister
chromatid junctions that have been later visualized by electron
microscopy (EM) analysis [17, 18]. Moreover, the 2D gel method
43
44 Luca Zardoni et al.
a DNA shape DNA mass

2nd Dimension, DNA shape complexity
Origin of bi-directional forks
complexity
Bubble arc
Linear fragment - 1N
Small bubble +
Middle bubble ++
2N
Large bubble +++
1N
Monomer spot,
linear fragments
Fully replicated
linear fragment
- 2N
1st Dimension, DNA mass
Incoming fork DNA shape DNA mass

b simple Y arc
complexity
1N
Linear fragment -
Small Y +
Middle Y ++
Large Y +
Fully replicated
linear fragment - 2N
c double Y arc
Fork merging DNA shape DNA mass
complexity
Linear fragment - 1N
Double Y +
X-shaped molecule ++
Fully replicated
linear fragment
- 2N
d X arc Joint molecules DNA shape DNA mass

complexity
Fully replicated
linear fragment - 1N
+
Sister chromatid
junctions ++
+
2N
Fig. 1 Principle of separation of DNA intermediates by 2D gel method. Upon DNA fragmentation by restriction
enzymes, replication and recombination molecules acquire a branched structure and can be separated from
Analysis of Branched DNA Intermediates by 2D Gel Method 45
has been successfully applied to detect even more rare interhomo-

log junctions in mitotic cells [19, 20].
The neutral–neutral 2D gel method exploits the fact that
branched DNA structures migrate slower than linear DNA mole-
cules of the same mass in an agarose gel electrophoresis, so that they
can be cleanly separated from each other in a two-dimensional run
[21]. The procedure is indeed studied to separate DNA molecules
according to their mass in a first run and according to their shape in
a second orthogonal run (Fig. 1). The rare replication and recom-
bination intermediates acquires a branched structure upon geno-
mic DNA fragmentation and they can be separated from the more
abundant linear molecules in a 2D gel. Moreover, a restriction
fragment engaged in replication or recombination has different
shapes and mass, thus tracing characteristic arcs in the 2D gel that
can be revealed by a classical Southern Blot analysis. Typical 2D gel
migration patterns include arcs that are diagnostic of DNA replica-
tion initiation, elongation or termination (Fig. 1). Recombination
molecules engaging fully replicated sister chromatids migrate as a
nearly vertical spike in the 2D gel (Fig. 1). The structural charac-
terization of those X-shaped molecules by in vivo and in vitro
treatments with DNA nucleases, branch migration assay and EM
analysis revealed that sister chromatids can form different types of
junctions resembling either Holliday junctions or hemicatenanes
[16, 18, 22–26]. In diploid cells, replication-dependent joint mole-
cules generated by the interaction between the two homolog chro-
mosomes can be also analyzed by introducing a polymorphic
restriction site that generates allelic fragments with a different size
[19]. Examples of replication-dependent 2D gels structures in
Saccharomyces cerevisiae are shown in Fig. 2.
Here we describe, together with the 2D gel procedure, a
protocol for in vivo UV-psoralen DNA cross-linking of yeast cells
coupled to a genomic DNA extraction method that utilizes the
cationic detergent CTAB. In vivo psoralen DNA cross-linking pre-
serves the original structure of replication intermediates preventing
2D gel artefacts. While this step is crucial to visualize certain labile
Fig. 1 (continued) each other and from linear molecules according to shape and mass in the 2D gel. Branched
fragments trace characteristic arcs in the 2D gel, while linear fragments migrate in the monomer spot. 2D gel
structures corresponding to a certain DNA fragment can be visualized by Southern blot. (a) Bidirectional DNA
replication initiated from an origin located in the center of the fragment generates molecules that increase
progressively by mass and complexity in shape tracing the bubble arc. (b) Passive replication of the fragment
generates three-arm molecules of which the most complex in shape are those that have been half replicated
and migrate at the apex of the simple Y arc. (c) Fork merging in the center of the fragment generates double
Y-shaped molecules, which are later converted into X-shaped molecules, tracing the double Y arc. (d) Sister
chromatid junctions formed between two fully replicated linear fragments just differ in shape depending on the
position of the junction, thus migrating in a nearly vertical spike arc (X arc)
a LB
Bi-directional replication forks
MB
SB Small Bubble (SB)
Middle Bubble (MB)
Large Bubble (LB)
b SY RNAP
R-loop Incoming Replication fork
Small Y (SY)
Gapped large Ys
c Polymorphic restriction site Types of Junctions

#
SCJ 1 IHJ
SCJ 2 sister single Holliday Junction
Homologue
chromatids
chromosomes
double Holliday Junction
Sister chromatid
junction (SCJ-1)
hemicatenane
Sister chromatid
junction (SCJ-2)
Pseudo double Holliday Junction
Inter-homologue
junction (IHJ)
Fig. 2 Examples of replication and recombination 2D gel structures in budding yeast. (a) 2D gel pattern
associated to a DNA region containing a replication origin. (b) 2D gel pattern associated to a DNA region of
head-on replication-transcription conflict in sen1 mutants. Forks arrested by a transcribing RNA polymerase
DNA structures, other DNA intermediates, such as hemicatenanes,

can be lost during the UV treatment. Different DNA extraction
protocols can be used to successfully recover replication and recom-
bination intermediates for 2D gel analysis. The CTAB-dependent
method is a rapid and efficient procedure for DNA extraction that
has been originally developed to prevent the spontaneous in vitro
dissolution of recombination intermediates [27].
2 Materials
2.1 Samples 1. Sodium Azide 10% w/v solution in water, store in a bottle
Collection wrapped with aluminum foil at 4 C (see Note 1).
and Psoralen DNA 2. Trioxsalen (4,5,8-Trimethylpsoralen): 0.2 mg/mL solution in
Cross-Linking ethanol, store in a bottle wrapped with aluminum foil at
20 C (see Note 2).
3. UV longwave cross-linker (366 nm). We routinely use a UVP
CL-1000 model.
2.2 DNA Extraction 1. Spheroplasting buffer: 1 M sorbitol, 100 mM EDTA pH 8.0,

with CTAB Method 0.1% ß-mercaptoethanol. Make up to 500 mL with water. Filter
through a 0.45 μm filter system and store in a bottle wrapped
with aluminum foil at 4 C.
2. Solution I: 2% w/v CTAB (Cetyl trimethylammonium bro-
mide), 25 mM EDTA pH 8.0, 1.4 M NaCl, 100 mM Tris–
HCl pH 7.6. Make up to 50 mL with water (enough for
20 DNA samples). Filter through a 0.45 μm filter system (see
Note 3).
3. Solution II: 1% w/v CTAB, 10 mM EDTA pH 8.0, 50 mM
Tris–HCl pH 7.6. Make up to 200 mL with water (enough for
20 DNA samples). Filter through a 0.22 μm filter system.
4. Solution III: 1 mM EDTA pH 8.0, 1.4 M NaCl, 10 mM Tris–
HCl pH 7.6. Make up to 200 mL with water. Filter through a
0.22 μm filter system.
5. 1 TE: 10 mM Tris Base pH 8.0, 1 mM EDTA pH 8.0.
6. Zymolyase 100 T: 10 mg/mL solution in water, store at
20 C.
ä
Fig. 2 (continued) (RNAP) migrate as large spot on the Y arc, while R-loop accumulation interferes with the
proper maturation of Y-shaped molecules generating gapped replication structures that migrate under the Y
arc [12]. (c) 2D gel pattern associated to a DNA region containing a restriction fragment length polymorphism
in sgs1 diploid cells treated with MMS. The IHJs formed between allelic fragments with a different size and the
two classes of SCJs formed between fragments with an homogeneous size migrate in three distinct spikes
that are all recognized by the same probe in Southern blot [19]. Different type of junctions corresponding to
SCJs and potentially also to IHJs are schematized on the right
7. Proteinase K: 20 mg/mL solution in water, store at 20 C.

8. RNase A: 10 mg/mL solution in water, store at 20 C.
9. Chloroform–isoamyl alcohol 24:1.
10. Isopropanol.
11. 70% Ethanol, store at 20 C.
12. Corex glass tube (see Note 4).
2.3 DNA Digestion 1. Restriction enzymes with appropriate buffers.

2. 2.5 M Potassium Acetate (KAc) pH 6.0.
3. Isopropanol.
4. 70% Ethanol, store a 20 C.
5. 1 TE: 10 mM Tris Base pH 8.0, 1 mM EDTA pH 8.0.
2.4 2D Gel 1. Owl™ A2 Large Gel Systems (Thermo fisher).

Electrophoresis 2. A2-RL-UVT gel casting tray (W 20 cm L 27 cm) (Thermo
fisher).
3. Agarose Low EEO.
4. 5 TBE: 0.44 M Tris Base, 0.44 M Boric Acid, 10 mM EDTA
pH 8.0. Make up to 2 L with water.
5. Ethidium bromide: 10 mg/mL.
6. Bromophenol Blue Xylene Cyanol dye (20).
7. 1 Kb ladder DNA, store at 4 C.
8. UV-Transilluminator.
2.5 Southern Blot 1. UV shortwave cross-linker (254 nm).

2. 20 SSC: 3 M NaCl, 300 mM NaCitrate adjust pH to 7.0.
3. 0.25 N HCl.
4. Denaturing Solution: 1.5 M NaCl, 0.5 M NaOH.
5. Neutralizing Solution: 20 mM NaOH, 1 M NH4Ac.
6. 3 MM paper.
7. PerfectHyb™ Plus Hybridization Buffer (Sigma-Aldrich) (see
Note 5).
8. Labeled cytidine triphosphate, α P32-dCTP.
9. Prime-a-Gene® Labeling System (Promega).
10. Template DNA containing the sequence of interest for probe
synthesis (optimal concentration 200 ng/μL).
11. Amersham Hybond N+ membrane (GE Healthcare).
12. Microspin™ G-50 Columns (GE Healthcare).
13. Washing Solution I: 2 SSC, 1% SDS. Make up to 500 mL

with water.
14. Washing Solution II: 0.1 SSC, 0.1% SDS. Make up to 1 L
with water.
15. UVP Hybridization Oven tubes.
16. Hybridization oven.
17. Phosphoimager BAS-MS 3543 plate (GE Healthcare).
18. Amersham Typhoon trio.
19. Stripping solution: 0.05 SSC, 1% SDS, 15 mM NaCl. Make
up to 150 mL with water.
3 Methods
3.1 Samples 1. Collect samples of ca. 2 109 cells (i.e., 100 mL at

Collection and UV 2 107cell/mL) (see Note 6).
Psoralen DNA 2. Add Sodium Azide to a final concentration of 0.1%, and cool
Cross-Linking down samples immediately on ice for at least 15 min (see
Note 7).
3. Centrifuge cells at 4700 g for 3 min at 4 C.
4. Resuspend pellets in 25 mL of cold water and transfer in 50 mL
conical tubes.
5. Centrifuge cells at 4700 g for 3 min at 4 C, eliminate any
trace of water using a pipette.
6. Leave cell pellets in ice.
7. Resuspend cells in 5 mL of cold water and transfer them into a
6 well plate on ice.
8. Add 300 μL of psoralen in each well and mix with a plastic rod
for 5 min (see Note 2).
9. Put the plate, without the cover, in the cross-linker under
366 nm UV light at a distance from the lamps of 5 cm for
10 min.
10. Repeat steps 8 and 9 four times (see Note 8).
11. Transfer the cells in a 50 mL conical tubes (one tube for
each well).
12. Wash the wells with 5 mL of cold water twice and collect the
water in the 50 mL conical tubes of step 11.
13. Centrifuge samples tubes at 4700 g for 3 min at 4 C,
eliminate any trace of water using a pipette.
14. Dried cell pellets must be stored at 80 C.
3.2 DNA Extraction 1. Resuspend cell pellets in 5 mL of Spheroplasting buffer by

with CTAB Method vortexing and add 200 μL Zymolyase 100 T.
2. Mix once and incubate at 30 C for 7–9 min. Spheroplasts
formation can be checked after 4 min and then checked every
2 min until a proper spheroplasting rate is reached (see Note 9).
Place spheroplasts on ice when ready in order to arrest Zymo-
lyase 100 T activity.
3. Centrifuge spheroplasts at 3800 g for 10 min at 4 C and
eliminate the supernatant using a pipette. It is important to
eliminate any trace of the supernatant since ß-mercaptoethanol
can affect DNA purification.
4. Resuspend spheroplasts in 2 mL of water and vortex well to
help spheroplast breakage.
5. Add 2.5 mL of Solution I and vortex.
6. Add 200 μL RNase A and incubate at 37 C for 30 min.
7. Add 200 μL Proteinase K, mix by vortexing and incubate 2 h at
50 C. Vortex samples two times during first hour to help
protein degradation.
8. Add 100 μL Proteinase K and incubate over night at 30 C.
9. Centrifuge samples for 10 min at 4000 g at 15 C.
10. Transfer the supernatant, carefully by decantation, in a 15 mL
conical tube containing 2.5 mL of freshly made chloroform–
isoamyl alcohol 24:1 at RT. Pellets are processed separately (see
steps 17–20) (see Note 10).
11. Mix several times the supernatant by shaking and centrifuge at
3800 g for 15 min at 15 C. If the sample is not separated in
three phases (with a predominance of the clear upper phase)
(Fig. 3), add 5 mL of chloroform–isoamyl alcohol 24:1 and
centrifuge for additional 15 min.
12. Carefully remove the clear upper phase using a p-1000 without
taking the white layer (Fig. 3) and transfer it in a 30 mL Corex
glass tube.
13. Add 10 mL (2 volumes) of Solution II.
14. Cover Corex glass tubes with Parafilm, mix without vortexing
and leave at RT for at least 1 h. The solution should become
turbid.
15. Centrifuge for 15 min at 29,000 g and discard the superna-
tant from the white pellet containing DNA.
16. Resuspend DNA pellets with 2.5 mL of Solution III by incu-
bating the solution at 37 C.
17. Resuspend pellets of step 10 in 2 mL of Solution III.
Fig. 3 Samples separated by centrifugation after DNA extraction with

chloroform–isoamyl alcohol. The DNA is contained in the clear upper phase
18. Vortex and incubate at 50 C for 1 h. Use cut yellow tips to

help complete pellets resuspension.
19. Transfer the solution by decantation in a 15 mL conical tube
containing 1 mL of freshly made chloroform–isoamyl alcohol
24:1 at RT.
20. Mix several times by vigorously shaking and centrifuge at
3800 g for at 15 C. Carefully remove the clear upper
phase and transfer in the 30 mL Corex glass tube containing
the supernatant from step 16. Once the supernatant and pellet
fractions have been pulled together, proceed with DNA
purification.
21. Add 1 volume of isopropanol to 30 mL Corex glass tubes and
mix without vortexing.
22. Centrifuge the DNA at 29,000 g for 15 min at 15 C in a
swing out rotor.
23. Discard the supernatant and add 2 mL of cold 70% ethanol.
24. Centrifuge 10 min at 29,000 g at 15 C.
25. Remove any trace of ethanol using a pipette and air-dry for
10 min.
26. Dissolve the pellets in 250 μL of 1 TE.
27. Incubate at RT over night with shaking to allow pellet
resuspension.
28. Centrifuge briefly and transfer DNA samples to a 1.5 mL
microcentrifuge tube. DNA samples can be stored at 4 C.
3.3 DNA Digestion 1. Quantify DNA using a spectrophotometer.

2. Digest 10 μg of DNA in 200 μL final volume with 70 Units of
enzyme (see Note 11) and the proper buffer. Mix well (do not
vortex).
3. Incubate over night at 37 C.
4. Precipitate the DNA by adding 1/8 volume of 2.5 M KAc
pH 6.0, invert tube several times.
5. Add 1 volume of isopropanol at RT and mix without vortexing.
6. Centrifuge at 18,000 g in a microfuge for 15 min at 15 C
and discard the supernatant.
7. Add 0.5 mL of 70% cold ethanol to the pellets and centrifuge
10 min at 15 C.
8. Discard supernatant, briefly centrifuge, and eliminate any trace
of supernatant with a pipette.
9. Air-dry for 10 min and resuspend in 20 μL of 1 TE for at least
3 h at 37 C.
3.4 2D Gel In neutral–neutral 2D gel method, DNA restriction fragments are

Electrophoresis separated in a first gel run on the basis of the size and in second
run on the basis of the shape (Figs. 1 and 4). In the first dimension
gel, DNA samples are run in low agarose concentration under low
voltage for a long period of time. Gel slices containing both the
non-replicated (1 N) and replicated (2 N) forms of DNA fragment
of interest are than excised and positioned orthogonally in a
new gel containing high agarose and the DNA intercalator ethi-
dium bromide. In the second dimension gel, DNA samples are run
under high voltage at low temperature. 2D gel run conditions
described below can be applied to the analysis of DNA intermedi-
ates associated to fragments with a length ranging from 2.5 Kb to
6.5 Kb.
1. Prepare the first dimension gel by melting 1.75 g of agarose
low EEO in 500 mL of 1 TBE. The gel contains a low
amount of agarose and is therefore very fragile. Always handle
the gel in the tray.
2. Pour gel at 4 C in the A2-RL-UVT gel casting tray and wait
for about 1 h. The temperature of gel when is poured must be
50 C.
3. Add 5 μL of 20 Bromophenol Blue Xylene Cyanol dye to the
digested DNA samples (see Subheading 3.3, step 9).
4. Pour 2 L of 1 TBE in the Thermo fisher Owl™ A2 Large Gel
Systems.
5. Submerge first dimension gel in the 1 TBE for at least
15 min.
a 1st dimension b c 2nd dimension

1 2 3 4 5 6
3 2 1
slices
separation by DNA
complexity
6 5 4
separation by DNA
MW Kb
+
10
mass
8
6,5 cm
6 3 2 1
slice
5
4
slices
3 -
6 5 4
2
1.5
Fig. 4 Genomic DNA separation by neutral–neutral 2D gel electrophoresis. (a) Gel stained with ethidium
bromide after first dimension electrophoretic run. If the fragment of interest is 4 Kb long, the slices cut from
each gel lane must contain all DNA molecules ranging from 4 Kb (non-replicated DNA) to 8 Kb (replicated
DNA). (b) Gel slices are rotated by 90 degrees and put in the second dimension gel tray. 3 gel slices 6.5 cm
long can be accommodated in two horizontal lanes in a gel tray 20 27 cm. (c) Gel after second dimension
electrophoretic run in ethidium bromide. The abundant nonreplicating linear DNA molecules, but not replica-
tion intermediates, are visible as a diagonal arc in the gel
6. Load the DNA samples on the first dimension gel leaving in

between samples one empty well. Load ca. 50 μL of 1 Kb DNA
ladder in the first and last well.
7. Run the gel at 50 V at room temperature for 20 h to separate
DNA fragments (see Note 12).
8. Prepare 2 L of 1 TBE + 60 μL of ethidium bromide for each
apparatus and leave at 4 C.
9. Prepare the second dimension gel by melting 4.05 g of agarose
low EEO in 450 mL of 1 TBE.
10. Dye the first dimension gel with ethidium bromide by sub-
merging the tray containing the gel in 800 mL of 1
TBE + 25 μL ethidium bromide in a plastic dish and cover it,
incubate for 30 min. If the DNA is not visible, leave the gel for
additional 15 min in ethidium bromide.
11. Carefully transfer the gel from the tray to a UV-Transilluminator.
Using a big knife, cut the gel in between sample lanes in order to
recover DNA molecules corresponding to the size of the
fragment of interest. For example, if the fragment is 4 Kb long,

gel slices must contain DNA molecules ranging from 4 Kb to
8 Kb. To be sure to include all replication intermediates, it is
recommended to cut a larger piece, typically ranging from 3.5 Kb
to 10 Kb. The gel slices are trimmed to 6.5 or 9.5 cm according
to the number of pieces that will be accommodated in the second
dimension gel (Fig. 4) (see Note 12).
12. Arrange slices in the A2-RL-UVT gel casting tray as in Fig. 4b
(see Note 12).
13. Pour the second dimension gel containing 13.5 μL ethidium
bromide very carefully around the gel slices avoiding their
floating. The temperature of the gel, when is poured, must be
50 C. Solidify at RT for 45 min.
14. Add the precooled 1 TBE (step 8) to the Owl™ A2 Large
Gel Systems apparatus, wait 20 min and run gels at 4 C at
180 V. Continue the run until the lower part of the DNA
diagonal arc visible under the UV-Transilluminator is at
0.5 cm from the bottom of the gel (Fig. 4c). Usually 7–9 h
are sufficient to complete second dimension gel run.
15. Place the gels into a cross-linker under UV light at 254 nm for
10 min to reverse psoralen DNA cross-linking.
16. Cut the second dimension gel under a UV-Transilluminator in
two pieces 20 10 cm, each of them containing 3 DNA
samples (Fig. 4c).
3.5 Southern Blot 1. Wash the gels for 5 min in 0.25 N HCl solution in agitation.
2. Discard 0.25 N HCl and wash with Denaturing Solution for
30 min in agitation.
3. Discard Denaturing Solution and wash with Neutralizing Solu-
tion for 20 min in agitation.
4. Cut a 10 20 cm Amersham Hybond N+ membrane for each
gel piece and equilibrate the membrane in 10 SSC. Handle
membrane carefully touching only the edges.
5. Transfer DNA from the gel to Amersham Hybond N+ mem-
brane overnight in 10 SSC buffer via a classical capillary
method, using 3 MM paper bridge and towels.
6. Cross-link DNA to the Amersham Hybond N+ membrane in the
cross-linker under 254 nm UV light (total energy 1200 J/m2).
7. Wash membranes with water four times for 15 min in agitation.
8. Insert 20 mL of prewarmed PerfectHyb™ Plus Hybridization
Buffer into the hybridization tube at 65 C.
9. Insert the membranes into the hybridization tube with the
DNA side inward and incubate in rotation at 65 C for at
least 2 h.
10. While the membranes are in prehybridization step, prepare the

probe using the Prime a Gene kit. Probe should be used to
hybridize 4 membranes.
11. Mix 2 μL of template DNA with 30.4 μL of nuclease free water,
boil 10 min at 100 C and transfer immediately to ice.
12. Add to the boiled DNA in order: 10 μL of 5 Labeling Buffer,
2 μL of BSA nuclease free, 0.7 μL of dATP, dGTP, dTTP, 1 μL
of Klenow (these reagents are provided in Prime-a-Gene kit),
250 μCi of labeled αP32-dCTP.
13. Mix without vortexing and incubate at RT for at least 2 h.
14. Purify the probe from non-incorporated labeled dCTP using
the Microspin™ G-50 Columns kit.
15. Check with Geiger counter that the probe contains at least half
of labeled dCTP.
16. Boil labeled probe for 10 min at 100 C.
17. Add probe to the hybridization tube and incubate overnight in
rotation at 65 C (see Note 13).
18. Discard the hybridization solution containing the probe. Add
ca. 20 mL of Wash Solution I, mix two to three times and
discard the solution (see Note 14).
19. Add 50 mL of Wash Solution I at 65 C in tube, incubate for
30 min at 65 C in rotation.
20. Discard 50 mL of Solution I, moves membranes from hybridi-
zation tube to a plastic container and add 450 mL Wash
Solution I at 65 C, incubate for 30 min in agitation at RT.
21. Discard Solution I, add 500 mL Wash Solution II at 50 C and
incubate for 15 min in agitation at RT.
22. Discard Solution II, add 500 mL Wash Solution II at 50 C and
incubate 15 min in agitation at RT.
23. Put the membranes on 3 MM paper for 10 min to dry them.
24. Expose the membranes to Phosphoimager BAS-MS 3543 plate
overnight to 3 days.
25. Acquire the image using a Phosphoimager as Amersham
Typhoon trio.
3.6 Filter Stripping 1. Pour boiling Stripping Solution over the membranes in a plas-
(See Note 15) tic container with a lid and let in agitation for no more than
30 min.
2. Wash filters extensively with water.
3. Hybridize filters with a new probe as described in Subheading
3.5, steps 8–25.
4 Notes
1. Weighing Sodium Azide powder under fume hood, since it is

highly toxic, and immediately add water.
2. Trioxsalen is a psoralen analog that creates interstrand cross-
links in DNA upon UVA light irradiation. Dissolve Trioxsalen
in cold ethanol and let the solution in agitation for at least 1 h.
Trioxsalene solution can be stored at 20 C for several
months. When used after prolonged storage at 20 C, mix
the solution on a stirrer for at least 2 h in a cold room
before use.
3. CTAB is poorly soluble. Dissolve the powder close to the final
volume as possible. It is preferable to use freshly prepared
solutions (especially Solution I), since the CTAB in high con-
centration could easily form precipitates.
4. Polypropylene tubes can be also used as long as they can be
subjected to centrifugation at 29,000 g.
5. The PerfectHyb™ Plus Hybridization Buffer, which contains
SDS that precipitates at low temperature, needs to be warmed
prior to use.
6. 2D gel method is typically conducted on DNA samples
obtained from cultured yeast cells that have been synchronized
in S-phase by treatment with cell cycle inhibitors, such as
α-factor or nocodazole, or using specific temperature-sensitive
mutations in CDC genes. Hydroxyurea (HU) or methyl
methanesulfonate (MMS) can be also used to slow down
S-phase progression, although need be taken into account
that these inhibitors cause DNA damage. S-phase synchroniza-
tion is crucial to detect replication and recombination inter-
mediates at single DNA genomic loci.
7. Sodium azide (a mitochondrial inhibitor) causes an irreversible
block of the cell growth at times of sampling, thus preventing
resumption of the cell cycle progression during the preparation
of yeast spheroplasts. This step is mandatory when cells are not
subject to psoralen DNA cross-linking.
8. The number of the cycles and amount of psoralen analog
employed, as well as the distance between cell samples and
the UV source, influence the number of cross-links in the
DNA. These parameters have been set for the number of cells
indicated at the step 1 of Subheading 3.1.
9. Cell growth conditions producing a thinner cell wall (i.e., when
galactose is used as carbon source) requires shorter
spheroplasting time.
10. The processing of pellets is an optional step that can be used to
increase the amount of DNA extracted.
11. The restriction enzymes are used in excess to assure a complete

DNA digestion. Psoralen DNA cross-linking treatment can
strongly affect DNA digestion. We also note that the cut
efficiency of a restriction enzyme is variable at different DNA
loci. An incomplete DNA digestion precludes the visualization
of rare DNA intermediates by 2D gel method. In a first
instance, the enzymatic cut efficiency could be tested at the
DNA region of interest in a classical monodimensional gel
followed by Southern blot.
12. 20 h is the standard running time for DNA fragments with
length ranging from 2.5 Kb to 6.5 Kb. Running time may need
to be adjusted based on the precise length of DNA fragment
under analysis and the desired size of gel slices used in the
second dimension. In a gel casting tray 20 cm wide, 3 gel slices
with a length of 6.5 cm or 2 gel slices of 9.5 cm can be
accommodated in a single line (Fig. 4b).
13. A soon as the probe has been added to the tube, close it and
mix the solution inside to allows the probe to be distributed
over the membranes. This step reduces non-specific probe
binding to the filters.
14. This step is crucial to eliminate the probe in excess and increase
the wash efficiency.
15. The membranes can be hybridized more than once, using
different probes. However, rehybridization can be successful
in the presence of abundant replication intermediates, since the
stripping procedure also partially eliminates DNA from the
membranes.
Acknowledgments
This work was supported by Associazione Italiana per la Ricerca sul

Cancro (IG 17714) and PRIN-MIUR (2015LZE994).
References
1. Brewer BJ, Fangman WL (1987) The localiza- region during DNA amplification in Sciara
tion of replication origins on ARS plasmids in DNA puff II/9A. Genes Dev 7:1072–1084.
S. cerevisiae. Cell 51:463–471. https://doi. https://doi.org/10.1101/gad.7.6.1072
org/10.1016/0092-8674(87)90642-8 4. Vaughn JP, Dijkwel PA, Hamlin JL (1990)
2. Little RD, Platt TH, Schildkraut CL (1993) Replication initiates in a broad zone in the
Initiation and termination of DNA replication amplified CHO dihydrofolate reductase
in human rRNA genes. Mol Cell Biol domain. Cell 61:1075–1087. https://doi.
13:6600–6613. https://doi.org/10.1128/ org/10.1016/0092-8674(90)90071-L
mcb.13.10.6600 5. Bénard M, Pierron G (1992) Mapping of a
3. Liang C, Spitzer JD, Smith HS, Gerbi SA Physarum chromosomal origin of replication
(1993) Replication initiates at a confined tightly linked to a developmentally-regulated
profilin gene. Nucleic Acids Res CS, Foiani M (2001) The DNA replication
20:3309–3315. https://doi.org/10.1093/ checkpoint response stabilizes stalled replica-
nar/20.13.3309 tion forks. Nature 412:557–561. https://doi.
6. Robinson NP, Dionne I, Lundgren M, Marsh org/10.1038/35087613
VL, Bernander R, Bell SD (2004) Identifica- 16. Liberi G, Maffioletti G, Lucca C, Chiolo I,
tion of two origins of replication in the single Baryshnikova A, Cotta-Ramusino C,
chromosome of the Archaeon Sulfolobus solfa- Lopes M, Pellicioli A, Haber JE, Foiani M
taricus. Cell 116:25–38. https://doi.org/10. (2005) Rad51-dependent DNA structures
1016/S0092-8674(03)01034-1 accumulate at damaged replication forks in
7. Kuzminov A, Schabtach E, Stahl FW (1997) sgs1 mutants defective in the yeast ortholog
Study of plasmid replication in Escherichia coli of BLM RecQ helicase. Genes Dev
with a combination of 2D gel electrophoresis 19:339–350. https://doi.org/10.1101/gad.
and electron microscopy. J Mol Biol 268:1–7. 322605
https://doi.org/10.1006/jmbi.1997.0955 17. Sogo JM, Lopes M, Foiani M (2002) Fork
8. Zhu J, Brun C, Kurooka H, Yanagida M, reversal and ssDNA accumulation at stalled
Huberman JA (1992) Identification and char- replication forks owing to checkpoint defects.
acterization of a complex chromosomal repli- Science 297:599–602. https://doi.org/10.
cation origin in Schizosaccharomyces pombe. 1126/science.1074023
Chromosoma 102:S7–S16. https://doi.org/ 18. Giannattasio M, Zwicky K, Follonier C,
10.1007/BF02451780 Foiani M, Lopes M, Branzei D (2014) Visuali-
9. Dijkwel PA, Hamlin JL (1995) The Chinese zation of recombination-mediated damage
hamster dihydrofolate reductase origin consists bypass by template switching. Nat Struct Mol
of multiple potential nascent-strand start sites. Biol 21:884–892. https://doi.org/10.1038/
Mol Cell Biol 15:3023–3031. https://doi. nsmb.2888
org/10.1128/mcb.15.6.3023 19. Carotenuto W, Liberi G (2010) Mitotic inter-
10. Larsen NB, Sass E, Suski C, Mankouri HW, homologue junctions accumulate at damaged
Hickson ID (2014) The Escherichia coli DNA replication forks in recQ mutants. DNA
Tus-Ter replication fork barrier causes site- Repair 9:661–669. https://doi.org/10.1016/
specific DNA replication perturbation in yeast. j.dnarep.2010.02.017
Nat Commun 5:3574. https://doi.org/10. 20. Bzymek M, Thayer NH, Oh SD, Kleckner N,
1038/ncomms4574 Hunter N (2010) Double Holliday junctions
11. Doksani Y, Bermejo R, Fiorani S, Haber JE, are intermediates of DNA break repair. Nature
Foiani M (2009) Replicon dynamics, dormant 464:937–941. https://doi.org/10.1038/
origin firing, and terminal fork integrity after nature08868
double-Strand break formation. Cell 21. Bell L, Byers B (1983) Separation of branched
137:247–258. https://doi.org/10.1016/j. from linear DNA by two-dimensional gel elec-
cell.2009.02.016 trophoresis. Anal Biochem 130:527–535.
12. Brambati A, Zardoni L, Achar YJ, Piccini D, https://doi.org/10.1016/0003-2697(83)
Galanti L, Colosio A, Foiani M (1239) Liberi 90628-0
G (2018) dormant origins and fork protection 22. Lucas I, Hyrien O (2000) Hemicatenanes form
mechanisms rescue sister forks arrested by tran- upon inhibition of DNA replication. Nucleic
scription. Nucleic Acids Res 46:1227. https:// Acids Res 28:2187–2193. https://doi.org/
doi.org/10.1093/nar/gkx945 10.1093/nar/28.10.2187
13. Calzada A, Hodgson B, Kanemaki M, 23. Zou H, Rothstein R (1997) Holliday junctions
Bueno A, Labib K (2005) Molecular anatomy accumulate in replication mutants via a RecA
and regulation of a stable replisome at a paused homolog-independent mechanism. Cell
eukaryotic DNA replication fork. Genes Dev 90:87–96. https://doi.org/10.1016/S0092-
19:1905–1919. https://doi.org/10.1101/ 8674(00)80316-5
gad.337205 24. Robinson NP, Blood KA, McCallum SA,
14. Shishkin AA, Voineagu I, Matera R, Cherng N, Edwards PAW, Bell SD (2007) Sister chroma-
Chernet BT, Krasilnikova MM, Narayanan V, tid junctions in the hyperthermophilic
Lobachev KS, Mirkin SM (2009) Large-scale archaeon Sulfolobus solfataricus. EMBO J
expansions of Friedreich’s Ataxia GAA repeats 26:816–824. https://doi.org/10.1038/sj.
in yeast. Mol Cell 35:82–92. https://doi.org/ emboj.7601529
10.1016/j.molcel.2009.06.017 25. Mankouri HW, Ashton TM, Hickson ID
15. Lopes M, Cotta-Ramusino C, Pellicioli A, (2011) Holliday junction-containing DNA
Liberi G, Plevani P, Muzi-Falconi M, Newlon structures persist in cells lacking Sgs1 or Top3
following exposure to DNA damage. Proc Natl Cell 7:971–980. https://doi.org/10.1016/

Acad Sci U S A 108:4944–4949. https://doi. S1097-2765(01)00237-4
org/10.1073/pnas.1014240108 27. Allers T, Lichten M (2000) A method for pre-
26. Bénard M, Maric C, Pierron G (2001) DNA paring genomic DNA that restrains branch
replication-dependent formation of joint DNA migration of Holliday junctions. Nucleic
molecules in Physarum polycephalum. Mol Acids Res 28:e6
Chapter 5
Neutral–Neutral 2-Dimensional Agarose Gel Electrophoresis

for Visualization of E. coli DNA Replication Structures
Karla A. Mettrick, Georgia M. Weaver, and Ian Grainge
Abstract
Neutral–neutral 2-dimensional agarose gel electrophoresis enables the detection of replication intermediate
structures in DNA. Here we describe how DNA from Escherichia coli cells can be purified to retain
replication intermediates and then be separated by size and shape using two consecutive agarose gel
electrophoresis protocols. The DNA structures present within a localized region can be visualized by a
Southern blotting/radioactive hybridisation protocol.
Key words DNA replication, 2-dimensional agarose gel, replication intermediates, Southern blotting
1 Introduction
Neutral–neutral two-dimensional (2D) agarose gel electrophoresis

is used as a tool for the visualization of different DNA structures,
particularly those of replication intermediates [1, 2]. DNA is
extracted from the cells of interest and may be digested using
specific restriction enzymes that cut to liberate a region of interest.
The DNA is separated in the first dimension by molecular weight
using low percentage agarose gel electrophoresis at a low voltage
for a long time and then, in a subsequent electrophoresis step, in
the second dimension by size and shape. The second dimension of
electrophoresis is at 90 to the first and utilizes a higher percentage
of agarose as well as the DNA intercalator ethidium bromide that
stiffens the DNA and constrains the movement of nonlinear shapes.
Electrophoresis is generally at a higher voltage and for a shorter
time than the first dimension. The result of these two rounds of
electrophoresis is that linear DNAs of various sizes run as a diagonal
line, being of uniform shape but increasing size higher up the
diagonal. Any DNA intermediates that are not linear in structure
migrate off that line. A specific region of the DNA can then be
61
62 Karla A. Mettrick et al.
detected by Southern hybridization [3], enabling the visualization

of the DNA intermediate structures present (Fig. 3).
Here we describe a protocol used successfully to visualize DNA
replication intermediates in E. coli cells in a region where DNA
replication forks have been stalled by an inducible nucleoprotein
block [4–6]. The protocol allows for multiple regions of genomic
DNA to be visualized from a single cell sample, enabling repair
intermediates at different localities to be determined [5, 6].
Whilst we utilize this protocol for E. coli genomic DNA to
visualize DNA at an induced nucleoprotein block in genomic
DNA, similar protocols have been used to visualize intermediates
in the terminus region of E. coli [7] and also to visualize structures
from E. coli plasmid DNA [8–10]. Variations also exist for visualis-
ing DNA extracted from eukaryotes that are then separated by a
similar 2D electrophoresis protocol [11–14].
2 Materials
All solutions are prepared using ultrapure water purified using a

Milli-Q® system. This protocol uses both dangerous chemicals and
radioactive material. Diligently follow all safety and waste disposal
regulations applicable.
2.1 Preparation 1. Prepare microscope slides to have a hydrophobic-coat by pipet-

of Agarose Plugs ting 40 μL of glass water-repellent or silicone solution on to
microscope slides and rub until dry (see Note 1). One micro-
scope slide is needed per cell sample processed.
2. Pett IV (PIV) buffer: 10 mM Tris:HCl (pH 8.0), 1 M NaCl.
Make to 100 mL in deionized water and store at room
temperature.
3. 0.8% agarose solution in PIV. Measure 0.4 g agarose powder
into the bottom of a 100 mL Schott bottle. Add 50 mL of PIV
buffer and heat intermittently in a microwave until the agarose
is dissolved. Make fresh on the day of use and store at 50 C to
keep molten.
4. Cell lysis buffer: 10 mM Tris–HCl (pH 8), 1 M NaCl, 100 mM
Ethylenediaminetetraacetic acid (EDTA), 0.2% sodium deox-
ycholate, 0.5% N-lauroylsarcosine sodium salt (Sarkosyl). Make
to 200 mL with deionized water and store at room tempera-
ture. Add 100 μg/mL lysozyme and 50 μg/mL RNase A
immediately before use.
5. EDTA/Sarcosyl/Proteinase K (ESP) solution: 0.5 M EDTA,
1% N-lauroylsarcosine sodium salt (Sarkosyl). Make to 200 mL
with deionized water and store at room temperature. Add
1 mg/mL proteinase K immediately before use.
2-Dimensional Agarose Gel Electrophoresis 63
6. Tris-EDTA (TE) buffer: 10 mM Tris–HCl, 1 mM EDTA

(pH 8.0). Autoclave and store at room temperature.
7. Restriction enzyme: An appropriate restriction enzyme must be
selected that will digest the DNA to give a fragment for the
region of interest; a size in the range of 3–8 kb is ideal. Individ-
ual agarose plugs made from the same cell sample can be
digested with different restriction enzymes to visualize a larger
region or a region at a different location.
2.2 2D Gel 1. 10% sodium azide solution in deionized water (see Note 2).
Electrophoresis 2. Two gel trays of approximately 25 25 cm, and associated
electrophoresis equipment including a comb to make wells
approximately the same width as the diameter of the agarose
plugs. The protocol has assumed a 25 25 cm tray is used.
3. DNA ladder appropriate for the size of the fragment of interest.
4. 5 TBE buffer: 135 g Tris base, 68.75 g boric acid, 50 mL of
0.5 M EDTA (pH 8.0). Make to 2.5 L with deionized water
and store at room temperature (see Note 3). Dilute to 1
concentration with deionized water prior to use.
5. First dimension agarose gel: 0.4% agarose in 300 mL 1 TBE
buffer. Dissolve 1.2 g in 300 mL of 1 TBE buffer by heating
in a microwave oven. Keep molten at 50 C.
6. Water bath containing 0.3 μg/mL ethidium bromide large
enough to emerge the first dimension gel.
7. Longwave UV Transilluminator.
8. Second dimension agarose gel: 0.9% agarose in 300 mL 1
TBE buffer with 0.3 μg/mL ethidium bromide. Dissolve 2.7 g
in 300 mL 1 TBE by heating in a microwave. Add 9 μL of
ethidium bromide. Keep molten at 50 C.
9. 1 TBE buffer: Dilute 500 mL of 5 TBE buffer with 2 L
deionized water. Store at room temperature.
10. 1 TBE buffer with 0.3 μg/mL ethidium bromide: Dilute
500 mL of 5 TBE buffer with 2 L deionized water and add
75 μL ethidium bromide. Store at 4 C.
2.3 Southern 1. Nylon membrane cut to the exact size of the gel block fragment
Hybridization (s) excised from the second dimension gel. If multiple gel
blocks are excised from the second dimension gel and posi-
tioned together for the Southern transfer, a single piece of
membrane can be used.
2. 3MM chromatography paper
3. Southern blotting transfer setup: tray to hold 10 SSC buffer,
tray/glass plate to support the blotting material (an inverted
gel tray supported with a block underneath works well for this),
paper towels stacked to at least 5 cm, glass plate as a weight on

top of the blotting set up (see Fig. 2).
4. Hybridization oven and UV crosslinker.
5. Hybridization bottles appropriate for the size of the membrane
being probed.
6. PCR product: The region of DNA that you wish to visualize
needs to be amplified by PCR, either in part or as a whole. The
PCR product needs to be purified.
7. 50 ng/μL random hexamer primers
8. 3000 Ci/mmol, 10 mCi/mL deoxyadenosine 5-
0
-triphosphate-32P-ATP (α32P-dATP): 50 μCi is required per
probe synthesis reaction.
9. DNA polymerase I, Large (Klenow) fragment (lacks 50 –30 exo-
nuclease activity) with supplied reaction buffer. This protocol
has assumed the buffer is at 10 concentration.
10. 1 mM dCTP/dGTP/dTTP deoxynucleotide mix: Mix 1 μL
each of 100 mM deoxycytidine triphosphate (dCTP), 100 mM
deoxyguanosine triphosphate (dGTP), 100 mM deoxythymi-
dine triphosphate and add 97 μL of PCR grade water. Store at
20 C.
11. Depurination buffer: 0.125 M HCl solution (see Note 4).
Dilute 11 mL of concentrated HCl in deionized water to
make 1 L and store at room temperature.
12. Denaturation buffer: 1.5 M NaCl, 0.5 M NaOH. Make to 1 L
with deionized water and store at room temperature (see Note
5).
13. Neutralization buffer: 1.5 M NaCl, 0.5 M Tris. Make to 1 L
with deionized water and adjust to pH 7.5 with HCl. Store at
room temperature (see Note 6).
14. 10 Saline Sodium Citrate (SSC) buffer: 0.15 M Trisodium
citrate, 1.5 M NaCl. Dissolve 88.2 g of trisodium citrate and
175.3 g of NaCl in approximately 1600 mL of deionized water.
Adjust pH to 7 with 1 M HCl. Adjust the volume to 2 L. Store
at room temperature (see Note 7).
15. 2 SSC buffer: Dilute 200 mL of 10 SSC buffer into 800 mL
of deionized water. Store at room temperature.
16. Modified Church and Gilbert Hybridization Buffer [15]:
0.5 M potassium phosphate buffer (pH 7.2), 7% (w/v) sodium
dodecyl sulfate (SDS), 10 mM EDTA. Dissolve 35 g of SDS
and 1 mL of 0.5 M EDTA (pH 8) in 500 mL of 0.5 M
potassium phosphate buffer at 65 C. If not using immediately,
the buffer may be stored at room temperature and reheated to
65 C prior to use.
Add 100 μg/mL bovine serum albumin (BSA) and 10 μg/

mL nonspecific DNA (e.g., salmon sperm DNA) to the pre-
warmed hybridization buffer immediately before use.
17. Low stringency wash buffer: 2 SSC, 0.1% (w/v) SDS. Add
20 mL of 10 SSC buffer to 1 mL of 10% SDS and adjust final
volume to 100 mL with deionized water. Warm to 55 C
before use.
18. Medium stringency wash buffer: 1 SSC, 0.1% (w/v) SDS.
Add 10 mL of 10 SSC buffer to 1 mL of 10% SDS and adjust
final volume to 100 mL with deionized water. Warm to 55 C
before use.
19. High stringency wash buffer: 0.1 SSC, 0.1% (w/v) SDS. Add
10 mL of 10 SSC buffer to 1 mL of 10% SDS and adjust final
volume to 100 mL with deionized water. Warm to 55 C
before use.
20. Storage phosphor screen.
21. Phosphor imager.
22. Plastic wrap.
3 Methods
3.1 Sample 1. Grow E. coli cells to an optical density (600nm) of 0.5–1.0 and
Preparation for 2D Gel collect cells into prechilled 15 mL centrifuge tubes (see Note
Electrophoresis 8). Add sodium azide to a final concentration of 0.1% (w/v)
(see Note 2). Incubate cells on ice for 5 min.
3.1.1 Sample Collection
2. Centrifuge the chilled cells 7000 g (4 C) for 10 min to pellet
the cells. Discard the supernatant.
3. Resuspend the cell pellet in 200 μL PIV.
4. Move the sample into a microcentrifuge tube and centrifuge for
2 min (17,000 g). Remove the supernatant.
5. Store the pellets at 20 C until needed.
3.1.2 Preparation 1. Resuspend the pelleted cells with the lowest OD600nm in 50 μL
of Agarose Plugs of PIV and place at 50 C. For all other pellets, adjust the PIV
volume for resuspension so the final cell density for each sample
is equivalent to the sample with the lowest OD.
2. Add an equal volume of 0.8% agarose in PIV to each of the
tubes from Step 1 to create a final agarose concentration of
0.4%. Keep at 50 C to prevent solidification.
3. Aliquot 20 μL of the suspensions onto the prepared micro-
scope slides to produce hemispherical “plugs.” Once solidified,
place the plugs in microfuge tubes containing 1 mL EC-Lysis
buffer and incubated at 37 C for 2 h. Plug moulds can be used
as an alternative.
4. Remove the EC-Lysis buffer and replace with 1 mL ESP solu-

tion for incubation overnight at 50 C (see Note 9).
5. Transfer the plugs into a 15 mL sterile tube and wash five times
in 12 mL TE Buffer, allowing for a 30 min equilibration with
each wash (see Note 10).
6. Store the plugs at 4 C in 1 mL TE until further processing (see
Note 11).
3.2 Two- 1. Place a single agarose plug in a fresh microfuge tube containing
Dimensional Agarose 150 μL of appropriate 1 restriction buffer and 3 μL of the
Gel Electrophoresis required restriction enzyme (see Note 12). Incubate at 37 C
for 6–8 h. Incubation can be longer if required, for complete
digestion.
2. Pour a 0.4% agarose gel and insert comb. Leave at 4 C to set.
3. Load the digested plug into a well, with the flat side of the plug
against the side of the well closest to the positive terminal. Seal
the well(s) with additional 0.4% agarose in TBE to prevent the
plugs from being displaced. Insert a single plug in the same
manner into each well as required. Place gel into gel tank and
cover with 1 TBE buffer. Load a DNA ladder in an empty
well, leaving a gap between the ladder and the samples.
4. Electrophorese at 55 V for 16 h (see Note 13).
5. Remove the gel from the tank and place in the water bath
containing 0.3 μg/mL ethidium bromide for 20 min. Visualize
the DNA using a long-wave UV transilluminator (see Note 14).
6. Excise the lane containing the DNA of interest; cut the lane
directly below the size of interest and then to the top of the
digested DNA within the lane to create a 7.5 cm agarose block
with minimal excess agarose (Fig. 1a). Ensure that the excised
agarose contains DNA fragments at least to twice the size of the
linear DNA of interest.
7. Place the excised agarose block on a 25 cm gel tray at 90 to the
direction of DNA migration.
8. Excise the other lanes of interest and place on the new gel tray;
a maximum of 6 agarose blocks can be placed on the new tray if
two rows of 3 are used (the first three at the top of the tray; the
second three halfway down at 12.5 cm; see Fig. 1b).
9. Pipette 0.9% agarose in TBE with 0.3 μg/mL ethidium bro-
mide around each gel block to seal them in place. Once set,
pour the remaining gel to the same level as the gel slices. Allow
to set.
10. Place the gel in a gel tank and pour over the prechilled 1 TBE
(with 0.3 μg/mL ethidium bromide).
Fig. 1 Excising the DNA region of interest from the agarose gels. (a) Following electrophoresis in the first
dimension of 6 agarose plugs, the digested DNA should show strong banding approximately the same sizes as
the DNA ladder. In this example, the region of interest is 5.5 kb so each lane was cut at approximately 5 kb and
all the DNA higher in molecular weight included in the excised gel block (excised fragment indicated by the red
box). (b) The six gels blocks were rotated 90 and placed on a 25 25 cm gel tray in two rows, one at the top
of the tray (closest to the negative terminal) and one halfway down the gel tray. (c) Following electrophoresis
in the second dimension, the DNA is visualized as a diagonal line (three samples shown). For each sample, a
block is excised (indicated by the red box) to include all of the diagonal as well as agarose above the diagonal
which will include more complex DNA structures
11. Electrophorese for 4 h at 220 V at 4 C (the fragments should

have migrated approximately 10 cm; see Note 15). Visualize
the DNA with UV to confirm proper migration and excise the
regions containing the digested DNA and the agarose in the
region above the diagonal (Fig. 1c).
3.3 Southern 1. Incubate the excised gel blocks in depurination solution for
Hybridization 10 min at room temperature with gentle agitation.
3.3.1 Transfer 2. Rinse the gel blocks briefly with distilled water and then with
denaturation buffer for 30 min. Rinse again briefly in distilled
water and then incubate the gel blocks in neutralization buffer
for 30 min with gentle agitation at room temperature.
3. Pour enough 10 SSC into a tray so that it will not dry out
overnight. Create a platform approximately 5 cm above the
level of the buffer. Saturate 3 sheets of 3MM chromatography
Fig. 2 Setup for assembly to transfer DNA from the second dimension agarose
gel blocks to the nylon membrane. The gel blocks excised from the second
dimension gel are placed on top of SSC-soaked filter paper. A single nylon
membrane is laid on top of the gel blocks in a manner preventing air bubbles
from forming. Overnight, the 10 SSC will move by capillary action from the tray
to the paper towels through the filter paper, carrying the DNA from the gel to the
membrane
paper with 10 SSC and place on the platform. Cut the chro-
matography paper so that it is long enough to be immersed in
buffer at both ends to act as a wick and wide enough to fit the
membrane gel on (see Fig. 2).
4. Place the gel block(s) on top of the saturated chromatography
paper. Frame the gel with plastic wrap to prevent the buffer
by-passing the gel during transfer (see Note 16). Carefully lay
the cut membrane on top of the gel(s). Remove air bubbles
between the membrane and gel by rolling a bottle or serologi-
cal pipette gently across the membrane.
5. Cut three sheets of 3MM chromatography paper to the same
size as the membrane. Saturate the chromatography paper
sheets with 10 SSC and place on top of the membrane.
Remove any air bubbles that have formed.
6. Stack paper towels at least 5 cm high on top of the 3MM paper
covering the membrane followed by a solid support (see Note
17). Allow the transfer to proceed overnight.
7. Without rinsing, expose the membrane (DNA side up) to UV
to crosslink the DNA to (see Note 18).
8. Rinse the membrane thoroughly in 2 SSC to prevent high
background on the blot images (see Note 19).
3.3.2 Probe Preparation 1. Add 50 ng of PCR product corresponding to the region of

interest to 3 μL of 50 ng/μL hexanucleotides, 2 μL of 10
Klenow fragment buffer and 8 μL of PCR grade water.
2. Heat the mixture to 95 C for 3 min then immediately place on
ice. Add 1 μL of 1 mM dC/dG/dT-TP mix, 1 μL (5 U) of
Klenow fragment and 5 μL (50 μCi) of α32P-dATP. Incubate at
room temperature for an hour.
3. Add 1 μL of 1 mM dNTP mix and 1 μL (5 U) of Klenow

fragment and incubate at room temperature for 20 min.
4. Heat the mixture to 95 C for 5 min immediately before use.
3.3.3 Hybridization 1. Roll the membrane into a hybridization bottle and add enough
of the prewarmed modified Church and Gilbert buffer to cover
the membrane (see Note 20). Incubate in the hybridization
oven, with rotation, at 55 C for 1 h.
2. Add the preprepared radiolabelled probe (see Subheading
3.3.2) and leave to hybridize to the DNA on the membrane
overnight at 55 C, with rotation.
3. Remove the probe and hybridization buffer and add low strin-
gency wash buffer (see Notes 20 and 21). Wash for at least
5 min at 55 C, with rotation. Repeat.
4. Wash the membrane twice in medium stringency buffer for at
least 10 min at 55 C.
5. Wash the membrane twice in high stringency buffer for at least
5 min at 55 C, with rotation.
6. Remove the wash buffer and wrap the membrane(s) in plastic
wrap, ensuring the outside is clean and dry. Lay the membrane
on a Phosphor Imaging Screen in a radiation film cassette
overnight (at room temperature) before imaging with a Phos-
phor imager (see Fig. 3).
4 Notes
1. This may be done in advance and the treated slides stored long
term at room temperature.
2. Sodium azide is extremely toxic. Consult the Safety Data Sheet
prior to commencing work and do not handle it until all safety
precautions have been read and understood.
3. Precipitates can form within the 5 TBE buffer during long-
term storage. Filtering the buffer in a 0.22 μm filter can
increase the length of time the buffer can be stored for.
4. Depurination buffer can be reused and is stable at room tem-
perature for up to 1 month.
5. Denaturation buffer can be reused once and is stable for up to
3 months at room temperature.
6. Neutralization buffer can be reused once and is stable for up to
3 months at room temperature.
7. 10 SSC and 2 SSC are stable at room temperature for
3 months.
Fig. 3 Southern blot of 2D-gel to visualize DNA replication intermediates. (a) Schematic representation of the
signal patterns frequently observed after 2D electrophoresis and Southern blotting, with (b) corresponding
representative results. The majority of the signal is localized to one distinct spot positioned on the diagonal
line, relating to linear double stranded DNA called the monomer spot. When replication is occurring, an arc
signal will be present indicating various Y-structures as replication fork sizes differ within the region of interest
across the population of cells. A shift in intensity from the monomer spot to a localized region within the Y-arc
(black oval, schematic 3) represents a blockage where the replication forks have stalled at a similar position in
the region of interest across the population of cells. If unresolved recombination intermediates, such as
Holliday junctions or regressed forks still remain across the population of cells an X-spike or cone signal
extends from the arc
8. The volume of cells used to make each plug will vary depending
on the experimental setup and aims. If the fork has stalled in the
region of interest due to for example, a nucleoprotein block,
then 7.5 mL of OD600nm ¼ 0.5 will be sufficient. Plasmid DNA
will also not require a high cell volume. However, if the fork
passing through the region is not stalled, a much higher cell
density will be required.
9. Plugs should be translucent. If they are not, further incubation
in fresh ESP buffer is required to ensure lysis is complete.
10. Decanting the TE wash buffer through a 40 μm nylon cell
strainer prevents loss of any agarose plugs.
11. When pipetting from the tubes containing the agarose plugs, a
200 μL tip or smaller is recommended to avoid damaging the
plugs.
12. An inoculation loop is useful to move and manipulate the

placement of a single agarose plug.
13. At this voltage the gel is electrophoresed at 2.2 V/cm if using a
25 cm gel tray. The time of electrophoresis will vary depending
on the size of the fragment of interest. Sixteen hours is appro-
priate for a 5.5 kb fragment.
14. There should be very little DNA remaining in the wells (indic-
ative of unlysed cells) with a strong banding pattern, mostly
below the highest DNA marker band (see Fig. 1).
15. Four hours is sufficient for a 5.5 kb fragment of interest but a
smaller fragment will need less time and a larger fragment may
need more time. The DNA should appear as a diagonal line for
each plug.
16. The path of the 10 SSC should not be able to “short-circuit”
the gel-membrane and be absorbed directly into the paper
towels as this will prevent efficient transfer of the DNA to the
membrane.
17. A heavy weight can be inhibitory to an efficient transfer. We
find a glass plate is sufficient for a 23 16 cm membrane but
anything heavier results in blots with a weak signal.
18. Crosslink the DNA to the membrane using the UV strength
recommended by the manufacturer of the nylon membrane.
19. Use the blot immediately for hybridization or dry it at room
temperature, wrap in plastic wrap and store at 4 C.
20. 20 mL of buffer is an appropriate volume to use in a
35 300 mm hybridization bottle.
21. The probe can be decanted into a tube and stored short-term at
4 C and then reused once. If it is to be reused, after step 1 is
completed (Subheading 3.3.3), remove the blocking buffer
from the hybridization bottle and replace with the stored
probe in hybridization buffer.
References
1. Bell L, Byers B (1983) Separation of branched bound DNA in vivo. EMBO J 25

from linear DNA by two-dimensional gel elec- (11):2596–2604. https://doi.org/10.1038/
trophoresis. Anal Biochem 130(2):527–535 sj.emboj.7601155
2. Brewer BJ, Fangman WL (1987) The localiza- 5. Mettrick KA, Grainge I (2016) Stability of
tion of replication origins on ARS plasmids in blocked replication forks in vivo. Nucleic
S. cerevisiae. Cell 51(3):463–471 Acids Res 44(2):657–668. https://doi.org/
3. Southern EM (1975) Detection of specific 10.1093/nar/gkv1079
sequences among DNA fragments separated 6. Weaver GM, Mettrick KA, Corocher TA,
by gel electrophoresis. J Mol Biol 98 Graham A, Grainge I (2019) Replication fork
(3):503–517 collapse at a protein-DNA roadblock leads to
4. Possoz C, Filipe SR, Grainge I, Sherratt DJ fork reversal, promoted by the RecQ helicase.
(2006) Tracking of controlled Escherichia coli Mol Microbiol 111(2):455–472. https://doi.
replication fork stalling and restart at repressor- org/10.1111/mmi.14166
7. Duggin IG, Bell SD (2009) Termination struc- of BLM RecQ helicase. Genes Dev 19
tures in the Escherichia coli chromosome repli- (3):339–350. https://doi.org/10.1101/gad.
cation fork trap. J Mol Biol 387(3):532–539. 322605
https://doi.org/10.1016/j.jmb.2009.02.027 12. Lopes M, Foiani M, Sogo JM (2006) Multiple
8. Kuzminov A, Schabtach E, Stahl FW (1997) mechanisms control chromosome integrity
Study of plasmid replication in Escherichia coli after replication fork uncoupling and restart at
with a combination of 2D gel electrophoresis irreparable UV lesions. Mol Cell 21(1):15–27.
and electron microscopy. J Mol Biol 268 https://doi.org/10.1016/j.molcel.2005.11.
(1):1–7. https://doi.org/10.1006/jmbi. 015
1997.0955 13. Giannattasio M, Zwicky K, Follonier C,
9. Olavarrieta L, Martinez-Robles ML, Foiani M, Lopes M, Branzei D (2014) Visuali-
Hernandez P, Krimer DB, Schvartzman JB zation of recombination-mediated damage
(2002) Knotting dynamics during DNA repli- bypass by template switching. Nat Struct Mol
cation. Mol Microbiol 46(3):699–707 Biol 21(10):884–892. https://doi.org/10.
10. Viguera E, Hernandez P, Krimer DB, Lurz R, 1038/nsmb.2888
Schvartzman JB (2000) Visualisation of plas- 14. Castan A, Hernandez P, Krimer DB, Schvartz-
mid replication intermediates containing man JB (2017) The abundance of Fob1 mod-
reversed forks. Nucleic Acids Res 28 ulates the efficiency of rRFBs to stall replication
(2):498–503 forks. Nucleic Acids Res 45
11. Liberi G, Maffioletti G, Lucca C, Chiolo I, (17):10089–10102. https://doi.org/10.
Baryshnikova A, Cotta-Ramusino C, 1093/nar/gkx655
Lopes M, Pellicioli A, Haber JE, Foiani M 15. Church GM, Gilbert W (1984) Genomic
(2005) Rad51-dependent DNA structures sequencing. Proc Natl Acad Sci U S A 81
accumulate at damaged replication forks in (7):1991–1995
sgs1 mutants defective in the yeast ortholog
Chapter 6
Alkali Comet Assay in Genotoxicity Tests

Maya Ueda
Abstract
DNA damage detected by the in vivo comet assay is an initial factor for Clastogenicity and gene mutation,
and it is considered that the potential for carcinogenesis can be evaluated. However, there is a problem that
the test results were not stable because the results fluctuated largely depending on the test execution
conditions. Therefore, the Organisation for Economic Co-operation and Development (OECD) test
guideline have described the conditions under which tests should be conducted in order to obtain stable
data. Herein, I describe an in vivo comet assay that is based on recently approved the OECD test guideline
(TG 489).
Key words Comet assay, Single cell gel assay, DNA damage, Electrophoresis, Apoptosis, OECD
TG 489
1 Introduction
The comet assay (also called single cell gel electrophoresis: SCGE)
is one of the genotoxicity test method, and it is widely known
in vivo assays using rodents. It is important to determine the
presence and absence of genotoxicity for understanding the carci-
nogenic mechanism, and Clastogenicity, DNA damage, and gene
mutagenicity are the indicators of evaluate are genotoxicity. Among
these indicators, the in vivo comet assay is a test for performing
single cell gel electrophoresis using cells isolated from tissues and
evaluating DNA damage from the electrophoretic image [1–3]. As
long as cells can be collected and isolated, any organ/tissue can be
applied to the in vivo comet assay. International validation study
centered on the Japanese Center for Alternatives to Animal Experi-
mentation (JaCVAM) was conducted, and the OECD test guide-
line TG 489 was adopted in 2014.
There are two types of comet assays. One is conducted under
neutral and another is conducted of electrophoresis under alkaline
conditions. In this paper, the alkali comet assay that is currently
considered the mainstream method is described. By the alkali
73
74 Maya Ueda
comet assay, the assay is conducted under highly alkaline conditions

(> pH 13), and not only double-strand break but also single-strand
break or DNA damage with alkali-sensitive sites such as abasic site
(AP site) is possible to detect.
The evaluation is possible regardless of species, age, and sex of
animals used under the alkali comet assay. However, it is recom-
mended to use both sexes for substances which show different
metabolism in males and females. In case the target organ is a
genital organ (e.g., a testis or uterus), animals of appropriate sex
are used. In principle, the standard dose selection is the maximum
tolerating dose, but 2000 mg/kg/day (when the administration
period is less than 14 days) is recognized as the limit dose for test
substances with low toxicity. The route selection of administration
is based on the human exposure route, and the administrations are
performed twice or more. In addition, because it is a detection
system for initial damage, it is required to collect organs before
the DNA damage caused by the test substance is repaired. Gener-
ally, two, three, or more administrations are performed, and organ
harvesting at 2–6 h after the final administration is suitable for
detecting DNA damage in the comet assay.
2 Materials
2.1 Sample 1. Mincing buffer (Homogenized buffer). The mincing buffer

Preparation consists of 20 mM EDTA (disodium) and 10% DMSO in
Hank’s Balanced Salt Solution (HBSS) (Ca++, Mg++ free, and
phenol red free if available), pH 7.5 (DMSO will be added
immediately before use). This solution is refrigerated at <10 C
until use.
2. Dounce type homogenizer (loose type).
3. Slide glass (e.g., superfrost slide glass, Matsunami Glass Ind.,
Ltd).
4. 1.0–1.5% (w/v) standard agarose gel for coating slide. Regular
melting agarose is dissolved at 1.0–1.5 w/v% in Dulbecco’s
phosphate buffer (Ca++, Mg++ free and phenol free) by heating
in a microwave.
5. 0.5% (w/v) low-melting agarose gel for the cell-containing
layer. Low-melting agarose is dissolved at 0.5 w/v% in Dulbec-
co’s phosphate buffer (Ca++, Mg++ free and phenol free) by
heating in a microwave. During the study this solution keeps at
37–45 C.
6. Lysing solution. The lysing solution consists of 100 mM
EDTA (disodium), 2.5 M sodium chloride, and 10 mM tris
hydroxymethyl aminomethane in purified water, with the pH
adjusted to 10.0 with 1 M sodium hydroxide and/or
Alkali Comet Assay in Genotoxicity Tests 75
hydrochloric acid. This solution may be refrigerated at <10 C

until use. On the same day of use, 1 v/v% of Triton X-100 and
10 v/v% DMSO are added to this solution and the complete
lysing solution is refrigerated at <10 C for at least 30 min prior
to use.
2.2 Alkaline Gel 1. Submarine-type electrophoresis unit (e.g., BE-540, BIO

Electrophoresis CRAFT).
2. Alkaline solution for unwinding and electrophoresis. The alka-
line solution consists of 300 mM sodium hydroxide and 1 mM
EDTA (disodium) in purified water, pH >13. This solution is
refrigerated at <10 C until use. The pH of the solution is
measured just prior to use.
3. Neutralization solution. The neutralization solution consists of
0.4 M tris hydroxymethyl aminomethane in purified water,
pH 7.5. This solution is either refrigerated at <10 C or stored
consistent with manufacturer’s specifications until use.
4. Ethanol (99.6%).
5. SYBR® Gold.
6. Image analyzer (Comet Assay IV system, Perceptive
Instruments).
3 Methods
3.1 Sample The procedure after administration of the test substance is as

Preparation follows.
1. After euthanizing the animal by an appropriate method (e.g.,
exsanguination with isoflurane anesthesia), harvest the target
organ.
2. In 3–5 mL of the buffer solution containing EDTA and
DMSO, isolate a part of the harvested organ (e.g., the liver is
about 5-mm cube, the kidney is about half of right or left
kidney) by mincing with scissors or homogenizing with
Dounce type homogenizer (loose type).
3. Gently mix 10 μL of the cell suspension and 90 μL of the
0.5 w/v% low-melting agarose gel, and place the cell-agarose
mixture on a coated slide glass (see Note 1).
4. After solidifying the layer containing cells, overlay low-melting
agarose gel and solidify.
5. The slides are immersed in chilled lysing solution overnight in a
refrigerator under a light proof condition. After this incubation
period, the slides are rinsed in purified water or neutralization
solution to remove residual detergent and salts prior to the
alkali unwinding step <10 C.
76 Maya Ueda
3.2 Alkaline Gel 1. The slides are randomly placed onto a platform of submarine-
Electrophoresis type electrophoresis unit (BE-540, BIO CRAFT) and the elec-
trophoresis solution is added. The electrophoresis solution is
poured until the surfaces of the slides are completely covered
with the solution. The slides are left for 20 min (unwinding)
(see Note 2).
2. After unwinding, the slides are electrophoresed at 0.7 V/cm
for at least 20 min, with a constant voltage at approximately
300 mA. The temperature of the electrophoresis solution
through unwinding and electrophoresis should be maintained
at a constant temperature <10 C (see Note 3).
3. After completion of electrophoresis, the slides are immersed in
the neutralization buffer for at least 5 min. Then, the slides are
dehydrated by immersing into absolute ethanol (99.6%) for at
least 5 min, and they are allowed to air-dry.
4. In the analysis, the comet image is stained for about 20 min
using a staining solution (e.g., 5000 to 10,000-fold diluted
SYBR® Gold) which stains DNA.
5. In order to quantitatively evaluate DNA damage, analysis is
performed using an image analyzer system (Comet Assay IV
system, Perceptive Instruments), and the percentage of DNA
in the tail relative to the total (% tail DNA) is used as an
indicator for DNA damage (see Notes 4 and 5).
4 Notes
1. It is necessary for prevent exfoliation of layers containing cells.

A slide glass is coated by dripping an appropriate amount of
agarose gel onto a slide glass, extending it with cover glass or
slide glass and drying it. Alternatively, the slide glass may be
dipped in the agarose gel, taken out, and dried. Also, it is also
possible to purchase coated slide glasses.
2. Due to the high alkali of the electrophoresis buffer, the DNA is
unwinding and single-stranded DNA fragments can also be
detected. In addition, alkali-sensitive sites generated on the
DNA strand by DNA adducts or incomplete repair can be
detected by cleaving under highly alkaline condition. Since
DNA is negatively charged, it moves to the anode by electro-
phoresis. The mobility by electrophoresis depends on the
molecular weight of the DNA fragment, and the smaller the
DNA fragment, the larger the mobility. That is, if the DNA
embedded in the gel is not damaged, it retains its intact round
nuclear morphology (Fig. 1), but if the DNA is damaged and
broken, the fragmented DNA moves according to its size and
becomes comet-like (Fig. 2).
Alkali Comet Assay in Genotoxicity Tests 77
Fig. 1 Cell nucleus without DNA damage
Fig. 2 Cell nucleus with DNA damage
3. During electrophoresis, the migration distance is greatly

affected by the electrophoresis conditions such as voltage, cur-
rent, electrophoresis time, and the temperature of the solution
in the electrophoresis buffer, so conduct under as much con-
stant conditions as possible.
78 Maya Ueda
Fig. 3 Cell nucleus that caused cell death
4. DNA strand breaks are induced not only by DNA damage

caused by compounds but also by cell death. Electrophoretic
comet images due to cell death such as apoptosis or necrosis are
different from normal electrophoretic comet images. Since
DNA is fragmented to pieces by cell death, it moves together
when it is electrophoresed, and a small amount remains (or may
not remain) at the nucleus, and it looks like a teardrop-like
cloud (apoptosis cell image: Hedgehog) (Fig. 3). Such cells are
considered separately from genotoxic DNA damage and
excluded from the cells to be analyzed.
5. Cross-linking agents that form cross-links between DNA and
DNA or between DNA and protein show lower values than
negative control groups, because cross-link formation makes it
difficult for DNA fragments to move.
References
1. Tice RR, Agurell E, Anderson D, Burlinson B, Recommendations for conducting the in vivo
Hartmann A, Kobayashi H, Miyamae Y, Rojas E, alkaline comet assay. 4th international comet
Ryu JC, Sasaki YF (2000) Single cell gel/comet assay workshop. Mutagenesis 18(1):45–51
assay: guidelines for in vitro and in vivo genetic 3. Burlinson B, Tice RR, Speit G, Agurell E,
toxicology testing. Environ Mol Mutagen Brendler-Schwaab SY, Collins AR, Escobar P,
35:206–221 Honma M, Kumaravel TS, Nakajima M, Sasaki
2. Hartmann A, Agurell E, Beevers C, Brendler- YF, Thybaud V, Uno Y, Vasquez M, Hartmann
Schwaab S, Burlinson B, Clay P, Collins A, A (2007) In Vivo Comet Assay Workgroup, part
Smith A, Speit G, Thybaud V, Tice RR, 4th of the Fourth International Workgroup on Gen-
International Comet Assay Workshop (2003) otoxicity Testing. Mutat Res 627(1):31–35
Chapter 7
Analysis of DNA Interstrand Cross-Links and their Repair

by Modified Comet Assay
Lonnie P. Swift, Lianne Castle, and Peter J. McHugh
Abstract
DNA interstrand cross-links (ICLs) are an extremely toxic form of DNA damage that cells experience upon
exposure to natural metabolites. Moreover, ICLs are cytotoxic lesions produced by a range of clinically
important anticancer agents. Therefore, improving our understanding of ICL induction and processing has
important implications in biology and medicine. The sensitive detection of ICLs in mammalian cells is
challenging but has been aided by the development of a modified form of the single-cell gel electrophoresis
(SCGE) assay, also known as the “comet assay.” Here we describe this method and how it can be used to
sensitively monitor the induction and removal of ICLs in single mammalian cells.
Key words DNA damage, DNA repair, Unhooking, Interstrand cross-links, Fanconi anemia,
Electrophoresis
1 Introduction
DNA interstrand cross-links (ICLs) are among the most cytotoxic

form of DNA damage a cell will experience [1, 2]. The study of the
cellular response to ICLs has substantial implications, from basic
biology to a better understanding human disease and in drug
development. For example, defects in the ability to respond to
and repair ICLs is associated with the inherited syndrome Fanconi
anemia, a devastating condition associated with bone marrow fail-
ure, developmental abnormalities, and an increased risk of cancer
[3]. Conversely, a number of widely used cancer chemotherapeutic
drugs (platinum agents, mitomycin C, and others) exert their anti-
tumor effects through the induction of ICLs, where alterations in
the cellular response to and repair of drug-induced ICLs is asso-
ciated with drug resistance in malignant disease [2]. These two
examples highlight the importance of studying ICL repair, and
the identification and characterization of the cellular processes
involved.
79
80 Lonnie P. Swift et al.
The detection of ICLs in cellular DNA is challenging, particu-

larly under conditions where the genomic ICL frequency is phar-
macologically or physiologically relevant. Since the 1970s, alkaline
elution-based methods have been extensively applied to the detec-
tion of ICLs in human cells [4, 5]. This method has been invaluable
in characterizing the kinetics of DNA cross-linking reactions in
cells, providing insights into the kinetics of ICL removal and help-
ing to identify the cellular pathways that promote ICL repair (for
example see ref. [6]). The alkaline elution approach, however, suf-
fers from a number of drawbacks and limitations, not least the large
number of cells required and the requirement to radiolabel the cells
prior to assay. Moreover, alkaline elution involves analysis of the
pooled material from a population of cells and is therefore not
suitable for single-cell studies where variation within a population
can be assessed. More recently, a modified version of the single-cell
gel electrophoresis (SGCE) assay has become a powerful tool to
examine ICL induction and processing [7]. This assay is now more
commonly known as the “comet” assay on account of the analyzed
cells microscopic resemblance to icy cosmic bodies, having both a
head (nucleus) and tail of broken DNA. This radioactive labeling-
free method requires far fewer cells than alkaline elution, is more
sensitive, can be applied to the analysis of single cells and is suitable
for the analysis of material obtained during in vivo experiments and
clinical studies, including in drug development [8–10].
In outline, the “classical” version of the comet assay involves
embedding cells in agarose (upon microscope slides), lysing and
deproteinizing the cells and then submitting the slides to conven-
tional submarine electrophoresis [11]. During the electrophoresis,
broken DNA fragments are able to migrate from the supercoiled
mass of the nucleoid producing the comet “tail,” while the unbro-
ken fraction of the genome is retained within the nucleoid or comet
“head.” Under neutral electrophoresis conditions, DNA double-
strand breaks are detected, whereas under denaturing (alkaline)
conditions the nucleoid unwinds such that DNA single-strand
breaks, double-strand breaks and alkali-labile sites are all revealed
[12]. In order to detect the presence of ICLs, the alkaline comet
assay has been modified such that, following treatment with the
known (or suspected) ICL-inducing agent and embedding the cells
in agarose, cells are exposed to a calibrated, fixed dose of ionizing
radiation. This induces single-strand breaks and alkali-labile sites
into the DNA. The presence of covalent ICLs retards the migration
of the broken DNA from the nucleoid, reducing tail length and
intensity. The reduction in tail length and intensity is related to the
frequency of ICLs in the genome in a linear manner [7, 10]. In
experiments designed to examine the repair of ICLs, post-
treatment incubation in drug-free media allows the ICL repair to
be followed. This is observed and quantified as a gradual restoration
of the comet tail as the covalent links between the DNA strands are
DNA Crosslink Analysis by Comet Assay 81
removed as the ICLs are incised. This method was pivotal in estab-
lishing that the XPF-ERCC1 structure-selective endonuclease plays
a key in during “unhooking” step of ICL processing, which is
required to release the covalently linked strands of the DNA double
helix and initiate repair [13, 14].
Here, we describe a detailed, updated protocol for the modified
version of the comet assay that can be applied to assess ICL induc-
tion and repair kinetics across a broad range of mammalian cell
systems.
The following method has been successfully applied to the
detection of ICLs, and their repair, in a wide variety of mammalian
cell lines, including human and rodent cell lines (see Note 1). In our
experience (unpublished observations), the method is also compat-
ible with cell synchronization methods to follow ICL removal in
specific phases of the cell cycle.
2 Materials
2.1 Chemicals 1. Cell culture media as required by the cell lines used (see Note
and Gel Reagents 2).
2. Frosted-end standard glass microscope slides (VWR cat #
631–1551).
3. 24 40 mm coverslips (VWR cat # 631–0135).
4. Agarose, Type 1-A, low EEO, 1% in H2O (Sigma cat # A0169)
(see Note 3).
5. Agarose, Type VII: low gelling temperature (LGT) 1% in PBS
(see Note 4) (Sigma cat# A9045).
6. Propidium iodide stocks: 10 mg/mL in H2O (Merck cat #
81845). Alternatively, SYBR Gold can be used as the DNA
stain at 1:10,000 in H2O (ThermoFisher Scientific cat#
S11494) (see Note 5).
7. Lysis Buffer: 30 mM NaOH, 1 M NaCl, 0.1% N-lauroylsarco-
sine (Sigma cat# L-9159) (made fresh).
8. Alkali Buffer: 30 mM NaOH, 2 mM EDTA. Make 10 stock,
store at 4 C.
9. Neutralization Buffer: 1 M Tris–HCl, pH 7.5.
2.2 Equipment 1. Large flat-bed electrophoresis tank (e.g., 15 25 cm Bio-Rad

cat #1704404) (see Note 6).
2. Microscope to collect images and analyze data (e.g., Zeiss
Observer Z1 microscope with Zen Pro software).
3. Analysis software (e.g., OpenComet software, OpenComet,
GNU General Public License version 1.3 http://www.com
etbio.org/ used as a plugin for ImageJ image analysis software
https://imagej.nih.gov/ij/download.html).
3 Methods
3.1 Slide and Cell 1. Precoat slides with 1% Type 1-A low EEO agarose in H2O by
Preparation pipetting 1 mL of molten agarose onto the center of the slide.
Allow to set and dry overnight at room temperature (see
Note 3).
2. Seed cells in recommended cell culture media. As an example,
for U2OS osteosarcoma cells, a line commonly employed in
DNA damage and repair studies, we routinely seed 5 105
cells in 2 mL in 6-well plates (see Note 7).
3.2 Cell Treatment All procedures are carried out on ice where practicable.
and Sample
1. Treat cells and incubate for desired times (see Note 8).
Processing
2. Where ICL repair removal is under assessment, remove
ICL-inducing treatment agent and allow cells to repair in
drug-free media for the desired time(s) (see Note 8). An exam-
ple list of samples and controls to include can be found in
Table 1.
3. Melt 1% Type VII low gelling temperature (LGT) agarose in
PBS in a microwave and keep at 40 C in a water bath (see
Note 9).
4. Harvest cells using standard methods. For each sample transfer
approximately 2 104 cells to wells of a 24-well plate to a final
volume of 0.1–0.5 mL. Prepare duplicate 24-well plates. One
plate will be irradiated, and the other plate will not be irradiated
(see Table 1). As an example, for U2OS cells, resuspend the cells
treated in step 2 (2 105 cells) in 2 mL media, allowing for
0.2 mL aliquots per sample (being approximately 2 104
cells). The cell number and therefore final density are impor-
tant to ensure a sufficient number of cells are present in each
imaged region. However, if cells are too densely packed data
collection becomes difficult due to comet tails overlapping with
other cells/tails.
NB: Prepare sufficient samples to produce duplicate slides
for all samples.
5. Irradiate the plate containing the controls and samples as listed
in Table 1 (in duplicate). Plates should be kept on ice to limit
any unwanted repair or further degradation of the DNA (see
Note 10).
6. To each sample well of the 24-well plate add 1 mL of 1% Type
VII (LGT) molten agarose, mix, and pipet 1 mL cells onto the
precoated slides. Place a 24 40 mm coverslip over the cells
and allow the agarose–cell mix to set (see Note 11). It is
advisable in this step to add the agarose to small batches of
Table 1
List of samples to be included for each cell line being tested
Sample number Description IR 10 Gy Plate

1 Non-drug treated control No Plate 1
a
2 Drug treated No
3 Drug treated + Repairb No
4 Non-drug treated control Yes Plate 2
a
5 Drug treated Yes
b
6 Drug treated + Repair Yes
a
Drug treatment to induce crosslinking. For example, CDDP 50 μM, 4 h. Multiple, varied, concentrations can be tested
to measure an effective drug dose to induce crosslinking (as calculated in Subheading 3.5, step 2)
b
Repair times will be cell type dependent. Taking measurements for 8, 16, 24, 36, and 48 h post treatment should give an
indication of “unhooking” (being repair time as calculated in Subheading 3.5, step 3)
In Subheading 3.2, step 4, two 24-well plates are prepared. Both plates will contain the same samples (as listed above).
One plate to be irradiated (plate 2 in this example), one plate will not be irradiated
Both plates must be kept on ice until slides are made
samples at a time to allow adequate processing time and ensure

the agarose does not set prematurely before the samples can be
added to slides.
7. Once set (1–3 min depending on room temperature), remove
coverslip and place slides in a shallow tub (lunch box) on ice.
8. Add ice-cold lysis buffer to the tub containing the slides ensur-
ing that all slides are immersed in buffer (see Note 12).
9. Incubate (on ice) for 1 h in the dark.
10. Carefully remove lysis buffer using a vacuum pump. Take care
not to disturb the gels.
11. Wash slides twice with ice-cold alkali buffer 2 30 min ensur-
ing slides remain completely immersed and protected from
light.
3.3 Slide 1. Transfer slides to the electrophoresis tank aligning all slides
Electrophoresis with the same direction/polarity (e.g., frosted ends to
anode). Ideally all samples in the same experiment should be
run at the same time in the same tank. If this is not possible,
controls must be included in each separate tank (this will
include replicates of samples 1 and 4 from Table 1).
2. Add alkali buffer to completely cover slides, but no more, as an
excess of buffer will alter electrophoresis conditions (see Note
13). Electrophorese, in the dark, for 15 min at 15 V for 15 cm
tank (1 V/cm/min) (see Note 6).
3. Remove electrophoresis buffer and flood each slide with

1–2 mL neutralization buffer and leave for approximately
10 min.
4. Rinse slides twice with 1–2 mL H2O for 10 min. Slides can be
kept in a moist environment at 4 C (with Milli-Q H2O or
PBS) until stained or allowed to air-dry.
3.4 Sample Staining 1. Rehydrate slides with 1 mL Milli-Q water for 30 min.
2. Flood each slide twice with 1 mL of 2.5 μg/mL propidium
iodide solution in H2O and incubate for 2 5 min at room
temperature in the dark (see Note 14).
3. Rinse off DNA stain with Milli-Q water once and replace and
leave water on slides for 30 min.
4. Dry slides for analysis. Store in slide box until image analysis.
Slides will remain readable indefinitely and can be restained if
necessary (see Note 15).
3.5 Data Acquisition 1. Collect multiple fields of view to enable acquisition of data
and Analysis from at least 50 cells chosen at random per sample following
the software’s protocol. Alternatively, tiled images can be
obtained. Expected results are shown in Fig. 1.
2. The degree of interstrand cross-linking (ICL) present follow-
ing drug treatment can be determined by comparing the length
of the comet tail (tail moment) of the irradiated drug-treated
samples with that of the irradiated control (untreated) and the
unirradiated control (untreated) samples (see Fig. 2a, [7]). The
frequency of ICLs is proportional to the decrease observed in
the tail moment when the irradiated drug-treated sample is
compared with that of the irradiated control (untreated) sam-
ple. This is, in effect, a measurement of the retardation of the
mobility of the DNA due to the presence of ICLs. This
decrease in tail moment (DTM) is calculated using the follow-
ing formula:

ðTMdi TMcuÞ
DTMð%Þ ¼ 1 100
ððTMci TMcuÞ þ ðTMdu TMcuÞÞ
DTM ¼ Decrease in tail moment (%).

TMdi ¼ Mean tail moment of the drug treated irradiated
sample.
TMci ¼ Mean tail moment of the irradiated control.
TMcu ¼ Mean tail moment of the unirradiated control
sample.
TMdu ¼ Mean tail moment of the drug treated unirradi-
ated sample
Fig. 1 Comet assay assessment of ICL formation. U2OS osteosarcoma cells as assessed by modified Comet
Assay. (a) Untreated, unirradiated cells have intact DNA that remains concentrated within the nucleoid, and
only a Comet “head” is observed. (b) Untreated, irradiated cells have damaged DNA following exposure to
10 Gy ionizing radiation (IR), this results in the formation of a “tail” of DNA containing breaks and alkali labile
sites that migrate from the nucleoid during electrophoresis. (c) Cisplatin treated (50 μM, 4 h), unirradiated
cells show no visible significant Comet tail—if present, this would be a measure of DNA single- and double-
strand breaks and alkali-labile sites induced by the treatment or as a by-product of the repair of the lesion. (d)
Cisplatin treated (50 μM, 4 h), irradiated cells have multiple ICLs that impede DNA migration during
electrophoresis, and the Comet tail decreases in size in a drug concentration-dependent manner (compare
d with b)
Fig. 2 Examples of data obtained. (a) Percentage decrease in tail moment indicating the increase in ICLs as a
function of increasing drug concentrations of Cisplatin (CDDP). (b) Unhooking kinetics as measured by the
modified Comet assay. The Comet tail of a given drug treatment (Cisplatin 50 μM, 4 h) will increase, over time,
indicating repair (“unhooking”) of ICLs has occurred
3. ICL “unhooking” can also be measured (Fig. 2b and formula

below). Unhooking is a function of the release of the covalent
linkage of the two DNA strands produced by the incision of the
ICLs during their repair. Unhooking is determined by measur-
ing the decrease in tail moment observed immediately after
drug treatment and comparing this with the cross-links still
present at post treatment times. Figure 2b shows that over a
period of time, ICLs are “unhooked” showing repair of
induced ICLs. This can be calculated via the following formula
[13]:

ð%DTM at T1 %DTM at T0Þ
%unhooking at T1 ¼ 100
ð%DTM T0Þ
where DTM is calculated via the formula above (Subhead-

ing 3.5, step 2) for each time point. Over time, if the ICL is
repaired you would expect to see these lesions being
“unhooked” and hence and increase in % unhooking. This is
also a measure indicating the repair of the ICLs is progressing.
A decrease in the speed of unhooking, or failure to unhook
indicates a repair defect.
4 Notes
1. This method has been successfully applied to a variety of mam-

malian cells, including human, mouse and Chinese hamster
ovary, from either cells in culture or clinically derived/primary
animal cells.
2. This method can be used on adherent or suspension cell lines.
Optimal standard conditions for growing cells should be fol-
lowed. No variation or special culturing conditions are required
in this method.
3. Low EEO agarose (low electroendosmosis) is used to provide a
medium of adhesion for the cell–agarose suspension added to
the slides in step 8. This process aims to stop the added cell–
agarose mix detaching during processing. If preferred, polyly-
sine slides can be used as they will also allow the adhesion of the
cell–agarose suspension.
4. Type VII agarose is made up in PBS, not H2O, to avoid
hypotonic lysis of the cells when the cell–agarose mix is made.
5. Some DNA stains are more sensitive than others. While propi-
dium iodide is satisfactory, other stains might produce a stron-
ger signal. The choice of DNA stain used will be determined by
the fluorescent filters available on the microscope to be used for
analysis.
6. Any electrophoresis chamber can be used. The conditions for

electrophoresis must be optimised to ensure adequate “tail”
length in the IR-treated samples. Excessive electrophoresis can
make data acquisition difficult as the length of the comet can
confuse the acquisition software.
7. Cell number should be kept the same between experiments to
ensure similar treatment conditions. The number of cells is
important as when cell–agarose suspensions are added to slides,
an optimal number of cells must be used to permit analysis.
Slides where cells are at a low density, or cells that are over-
lapping (at high-density), present challenges during data
acquisition.
8. To study ICL formation adequate incubation time for the
drug-specific lesions should be allowed. As a positive control
cisplatin, 10 μM 4 h, will induce a significant number of inter-
strand cross-links. Treatment time and repair time is drug and
cell type dependent.
9. Type VII agarose will set at 37 C, keeping the agarose at
temperatures much greater than 40 C will result in exposure
of cells to excessive temperature when preparing agarose–cell
mixes (step 8).
10. Determine the ionizing radiation dose required empirically, for
most irradiators (we have primarily used a caesium 137 source)
and for all mammalian cell lines an irradiation dose of 10 Gy has
proven optimal.
11. The coverslip will “flatten” the cell–agarose mix and should
cover the entire volume of the mix.
12. Adding and removing buffers to the slides should be done with
great care. If the cell-agarose gel is disturbed, detaching it from
the slide, reposition the gel on the slide and avoid disturbing it
again. When slides are being dried (Subheading 3.3, step 4)
ensure the gel is over the slide and it will dry in place allowing
staining and analysis.
13. The amount of buffer added should be noted and the same
volume used for each experiment under the same electropho-
resis tank conditions. This will aid reproducibility of the data
obtained.
14. Extended periods of staining can make cells too “bright.”
Staining conditions must be optimised if this becomes a prob-
lem. Alternatively, SYBR Gold DNA stain can be used in a
10-min room temperature stain at the manufacturer’s specified
concentration.
15. Slides can be dried in an oven at 37 C (~3–4 h), 65 C (~2 h)
or at room temperature overnight.
References
1. Dronkert ML, Kanaar R (2001) Repair of cross-linking agent with potent and broad
DNA interstrand cross-links. Mutat Res spectrum antitumor activity: part 1: cellular
486:217–247 pharmacology, in vitro and initial in vivo anti-
2. McHugh PJ, Spanswick VJ, Hartley JA (2001) tumor activity. Cancer Res 64:6693–6699
Repair of DNA interstrand crosslinks: molecu- 9. Puzanov I, Lee W, Chen AP, Calcutt MW,
lar mechanisms and clinical relevance. Lancet Hachey DL, Vermeulen WL, Spanswick VJ,
Oncol 2:483–490 Liao CY, Hartley JA, Berlin JD et al (2011)
3. Kim H, D’Andrea AD (2012) Regulation of Phase I pharmacokinetic and pharmacody-
DNA cross-link repair by the Fanconi ane- namic study of SJG-136, a novel DNA
mia/BRCA pathway. Genes Dev sequence selective minor groove cross-linking
26:1393–1408 agent, in advanced solid tumors. Clin Cancer
4. Ewig RA, Kohn KW (1977) DNA damage and Res 17:3794–3802
repair in mouse leukemia L1210 cells treated 10. Hartley JM, Spanswick VJ, Gander M,
with nitrogen mustard, 1,3-bis(2-chloroethyl)- Giacomini G, Whelan J, Souhami RL, Hartley
1-nitrosourea, and other nitrosoureas. Cancer JA (1999) Measurement of DNA cross-linking
Res 37:2114–2122 in patients on ifosfamide therapy using the sin-
5. Ross WE, Ewig RA, Kohn KW (1978) Differ- gle cell gel electrophoresis (comet) assay. Clin
ences between melphalan and nitrogen mus- Cancer Res 5:507–512
tard in the formation and removal of DNA 11. Olive PL, Banath JP, Durand RE (1990) Het-
cross-links. Cancer Res 38:1502–1506 erogeneity in radiation-induced DNA damage
6. Papadopoulo D, Averbeck D, Moustacchi E and repair in tumor and normal cells measured
(1987) The fate of 8-methoxypsoralen-photo- using the “comet” assay. Radiat Res 122:86–94
induced DNA interstrand crosslinks in Fanco- 12. Fairbairn DW, Olive PL, O’Neill KL (1995)
ni’s anemia cells of defined genetic The comet assay: a comprehensive review.
complementation groups. Mutat Res Mutat Res 339:37–59
184:271–280 13. De Silva IU, McHugh PJ, Clingen PH, Hartley
7. Spanswick VJ, Hartley JM, Ward TH, Hartley JA (2000) Defining the roles of nucleotide
JA (1999) Measurement of drug-induced excision repair and recombination in the repair
DNA interstrand crosslinking using the of DNA interstrand cross-links in mammalian
single-cell gel electrophoresis (comet) assay. cells. Mol Cell Biol 20:7980–7990
Methods Mol Med 28:143–154 14. Bhagwat N, Olsen AL, Wang AT, Hanada K,
8. Hartley JA, Spanswick VJ, Brooks N, Clingen Stuckert P, Kanaar R, D’Andrea A, Niedernho-
PH, McHugh PJ, Hochhauser D, Pedley RB, fer LJ, McHugh PJ (2009) XPF-ERCC1 parti-
Kelland LR, Alley MC, Schultz R et al (2004) cipates in the Fanconi anemia pathway of cross-
SJG-136 (NSC 694501), a novel rationally link repair. Mol Cell Biol 29:6427–6437
designed DNA minor groove interstrand
Chapter 8
Analysis of Chromosomal DNA Fragmentation in Apoptosis

by Pulsed-Field Gel Electrophoresis
Takeshi Terabayashi, Asako Tokumaru, Toshimasa Ishizaki,
Abstract
Double-strand DNA break (DSB) formation is a key feature of apoptosis called chromosomal DNA
fragmentation. However, some apoptosis inducers introduce DNA damage-induced DSBs prior to induc-
tion of apoptotic chromosomal DNA fragmentation. To analyze these distinct breaks, we have developed a
method using pulsed-field gel electrophoresis (PFGE) with a rotating gel electrophoresis system (RGE)
that enables us to distinguish between apoptotic DSBs and DNA damaging agent-induced DSBs based on
their mobility in the electrophoresis gel. Apoptotic DSBs appear as smeared low-molecular weight bands
(less than 500 kb), while damage-induced DSBs result in a compact single band (more than 500 kb).
Furthermore, using a caspase inhibitor, Z-VAD-FMK, we can confirm whether broken DNA fragments are
produced as part of an apoptotic response. Overall, we succeeded in characterizing two individual apoptosis
inducers and showed the different effects of those compounds on the induction of DNA breaks.
Key words Apoptosis, Caspase inhibitor Z-VAD-FMK, Double-strand breaks, Shikonin, Evodiamine
1 Introduction
DNA double-strand breaks (DSBs) occur as a result of cellular

stresses and are classified into two groups. The first is apoptosis-
dependent DSB formation, where an apoptosis-specific endonucle-
ase cleaves chromosomes, leading to the accumulation of DSBs
[1, 2]. The second is DNA damage-induced DSBs, which are
directly or indirectly induced by DNA damaging agents [3–5]. In
both cases, the effects of DSBs on organisms are widely studied in
chemical biology, toxicology, oncology, developmental biology,
immunology, and environmental science.
DSB formation resulting in chromosomal DNA fragmentation
is a key feature of apoptosis. Apoptosis is induced in developmental
and immunological responses as well as in response to cellular
stresses, such as DNA damage, ER-stresses, mitochondrial stresses,
and other irregular cell metabolism [6]. DSB formation during
89
90 Takeshi Terabayashi et al.
apoptosis is carried out by the endogenous endonuclease, caspase-

activated DNase (CAD), which cleaves chromatin DNA into frag-
ments, generally smaller than 500 kb [2, 7, 8]. This process is
critical in the degradation of chromosomal DNA and for recycling
nucleotides and amino acids. CAD is usually inactivated by interac-
tion with a regulatory protein, inhibitor of caspase-activated DNase
(ICAD) [9]. Once apoptosis is initiated, ICAD is cleaved by
caspase-3, one of the effectors of apoptosis, resulting in the release
and activation of CAD [10]. A caspase inhibitor, Z-VAD-FMK,
inactivates several caspases including caspase-3 [11, 12]. Therefore,
cotreatment with Z-VAD-FMK and an apoptosis inducer should
suppress chromosomal DNA fragmentation by blocking caspase-3
function, resulting in suppression of apoptosis [1, 13].
DNA damage on the template strand leads to a stalled DNA
replication fork, and this damage is often converted into DSBs [14–
17]. DSB is considered as one of the most dangerous types of DNA
damage, because DSBs can induce chromosomal aberrations, and
these serious genomic alterations can cause carcinogenesis, aging,
and cell death [18–21]. Therefore, DNA damaging agents are
widely used in basic studies of DNA repair, DNA damage
responses, and apoptosis. Moreover, some DNA damaging agents
that show selective cytotoxicity against proliferating cells are used in
chemotherapy regimens [22, 23].
We examined the effects of two apoptosis inducers, shikonin
and evodiamine, isolated from traditional herbal medicines, on
DSB formation. Shikonin was discovered from the roots of Lithos-
permum erythrorhizon [24]. Although the molecular mechanism by
which it induces apoptosis is not fully understood, it has been
reported that shikonin might act as a proteasome inhibitor, rather
than as an inhibitor of DNA metabolism or as a DNA damaging
agent [25–27]. Therefore, it is likely that the inhibitory effect of
shikonin on proteasome function might induce apoptosis
[28]. Meanwhile, evodiamine, extracted from the genus Tetra-
dium, is used as a dietary supplement [29]. Reportedly, high
doses of evodiamine induce apoptosis [30]. Since evodiamine
shows an inhibitory effect on DNA topoisomerase in vitro, this
might be involved in the induction of apoptosis [31, 32]. Treatment
with topoisomerase poisons could induce the accumulation of
DSBs which occurs independently during apoptotic chromosomal
DNA fragmentation [33, 34]. Therefore, it is widely believed that
DSBs introduced by topoisomerase poisons cause apoptosis. Inter-
estingly, the accumulation of DSBs induced by topoisomerase was
suppressed by cotreatment with a DNA replication inhibitor, aphi-
dicolin [35, 36]. Combining these features, we attempted to dis-
tinguish chromosomal DNA fragmentation induced by apoptosis
from DSB induced by DNA damaging agents. Cells treated with
shikonin accumulated DSBs, which were suppressed by cotreat-
ment with Z-VAD-FMK, but not with aphidicolin (Fig. 1). This
Chromosomal DNA Fragmentation in Apoptosis 91
Fig. 1 Analysis of the accumulations of DSBs after cotreatments of shikonin with either aphidicolin or Z-VAD-
FMK by PFGE
suggests that shikonin-induced DSBs are the result of chromo-

somal DNA fragmentation during apoptosis. While treatment
with evodiamine also resulted in the formation of DSBs, it was
completely suppressed by cotreatment with aphidicolin; however,
cotreatment with Z-VAD-FMK led to the loss of only fragments
smaller than 500 kb (Fig. 2). Since the majority of DSBs, larger
than 500 kb fragments, induced by treatment with evodiamine still
remained after cotreatment with Z-VAD-FMK, evodiamine-
induced DSB formation must occur independently of apoptosis.
In this chapter, we describe the strategy for analyzing chromosomal
breakages in mammalian cells using a PFGE with RGE system.
2 Materials
2.1 Tissue Culture 1. Dulbecco’s modified Eagle medium (DMEM) with 10% fetal
and Drug Treatment bovine serum (FBS). Stored at 4 C.
2. HeLa cells.
3. 10 mM shikonin, an apoptosis inducer, dissolved in dimethyl
sulfoxide (DMSO) and stored at 20 C.
Fig. 2 Analysis of the accumulations of DSBs after cotreatments of evodiamine with either aphidicolin or Z-
VAD-FMK by PFGE
4. 10 mM aphidicolin, a DNA replication inhibitor, dissolved in

DMSO and stored at 20 C
5. 10 mM Z-VAD-FMK, a caspase inhibitor, dissolved in DMSO
and stored at 20 C.
2.2 Preparation 1. Dulbecco’s phosphate buffer saline ( ) (D-PBS) (WAKO).

of Plugs for PFGE 2. 0.5% trypsin–ethylenediamine tetraacetate (EDTA)
3. DMEM with 10% FBS.
4. Cell counter.
5. 1% agarose for plug preparation. Add 1 g of PFGE grade
agarose to 100 mL of pure water. Melt agarose by heating
using microwave when you prepare the plugs.
6. Plug mold (Bio-Rad cat # 1703713).
7. Lysis Buffer: 1% (w/v) sodium lauryl sarcosinate, 0.2% (w/v)
sodium deoxycholate, 100 mM EDTA, and 0.25 mg/mL pro-
teinase K (see Note 1).
8. TE buffer for PFGE: 10 mM Tris–Cl (pH 8.0), 100 mM
EDTA. Measure 10 mL of 1 M Tris–Cl (pH 8.0) and
200 mL of 0.5 M EDTA, pH8.0, and transfer to a glass beaker.
Make up to 1 L with ultrapure water.
2.3 Running PFGE 1. Biometra’s PFGE apparatus set.

2. 10 TBE buffer. Add 500 mL of water and 40 mL of 0.5 M
EDTA, pH8.0, in a glass beaker. Weigh 108 g of Tris and 55 g
of boric acid, and transfer to diluted EDTA solution. Dissolve
Tris and boric acid. Make up to 1 L with pure water. Store at
room temperature.
3. 0.9% Agarose gel in 0.25 TBE. Add 10 mL of 10 TBE
buffer and 390 mL of pure water in a beaker. Weigh 3.6 g of
PFGE-grade agarose and transfer to the 0.25 TBE buffer.
Melt agarose using microwave.
4. Running buffer for PFGE: 0.25 TBE. Mix 60 mL of 10
TBE buffer and 2340 mL of cold pure water. Keep it at 4 C.
5. Staining buffer: 0.5 μg/mL ethidium bromide in 0.25 TBE.
After PFGE, measure 500 mL of running buffer and add 25 μL
of 10 mg/mL ethidium bromide solution.
6. Plastic container.
3 Methods
3.1 Sample 1. Prepare 50–80% confluent cells on the culture dish (see Note
Preparation for PFGE 2).
2. Treatment with an apoptosis inducer. Treat the cells with
10 μM shikonin or 10 μM evodiamine, which are known apo-
ptosis inducers, and incubate for 24 h. Also, cotreat the cells
with 10 μM aphidicolin or 10 μM Z-VAD-FMK.
3. After incubation, collect culture medium in a 50 mL tube (see
Note 3).
4. Wash cells twice with 10 mL of D-PBS. PBS used for washing
cells should be collected in the same tube as the medium.
5. Add 1 mL of 0.25% trypsin-EDTA and incubate at 37 C for
2 min. When cells come off the plate, add 4 mL of culture
medium (DMEM with 10% FBS), and prepare cell suspension
by pipetting. Then, collect cell suspension in the 50 mL tube.
6. Centrifuge at 450 g for 5 min. Discard supernatant. Resus-
pend cell pellets in 5 mL D-PBS.
7. Count the number of cells using the cell counter. Typically, this
should be approximately 50–150 104 cells/mL.
8. Centrifuge 450 g for 5 min. Discard supernatant. Resuspend
cell pellets in D-PBS. The final cell concentration should be
adjusted to 5 105 per 100 μL.
9. Melt 1% PFGE-grade agarose using the microwave.
10. Prepare plugs. Mix the same volume of cell suspension as
melted 1% agarose and pour the mixed sample into the plug
mold. Leave the plugs at room temperature or at 4 C until

agarose is set (see Note 4).
11. Incubate the plugs in 1 mL of lysis buffer at 37 C overnight.
We usually perform this step in 2 mL sample tubes (see Note 5).
12. After overnight incubation, plugs are ready to be analyzed with
PFGE (see Note 6) (Fig. 3).
3.2 PFGE Using 1. Preparation of 0.9% agarose gel with 0.25 TBE. Set the
Biometra’s Apparatus Biometra’s PFGE gel tray. We usually use the large frame
(20 20 cm; 400 mL gel). Weigh 3.6 g of PFGE grade agarose
and transfer it to 400 mL of 0.25 TBE. Melt agarose by
heating using microwave and dissolve it completely. Leave
agarose gel solution at room temperature until its temperature
drops to around 50 C.
2. When the temperature of agarose gel solution reaches approxi-
mately 50 C, pour the agarose gel solution into the gel frame.
An important point is not to pour the entire agarose gel
solution. Leave 10–20 mL of agarose gel solution in the beaker
for closing the wells in a later step.
3. Load plugs in the agarose gel. First, fill the wells with TE for
PFGE (Fig. 4a). Instead of TE for PFGE, you can also use
0.25 TBE buffer. Second, slide the plugs into the wells. We
use a microscope coverslip to slide plugs along into the wells
(Fig. 4b). Third, after loading the samples, remove the TE
buffer as much as possible. Finally, close all wells with melted
agarose gel (Fig. 4c) (see Note 7).
4. Remove the frame of the agarose gel. Then, place it into the
PFGE apparatus.
5. Turn on the cooling system. Add 2.4 L of 0.25 TBE buffer
(see Note 8).
6. Perform PFGE with Biometra’s apparatus. Set the parameters
described below (see Note 9).
Temperature: 13 C.
Time: 23 h.
Voltage: 180 V to 120 V log.
Angle: 120 to 110 lin.
Pulse: 30 s to 5 s log.
Buffer: 0.25 TBE buffer 2.4 L.
No inverse.
7. After the electrophoresis, transfer the gel into the plastic con-
tainer. Then, add staining buffer. The gel is stained overnight.
If necessary, destain the gel with 0.25 TBE buffer (see
Note 10).
Fig. 3 Titration of cell number for the detection of chromosomal DNA fragmen-
tation in apoptosis in HeLa cells. (a) Untreated control. (b) Cells were treated with
10 μM shikonin for 24 h
Fig. 4 Procedures for loading plugs on agarose gel. (a) Fill the wells with TE for PFGE. (b) Slide the plugs into
the wells across a coverslip for microscopy. (c) Close all the wells with melted agarose gel
8. Analyze the EtBr-stained gel with the typhoon FLA7000 scan-

ner. If necessary, the bands on the gel can be quantified with a
software, such as ImageQuant (GE Healthcare).
4 Notes
1. Add 700 mL of ultrapure water and 200 mL of 0.5 M EDTA

into a glass beaker. Weigh 10 g of sodium lauryl sarcosinate and
2 g of sodium deoxycholate and transfer to the diluted EDTA
solution. Dissolve sodium lauryl sarcosinate and sodium deox-
ycholate. Make it up to 1 L with water. This solution can be
stored at room temperature. Proteinase K should be added just
before use. Prepare 10 mg/mL Proteinase K in pure water. The
10 mg/mL Proteinase K solution should be stored at 20 C.
When you use the lysis buffer, 975 μL of lysis buffer and 25 μL
of 10 mg/mL proteinase K should be mixed in a 2 mL
sample tube.
2. As shown in Fig. 3, suitable cell density is 3 105 cells per lane

if you use ethidium bromide-staining to detect DNA. There-
fore, cells which tend to grow to a high density, such as mouse
ES cells, HeLa cells, and HepG2, can be grown on 3 cm, 6 cm,
or 10 cm dishes. 12-well and 6-well dishes are also applicable.
Relatively large cells, such as mouse embryonic fibroblasts
(MEFs), human primary fibroblasts, and TERT-transformed
fibroblasts, should be grown on 10 cm or 15 cm dishes.
Here, 50% confluent HeLa cells were prepared on a 10 cm
dish, cultured in 10 mL of DMEM with 10% FBS.
3. After the incubation, whole cells should be collected. Cells
which are no longer attached to the plate are classified as
dying and dead cells. To detect chromosomal DNA fragmenta-
tion during apoptosis, culture medium containing dying and
dead cells should be collected. We usually use a 50 mL tube for
collecting medium. On the other hand, if you would like to
detect DNA damage-induced DSBs, discard the medium and
D-PBS. After treatment with trypsin-EDTA, add fresh medium
with 10% FBS and collect cell suspensions in a 15 mL tube.
4. Using the plug mold (BIORAD cat # 1703713), plugs should
be prepared. Since the volume of one plug is 80 μL, mix 50 μL
of cell suspension and 50 μL of 1% agarose, and pour the mixed
sample on the plug mold. Then the final cell density is
2.5 105 per plug in 0.5% agarose plugs. Leave the plugs at
room temperature or at 4 C until agarose is set.
5. The original protocol was that cells were lysed in 5 mL of lysis
buffer with 1 mg/mL proteinase K at 50 C for 48 h. This also
works but requires more proteinase K and a longer
incubation time.
6. If you would like to store samples, it is better to replace the TE
buffer with PFGE. You can keep plugs at 4 C for several
months. However, NEVER freeze the plugs.
7. In the original protocol for PFGE, plugs should be washed
with TE. Typically, they are washed four times with 5 mL of TE
for 15 min. However, as long as you use Biometra’s apparatus,
it is not necessary to wash the plugs with TE. Plugs incubated
with lysis buffer can be directly loaded on the agarose gel.
8. During PFGE, the running buffer should be kept at 13 C.
However, even if the initial temperature is slightly lower than
13 C, it usually does not cause any problems. Therefore,
prepare ice cold running buffer (0.25 TBE).
9. It takes approximately 26 h to complete this electrophoresis.
10. In our hands, ethidium bromide-staining of PFGE gel is less
efficient compared to staining a regular agarose gel. For higher
sensitivity, use either Cyber-green or Cyber-gold.
Acknowledgments
We would like to thank Editage (www.editage.jp) for English lan-

guage editing. This research was supported by a Grant-in-Aid for
the Cooperative Research Project from Institute of Natural Medi-
cine, University of Toyama in 2014 and by JSPS KAKENHI Grant
Number 16 K07119 to T. T. and 17 K08339 to T. I.
References
1. Liu X, Zou H, Slaughter C, Wang X (1997) degradation during apoptosis. J Biol Chem
DFF, a heterodimeric protein that functions 280(42):35670–35683
downstream of caspase-3 to trigger DNA frag- 10. Widlak P, Garrard WT (2009) Roles of the
mentation during apoptosis. Cell 89 major apoptotic nuclease-DNA fragmentation
(2):175–184 factor-in biology and disease. Cell Mol Life Sci
2. Enari M, Sakahira H, Yokoyama H, Okawa K, 66(2):263–274
Iwamatsu A, Nagata S (1998) A caspase- 11. Slee EA, Zhu H, Chow SC, MacFarlane M,
activated DNase that degrades DNA during Nicholson DW, Cohen GM (1996) Benzylox-
apoptosis, and its inhibitor ICAD. Nature ycarbonyl-Val-Ala-asp (OMe) fluoromethylke-
391(6662):43–50 tone (Z-VAD.FMK) inhibits apoptosis by
3. Rogakou EP, Boon C, Redon C, Bonner WM blocking the processing of CPP32. Biochem J
(1999) Megabase chromatin domains involved 315(Pt 1):21–24
in DNA double-strand breaks in vivo. J Cell 12. Garcia-Calvo M, Peterson EP, Leiting B,
Biol 146(5):905–916 Ruel R, Nicholson DW, Thornberry NA
4. Hanada K, Budzowska M, Davies SL, van (1998) Inhibition of human caspases by
Drunen E, Onizawa H, Beverloo HB, peptide-based and macromolecular inhibitors.
Maas A, Essers J, Hickson ID, Kanaar R J Biol Chem 273(49):32608–32613
(2007) The structure-specific endonuclease 13. Shimizu T, Pommier Y (1997) Camptothecin-
Mus81 contributes to replication restart by induced apoptosis in p53-null human leukemia
generating double-strand DNA breaks. Nat HL60 cells and their isolated nuclei: effects of
Struct Mol Biol 14(11):1096–1104 the protease inhibitors Z-VAD-fmk and
5. Eppink B, Tafel AA, Hanada K, van Drunen E, dichloroisocoumarin suggest an involvement
Hickson ID, Essers J, Kanaar R (2011) The of both caspases and serine proteases. Leuke-
response of mammalian cells to UV-light mia 11(8):1238–1244
reveals Rad54-dependent and independent 14. Lundin C, Erixon K, Arnaudeau C, Schultz N,
pathways of homologous recombination. Jenssen D, Meuth M, Helleday T (2002) Dif-
DNA Repair (Amst) 10(11):1095–1105 ferent roles for nonhomologous end joining
6. Elmore S (2007) Apoptosis: a review of pro- and homologous recombination following rep-
grammed cell death. Toxicol Pathol 35 lication arrest in mammalian cells. Mol Cell
(4):495–516 Biol 22(16):5869–5878
7. Sakahira H, Iwamatsu A, Nagata S (2000) Spe- 15. Hansen LT, Lundin C, Spang-Thomsen M,
cific chaperone-like activity of inhibitor of Petersen LN, Helleday T (2003) The role of
caspase-activated DNase for caspase-activated RAD51 in etoposide (VP16) resistance in small
DNase. J Biol Chem 275(11):8091–8096 cell lung cancer. Int J Cancer 105(4):472–479
8. Sakahira H, Enari M, Nagata S (2015) Corri- 16. Hanada K, Budzowska M, Modesti M, Maas A,
gendum: cleavage of CAD inhibitor in CAD Wyman C, Essers J, Kanaar R (2006) The
activation and DNA degradation during apo- structure-specific endonuclease Mus81-Eme1
ptosis. Nature 526(7575):728 promotes conversion of interstrand DNA
9. Yuste VJ, Sanchez-Lopez I, Sole C, Moubarak crosslinks into double-strands breaks. EMBO
RS, Bayascas JR, Dolcet X, Encinas M, Susin J 25(20):4921–4932
SA, Comella JX (2005) The contribution of 17. Chu WK, Payne MJ, Beli P, Hanada K,
apoptosis-inducing factor, caspase-activated Choudhary C, Hickson ID (2015) FBH1
DNase, and inhibitor of caspase-activated influences DNA replication fork stability and
DNase to the nuclear phenotype and DNA homologous recombination through ubiquity-
lation of RAD51. Nat Commun 6:5931
18. Abraham J, Lemmers B, Hande MP, Moyna- sensitivity of gastric cancer through reactive
han ME, Chahwan C, Ciccia A, Essers J, oxygen species. Sci Rep 6:38267
Hanada K, Chahwan R, Khaw AK, 28. Yang H, Zhou P, Huang H, Chen D, Ma N,
McPherson P, Shehabeldin A, Laister R, Cui QC, Shen S, Dong W, Zhang X, Lian W,
Arrowsmith C, Kanaar R, West SC, Jasin M, Wang X, Dou QP, Liu J (2009) Shikonin exerts
Hakem R (2003) Eme1 is involved in DNA antitumor activity via proteasome inhibition
damage processing and maintenance of geno- and cell death induction in vitro and in vivo.
mic stability in mammalian cells. EMBO J 22 Int J Cancer 124(10):2450–2459
(22):6137–6147 29. Zhao Z, He X, Han W, Chen X, Liu P, Zhao X,
19. McPherson JP, Lemmers B, Chahwan R, Wang X, Zhang L, Wu S, Zheng X (2019)
Pamidi A, Migon E, Matysiak-Zablocki E, Genus Tetradium L.: a comprehensive review
Moynahan ME, Essers J, Hanada K, on traditional uses, phytochemistry, and phar-
Poonepalli A, Sanchez-Sweatman O, macological activities. J Ethnopharmacol
Khokha R, Kanaar R, Jasin M, Hande MP, 231:337–354
Hakem R (2004) Involvement of mammalian 30. Fang C, Zhang J, Qi D, Fan X, Luo J, Liu L,
Mus81 in genome integrity and tumor sup- Tan Q (2014) Evodiamine induces G2/M
pression. Science 304(5678):1822–1826 arrest and apoptosis via mitochondrial and
20. Hoeijmakers JH (2009) DNA damage, aging, endoplasmic reticulum pathways in H446 and
and cancer. N Engl J Med 361 H1688 human small-cell lung cancer cells.
(15):1475–1485. https://doi.org/10.1056/ PLoS One 9(12):e115204
NEJMra0804615 31. Pan X, Hartley JM, Hartley JA, White KN,
21. Terabayashi T, Hanada K (2018) Genome Wang Z, Bligh SW (2012) Evodiamine, a dual
instability syndromes caused by impaired catalytic inhibitor of type I and II topoisome-
DNA repair and aberrant DNA damage rases, exhibits enhanced inhibition against
responses. Cell Biol Toxicol 34(5):337–350 camptothecin resistant cells. Phytomedicine
22. Guainazzi A, Scharer OD (2010) Using syn- 19(7):618–624
thetic DNA interstrand crosslinks to elucidate 32. Lee YC, Lee CH, Tsai HP, An HW, Lee CM,
repair pathways and identify new therapeutic Wu JC, Chen CS, Huang SH, Hwang J, Cheng
targets for cancer chemotherapy. Cell Mol KT, Leiw PL, Chen CL, Lin CM (2015) Tar-
Life Sci 67(21):3683–3697 geting of topoisomerase I for prognoses and
23. Hühn D, Bolck HA, Sartori AA (2013) Target- therapeutics of Camptothecin-resistant ovarian
ing DNA double-strand break signalling and Cancer. PLoS One 10(7):e0132579
repair: recent advances in cancer therapy. 33. Sakasai R, Iwabuchi K (2016) The distinctive
Swiss Med Wkly 143:w13837 cellular responses to DNA strand breaks caused
24. Efferth T, Miyachi H, Bartsch H (2007) Phar- by a DNA topoisomerase I poison in conjunc-
macogenomics of a traditional Japanese herbal tion with DNA replication and RNA transcrip-
medicine (Kampo) for cancer therapy. Cancer tion. Genes Genet Syst 90(4):187–194
Genomics Proteomics 4(2):81–91 34. Kawashima Y, Yamaguchi N, Teshima R,
25. Wu Z, Wu LJ, Li LH, Tashiro S, Onodera S, Narahara H, Yamaoka Y, Anai H, Nishida Y,
Ikejima T (2004) Shikonin regulates HeLa cell Hanada K (2017) Detection of DNA double-
death via caspase-3 activation and blockage of strand breaks by pulsed-field gel electrophore-
DNA synthesis. J Asian Nat Prod Res 6 sis. Genes Cells 22(1):84–93
(3):155–166 35. Ryan AJ, Squires S, Strutt HL, Johnson RT
26. Wu Z, Wu L, Li L, Tashiro S, Onodera S, Ike- (1991) Camptothecin cytotoxicity in mamma-
jima T (2004) p53-mediated cell cycle arrest lian cells is associated with the induction of
and apoptosis induced by shikonin via a cas- persistent double strand breaks in replicating
pase-9-dependent mechanism in human malig- DNA. Nucleic Acids Res 19(12):3295–3300
nant melanoma A375-S2 cells. J Pharmacol Sci 36. Hawtin RE, Stockett DE, Wong OK,
94(2):166–176 Lundin C, Helleday T, Fox JA (2010) Homol-
27. Liang W, Cai A, Chen G, Xi H, Wu X, Cui J, ogous recombination repair is essential for
Zhang K, Zhao X, Yu J, Wei B, Chen L (2016) repair of vosaroxin-induced DNA double-
Shikonin induces mitochondria-mediated apo- strand breaks. Oncotarget 1(7):606–619
ptosis and enhances chemotherapeutic
Chapter 9
Detection of DNA Damage-Induced DSBs by

the Contour-Clamped Homogeneous Electric Field (CHEF)
System in Mammalian Cells
Yuri Takiguchi, Ryo Kariyazono, and Kunihiro Ohta
Abstract
Double-strand breaks (DSBs) and their repair mechanisms are essential for normal cell life. However,
quantitative analysis of DSBs on mammalian whole chromosomes remains difficult. The method described
here enables the quantitative detection of mammalian chromosomal DSBs by pulsed-field gel electropho-
resis (PFGE) using a contour-clamped homogeneous electric field (CHEF). We illustrate this method by
measuring DNA damage-induced DSBs in mammalian cells. The electrophoresis conditions presented here
enabled the visualization of fragmented DNA (several mega-base pairs down to 500 kbp) as a single band.
Using this protocol, about 10–45 samples can be analyzed on a single gel, depending on the direction of
electrophoresis.
Key words DNA double-strand break (DSB), DNA damage, Pulsed-field gel electrophoresis (PFGE),
Contour-clamped homogeneous electric field (CHEF)
1 Introduction
DNA double-strand breaks are toxic lesions that can lead to chro-
mosomal abnormalities and cell death [1]. While DSB-inducing
radiation and some anticancer drugs are designed to take advantage
of this cellular toxicity [2], DSBs may also occur endogenously
during the replication process due to the activity of endonucleases
involved in DNA repair mechanisms [3, 4].
Reliable methods for the quantification of DSBs are necessary
to assess the effectiveness of anticancer treatments and DNA repair
mechanisms. Previous methods to evaluate DSBs such as the comet
assay or pulsed field gel electrophoresis (PFGE), make use of
immunofluorescent (IF) staining of DNA damage response pro-
teins such as γ-H2AX, 53BP1, or RAD51 [1]. While the IF focus
assay has been widely used to detect DNA DSBs, a precise quanti-
tative evaluation of IF foci remains technically challenging in terms
of resolution and sensitivity [5]. Both the comet assay [6] and
101
102 Yuri Takiguchi et al.
PFGE are electrophoresis-based DNA fractionation methods, but

PFGE provides information on the length of the broken DNA
fragment, and may be combined with downstream quantitative
analysis, such as immunoblotting or Southern blotting [1].
PFGE is an agarose gel electrophoresis designed for the sepa-
ration of huge DNA molecules up to 12 mega-base pairs (Mbp)
[7]. The direction of the electric current varies in pulses, causing
the DNA molecules to migrate according to a zigzag motion inside
the gel [8]. The size of human chromosomes is about 50–280 Mb
(e.g., chromosome-21: 45 Mb, chromosome-1: 279 Mb) [9];
therefore, individual intact human chromosomes cannot be sepa-
rated and analyzed like those of microorganisms such as yeasts and
bacteria.
Over time, a variety of PFGE-based equipment was developed,
including CHEF (contour-clamped homologous electric field)
[10], TAFE (transverse alternating field electrophoresis) [11], and
RGE (rotating-clamped homogeneous electric field) [12] with the
CHEF system being most prevalent [10, 13]. Here, we describe a
method to detect DSBs in mammalian cells as damage-induced
DNA fragments using the PFGE-CHEF system, based on the
CHEF system as described in Zellweger et al. [14]. The electro-
phoresis program presented here was optimized so that intact DNA
remains in the well (start position), while broken DNA fragments
(ranging from 0.5 to several Mbp) migrate as a single band [3, 4]
(Fig. 1), which can be easily quantified by image quantifying
devices. Moreover, this PFGE method is able to detect DSBs
selectively without detecting single-stranded DNA breaks [4]. We
demonstrate representative results of this method by detecting
DNA damage in a human cell line.
2 Materials
Prepare all solutions using ultrapure water.
2.1 Cell Culture 1. Mammalian cell line of interest cultured in the appropriate
and Treatment medium (see Note 1). In this protocol, we used human cell
with DNA Damage line HeLa.
Agents 2. HeLa was cultured in DMEM which contains 10% FBS.
3. Damage agent(s) of interest, such as anticancer drugs, and/or
irradiation treatment.
4. PBS(): purchase ready-made mix, or prepare a filter-sterilized
solution (8.0 g/L NaCl, 0.2 g/L KCl, 1.44 g/L Na2HPO4,
0.24 g/L KH2PO4, pH 7.4).
2.2 Buffers 1. Low melting-point (LMP) agarose: PFGE-grade LMP agarose,

such as Certified™ Megabase agarose (Bio-Rad).
Detection of DNA Damage-Induced DSBs by the Contour-Clamped Homogeneous. . . 103
A B VP16
Marker 0 5 10 20 (µM)
Direction of electrophoresis
565-2200
450
365
285
Electrophoresis
225
(kbp)
Intact DNA
Fragmented DNA
Fig. 1 PFGE analysis for DSB formation in mammalian cells. (a) Detection of broken DNA by PFGE. This PFGE
protocol enables the detection of DNA fragments in mammalian cells as a single band with a length of
565–2200 kbp. (b) Representative examples of DNA fragments in VP16-treated HeLa cells. Size maker bands
(Bio-Rad, #1703605) corresponds to 225, 285, 365, 450, and > 565 kbp (565, 610, 680, 750, 785, 825,
945, 1020, 1125, 1600, and 2200 kbp), respectively. DNA fragments of 565–2200 kbp are compacted into a
single band. Human HeLa cell line was treated with VP16 (0, 5, 10, 20 μM) for 24 h and electrophoresed for
21 h by CHEF Mapper™. The gel was stained with SYBR® Green and scanned using ImageQuant LAS 4000
mini (GE Healthcare). Each plug contains about 2.5 105 cells. The arrowhead indicates the band for
fragmented DNA migrated at the position of the >565 kbp band
2. 1% LMP agarose gel stock: dissolve and melt 1% LMP agarose

in H2O (see Note 2).
3. Premix lysis buffer: 100 mM EDTA (pH 8.0), 1% (w/v)
sodium lauryl sarcosine, 0.2% (w/v) sodium deoxycholate.
4. Proteinase K stock solution (10): 10 Proteinase K (Wako)
stock solution (10 mg/mL) can be stored at 20 C. Dissolve
10 mg of Proteinase K powder in 1 mL of H2O. Thaw an
aliquot of 10 Proteinase K stock solution immediately
before use.
5. TE buffer: 10 mM Tris–HCl (pH 8.0) containing
1 mM EDTA.
2.3 Pulsed-Field Gel 1. TBE buffer (5): dissolve 54 g of Tris base and 27.5 g boric
Electrophoresis acid in 950 mL, add 20 mL of 0.5 M EDTA (pH 8.0), and
and Imaging fill up to 1 L with H2O. Working solution is 0.25 TBE (see
Note 3).
2. CHEF disposable plug mold® (Bio-Rad).
3. Gel casting stand (Bio-Rad) for running gel.
4. Instrument for CHEF system. The CHEF Mapper® XA System

(Bio-Rad) is used in our experiments; however, any CHEF-
based devices can be used after slightly adjusting the
conditions.
5. DNA detection: Ethidium bromide (final 1 μg/mL) or any
other kind of DNA staining agent.
6. Any image quantifying device available in your laboratory.
3 Methods
We analyze damage-induced DSBs in mammalian cells after treat-

ment by damage inducers such as anticancer drugs or irradiation.
3.1 Cell Culture 1. Culture cells in 100 mm tissue culture dish containing 10 mL
and Induction of DSBs of appropriate medium until they reach subconfluency.
2. Add DNA damage agents of interest at several different con-
centrations (see Note 4).
3.2 Preparation 1. Discard the medium and wash cells once with PBS() to
of Agarose Sample remove apoptotic cells. Cells are harvested after trypsinization
Plugs at 37 C for a few minutes. Culture medium (without damage
agent) was then added to collect the cell suspension.
2. Centrifuge at 1000 g for 3 min and carefully remove the
supernatant. Resuspend the pellet in 5 mL of PBS(). During
these steps, make sure the pipetting is gentle enough to avoid
cell damage.
3. Assess cell concentration using a hemocytometer, centrifuge at
1000 g for 3 min, and dilute the cell suspension with PBS()
to 5 105 cells/mL. A minimum of 50 μL of this cell suspen-
sion (2.5 105 cells) is needed per plug. Avoid applying too
much cells per plug, as an excess of protein may interfere with
band separation during electrophoresis (cf. Fig. 2). The opti-
mal value is 1–5 105 cells per plug.
4. Melt the 1% agarose gel solution and keep it 60 C. Quickly add
180 μL of the cell suspension as described above into an equal
amount of melted 1% gel solution in 1.5 mL microtubes pre-
warmed at 55 C, followed by gentle pipetting several times (see
Note 5).
5. Insert the appropriate amount (depending on the plug mold
size, in our case 85–90 μL) of the gel-cell suspension solution
into one well of a plug mold. Please note that the gel shrinks in
size after solidification, hence apply an excess amount of the
solution into each well. Plugs may be kept on ice until complete
gelation.
VP16 20μM NT
A B
NT 103 104 105 106 (cells) 103 104 105 106 (cells)
Fig. 2 Dependence of DSB band intensity on cell number in each well. Both gels
were stained with ethidium bromide, and visualized using an ultraviolet
(UV) illuminator AE-6932GXES (ATTO, Japan). Note that too many cells resulted
in the appearance of smeared bands due to an excess of protein. (a) Hela cells
were treated with 20 μM of VP16 for 24 h. Plugs contained 1.25 103–106
cells, respectively. (b) Nontreated (NT) cells. Each plug contained
1.25 103–106 cells
6. Prepare lysis solution by mixing 900 μL of Premix lysis buffer

and 100 μL of 10 Proteinase K solution thawed immediately
before use. Then incubate the sample plugs at 37 C for 48 h in
the lysis solution. The maximum recommended number of
plugs for 1 mL of lysis buffer is 4.
7. Wash the plugs three times in the TE buffer. Each plug should
be stored at 4 C in at least 0.5 mL of TE buffer. Do not freeze
the plugs.
3.3 Pulsed Field Gel 1. At first, prewash the chamber. Fill the electrophoresis chamber
Electrophoresis with 2.2 L of 0.25 TBE and turn on the pump at speed 70.
Using CHEF Circulate and refresh the buffer through the electrophoresis
chamber, tubes, and pump for at least 20 min. Discard the
buffer and repeat the wash with 2.2 L of 0.25 TBE. Then
turn off the pump and drain the buffer.
2. Preparation of casting gel. Microwave 0.9% (w/v) Certified™
Megabase agarose in 0.25 TBE buffer until the agarose is
melted completely and let the gel solution cool down by gentle
stirring. When the temperature dropped to 50–60 C, pour it
into the gel casting stand carefully to avoid air bubble
formation.
3. When the gel is completely set, carefully remove the comb and
insert the washed plugs into the bottom of wells. Before
Fig. 3 Schematic diagram of the standard setting of included angle 120 . The left panel shows the standard
gel setting which uses the shorter axis of gel for plug loading. The right panel shows a schematic presentation
of included angle 120 . It can be divided into +60 and 60 . This figure is modified from the “CHEF Mapper®
XA PFGE System Instruction Manual and Application Guide, Page 4 and 20. (Bio-Rad Laboratories, Inc.)”
insertion into each well, the plug mold should be divided into
half using a spatula. Then, pour melted previous 0.9% (w/v)
agarose solution above the well to fill in the gaps while avoiding
air bubble formation.
4. Remove the side parts of the gel casting stand and place the gel
on the center concavity of the electrophoresis chamber. Grad-
ually fill the electrophoresis chamber with 2.2 L of 0.25 TBE.
Then turn on the pump and the chiller system. Set the chiller
temperature to 14 C (see Note 6).
5. The setting of the CHEF system is as described in Zellweger
et al. [14]. A schematic representation of the included angles is
described in Fig. 3.
BlockI: 9 h, 120 included angle (State 1: + 60 , State 2:
60 ), 5.5 V/cm, 30 to 18-s switch.
BlockII: 6 h, 117 included angle (State 1: +58.5 , State 2:
58.5 ), 4.5 V/cm, 18 to 9-s switch.
BlockIII: 6 h, 112 included angle (State 1: +56 , State 2:
56 ), 4.0 V/cm, 9 to 5-s switch.
Included angle 120 can be divided to +60 and 60 (see
Fig. 3).
Precise procedure for CHEF (see Note 7).
6. After the electrophoresis, gently pick up the gel, then stain in
200 mL of 1 μg/mL ethidium bromide or equivalent fluores-
cent staining agent until bands are clearly detectable by UV or
fluorescence. It takes 1–2 h for the gel to be stained with
ethidium bromide (see Note 8). 5 min rinse by H2O will
make it clear.
7. Analyze the gel with any available image quantifying device.

8. Following this step, immunoblotting or Southern blotting may
enable quantitative analysis. Procedure of quantitative analysis
is described in Kawashima et al. [1].
3.4 Scaling The CHEF Mapper can analyze more samples (up to 45 plugs), if
up the Experimental the samples are loaded in the wells along the longer axis of the gel.
Process
1. Since the setting position of the casting gel is fixed, the angles
of electric current should be modified as described below.
2. Change the angle, with the other settings the same as described
in Subheading 3.3.
Block I: 9 h, 120 included angle (+30 , +150 ),
5.5 V/cm, 30 to 18-s switch.
Block II: 6 h, 117 included angle (+31.5 , +148.5 ),
Block III: 6 h, 112 included angle (+34 , +146 ),
The input of the two state angles should fit the following
equation and Fig. 4.
State1 ¼ ð180included angleÞ=2, State2
∘
¼ 180State1, ðState1 þ State2 ¼ 180 Þ:
Fig. 4 Schematic diagram for plug application along the longer axis of the gel. The left panel shows the
position of the gel. The right panel shows schematic indication of setting of electric current with included angle
120 . In this case, included angle 120 should be divided into +30 and + 150 . State1 and State2 have the
same vector as State1’ and State2’, respectively. State1’ + State2’ ¼ 180
4 Notes
1. Mouse ES cells, SV40 transformed human fibroblast cell lines,

CHO cell lines, HeLa and HEK293 are appropriate for this
assay. Nonadherent cells easily enter apoptosis when exposed to
DNA damage agents, and the DNA of apoptotic cells may be
detected as a smeared band. In this protocol, we used human
cell line HeLa as an example.
2. Mix 1 g of LMP agarose with 100 mL of H2O in a 500 mL
glass flask as a solid gel and heat the mixture before use by
microwave.
3. In this protocol, we use a 1/4th dilution of the standard TBE
buffer.
4. For VP16 treatment of human cell lines, a concentration of
5 μM to 20 μM for 24 h is optimal for DSB detection using this
method. See ref. Kawashima et al. [1] for other damage agents
and more information. An example of VP16 treatment is
shown in Fig. 1.
5. Three plugs can be prepared from this volume of cell suspen-
sion. Do not vortex.
6. It takes about 30 min for the gel temperature to settled at
14 C. Uniform cooling is essential to reduce smiling during
electrophoresis.
7. This setting is valid for the CHEF Mapper® XA System
(Bio-Rad).
(a) Start up the CHEF and select “MULTI STATE” mode.
(b) The screen shows “Program with interrupts?”—Select
“No.”
(c) Input “Block1 state01 5.5 V/cm, angle ¼ 60 , in
time ¼ 30s, final time ¼ 18 s, a ¼ linear.”
(d) The screen shows “Continue with another State (Vec-
tor)?”—Select “Yes.”
(e) Input “Block1 state 02 5.5 V/cm, angle ¼ 60 , in
time ¼ 30s. final time ¼ 18 s, a ¼ linear”.
(f) The screen shows “Continue with another Block?”—
Select “Yes.”
(g) Block2 state01 4.5 V/cm, angle ¼ 58.5 , in time ¼ 18 s,
final time ¼ 9 s, a ¼ linear. Next state.
(h) Block2 state02 4.5 V/cm, angle ¼ 58.5 , in time ¼ 18 s,
final time ¼ 9 s, a ¼ linear. Next block.
(i) Block3 state01 4.0 V/cm, angle ¼ 56 , in time ¼ 9 s, final
time ¼ 5 s, a ¼ linear. Next state.
(j) Block3 state02 4.0 V/cm, angle ¼ 56 , in time ¼ 9 s,

final time ¼ 5 s, a ¼ linear.
(k) The screen shows “Continue with another Block?”—
Select “No.”
(l) Setting is complete. Please push the “Start run” button.
8. Some DNA-binding fluorescent agents are more sensitive than
ethidium bromide: SYBR® Green or Gold (TAKARA). Opti-
mize conditions for each staining agent. To reduce the back-
ground, rinse the gel in H2O for 5 min after staining.
References
1. Kawashima Y, Yamaguchi N, Teshima R et al https://doi.org/10.1016/0092-8674(84)
(2017) Detection of DNA double-strand 90301-5
breaks by pulsed-field gel electrophoresis. 8. Herschleb J, Ananiev G, Schwartz DC (2007)
Genes Cells 22:84–93. https://doi.org/10. Pulsed-field gel electrophoresis. Nat Protoc
1111/gtc.12457 2:677–684. https://doi.org/10.1038/nprot.
2. Lord CJ, Ashworth A (2012) The DNA dam- 2007.94
age response and cancer therapy. Nature 9. Frazier M, Gibbs RA, Muzny DM et al (2001)
481:287–294. https://doi.org/10.1038/ Initial sequencing and analysis of the human
nature10760 genome. Nature 409:860–921. https://doi.
3. Hanada K, Budzowska M, Modesti M et al org/10.1038/35057062
(2006) The structure-specific endonuclease 10. Chu G, Vollrath D, Davis R (1986) Separation
Mus81-Eme1 promotes conversion of inter- of large DNA molecules by contour-clamped
strand DNA crosslinks into double-strands homogeneous electric fields. Science
breaks. EMBO J 25:4921–4932. https://doi. 234:1582–1585. https://doi.org/10.1126/
org/10.1038/sj.emboj.7601344 science.3538420
4. Hanada K, Budzowska M, Davies SL et al 11. Gardiner K, Patterson D (1989) Transverse
(2007) The structure-specific endonuclease alternating field electrophoresis and applica-
Mus81 contributes to replication restart by tions to mammalian genome mapping. Electro-
generating double-strand DNA breaks. Nat phoresis 10:296–302. https://doi.org/10.
Struct Mol Biol 14:1096–1104. https://doi. 1002/elps.1150100505
org/10.1038/nsmb1313 12. Southern EM, Anand R, Brown WRA, Fletcher
5. Vrouwe MG, Pines A, Overmeer RM et al DS (1987) A model for the separation of large
(2011) UV-induced photolesions elicit ATR- DNA molecules by crossed field gel electro-
kinase-dependent signaling in non-cycling cells phoresis. Nucleic Acids Res 15:5925–5943.
through nucleotide excision repair-dependent https://doi.org/10.1093/nar/15.15.5925
and -independent pathways. J Cell Sci 13. Nassonova ES (2008) Pulsed field gel electro-
124:435–446. https://doi.org/10.1242/jcs. phoresis: theory, instruments and applications.
075325 Tsitologiia 50:927–935. https://doi.org/10.
6. Olive PL, Banáth JP (2006) The comet assay: a 1134/S1990519X08060011
method to measure DNA damage in individual 14. Zellweger R, Dalcher D, Mutreja K et al
cells. Nat Protoc 1:23–29. https://doi.org/ (2015) Rad51-mediated replication fork rever-
10.1038/nprot.2006.5 sal is a global response to genotoxic treatments
7. Schwartz DC, Cantor CR (1984) Separation of in human cells. J Cell Biol 208:563–579.
yeast chromosome-sized DNAs by pulsed field https://doi.org/10.1083/jcb.201406099
gradient gel electrophoresis. Cell 37:67–75.
Chapter 10
Investigation of DNA Double-Strand Breaks Induced in Host

Cells Following Infection with Genotoxic Bacteria
Rie Teshima
Abstract
Carcinogenesis is caused by genome instability, one of the major causes of which is double-strand DNA
breaks (DSBs). Interestingly, infection by particular species of bacteria can induce DSBs in host cells. For
example, several reports suggest an association between periodontal disease and oral cancer. Aggregatibac-
ter actinomycetemcomitans, a common periodontal pathogen, causes DSBs in the host cell. Pulsed-field gel
electrophoresis (PFGE) is often used to identify DSBs in host cells. However, as established during
investigation of A. actinomycetemcomitans infection, it is often difficult to determine whether broken
DNA fragments are indeed from human chromosomes or whether they are bacterial in origin using
PFGE-based methods. Because the method involves the coculture of human cells with bacteria, both
bacterial and human DNA fragments may be present in the broken DNA fraction. To address this problem,
we have developed a method to detect only human chromosomal DNA upon PFGE analysis. Human
chromosomes were prelabeled with halogenated deoxyuridine (e.g., BrdU and IdU) before being fractio-
nated by PFGE and visualized by immunoblotting. As proof of concept, we successfully used this method to
investigate the mechanism of DSB formation in host chromosomes following infection with genotoxic
bacterial species.
Key words Double-strand breaks, Immunoblotting, Periodontal pathogens, PFGE, Aggregatibacter

actinomycetemcomitans
1 Introduction
The accumulation of genome instabilities is a major cause of carci-

nogenesis. Double-strand DNA breaks (DSBs) are one of the most
common causes of genome instability [1]. DSBs are typically
induced by endogenous and exogenous DNA-damaging agents
such as oxidative stress and DNA cross-linkers. Recently, infection
by some bacterial species has been shown to induce DSBs in host
cells. This suggests that infection by particular species of bacteria
may increase the risk of carcinogenesis. Although Helicobacter
pylori is probably the best known among these pathogens because
of its association with gastric cancer [2, 3], similar associations have
been made for other bacteria. For example, Salmonella typhus is
111
112 Rie Teshima
associated with gallbladder cancer [4], while Chlamydia trachoma-

tis is associated with cervical cancer [5]. Interestingly, all of these
bacteria can introduce DSB in host cells [6–8].
Several reports suggest that periodontal disease is a risk factor
for onset of oral squamous cell carcinoma [9, 10]. While various
species of oral bacteria are well-documented causative agents of
dental caries and periodontal disease, some of these pathogens are
also associated with more serious conditions such as infective endo-
carditis, aspiration pneumonia, meningitis, preterm birth, low birth
weight, and other systemic diseases. In addition, studies show that
chronic periodontitis increases the risk of oral cancer [9, 10]. Like
other gastrointestinal cancers, oral cancers arise as a result of the
combination of both chronic inflammation and accumulated geno-
mic instability, including mutations, deletions, inversions, duplica-
tions, translocations, and chromosomal loss. However, the
mechanism by which genomic instability accumulates in the gingiva
is poorly understood. We therefore hypothesized that infection by
specific periodontal pathogens could induce DSB in host cells,
which was validated by our discovery that Actinobacillus actinomy-
cetemcomitans (now called Aggregatibacter actinomycetemcomi-
tans) infection induced DSBs in host cells [11].
Pulsed-field gel electrophoresis (PFGE) is widely used in the
detection of DSBs. For the screening and characterization of gen-
otoxic compounds, simple DNA staining following PFGE is suffi-
cient. However, to study DSBs that arise in host cells following
infection with genotoxic bacteria, simple DNA staining cannot
distinguish between host and bacterial DNA fragments in the
broken DNA fractions [12]. To overcome this problem, we devel-
oped a method of distinguishing human DNA by immunoblotting
using halogenated deoxyuridines such as BrdU and IdU. Human
chromosomal DNA was prelabeled with one of these halogenated
deoxyuridines, for example IdU, for one replication time, resulting
in all of the human chromosomal DNA being labeled with IdU.
Host cells were then infected with unlabeled bacteria and, follow-
ing incubation, the accumulated DSBs were fractionated by PFGE.
The resulting DNA fragments were then transferred to a nylon
membrane. IdU-incorporated DNA fragments, corresponding to
human chromosomal DNA, were visualized by immunoblotting
using anti-BrdU antibody, which cross-reacts with IdU. Therefore,
while total DNA staining detects both human and bacterial DNA
fragments, this immunoblotting method only detects human DNA
fragments, allowing selective detection of DSBs that occur in
human cells as a result of infection with genotoxic bacteria
(Figs. 1 and 2).
We hope that this method will aid in further investigations of
genome instability induced by infection with genotoxic bacterial
species.
Investigation of DNA Double-Strand Breaks Induced in Host Cells Following. . . 113
Fig. 1 Schematic representation of this method. (a) Prelabeling human chromo-

somes: add 10 μM IdU in the medium, and incubate for at least one generation
time. (b) Infection: medium should be replaced to fresh medium without IdU
before infection, and then add the bacterial solution on human cell culture. (c)
Sample preparation: harvest the cell and prepare the plugs. Then load the plug
on the agarose gel, and perform PFGE. (d) Detection of total DNA: total DNA
staining is carried out with EtBr-staining. In this way, both human and bacterial
DNA fragments are detected. (e) Detection of human DNA by immunoblotting:
since only human DNA was prelabeled, IdU-signal represents only human DNA
114 Rie Teshima
Fig. 2 Detection of DSBs in host cells. The upper gel is the EtBr stained gel. This
represents total DNA including both bacterial and human DNAs. The lower gel is
immunoblotting against IdU. IdU-signal represents human DNAs
2 Materials
2.1 Cell and Bacterial 1. Dulbecco’s modified Eagle medium (DMEM) supplemented
Culture with 10% fetal bovine serum (FBS).
2. SAS cells (C-2011-1142), available from the American Type
Culture Collection. This is a cell line derived from a poorly
differentiated human squamous cell carcinoma of the tongue.
3. Tissue culture flask (250 ml, T-75).
4. Tissue culture dishes (10 cm dish).
5. Todd Hewitt broth: 15 g Todd Hewitt broth base, 5 g yeast
extract, purified water to 500 ml. Autoclave and store at 4 C.
6. Aggregatibacter actinomycetemcomitans strain Y4 (see Note 1).
7. Glass vials (100 ml) (Fig. 3).
8. Rubber stoppers (Fig. 3).
9. Aluminum seals (Fig. 3).
10. Hand crimper (Fig. 3).
11. Nitrogen gas (Fig. 3).
Fig. 3 Culture of anaerobic bacteria. (a) Instruments required for the culture of anaerobic bacteria. Vial, Long
needle, Rubber stopper, Aluminum seal, hand crimper. (b–e) Method for the culture of anaerobic bacteria. Fill
a glass vial with nitrogen using a long needle (b). After fitting a rubber stopper, use a hand crimper and tighten
the aluminum seal (c–e). After sealing, vials should be autoclaved. Inject 10 ml of sterile Todd Hewitt broth
medium into the vial, and inoculate bacteria (f)
12. Iododeoxyuridine (IdU) (2 mM stock solution in water, fil-

trated with 0.22 μm filter). Store at 4 C. For long-term
storage, store at 20 C (see Note 2).
2.2 PFGE 1. Dulbecco’s phosphate-buffered saline ( ) (D-PBS).

2.2.1 Preparation 2. 0.5% Trypsin/ethylenediaminetetraacetic acid (EDTA)
of Plugs solution.
3. DMEM supplemented with 10% FBS.
4. Cell counter.
5. 1% Agarose: 1 g chromosome grade agarose, purified water to
100 ml.
6. Plug mold.
7. 0.5 M EDTA.
8. 1 M Tris–HCl, pH 8.0.
9. 10 mg/ml Proteinase K.
10. Lysis buffer: 10 g sodium lauroyl sarcosinate (1%, w/v), 2 g
sodium deoxycholate (0.2%, w/v), 200 ml of 0.5 M EDTA
(100 mM final concentration), purified water to 1 l. Store at
room temperature. Before use, add 1/40 vol of 10 mg/ml
proteinase K (final concentration 0.25 mg/ml).
116 Rie Teshima
11. TE buffer: 10 ml of 1 M Tris–Cl (pH 8.0, 10 mM final

concentration), 200 ml of 0.5 M EDTA (100 mM final con-
centration), purified water to 1 l. Autoclave and store at room
temperature.
2.2.2 Running PFGE Gels 1. PFGE apparatus set.

2. 10 TBE buffer: 108 g Tris, 55 g boric acid, 40 ml of 0.5 M
EDTA, purified water to 1 l. Autoclave and store at room
temperature.
3. 0.9% Agarose gel in 0.25 TBE: 3.6 g PFGE-grade agarose,
10 ml of 10 TBE buffer, purified water to 400 ml.
4. Running buffer: 2.4 l of 0.25 TBE buffer.
5. 10 mg/ml Ethidium bromide (EtBr) solution.
6. Staining buffer: supplement 500 ml of running buffer with
25 μl of EtBr solution (0.5 μg/ml EtBr final concentration).
7. Plastic container large enough to hold PFGE gel.
8. Typhoon FLA 7000 laser scanner.
2.3 Immunoblotting 1. UV cross-linker (UVP).

2. Denaturation buffer: 0.5 N NaOH, 1.5 M NaCl. Dissolve
100 g NaOH (pH 7.2) and 429 g NaCl in sterile purified
water to 5 l. Store at room temperature.
3. Neutralization buffer: 0.5 M Tris–HCl, 1.5 M NaCl. Dissolve
429 g NaCl, 300 g Tris and 200 ml of HCl (35–37%) in sterile
purified water to 5 l. Store at room temperature.
4. 20 SSC: 0.3 M sodium citrate (pH 7.0), 3 M NaCl.
5. 2 SSC: 0.03 M sodium citrate (pH 7.0), 0.3 M NaCl.
6. Nylon membranes (e.g., Hybond-N+ membranes).
7. Filter paper.
8. 0.1% (v/v) Tween 20 in PBS.
9. Blocking buffer: 5% (w/v) skim milk in 0.1% Tween 20 in PBS.
10. Mouse anti-BrdU antibody (e.g., B44 supplied by BD
Biosciences).
11. Alkaline phosphatase (AP)-conjugated donkey anti-mouse
antibodies.
12. AP Buffer: 20 ml of 5 M NaCl, 50 ml of 1 M MgCl2, 100 ml of
1 M Tris–HCl (pH 9.5), 830 ml of purified water. Autoclave
and store at room temperature.
13. 5-bromo, 4-chloro, 3-indolylphosphate (BCIP) and nitro-blue
tetrazolium (NBT) solution (e.g., BCIP/NBT solution sup-
plied by Roche).
3 Methods
3.1 Bacterial 1. Culture SAS cells in a 250 ml tissue culture flask in DMEM-
and Human Cell 10% FBS medium at 37 C in an atmosphere containing 5%
Culture CO2. When confluent, passage the cells into eight 10-cm tissue
culture dishes.
3.1.1 Human Cell Culture
2. Immediately after passaging SAS cells, add 50 μl of 2 mM IdU
solution (final concentration 10 μM) to the cell culture
medium.
3. Following incubation for 24 h (see Note 3), gently aspirate
IdU-supplemented medium, wash twice with D-PBS, replace
with fresh DMEM-10% FBS medium.
4. Inoculate the bacterial suspension on cells to achieve the
desired multiplicity of infection (MOI). In our experiment,
we had approximately 6–10 104 cells/ml at this point. For
this experiment, we used a MOI of ~300.
3.1.2 Bacterial Cell 1. Fill a glass vial with nitrogen using a long needle. After fitting a
Culture rubber stopper, use a hand crimper and tighten the aluminum
seal (Fig. 3a–e).
2. Autoclave the vial.
3. Inject 10 ml of sterile Todd Hewitt broth medium into the
autoclaved vial.
4. Inoculate the medium with bacterial stock solution (stored at
80 C and thawed prior to inoculation) and incubate at 37 C
for 24 h (Fig. 3d).
5. Following incubation, adjust the density of the bacterial culture
using sterile culture medium to a suitable concentration to
obtain the correct MOI once added to the cultured SAS cells.
6. The relationship between the optical density at 600 nm of the
culture and the number of viable bacterial cells should be
determined in advance by plating out dilutions of overnight
bacterial culture and calculating the number of colony-forming
units per ml in the original culture.
3.2 Sample 1. Sub-confluent SAS cells infected with A. actinomycetemcomitans

Preparation for PFGE were analyzed for the accumulation of DSBs at 24 h post-
infection.
2. For harvesting cells, gently aspirate the growth medium and
wash cells twice with 10 ml of D-PBS.
3. Add 1 ml of 0.5% trypsin-EDTA and incubate at 37 C for
2 min (see Note 4).
4. Add 4 ml of DMEM-10% FBS medium and loosen cells by
pipetting. Collect the cell suspension into a sterile 15-ml tube.
118 Rie Teshima
5. Centrifuge the cell suspension at 420 g for 5 min. Discard

supernatant. Resuspend the cell pellet in 5 ml of D-PBS.
6. Count the number of cells using a cell counter. In our experi-
ment, we had approximately 4–20 105 cells/ml at this point.
7. Centrifuge the cells at 420 g for 5 min. Discard the superna-
tant and resuspend the cell pellet in D-PBS. The final cell
concentration should be adjusted to 4 106 cells/100 μl.
8. Melt 1% PFGE-grade agarose using a microwave.
9. Prepare plugs using the plug mold. Mix equal volumes of cell
suspension and melted 1% agarose in a 1.5-ml sample tube
prewarmed to 50 C and pour into the plug mold. Each
agarose plug should contain ~2 106 cells/100 μl. Leave the
plugs at room temperature or at 4 C until agarose is set (see
Note 5).
10. Incubate set plugs in 1 ml of lysis buffer at 37 C for 24 h. We
usually perform this step in 2-ml sample tubes (see Note 6).
11. Following incubation, plugs can be stored at 4 C until PFGE
analysis (see Note 7).
3.3 PFGE 1. Prepare a 0.9% agarose gel in 0.25 TBE using the gel tray
provided with the PFGE apparatus. Melt agarose by heating in
a microwave until completely dissolved. Stand at room temper-
ature until the temperature of the agarose reaches approxi-
mately 50 C before pouring the gel. Retain approximately
10–20 ml of the melted agarose for use in step 2.
2. Load plugs onto the agarose gel. First, fill each well with TE
buffer. Next, slide plugs into individual wells. We use a glass
coverslip to assist with this step. After loading samples
(Fig. 4a), remove the TE buffer from the wells and seal each
well using the retained melted agarose (see Note 8) (Fig. 4b).
Fig. 4 Method for loading plugs on agarose gel for PFGE. PFGE: (a) Load plug on
the agarose gel. Use the coverslip for microscopy to assist the slide the plug on
the well. (b) closing the wells
3. Remove the frame from the agarose gel and place into the
PFGE apparatus.
4. PFGE running conditions when using a Biometra apparatus:
temperature, 13 C; time, 23 h; voltage, 180 V to 120 V log;
angle, 120 to 110 lin; pulse, 30 s to 5 s log; buffer, 0.25
TBE buffer (2.4 l); no inverse.
5. Following electrophoresis, transfer the gel to the plastic con-
tainer. Add 500 ml of running buffer and 25 μl of 10 mg/ml
EtBr solution to the container and stain the gel overnight.
6. Analyze the EtBr-stained gel using a Typhoon FLA 7000 laser
scanner.
7. Return the gel to the plastic container.
3.4 Immunoblotting 1. After PFGE, expose the EtBr-stained gel to UV light (2000
Joules) using a UV cross-linker (see Note 9).
2. Following UV irradiation, incubate the gel in denaturation
buffer for 1 h at room temperature (see Note 10).
3. Discard the denaturation buffer, wash the gel twice with water,
and incubate for 1 h in neutralization buffer at room
temperature.
4. Place the pedestal in a plastic container and place three sheets of
filter paper that is cut larger than the pedestal on it. Immerse
the membrane and filter paper in 20 SSC prior to use. Put any
extra 20 SSC in the bottom of the container and let the edge
of the filter paper soak in water. Place the gel on top of three
layers of filter paper (make sure there are no bubbles). Lay the
membrane (10 20 cm) on top of the gel and cover with a
further three layers of filter paper. Stack paper towels on top of
the filter paper and place a weight on top. Cover the area
around the gel to prevent drying of the filter paper. Incubate
overnight at room temperature to allow the transfer of DNA
onto the membrane (Fig. 5).
5. Cross-link the transferred DNA using a UV cross-linker (1200
Joules).
6. Treat membranes with blocking buffer for 1 h.
7. Incubate membranes with mouse anti-BrdU antibody
(1:10,000 dilution with 0.1% Tween-20 in PBS) for at least
3 h, or overnight at room temperature.
8. Wash membranes three times for at least 10 min with 0.1%
Tween-20 in PBS.
9. Add AP-conjugated donkey anti-mouse antibody (1:10,000
dilution with 0.1% Tween-20 in PBS) in PBS containing 0.1%
Tween 20 to the membrane and incubate for at least 1 h, or
overnight.
120 Rie Teshima
Fig. 5 Transfer the DNA from the agarose gel to Nylon membranes. (a,b) Schematic representation of this
method. Method is the same as normal southern blot except for 2000 Joules UV irradiation in the presence of
E-Br before denaturing (see Subheading 3.4)
10. Wash membrane three times for at least 10 min with 0.1%
Tween 20 in PBS.
11. Visualize signals using BCIP/NBT solution in AP buffer. Soak
the membranes with shaking in a solution prepared by mixing
AP buffer (100 ml) with BCIP/NBT solution (500 μl) (see
Note 11).
4 Notes
1. A. actinomycetemcomitans Y4 should be cultured under anaer-

obic conditions. Fill vials with nitrogen and seal with rubber
stoppers and aluminum seals. After autoclaving the nitrogen-
filled vials, fill with liquid culture medium and inoculate with
bacterial stock solution. Following incubation at 37 C, add the
required volume to SAS cell culture medium. The volume of
bacterial suspension should not exceed 10% of the cell culture
solution. Concentrate bacterial suspension if necessary prior to
addition to the cultured human cells.
2. The concentration of the IdU stock solution is 2 mM because
IdU does not dissolve at concentrations greater than 2 mM.
The concentration is then adjusted from 2 mM to a final
concentration of 10 μM.
3. When labeling entire chromosomes, prelabeling of IdU is suf-

ficient for one generation time. Prelabeling for two generation
times increases the sensitivity of the detection of human DNA.
4. Prolonged incubation with trypsin/EDTA will destroy the cell
structure. This causes mechanical DNA breakage during pipet-
ting. Therefore, it is better not to exceed an incubation time of
2 min. If cells are still difficult to remove from the plate follow-
ing trypsin/EDTA treatment, pretreat the plate with 1%
gelatin.
5. When mixing equivalent volumes of cell suspension and melted
1% agarose, we make about three plugs per sample, equating to
160 μl of each component. Mix in a 1.5 ml tube and pour into
the molds. Preheat the 1.5-ml tube to 50 C.
6. Proteinase K should be added just before you use the lysis
buffer.
7. The original protocol lysed cells in 5 ml of lysis buffer contain-
ing 1 mg/ml proteinase K at 50 C for 48 h. While this also
works, cells can be lysed by incubation at 37 C for 24 h in 1 ml
of lysis buffer containing 0.25 mg/ml proteinase K.
8. Although the original PFGE protocol calls for washing of the
plugs with TE, we have found that there is no need to wash the
plugs—plugs lysed in lysis buffer can be loaded directly onto
the agarose gel.
9. UV irradiation in the presence of EtBr can destroy chromo-
somal DNA. If you prefer to avoid EtBr staining, this step can
be substituted by irradiation of the gel at 20 Gy γ-rays. For the
efficient destruction of chromosomal DNA, overnight staining
of the gel with ethidium bromide is preferable.
10. When gels are immersed in denaturation buffer for 1 h, the
color of the EtBr-stained plugs changes from pink to yellow.
11. As alternative strategy for the detection of IdU signal, horse-
radish peroxidase (HRP)-conjugated anti-mouse secondary
antibodies can be used to detect and visualize the IdU signal
using the ECL system [11].
Acknowledgments
We thank K. Hanada for expert advice and for collaborating on

drafting the manuscript. We also thank Tamsin Sheen, PhD, from
Edanz Group (www.edanzediting.com/ac) for editing a draft of
the manuscript.
122 Rie Teshima
References
1. Terabayashi T, Hanada K (2018) Genome Moriyama M, Graham DY, Yamaoka Y (2014)
instability syndromes caused by impaired Helicobacter pylori infection introduces DNA
DNA repair and aberrant DNA damage double-strand breaks in host cells. Infect
responses. Cell Biol Toxicol 34:337–350 Immun 82:4182–4189
2. Hanada K, Graham DY (2014) Helicobacter 8. Grasso F, Frisan T (2015) Bacterial Genotox-
pylori and the molecular pathogenesis of ins: merging the DNA damage response into
intestinal-type gastric carcinoma. Expert Rev infection biology. Biomol Ther 5:1762–1782
Anticancer Ther 14:947–954 9. Tezal M, Sullivan MA, Hyland A, Marshall JR,
3. Hanada K, Yamaoka Y (2014) Genetic battle Stoler D, Reid ME, Loree TR, Rigual NR,
between helicobacter pylori and humans. The Merzianu M, Hauck L, Lillis C, Wactawski-
mechanism underlying homologous recombi- Wende J, Scannapieco FA (2009) Chronic peri-
nation in bacteria, which can infect human odontitis and the incidence of head and neck
cells. Microbes Infect 16:833–839 squamous cell carcinoma. Cancer Epidemiol
4. Koshiol J, Wozniak A, Cook P, Adaniel C, Biomark Prev 18:2406–2412
Acevedo J, Azocar L, Hsing AW, Roa JC, 10. Tezal M, Sullivan MA, Reid ME, Marshall JR,
Pasetti MF, Miquel JF, Levine MM, Hyland A, Loree T, Lillis C, Hauck L,
Ferreccio C, Gallbladder Cancer Chile Work- Wactawski-Wende J, Scannapieco FA (2007)
ing G (2016) Salmonella enterica serovar Typhi Chronic periodontitis and the risk of tongue
and gallbladder cancer: a case-control study cancer. Arch Otolaryngol Head Neck Surg
and meta-analysis. Cancer Med 5:3310–3235 133:450–454
5. Zhu H, Shen Z, Luo H, Zhang W, Zhu X 11. Teshima R, Hanada K, Akada J, Kawano K,
(2016) Chlamydia trachomatis infection- Yamaoka Y (2018) Aggregatibacter actinomy-
associated risk of cervical Cancer: a meta- cetemcomitans infection causes DNA double-
analysis. Medicine (Baltimore) 95:e3077 strand breaks in host cells. Genes Cells
6. Chumduri C, Gurumurthy RK, Zadora PK, 4:64–273
Mi Y, Meyer TF (2013) Chlamydia infection 12. Kawashima Y, Yamaguchi N, Teshima R,
promotes host DNA damage and proliferation Narahara H, Yamaoka Y, Anai H, Nishida Y,
but impairs the DNA damage response. Cell Hanada K (2017) Detection of DNA double-
Host Microbe 13:746–758 strand breaks by pulsed-field gel electrophore-
7. Hanada K, Uchida T, Tsukamoto Y, Watada M, sis. Genes Cells 22:84–93
Yamaguchi N, Yamamoto K, Shiota S,
Chapter 11
Monitoring of DNA Replication and DNA Double-Strand

Breaks in Saccharomyces cerevisiae by Pulsed-Field Gel
Electrophoresis (PFGE)
Kenji Keyamura and Takashi Hishida
Abstract
Separating DNA fragments using standard agarose gel electrophoresis is based on the capacity of negatively
charged DNA molecules to move through the agarose gel matrix toward the positive electrode. Pulsed-field
gel electrophoresis (PFGE) is an agarose gel electrophoresis technique that enables the separation of DNA
molecules at a megabase scale, making the direct genomic analysis of large DNA molecules possible. For
instance, 16 chromosomes (size range; 0.2–2.2 Mb) in Saccharomyces cerevisiae, whose karyotype cannot be
easily observed with a microscope, can be directly separated on agarose gel. PFGE is also a powerful
analytical tool for chromosomal mapping and genome structure analysis in bacterial and mammalian cells.
In this chapter, we will describe the preparation of intact yeast chromosomal DNA for PFGE and general
PFGE procedures and will introduce a PFGE method to monitor the DNA replication fork progression and
DNA double-strand breaks (DSBs).
Key words Pulsed-field gel electrophoresis (PFGE), Contour-clamped homogeneous electric field
(CHEF), Chromosome, S. cerevisiae, Replication fork, DNA double-strand break
1 Introduction
Conventional agarose gel electrophoresis is a basic molecular biol-

ogy technique that is most frequently employed for separating
DNA molecules depending on their lengths and conformations.
However, the molecular sieving effects of the gel matrix are limited
and preclude the separation of >50 kb DNA molecules. In 1984,
Schwartz and Cantor developed a technique called pulsed-field gel
electrophoresis (PFGE) to overcome this limitation [1]. This tech-
nique enables the separation of large DNA molecules on agarose
gel by periodically altering the direction of the electric field relative
to the gel. Subsequent improvements made it possible to linearly
separate large DNA molecules (up to 12 megabases) on agarose gel
[2–4]. Contour-clamped homogeneous electric field (CHEF) gel
electrophoresis is the most frequently used system for PFGE
123
124 Kenji Keyamura and Takashi Hishida
analysis, which applies a contour-clamped homogeneous electric

field that alternates between two orientations with a single pulse
time [5]. The pulse time primarily determines the size range of
separation; longer pulse times enable the separation of larger DNA
fragments. To further improve the resolution, switch times are now
regularly increased through the run (known as a ramped pulse
time). In addition, various conditions, such as electric field
strength, time of electrophoresis, buffer temperature, and agarose
concentration, can also affect the migration rate of the large sizes of
linear DNA molecules resolved during PFGE. On the other hand,
the large-sized circular DNA molecules, such as bacterial chromo-
somes, do not penetrate the gel because of their conformation with
smaller effects of the electric field [6, 7]. Therefore, for bacterial
genotyping studies, large fragments of a chromosome digested by
rare-cutting restriction endonucleases (e.g., NotI) can be separated
by PFGE. In addition, DNA molecules with branched structures
(e.g., replication forks and recombinant intermediates) often accu-
mulate in the wells, because they are more likely to be captured in
an agarose gel matrix [8]. Furthermore, chromosomal double-
strand breaks (DSBs) can be easily observed as the disappearance
of chromosomal bands and the appearance of smeared DNA mole-
cules on the low-molecular weight side [9, 10]. Thus, PFGE can be
used not only for genome characterization and molecular genotyp-
ing but also for the detection of different electrophoretic patterns
based on different chromosomal structures. PFGE can therefore be
employed to observe the DNA dynamics during DNA replication
and DSB repair.
2 Materials
2.1 Culture Media 1. Yeast extract–peptone–dextrose–adenine (YPDA) medium: 1%

and Supplements (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) dextrose, and
0.003% (w/v) adenine sulfate. To make the solid medium, add
2% (w/v) agar.
2. α-factor mating pheromone (Trp-His-Trp-Leu-Gln-Leu-Lys-
Pro-Gly-Gln-Pro-Met-Tyr): prepare a stock solution (1 mg/
mL) by dissolving α-factor peptide in sterile distilled water (see
Note 1).
3. Pronase: 10 mg/mL stock solution in sterile distilled water (see
Note 1).
4. Methyl methanesulfonate (MMS) (see Note 2).
5. Sterile 10% (w/v) sodium thiosulfate pentahydrate in distilled
water.
Monitoring of DNA Replication and DNA Double-Strand Breaks. . . 125
2.2 Yeast Strains 1. Saccharomyces cerevisiae S288C derivative BY4741: MATa

his3Δ1 leu2Δ0 ura3Δ0 met15Δ0.
2. bar1Δ: BY4741 bar1Δ::URA3,
3. rad51Δ: BY4741 rad51Δ::KanMX4.
2.3 Yeast DNA 1. 0.5 M EDTA (pH 7.5) solution: dissolve EDTA·2Na·2H2O in
in Agarose Plugs distilled water, adjust it to pH 7.5 with sodium hydroxide, and
then sterilize it using a steam autoclave (121 C for 20 min) for
preparing the following reagents.
2. 50 mM EDTA (pH 7.5) solution.
3. Resuspension solution: 50 mM EDTA (pH 7.5) and 28 mM
2-mercaptoethanol.
4. Zymolyase solution: 5 mg/mL Zymolyase 100 T (nacalai tes-
que), 10 mM Tris-HCl (pH 7.5), and 50% (v/v) glycerol (see
Note 1).
5. Low-melting agarose gel: 1.6% (w/v) certified low-melting
agarose (#1613111; Bio-Rad) in 125 mM EDTA (pH 7.5)
for preparing the plugs.
6. Lysis buffer: 10 mM Tris-HCl (pH 7.5), 0.46 M EDTA
(pH 7.5), and 1 M 2-mercaptoethanol.
7. ES buffer: 10 mM Tris-HCl (pH 7.5), 0.46 M EDTA (pH 7.5),
and 1% (w/v) N-lauroylsarcosine sodium salt.
8. 15–20 mg/mL Proteinase K.
9. ESP buffer: ES buffer containing 1 mg/mL proteinase K.
10. Plug mold (#1703713; Bio-Rad).
2.4 CHEF 1. 0.5 TBE buffer: prepare by diluting sterile 10 TBE buffer
Pulsed-Field Gel (108 g of Tris base, 55 g of boric acid, and 40 mL of 0.5 M
EDTA [pH 8.0] per liter) with the 20-fold volume of distilled
water.
2. Agarose gel solution: 1% (w/v) pulsed-field certified agarose
(#1620137; Bio-Rad) in 0.5 TBE buffer (see Subheading 3.2
for more details).
3. Sealing agarose gel solution: 0.8% (w/v) certified low-melting
agarose in 0.5 TBE buffer for filling the void space of the well
(see Subheading 3.2 for more details).
4. Gel casting stand (#1703689; Bio-Rad), comb (#1704326
[10 wells] or #1704324 [15 wells]; Bio-Rad), and comb holder
(#1703699; Bio-Rad).
5. CHEF mapper XA system (#1703670; Bio-Rad): This system
is composed of a power module, electrophoresis chamber,
cooling module, and variable speed pump.
6. SYBR Gold (Invitrogen).
3 Methods
3.1 Preparation DNA preparation is the most critical step in PFGE. In order to
of Agarose Plugs avoid the breakage of chromosomal DNA during the manipulation,
the spheroplast cells are first embedded in low-melting agarose
plugs and then treated with proteinase K to hydrolyze proteins in
the presence of a chelating agent (EDTA) that prevents nuclease
damage to the DNA.
1. Pellet yeast cells from an appropriate volume of culture in a
centrifuge, wash the cells twice with cold 50 mM EDTA
(pH 7.5), and then remove the supernatant (see Subheadings
3.5 and 3.6 for more details). Typically, we use 4–6 107 cells
per sample; this will produce at least two agarose plugs for
PFGE. Freeze the cell pellet using liquid nitrogen and store it
at 80 C until use.
2. Thaw the frozen cells (4–6 107 cells) in a tube on ice.
3. Add 120 μL of resuspension solution to the tube and resuspend
the cells by vortexing.
4. Add 2.5 μL of Zymolyase solution to the cell suspension and
gently mix it by pipetting.
5. Incubate the cell suspension at 30 C for 10 min (see Note 3).
6. Melt 1.6% low-melting agarose using a microwave oven and
keep it warm by placing it in an incubator or water bath set at
50 C.
7. Add an equal volume of 1.6% low-melting agarose to the
incubated cell suspension to obtain a final agarose concentra-
tion of 0.8%.
8. Gently and homogeneously mix the cell–agarose mixture. Keep
the mixture at 40–45 C.
9. Pipet the cell–agarose mixture into plug molds. Take care to
avoid air bubbles. Each well in Bio-Rad’s disposable plug
molds holds approximately 100 μL of sample (see Note 4).
10. Solidify the agarose plug at 4 C for 20–30 min.
11. Push the plug out into a new tube containing 1 mL of a lysis
buffer using the provided snap-off tool on the plug mold.
12. Incubate the plugs at 37 C for 3–5 h (see Notes 3 and 5).
13. Remove the lysis buffer and wash the plugs with 1 mL of ES
buffer.
14. Add 1.5 mL of ESP buffer to the tube.
15. Incubate the plugs at 50 C for 6 h (see Note 6).
16. Remove the ESP buffer and add 1.5 mL of fresh ESP buffer to
the tube.
17. Incubate the plugs at 50 C for 16–20 h (see Note 6).

18. Remove the ESP buffer and wash the plugs with 1 mL of 0.5
TBE buffer.
19. Add 1 mL of fresh 0.5 TBE buffer to the tube and incubate
the plug at room temperature for 30 min, followed by the
removal of the buffer.
20. Add 1 mL of fresh 0.5 TBE buffer to the tube and incubate
the plug at 4 C overnight, followed by the removal of the
buffer.
21. Store the plugs in 0.5 TBE buffer at 4 C until use (see
Note 7).
3.2 Preparing To cast the gel, use a casting stand with removable end plates,
the Pulsed-Field Gel platform, comb, and comb holder. The dedicated casting stands
and combs provided by Bio-Rad come in various standards accord-
ing to your needs. Here, we introduce a protocol using a
14 13 cm casting stand and a 14 1.5 mm comb for 10–15
wells.
1. Assemble the casting stand.
2. Attach the comb to the comb holder and adjust the height of
the comb to 1–2 mm above the surface of the platform by
loosening the screw and then tightening when the comb is
properly positioned.
3. Completely melt 1.2 g of pulsed-field certified agarose in
120 mL of 0.5 TBE buffer using a microwave oven or
steam autoclave.
4. Pour the melted agarose into the casting stand on a level
surface and insert the comb (attached to the comb holder)
into the agarose (see Note 8).
5. After 1 h at room temperature, solidify the agarose gel on the
casting stand at 4 C for at least 2 h.
6. Carefully remove the comb holder and comb, embed a sample
plug into the well, and seal each well with a sealing agarose gel
solution (50 C), allowing the seal to harden for 5–10 min to
fix the plug.
7. Remove the casting stand with the end plates and clean the
extra agarose gel on the back and side of the platform to which
the agarose gel adheres (see Note 9).
3.3 Running 1. Fill the electrophoresis chamber with 2.2 L of 0.5 TBE buffer
the Pulsed-Field Gel and cool down to 14 C by circulating the buffer using the
cooling module and the variable speed pump.
2. Place the gel on the platform into the frame on the surface of
the electrophoresis chamber under 0.5 TBE buffer.
3. Enter the run parameters (voltage, run time, switching time,

etc.) using the “Two-State Mode,” which generate the inclu-
sion angel of 120 . The gel was run at 6 V/cm for 24 h with an
initial switch time of 60 s and a final switch time of 120 s
(linear ramp).
4. After setting the parameters, run the CHEF mapper system.
3.4 Detecting 1. After the electrophoresis is complete, soak the gel in 200 mL of
the Chromosomal 0.5 TBE buffer containing SYBR Green I (10,000-fold dilu-
Bands tion) and stain the gel for 60 min at room temperature with
gentle shaking (see Note 10).
2. After staining, wash the gel with 0.5 TBE buffer for at least
15 min at room temperature with gentle shaking (see Note 11).
3. Detect the migration pattern of each chromosome using a
fluorescence transilluminator with an appropriate filter for
SYBR Green I.
3.5 Monitoring In order to monitor the replication status in budding yeasts, cells
the Replication Status are initially synchronized by blocking them at the G1-phase of the
in Synchronized Cells cell cycle, followed by releasing them into the S-phase of the cell
by PFGE cycle. The most popular method to obtain G1-arrested cells is to
use an alpha-mating-type pheromone (α-factor), whose binding
leads to the inactivation of the Cdc28/G1 cyclin complex in
MATa haploid cells, thus resulting in an arrest at the G1 cell cycle
stage [11–13]. After release from the G1 arrest by removing
α-factor, cells become able to maintain at least two cycles of
synchrony.
α-factor is very expensive. However, the working concentration
(0.1–10 μg/mL) can be minimized by carrying out the experiment
in a bar1Δ strain in place of a BAR1 strain. The BAR1 gene
encodes a protease, which is secreted from MATa cells and degrades
the α-factor [14–16]. Thus, the working concentration of the
α-factor can be reduced to about 100-fold as compared to when
using the BAR1 strain. Here we describe the cell cycle synchroni-
zation with α-factor using a bar1 strain for monitoring the cell cycle
progression by PFGE analysis (Fig. 1a).
1. Inoculate fresh colonies into a YPDA medium and incubate
them at 30 C overnight.
2. Add the optimum amount of overnight culture to a fresh
YPDA medium to adjust the cell concentration to 2 106
cells/mL and then grow the cells to logarithmic phase at
30 C (usually between 120 and 180 min) (see Notes 12
and 13).
3. Add α-factor (0.1 μg/mL as a final concentration) to the
culture and then further incubate the cells at 30 C for
90–120 min to arrest G1 (see Notes 14 and 15).
a b
Time (min) after release
Asn 0 20 30 40 50 60 70
*well 70
60
Time (min) after release

50
40
30
20
G1 0
Asn
Lane 1 2 3 4 5 6 7 8
1C 2C
Fig. 1 Monitoring of DNA replication progression in synchronized cells. (a) bar1Δ

cells grown to early log phase at 30 C were arrested in G1 with α-factor and
were then released into a fresh YPDA medium. Samples from synchronized cell
cultures were taken at the indicated time points (lanes 2–8) after being released
from G1 arrest and analyzed using PFGE, and then chromosome bands were
detected with SYBR Green I staining. Asynchronous cells (Asn) were also
analyzed (lane 1). The asterisk indicates an image of the well taken with low
exposure to observe the accumulation of replication forks. (b) Cell cycle pro-
gression was determined using flow cytometry
4. Pellet the cells by centrifugation at 1,200 g for 5 min at room

temperature and discard the supernatant.
5. Wash the cells twice with the same volume of sterile distilled
water as that of the culture.
6. Resuspend the cells in the working volume of fresh YPDA
containing 100 μg/mL Pronase and then incubate them at
30 C to release them from arrest (see Note 16).
7. Take an aliquot of the culture at any desired time points (e.g.,
every 10–20 min) (see Notes 17 and 18).
8. Pellet the cells by centrifugation at 1,200 g for 5 min at 4 C
9. Wash the cell pellet twice with 1 mL of cold 50 mM EDTA

(pH 7.5).
10. Freeze the cell pellet using liquid nitrogen and store it at
80 C until use (see Subheading 3.1).
3.6 Monitoring DSBs of chromosomal DNA are caused by exogenous sources, such
the Repair Status as ionizing radiation and chemical agents, or endogenous sources,
During DSBs by PFGE such as oxidative and DNA replication stress. In order to maintain
the genome integrity, cells have several DSB repair pathways,
including nonhomologous end joining, homologous recombina-
tion, single-strand annealing, and break-induced replication
[17]. PFGE analysis is a powerful technique for directly monitoring
the behaviors and repair rates of DSBs. Thus, it is generally used to
measure the repair activity of genes related to the DSB repair
pathway. MMS, a DNA-alkylating agent, blocks the progression
of DNA replication forks, resulting in DSBs. Here, we describe a
method for monitoring the repair status of DSBs by PFGE analysis
using cells treated with MMS (Fig. 2).
WT rad51Δ
Time (h) 0 2 4 6 0 2 4 6
Lane 1 2 3 4 5 6 7 8 9 10
Fig. 2 Recovery from DSBs in cells treated with MMS. Wild-type and rad51Δ
cells were taken at 0, 2, 4, and 6 h (lanes 2–5: wild-type, lanes 7–10: rad51Δ)
after treatment with 0.1% MMS for 30 min. The chromosomes of the cells were
separated using PFGE and stained with SYBR Green I. Lanes 1 and 6 show the
chromosomes in MMS-untreated wild-type and rad51Δ cells, respectively. A
rad51Δ strain was used as a mutant defective in the repair of DSBs by
homologous recombination
1. Inoculate fresh colonies into a YPDA medium and incubate

them at 30 C overnight.
2. Add the optimum amount of overnight culture to a fresh
YPDA medium to adjust the cell concentration to 5 106
cells/mL and then grow the cells to logarithmic phase at
30 C (usually between 120 and 180 min) (see Note 12).
3. Add MMS (0.1–0.2% as a final concentration) to the culture
and further grow the cells at 30 C for 30 min.
5. Resuspend the cells with the same volume of sterile 10%
sodium thiosulfate as that of the recovered culture to detoxify
the MMS.
7. Wash the cells once with the same volume of sterile distilled
water as above.
8. Resuspend the cells with the same volume of YPDA medium as
above and incubate them at 30 C to release them from the
exposure to MMS.
9. Take an aliquot of the culture at the desired times (e.g., every
2 h) (see Note 18).
10. Pellet the cells by centrifugation at 1,200 g for 5 min at 4 C
11. Wash the cell pellet twice with 1 mL of cold 50 mM EDTA
(pH 7.5).
12. Freeze the cell pellet using liquid nitrogen and store it at
80 C until use (see Subheading 3.1).
4 Notes
1. These solutions can be stored at 20 C for at least 1 year.

2. Because MMS is a genotoxic agent, we recommend that gloves
be worn during use. In addition, liquid media and waste con-
taining MMS should be neutralized by sodium thiosulfate (10%
as a final concentration).
3. These manipulations are performed to create spheroplasts.
Although most PFGE protocols treat cell samples with Zymo-
lyase within a solid agarose plug, this reduces the efficiency of
spheroplast generation and may increase the amounts of DNA
molecules accumulated in the well during PFGE. To overcome
this problem, it is advised to treat cell samples with Zymolyase
at 30 C for 10 min prior to adding the agarose solution.
4. If you use a comb for 10 wells, you can pipet 100 μL of the cell–
agarose mixture into each well in the plug molds. If you use a
comb for 15 wells, you can pipet 60–65 μL of that into each
well in the plug molds.
5. The plugs can be incubated at 37 C overnight.
6. These manipulations are performed to digest intracellular pro-
teins and Zymolyase.
7. The prepared agarose plugs can be stored at 4 C for 3 months.
8. Before the gel solidifies, the bubbles generated on the surface
of the gel should be removed with a tip or a spatula.
9. Do not remove the gel from the platform.
10. 0.5 μg/mL ethidium bromide solution or 10,000-fold-diluted
SYBR Gold (Invitrogen) can be used in place of SYBR Green I
for gel staining.
11. If necessary, destain the gel overnight in 0.5 TBE buffer to
further reduce background staining.
12. Measure the cell concentration of the overnight culture using a
hemocytometer or an automatic cell counter and calculate the
volume of culture necessary for your experiment.
13. For efficient synchrony, it is essential that the number of cells
should not exceed the density of 5 106 cells/mL.
14. If you use a BAR1 strain, add at least 10 μg/mL (as a final
concentration) of α-factor to the culture.
15. Small samples taken usually at 90–120 min should be sonicated
and examined under a microscope. Shmoo-like morphology
represents G1-arrested cells [18].
16. It is important to add Pronase because even a small remaining
amount of α-factor can inhibit release from the G1 arrest.
Pronase does not affect cell growth.
17. The progression of the cell cycle can be confirmed by analyzing
the DNA content or the morphology of the cells. We recom-
mend using flow cytometry for DNA contents or a microscope
for cell morphology [19, 20]. In this experiment, we showed
the results of flow cytometry analysis using the cells released
from the G1 arrest (Fig. 1b).
18. Count the cell number in the culture using a hemocytometer
or an automatic cell counter and determine the volume of
culture necessary for preparing the plugs.
Acknowledgments
We thank S. Tanaka for technical assistance. This work was sup-

ported by Grants-in-Aid for Scientific Research from the Ministry
of Education, Culture, Sports, Science and Technology (MEXT),

Japan.
References
1. Schwartz DC, Cantor CR (1984) Separation of 11. Hartwell LH, Culotti J, Pringle JR, Reid BJ
yeast chromosome-sized DNAs by pulsed field (1974) Genetic control of the cell division
gradient gel electrophoresis. Cell 37:67–75 cycle in yeast. Science 183:46–51
2. Carle GF, Frank M, Olson MV (1986) Electro- 12. Sprague GF Jr, Blair LC, Thorner J (1983) Cell
phoretic separation of large DNA molecules by interactions and regulation of cell type in the
periodic inversion of the electric field. Science yeast Saccharomyces cerevisiae. Annu Rev
232:65–68 Microbiol 37:623–660
3. Southern EM, Anand R, Brown WRA, Fletcher 13. Mendenhall MD, Jones CA, Reed SI (1987)
DS (1987) A model for the separation of large Dual regulation of the yeast CDC28-p40 pro-
DNA molecules by crossed field gel electro- tein kinase complex: cell cycle, pheromone, and
phoresis. Nucleic Acids Res 15:5925–5943 nutrient limitation effects. Cell 50:927–935
4. Clark SM, Lai E, Birren BW, Hood L (1988) A 14. Ciejec E, Thorner J (1979) Recovery of
novel instrument for separating large DNA S. cerevisiae a cells from G1 arrest by alpha
molecules with pulsed homogenous electric factor pheromone requires endopeptidase
fields. Science 241:1203–1205 action. Cell 18:623–635
5. Chu G, Vollrath D, Davis WR (1986) Separa- 15. Chan RK, Otte CA (1982) Isolation and
tion of large DNA molecules by contour- genetic analysis of Saccharomyces cerevisiae
clamped homogeneous electric fields. Science mutants supersensitive to G1 arrest by a factor
234:1582–1585 and alpha factor pheromones. Mol Cell Biol
6. Beverley SM (1988) Characterization of the 2:11–20
’unusual’ mobility of large circular DNAs in 16. MacKay VL, Welch SK, Insiey MY, Manney
pulsed field-gradient electrophoresis. Nucleic TR, Holly J, Saari GC, Parker ML (1988)
Acids Res 16:925–939 The Saccharomyces cerevisiae BAR1 gene
7. Khan SR, Kuzminov A (2013) Trapping and encodes an exported protein with homology
breaking of in vivo nicked DNA during pulsed to pepsin. Proc Natl Acad Sci U S A 85:55–59
field gel electrophoresis. Anal Biochem 17. Mehta A, Haber JE (2014) Sources of DNA
443:269–281 double-strand breaks and models of recombi-
8. Game JC, Sitney KC, Cook VE, Mortimer RK national DNA repair. Cold Spring Harb Per-
(1989) Use of a ring chromosome and pulsed- spect Biol 6:a016428
field gels to study interhomolog recombina- 18. Levi JD (1956) Mating reaction in yeast.
tion, double-strand DNA breaks and sister- Nature 177:753–754
chromatid exchange in yeast. Genetics 19. Zhang H, Siede W (2004) Analysis of the bud-
123:695–713 ding yeast Saccharomyces cerevisiae cell cycle
9. Michel B, Ehrlich SD, Uzest M (1997) DNA by morphological criteria and flow cytometry.
double-strand breaks caused by replication Methods Mol Biol 241:77–91
arrest. EMBO J 16:430–438 20. Amberg DC, Burke DJ, Strathern JN (2005)
10. Westmoreland J, Ma W, Yan Y, Van Hulle K, Methods in yeast genetics. A cold spring harbor
Malkova A, Resnick MA (2009) RAD50 is laboratory course manual, 20th edn. CSH
required for efficient initiation of resection press, New York, NY, pp 175–176
and recombinational repair at random,
gamma-induced double-strand break ends.
PLoS Genet 5:e1000656
Chapter 12
Pulsed-Field Gel Electrophoresis for Detecting

Chromosomal DNA Breakage in Fission Yeast
Takatomi Yamada, Hiroshi Murakami, and Kunihiro Ohta
Abstract
DNA-strand breaks influence structure and function of chromosomes in diverse ways, and it is essential to
analyze the lesions to understand behaviors of genetic information. For researchers in a wide array of fields
including recombination, repair, and DNA damage response, efficient and easy detection of DNA breaks is
of paramount importance. Among several procedures suitable for this purpose, a method to directly
observe broken chromosomes by pulsed-field gel electrophoresis, using the fission yeast Schizosaccharomyces
pombe as a model organism, is described in this chapter. Because S. pombe chromosomes are megabase-size,
careful attention should be paid to maintain DNA as intact as possible. The protocol includes induction of
DNA breaks, preparation of chromosomes, and separation of chromosomal DNA by PFGE. This procedure
can be applicable to other species as well as other experiments handling large-size DNA molecules.
Key words DNA single-strand breaks, DNA double-strand breaks, Pulsed-field gel electrophoresis
(PFGE), Fission yeast, Agarose plugs
1 Introduction
Chromosomal DNA dictates virtually all vital cellular activities and

yet is a dynamic molecule, which is often broken and repaired.
Breaks in DNA strands, double-strand breaks (DSBs) and single-
strand breaks (SSBs), are caused by various reasons including extra-
cellular stimuli such as radiation and drugs, and intracellular factors
such as replication stress and metabolites. These DSBs and SSBs
have profound effects on cells. For instance, they both menace
maintenance and transmission of genetic information. Of these,
DSBs are more deleterious, because they sever strings of genetic
information without leaving a possible template of DNA repair
nearby. SSBs are dangerous as well in that they frequently can be
converted to DSBs. Not surprisingly, cells possess multiple systems
to swiftly sense and amend DSBs and SSBs. In the opposite exam-
ple, cells sometimes break their own genomic DNA. This case is
well illustrated by homologous recombination in meiotic cells and
135
136 Takatomi Yamada et al.
V(D)J recombination in lymphocytes, which diversify genetic infor-

mation of gametes and the antigen receptor repertories, respec-
tively [1]. These recombination events exploit programmed DSBs
for creating novel DNA sequences. Therefore, breaks in a blueprint
of life can go both ways for cells, either detrimental or beneficial,
depending on the situation.
How cells handle DNA breaks is a pivotal issue for diverse
aspects of biology such as DNA damage response, repair, recombi-
nation, and meiosis. For researchers in these fields, detecting DNA
breaks is a central experiment, which can be achieved by multiple
procedures. Here, using the fission yeast Schizosaccharomyces pombe
as a model, we describe a method to directly detect broken DNA
molecules by pulsed-field gel electrophoresis (PFGE). S. pombe has
three chromosomes, whose approximate lengths are 5.6 Mbp,
4.7 Mbp, and 2.5 Mbp. Under normal circumstances, PFGE fol-
lowed by staining the gel visualizes intact chromosomes as three
discrete bands. However, when the same experiments are per-
formed on cells carrying broken DNA strands, smeared signals
emerge underneath the three bands, as DSBs and closely located
SSBs produce DNA fragments, which migrate faster than intact
chromosomes through PFGE gels. Therefore, the proportionate
difference between the intact chromosomes and smeared broken
DNA serves as an estimation for the degree of broken DNAs. One
advantage of this method is that it allows for examination of DNA
breaks without knowing exact locations of the lesions; it is suitable
for initial analyses of factors involved in DNA repair and meiotic
DNA breaks. On the other hand, it is a qualitative assay, and should
be combined with other procedures (e.g., restriction enzyme treat-
ment and Southern blotting) for quantification of the extent of
DNA breaks.
DNA fragments longer than a particular length migrate at the
same rate through agarose gels; hence, fractionation of megabase-
sized DNA is not feasible by conventional electrophoresis. PFGE
circumvents this problem by periodically alternating the electric
field among multiple states during electrophoresis (Fig. 1): DNA
molecules change migrating direction in response to each switch,
and larger DNA fragments take more time for such reorientation
than shorter fragments. Therefore, PFGE amplifies the difference
in DNA molecular size and permits the separation of large size
DNA like whole chromosomes. One of the major obstacles in this
experiment is mechanical damage to the DNA during its prepara-
tion. To avoid this problem, cells are embedded in agarose plugs,
which are sequentially soaked in solutions containing Zymolyase,
SDS, or Proteinase K. This treatment disrupts cells and removes
proteins, while it maintains large-sized DNA intact. This chapter
provides a protocol for generation of DNA-strand breaks in the
fission yeast genome, preparation of agarose plugs to embed DNA,
and subsequent PFGE.
PFGE Analyses of Fission Yeast Genome DNA 137
Fig. 1 A schematic draw of PFGE electrophoresis chamber. The broken lines and
the gray box indicate electrodes and a gel, respectively. The white boxes inside
the gel represent wells for plugs, but are not drawn to scale. Direction of buffer
flow and DNA migration is indicated by the black arrow. The magenta (A) and the
cyan (B) arrows indicate directions of electric fields
2 Materials
2.1 Media for Fission 1. YES medium (complete medium): 0.5% yeast extract, 3% glu-
Yeast Culture and DNA cose, 0.2 mg/ml adenine, 0.2 mg/ml histidine, 0.2 mg/ml
Damaging Agents leucine, 0.2 mg/ml uracil in H2O. Sterilize by autoclaving at
121 C for 15 min and store at room temperature.
2. MM medium (synthetic selection medium and preculture
medium for meiosis induction): 0.3% potassium hydrogen
phthalate, 0.22% Na2HPO4, 0.5% NH4Cl, 2% glucose,
0.2 mg/ml adenine, 0.2 mg/ml histidine, 0.2 mg/ml leucine,
0.2 mg/ml uracil, 20 ml/l 50 salts stock solution (5.2 mM
MgCl2, 0.1 mM CaCl2, 13.4 mM KCl in H2O), 1 ml/l 1000
vitamins stock solution (1% nicotinic acid, 1% inositol, 0.001%
biotin, 0.1% pantothenic acid, 0.28 mM Na2SO4 in H2O),
0.1 ml/l 10,000 minerals stock solution (8.1 mM H3BO3,
2.37 mM MnSO4, 1.39 mM ZnSO4, 0.74 mM FeCl3,
0.25 mM Na2MoO4, 0.6 mM KI, 0.16 mMCuSO4, 1% citric
acid in H2O) in H2O. Sterilize by autoclaving at 121 C for
15 min and store at room temperature.
3. MM-N medium (Nitrogen-lacking medium to arrest cells at
G1 phase): 0.3% potassium hydrogen phthalate, 0.22%
Na2HPO4, 1% glucose, 20 ml/l 50 salts stock solution,
1 ml/l 1000 vitamins stock solution, 0.1 ml/l 10,000
minerals stock solution in H2O. Sterilize by autoclaving at
121 C for 15 min, and store at room temperature.
4. MM + 1/10 N medium (Sporulation medium): 0.3% potas-

sium hydrogen phthalate, 0.22% Na2HPO4, 0.05% NH4Cl, 1%
glucose, 20 ml/l 50 salts stock solution, 1 ml/l 1000
vitamins stock solution, 0.1 ml/l 10,000 minerals stock solu-
tion in H2O. Sterilize by autoclaving at 121 C for 15 min.
Store at room temperature, but warm at 34 C prior to use.
5. DNA damaging agents: Various agents are commercially avail-
able (e.g., bleomycin and phleomycin). Prepare stock solution
of your interest. Alternatively, exposing cells to ionizing radia-
tion also breaks DNA strands.
2.2 Preparation 1. CSE: 20 mM citrate-phosphate (pH 5.6) (see Note 1), 1.2 M
of Agarose Plugs sorbitol, 40 mM EDTA (pH 8.0).
2. CSE w/Zymolyase: 1.5 mg/ml Zymolyase 20 T in CSE (pre-
pare before use) (see Note 2).
3. TSE: 10 mM Tris-Cl (pH 7.5), 0.9 M sorbitol, 45 mM EDTA
(pH 8.0).
4. Low melting-point (LMP) agarose in TSE: 1% LMP agarose in
TSE. Dissolve agarose by microwaving prior to use.
5. SDS Buffer: 50 mM Tris-Cl (pH 7.5), 1% SDS, 250 mM EDTA
(pH 8.0). Store at room temperature and warm at 50 C
before use.
6. Sarcosine Buffer: Dissolve 1% N-lauryl sarcosine in 500 mM
EDTA (pH 9.5). Store at room temperature and warm at 50 C
before use.
7. 20 mg/ml Proteinase K.
2.3 Pulsed-Field Gel 1. 50 TAE: 2 M Tris, 2 M acetic acid, 50 mM EDTA (pH 8.0).
Electrophoresis Dilute with H2O to prepare working solution (1 TAE).
and Image Acquisition 2. Agarose suitable for megabase-sized DNA (see Note 3).
3. Apparatus for PFGE, including a power supply, a chiller, and an
electrophoresis chamber.
4. Ethidium bromide solution (1 μg/ml): Dilute concentrated
stock solution with 1TAE. The buffer (1 TAE) used for
PFGE can be used for this purpose.
5. Apparatus for image acquisition of the stained gel, such as a
camera or an image analyzer.
3 Methods
3.1 Induction of DNA To analyze broken DNA caused by external factors, introduce DSBs
Damage by Drugs and SSBs to the genome by exposing cells to DNA damaging
agents.
1. Treat fission yeast cells that are exponentially growing in an

appropriate liquid medium (usually YES).
2. Treat cells with DNA-damaging agents such as bleomycin and
phleomycin. Concentration and duration of the treatment may
vary depending on drugs used and aims of the experiments, and
should be optimized for each experiment (see Note 4).
3. After the treatment, wash cells several times with the same
medium that is used for culturing cells (but without drugs) to
remove drugs. During this wash, count the cell density, as
subsequent plug preparation should be proportionate to the
cell number.
3.2 Induction of DNA To analyze meiotic DSBs, induce fission yeast cells to enter meiosis,
Damage by Meiosis and collect those undergoing meiotic DSB generation. Because the
frequency of this event is low in fission yeast, it is essential to
synchronize meiosis induction and progression. A method for syn-
chronous meiosis induction using the temperature-sensitive pat1-
114 mutants is described below [2] (for details of the pat1-114
mutation, see Note 5).
1. Grow pat1-114 fission yeast cells in MM liquid medium at
25 C. Wash exponentially growing cells with H2O and transfer
them to MM-N at the concentration of 4 106 cells/ml.
2. Culture cells at 25 C for 12–18 h (see Note 6).
3. Centrifuge the culture at 1204 g for 5 min to harvest cells
and transfer them to MM + 1/10 N (prewarmed at 34 C) at
the concentration of 1 107 cells/ml.
4. Culture cells at 34 C, and collect cells every 1 h. Usually,
meiotic DSBs appear around 3–4 h after the induction (see
Note 7).
3.3 Preparation 1. Take 1.5 108 cells from the drug-treated or meiotic culture
of Agarose Plugs (for example, take 15 ml from a 1 107 cells/ml culture), and
centrifuge them at 1204 g for 5 min.
2. Suspend the cells in 10 ml of CSE and centrifuge them at
1204 g for 5 min. Repeat the CSE-wash again.
3. Suspend cells in 10 ml of CSE w/Zymolyase, and incubate the
suspension at 30 C for one hour with occasional agitation.
During this incubation time, dissolve LMP agarose in TSE by
microwaving and keep the solution at 50 C.
4. Collect cells by centrifugation at 1204 g for 5 min and
discard the supernatant.
5. Suspend cells in 100 μl of TSE and transfer the suspension to a
1.5 ml tube. After centrifugation at 3900 g for 1 minute,
remove supernatant completely (see Note 8).
6. Suspend the cells in 250 μl of TSE. Add 250 μl of 1% LMP

agarose in TSE, and mix quickly but thoroughly.
7. Pour appropriate amount of the cell suspension into chambers
of a plug mold. Place the plug mold at 4 C and allow the
plugs to set. Usually, 30 min is enough for this incubation (see
Note 9).
8. Dispense plugs into a tube (50 ml tubes are convenient) con-
taining 10 ml of SDS Buffer (prewarmed at 50 C) and incu-
bate them at 50 C for 1.5 h.
9. Discard SDS buffer, and pour 5 ml of Sarcosine Buffer. Wash
the plugs by gently swirling the tube, and discard the buffer.
10. Pour 5 ml of SDS Buffer again, and then add Proteinase K
solution to the final concentration of 1 mg/ml. Incubate the
plugs at 50 C for at least 48 h.
11. Wash the plugs with 10 ml of TE at least three times (see
Note 10). Plugs should be stored in TE at 4 C.
3.4 Pulsed-Field Gel 1. The height of plugs analyzed by PFGE should be shorter than
Electrophoresis that of the wells, and therefore plugs should be cut to appro-
priate size with a spatula or a razor blade, if necessary.
2. Place a plug in a 1.5 ml tube containing 1 ml of 1 TAE. Wash
the plugs by gently rocking the tube for 15 min at room
temperature.
3. Carefully remove the buffer, and add fresh 1 ml of 1 TAE.
Repeat the wash again.
4. Fill the electrophoresis chamber with 2 l of 1 TAE. Turn the
pump on, and circulate the buffer for at least 15 min to wash
the entire system (the chamber and connecting tubes).
5. Turn the pump off and drain the buffer. Repeat the wash with
fresh 2 l of 1 TAE.
6. Assemble a gel-forming stand, and then place a comb
appropriately.
7. Microwave 0.8% agarose solution in 1 TAE until the agarose
is dissolved completely. Cool the agarose solution to approxi-
mately 50 C.
8. Pour the agarose solution into the assembled gel-forming
stand. Remove bubbles, and allow the gel to set completely.
9. After the gel solidifies, carefully remove the comb.
10. Insert the washed plugs into wells of the gel, and carefully push
the plugs to the well bottom (see Note 11). Spatulas or micro-
pipette tips may be useful for this step. Pour melted 1%
LMP-agarose in TSE on top of each well, to seal the plug-
containing wells. Ensure that no bubble is trapped inside the
wells.
11. Disassemble the gel-forming stand, and take the gel to be

placed in the appropriate slot of the electrophoresis chamber.
12. Gently fill the electrophoresis chamber with 2.2 l of 1 TAE.
Turn the pump on to circulate the buffer, and then turn the
chiller on (see Note 12). Stronger flow rate is preferable in
terms of buffer circulation (and hence temperature mainte-
nance), but ensure that the gel does not float due to the
strong flow.
13. Set the temperature to 14 C. Circulate the buffer for at least
2 h, although it takes only 20–30 min until the chiller indicates
that the actual temperature is 14 C (see Note 13).
14. Start the run. One of the examples for the running condition is
as follows. Running time: 48 h, 2.0 V/cm, Included

angle:106 , Initial switching time: 20 min, Final switching
time: 30 min.
15. After the run, stop the chiller and then the pump (see Note
12). Carefully transfer the gel to a tray containing 200 ml of
ethidium bromide solution and stain the gel for an hour (see
Note 14). Destain the gel, if necessary.
16. Acquire the image of the stained gel with appropriate apparatus
such as an image analyzer or a camera.
17. Wash the entire electrophoresis system with 2 l of water for at
least 15 min. Repeat the wash two more times.
4 Notes
1. To make 20 ml of 0.1 M citrate–phosphate buffer (pH 5.6),

mix 11.6 ml of 0.2 M Na2HPO4, and 8.4 ml of 0.1 M citric
acid [3].
2. Zymolyase-100 T, which is more purified and has five times
higher activity than Zymolyase-20 T, can be used as well, but
the concentration should be 0.3 mg/ml.
3. Choice of agarose greatly influences the resolution of frag-
ments. Among various options available, choose the most
appropriate one for each experiment.
4. For bleomycin treatment of fission yeast cells, it is recom-
mended to start with 1.5 mU/ml and 90 min [4]. It should
be noted that, in some cases, high concentration of drugs can
inhibit proper DNA separation by PFGE [5]. This problem
may be at least partly caused by abnormal DNA structure such
as replication intermediates.
5. The pat1 gene codes for a kinase which negatively regulates
meiosis induction, and heat-inactivation of pat1-114 in
G1-arrested cells enables high synchronicity of meiosis
pregression [6].
6. Culturing fission yeast in nitrogen-free medium arrests cells at

G1 phase, which is the starting point of meiotic division.
G1-arrested cells are round-shaped.
7. It is highly recommended to monitor progression of premeio-
tic DNA synthesis by flow cytometry and/or meiotic divisions
by microscopic observation of DAPI-stained nuclei.
8. Remove CSE completely, otherwise final DNA concentrations
may vary among plugs. It is also important to handle cell
suspension as quickly as possible, once LMP-agarose solution
is added.
9. Plugs are fragile, and careful attention should be paid not to
scar them.
10. Plugs may be transparent at this stage, and may not be easily
visible in the buffer. Carefully wash plugs not to lose them.
11. It is recommended to fill wells with 1 TAE prior to inserting
plugs. This is helpful to detect trapped bubbles and load plugs.
12. It is important to turn the pump on first. Running the chiller
without turning on the pump can interfere with temperature
control, and damage the chiller. For the same reason, turn off
the chiller first, when the run is complete.
13. To obtain reproducible results, it is important to keep the
temperature of inside the gel to be 14 C. Bear in mind that
the temperature indicator of the chiller monitors temperature
of the buffer and may not reflect that of the gel.
14. Other dyes such as SYBR Green can be used, but duration of
staining and concentration should be optimized for the
dye used.
Acknowledgments
We thank Dr. Ee Sin Chen for comments on the manuscript and

Dr. Shintaro Yamada for the original image of Fig. 2.
Fig. 2 An example of PFGE analyses of meiotic fission yeast cells. Signals of

intact chromosomes and broken DNA fragments are indicated by three horizontal
bars and the vertical line, respectively. Note that meiotic DSBs appear at 3 h
after meiosis induction and disappear due to repair by 7 h
References
1. Yamada T, Ohta K (2016) Regulation of recom- 4. Nicolas E, Yamada T, Cam HP, FitzGerald PC,
bination by chromatin. In: Hanaoka F, Sugasawa Kobayashi R, Grewal SIS (2007) Distinct roles
K (eds) DNA replication, recombination, and of HDAC complexes in promoter silencing,
repair—molecular mechanisms and pathology. antisense suppression and DNA damage protec-
Springer, Tokyo tion. Nat Struct Mol Biol 14:372–380
2. Murakami H, Nurse P (1999) Meiotic DNA 5. Tang MYR, Guo HF, Nguyen TTT, Low LS,
replication checkpoint control in fission yeast. Jackson RA, Yamada T, Chen ES (2015) Two
Genes Dev 13:2581–2593 fission yeast high mobility group box proteins in
3. McIlvaine TC (1921) A buffer solution for the maintenance of genomic integrity following
colorimetric comparison. J Biol Chem doxorubicin insult. Gene 562:70–75
49:183–186 6. Yamamoto M (1996) Regulation of meiosis in
fission yeast. Cell Struct Funct 21:431–436
Chapter 13
Detection of DNA Double-Strand Breaks by Pulsed-Field

Gel Electrophoresis of Circular Bacterial Chromosomes
Ichizo Kobayashi and Katsuhiro Hanada
Abstract
Double-strand breakage of DNA is a process central to life and death in DNA-coded organisms. Its sensitive
and quantitative detection is realized by pulsed-field gel electrophoresis of a huge (Mb) circular chromo-
some. A single double-strand break at one of its millions of potential sites will make it linear and release it
from branches of an agarose jungle. Then the huge fragments will move according to their size. We
developed this method to analyze formation of DNA double-strand breaks and their processing in E. coli.
Here we detail our protocol taking the example of chromosome breaks caused by action of a restriction
enzyme in vivo. It is important to prevent formation of irrelevant double-strand breaks.
Key words DNA double-strand break, DNA repair, DNA recombination, DNA replication, Bacterial
chromosome, Restriction endonuclease
1 Introduction
Double-strand breakage of DNA is central to many processes in life

and death in all the DNA-based organisms examined. These pro-
cesses include DNA replication, DNA recombination, DNA dam-
age repair, mutagenesis, and programmed cell death. There are
many methods developed for its detection [1]. Among these,
pulsed-field gel electrophoresis owes its advantage to its quantita-
tive nature with a wide dynamic range.
Change of electrophoretic mobility of a plasmid after its con-
version from a circular to a linear form by a single double-strand
break has been known for a long time. The difference in mobility
was used to detect a single double-strand break on a yeast circular
chromosome of 300 kb in pulsed-field gel electrophoresis [2]. The
chromosome of E. coli of 5 Mb cannot even enter the gel and stay in
the starting point (well) under standard conditions for pulsed-field
gel electrophoresis, presumably trapped in the branches of agarose
resin. However, after breakage, it moves through the agarose. We
detected DNA double-strand breakage by this principle [3–5]. It
145
146 Ichizo Kobayashi and Katsuhiro Hanada
Fig. 1 Pulse-field gel electrophoresis to detect bacterial chromosome breakage.

E. coli (mcrBC+) cells carrying a plasmid with pvuIIM under the pBAD promoter
were grown under antibiotic selection to the mid-exponential phase, diluted and
further grown in the presence of 0%, 0.002% or 0.002% arabinose (ara) to
induce expression of M.PvuII. At the indicated time intervals (in minutes),
chromosomal DNA was prepared and subjected to pulsed-field agarose gel
electrophoresis. M, λ DNA ladder. λ/Hind, λ DNA cut with HindIII. Modified
from Fig. 4b of [6] under Creative Commons Attribution License 4.0
has become a sensitive and quantitative method in detecting DNA

double-strand breaks especially in bacteria [1].
Here we introduce the protocol developed in Kobayashi lab at
University of Tokyo. It departs from the manufacturer’s manual in
several points to obtain clear patterns. The example used is an
analysis of breakage of E. coli chromosome by its own methyl-
specific restriction enzyme after expression of a DNA methyltrans-
ferase (Fig. 1) [6, 7].
(1) The most important point with this technique is to prevent
breakage of long DNA either by physical shearing force or by the
action of DNases, endogenous or exogenous. The cells are instantly
killed by 2,4-dinitrophenol, which prevents DNA degradation by
ATP-dependent exonucleases. The cells are lysed and the chromo-
somes are deproteinized very gently within an agarose plug to avoid
shearing of DNA. All the tubes and vessels should be free from any
DNases, for example, restriction enzymes left from previous experi-
ments, and from any DNase-producing microorganisms. (2) Prepa-
ration and handling of agarose plugs and gel are critical. They
should be homogeneous. Control of temperature of agarose,
tubes, and vessels is important. If the agarose cools down too
quickly, the gel may become heterogeneous. Formation of bubbles
needs to be avoided by repeated pipetting and careful transfer. The
plugs and the gel are slippery and needs special tools, such as an
DNA Double-Strand Breakage as Detected by PFGE 147
inoculation loop (Fig. 5d) and a cooking spatula (Fig. 5e), and
extreme care in handling. (3) Another point is to set the electro-
phoresis cell and the gel in a horizontal position with a spirit level
(Fig. 5c).
2 Materials
2.1 Sample 1. Spirit level (Fig. 5c). Use one to make sure the working space
Preparation on lab bench, the apparatus, and the tray are horizontal.
2. Plastic gloves. Not slippery.
3. 1.5 mL sample tubes and 5 mL sample tubes. The tubes and
vessels used here and elsewhere have been sterilized and dried.
4. Comb mold (Figs. 4 and 5a), comb stand (Fig. 6), and comb
(Fig. 6) (Bio-Rad). Washed and dried.
5. Inoculation loop (Fig. 5d). Plastic, disposable, and sterile. For
handling of agarose plugs.
6. 2,4-dinitrophenol. Dissolve 100 mg in 5 mL water. Then
filtrate with 0.2 μm filter syringe. Water used here and else-
where is ultrapure and sterilized.
7. 2% agarose gel. Dissolve 1 g of SeaPlaque GTG agarose (BMA)
in 50 mL water. Heat to dissolve agarose well. Keep at 50 C
(see Note 1).
8. 1 M Tris-Cl (pH 8.0). Autoclave. Store at room temperature.
9. 0.5 M EDTA (pH 8.0). Autoclave. Store at room temperature.
10. 5 M NaCl. Autoclave. Store at room temperature.
11. 10% sodium deoxycholate: dissolve 10 g in 80 mL water and
make up to 100 mL with water. Then filtrate with 0.2 μm filter.
Store at room temperature. Protect from light.
12. 10% Sodium lauroyl sarcosinate: dissolve 10 g in 80 mL water
and make up to 100 mL with water. Then filtrate with 0.2 μm
filter. Store at room temperature.
13. Suspension buffer: 10 mM Tris-Cl (pH 8.0), 20 mM NaCl,
50 mM EDTA. Mix water, 150 μL of 1 M Tris-Cl (pH 8.0),
60 μL of 5 M NaCl, and 1.5 mL of 0.5 M EDTA. Adjust to
15 mL with water. Store at room temperature.
14. Lysozyme stock solution: 25 mg/mL Lysozyme, 10 mM Tris-
Cl (pH 8.0). Mix water, 250 mg of Lysozyme and 100 μL of
1 M Tris-Cl (pH 8.0). Adjust to 10 mL with water. Store at
20 C.
15. Lysozyme solution: 1 mg/mL Lysozyme, 0.2% Sodium deox-
ycholate, 0.5% Sodium lauroyl sarcosinate, 10 mM Tris-Cl
(pH 8.0), 50 mM NaCl, 10 mM EDTA. Mix water, 150 μL
of 1 M Tris-Cl (pH 8.0), 150 μL of 5 M NaCl, 300 μL of 0.5 M
EDTA, 300 μL of 10% Sodium deoxycholate, 750 μL of 10%

Sodium lauroyl sarcosinate, and 600 μL of 25 mg/mL Lyso-
zyme. Adjust to 15 mL with water. Prepare just before use.
16. Proteinase K stock solution: 20 mg/mL proteinase K, 10 mM
Tris-Cl (pH 8.0). Mix water, 100 μL of 1 M Tris-Cl (pH 8.0),
and 200 mg of Proteinase K. Adjust to 10 mL with water. Store
at 20 C.
17. Proteinase K solution: 1 mg/mL Proteinase K, 100 mM
EDTA, 0.2% Sodium deoxycholate, 1% Sodium lauroyl sarco-
sinate. Mix water, 3 mL of 0.5 M EDTA, 300 μL of 10%
Sodium deoxycholate, 1.5 mL of 10% Sodium lauroyl sarcosi-
nate, and 750 μL of 20 mg/mL Proteinase K. Adjust to 15 mL
with water. Prepare just before use.
18. Wash buffer: 20 mM Tris-Cl (pH 8.0), 100 mM EDTA. Mix
water, 2 mL of 1 M Tris-Cl (pH 8.0) and 20 mL of 0.5 M
EDTA. Adjust to 100 mL with water. Store at room
temperature.
2.2 Electrophoresis 1. CHEF DRIII apparatus (Bio-Rad) (Fig. 2). Gel tray (Fig. 6).
Make sure they are horizontal with a spirit level (Fig. 5c).
2. Plastic container for gel stain. Wash and dry (see Note 2).
3. A large spatula for cooking (Fig. 5e). To move the gel (see
Note 3).
4. 10 TBE. Mix water, 54 g of Trizma base, 27.5 g of boric acid,
and 20 mL of 0.5 M EDTA. Adjust to 500 mL with water.
Filtrate with 0.2 μm filter. Store at room temperature.
Fig. 2 Machine for pulsed-field gel electrophoresis. CHEF III by Bio-Rad. The
electrophoresis gel is placed in the cell
Fig. 3 Preparation of agarose plugs. Incubation of the plug is carried out with
gentle shaking (Fig. 5b)
5. 1.2% agarose (Running gel). Add 2.16 g Certified Megabase

Agarose (Bio-Rad) to 171 mL water. Heat. After melting,
adjust to 171 mL with water, add 9 mL 10 TBE and mix
well. Keep at 60 C (see Note 1).
6. 0.5 TBE. Dilute 10 TBE 20-fold with water. Keep in the
refrigerator or on ice until use.
3 Methods
3.1 Preparing Plugs Outlined in Figs. 3 and 4. Wear gloves throughout.

1. Dilute an overnight culture of bacteria 100 fold in Luria–
Bertani (LB) medium. Incubate at 37 C with aeration.
Plug preparation
2,4-dinitrophenol 2% low-melting agarose

(melted at 50ºC)
cell
mix
Plug mold
on ice
Plug
(1% agarose)
Fig. 4 Preparation of plugs. A simplified scheme
2. When the culture reached mid-exponential phase

(OD600 ¼ 0.6), transfer 0.5 mL of the culture to a 1.5-mL
tube containing 2.5 μL of 2% 2,4-dinitrophenol on ice and
immediately Vortex gently (see Note 4).
3. Centrifuge at 1000 g for 5 min at 4 C.
4. Discard the supernatant. Add 250 μL of suspension buffer
mixed with 1.25 μL of 2% 2,4-dinitrophenol. Vortex.
5. Centrifuge at 1000 g for 5 min at 4 C.
6. Place the comb mold firmly on seal.
7. Discard the supernatant. Add 250 μL of suspension buffer and
Vortex.
8. Place the tube on aluminum block at 50 C. Add 250 μL of 2%
SeaPlaque GTG agarose kept at 50 C, and mix well by pipet-
ting (Fig. 4) (see Note 5).
9. Then carefully transfer the mixture into a hole of the plug mold
with a pipette (Fig. 4). One plug occupies 80–90 μL. One
culture suspension can make up to five plugs.
10. Place the plug mold on ice for 10 min to solidify agarose.
3.2 In-Plug 1. Aliquot 1.5 mL Lysozyme solution in a 5 mL tube.

Reactions 2. Remove the seal on the bottom of the mold. With a plastic
piece, push the plug out of the mold into the Lysozyme solu-
tion (Fig. 5a). Up to five plugs from an identical culture can be
placed in one tube.
3. Incubate the tube at 37 C for 2 h with slow shaking in a
hybridization oven (Fig. 5b).
4. Discard the Lysozyme solution. Wash with water. (Add 2.5 mL
of pure water. Stir gently with a finger and discard water.) Use
In-plug reactions
A. Transfer the plug to a tube. B. Incubation.
C. Spirit level. D. Inoculation loop E. Spatula
Fig. 5 In-plug reactions. (a) Transfer of a plug from the plug mold into Lysozyme solution. (b) Incubation of
plugs in tubes with slow shaking in a hybridization oven. (c) Spirit level. From Wikipedia (Public Domain). (d)
Inoculation loop. By Nadina Wiórkiewicz (https://commons.wikimedia.org/wiki/File:Inoculation_loop-plastic_
big.jpg). Reproduced under Creative Commons Attribution-Share Alike 3.0 Unported license. (e) Spatula
(spatule coudée). By Vorzinek (https://commons.wikimedia.org/wiki/File:Spatule_coudee.jpg). Reproduced
under Creative Commons Attribution-Share Alike 3.0 Unported license
inoculation loop (Fig. 5d) to gently hold the plug during

exchange of liquids (see Note 6).
5. Add 2.5 mL Proteinase K solution and incubate overnight
(~15 h) at 50 C with slow shaking in a hybridization oven.
6. Discard the liquid. Add 2.5 mL Wash buffer and shake gently
for 15 min at room temperature. Repeat this wash.
7. Add 2.5 mL Wash buffer and store at 4 C.
3.3 Preparing 1. Make sure the gel tray lies horizontally with a spirit level
Electrophoresis Gel (Fig. 5c).
2. Attach a comb to the comb stand (black). Lay the comb stand
on the empty gel tray (Fig. 6).
3. Recover a plug from the wash buffer with an inoculation loop
(Fig. 5d). Place the plug on a tooth of the comb. Remove extra
liquid with Kimwipes. Align all the plugs. Fix each plug to each
tooth with a tiny amount of melted 1.2% agarose at 60 C
delivered by a 1000 μL pipette (see Note 7).
4. Place an agarose piece with size marker fragments (Bio-Rad) on
a tooth in the same way.
5. Leave the tray in the refrigerator for 5 min.
Gel preparation • Stand up the comb.

• Pour agarose from the back.
Make sure bench and tray are
horizontal with a spirit level.
• Melted agarose at 60ºC.

• Lay a comb on a tray.
• Place each plug on each tooth
with a inoculator loop.
• Add a small amount of
agarose to connect them.
• Carefully remove the comb.
• Fill the resulting wells with agarose.
Fig. 6 Preparation of electrophoresis gel. Agarose is poured around the comb with attached plugs. This gives a
cleaner electrophoresis pattern
6. Stand up the comb stand with the teeth on the side of the closer
electrodes. The plugs are on the opposite side (side of electro-
phoresis movement) on the teeth (Fig. 6). Slowly pour melted
1.2% agarose kept at 60 C on the gel tray. 270 mL for the
larger gel and 180 mL for the smaller gel. Cover with alumi-
num foil. Leave at room temperature for 30–40 min until
agarose is solid. (They change from transparent to white.)
Then leave it in the refrigerator for 10 min.
7. Carefully remove the comb (see Note 8).
8. Carefully fill each of the resulting holes by melted 1.2% agarose
with a 100-μL pipette (see Note 9).
9. Place the gel tray in the refrigerator for 5 min.
3.4 Electrophoresis 1. Start before preparation of the gel. Make sure the electropho-
resis cell is horizontal with a spirit level (Fig. 5c). Pour 2.4 L of
0.5 TBE, circulate by pump (Fig. 2, left) with cooling to
14 C.
2. Gently place the tray in the electrophoresis cell (Fig. 2, middle).
3. Start electrophoresis with the setting below (see Note 10).
Pulse time: 5–40 s.
Duration: 18 h.
Temperature: 14 C.
Voltage: 6 V/cm.
Angle: 120 .
4. Add 10 mg/mL ethidium bromide 50 μL to 500 mL of the
running buffer in a plastic container and mix.
5. After electrophoresis, turn off the pump. Drain off the running
buffer from hose in the right hole (Fig. 2, center). Take off
the lid. Remove the black frame around the gel and slide off the
gel from the plate. Use a large spatula for cooking (Fig. 5e).
Carefully transfer the gel to the plastic container with
ethidium bromide. Shake gently at room temperature for 1 h
(see Note 11).
6. Transfer the gel with the spatula to a container with tap water
and shake gently at room temperature for 30 min. Discard
water.
7. Add water to the electrophoresis cell of the machine, circulate
water and discard water. Repeat this. Leave the cover slightly
open to dry.
8. Take digital picture of the gel and analyze.
4 Notes
1. Agarose concentration is critical. Upon heating, water evapo-

rates. Add water to adjust volume and concentration here and
elsewhere. Do not leave agarose solution at a high temperature
because the concentration will increase.
2. Gel tray, the comb mold, and the comb should be freed from
DNases and DNase-secreting microorganisms. Their previous
use for electrophoresis of restriction fragments may leave some
restriction enzyme.
3. The spatula should be in a square shape with wide edges, which
can temporarily hold the gel at the proximal side (Fig. 5e). Do
not use a triangle-shaped spatula. The gel will easily slip off and
break.
4. Do not leave the culture in the shaker, on ice or at room
temperature before adding 2,4-dinitrophenol.
5. Before transfer of agarose, pipet in and out agarose several
times.
6. Never vortex the plugs. They will be easily broken.
7. This procedure of placing the plugs gives cleaner results.
8. Do not add water or liquid here.
9. Watch the holes from side (in the direction perpendicular to

the electrophoresis direction). If the gel is too cold, the filled
agarose becomes heterogeneous.
10. Here are two parameter sets with CHEF DRIII system. For
10–500 kb fragments, 1.2% agarose, 0.5 TBE, 14 C, 5–40 s,
6 V/cm,120 , 18 h. For 200 kb–2.2 Mb, 1% agarose, 0.5
TBE, 14 C, 60–120 s, 6 V/cm,120 , 24 h.
11. The gel is slippery. It often drops and breaks into pieces at this
final stage. They may be reassembled as in a jigsaw puzzle for
analysis, but the product may not be as beautiful as in the
puzzle.
Acknowledgments
This work is based on the lab protocol developed in Kobayashi lab

and a presentation material assembled by Dr. Eri Fukuda, which
have been modified by other lab members.
References
1. Klein HL, Bačinskaja G, Che J, Cheblal A, changes in Escherichia coli DNA. Detection by
Elango R, Epshtein A, Fitzgerald DM, Gómez- pulsed field gel electrophoresis and evidence for
González B, Khan SR, Kumar S, Leland BA, involvement of homologous recombination. J
Marie L, Mei Q, Miné-Hattab J, Piotrowska A, Mol Biol 243:611–620. https://doi.org/10.
Polleys EJ, Putnam CD, Radchenko EA, Saada 1016/0022-2836(94)90036-1
AA, Sakofsky CJ, Shim EY, Stracy M, Xia J, 4. Naito T, Kusano K, Kobayashi I (1995) Selfish
Yan Z, Yin Y, Aguilera A, Argueso JL, Freuden- behavior of restriction-modification systems.
reich CH, Gasser SM, Gordenin DA, Haber JE, Science 267:897–899. https://doi.org/10.
Ira G, Jinks-Robertson S, King MC, Kolodner 1126/science.7846533
RD, Kuzminov A, Lambert SA, Lee SE, Miller 5. Handa N, Kobayashi I (2003) Accumulation of
KM, Mirkin SM, Petes TD, Rosenberg SM, large non-circular forms of the chromosome in
Rothstein R, Symington LS, Zawadzki P, recombination-defective mutants of Escherichia
Kim N, Lisby M, Malkova A (2019) Guidelines coli. BMC Mol Biol 4:5. https://doi.org/10.
for DNA recombination and repair studies: cel- 1186/1471-2199-4-5
lular assays of DNA repair pathways. Microb Cell
6:1–64. https://doi.org/10.15698/mic2019. 6. Fukuda E, Kaminska KH, Bujnicki JM, Kobaya-
01.664 shi I (2008) Cell death upon epigenetic genome
methylation: a novel function of methyl-specific
2. Game JC, Sitney KC, Cook VE, Mortimer RK deoxyribonucleases. Genome Biol 9:R163.
(1989) Use of a ring chromosome and pulsed- https://doi.org/10.1186/gb-2008-9-11-r163
field gels to study interhomolog recombination,
double-strand DNA breaks and sister-chromatid 7. Fukuyo M, Sasaki A, Kobayashi I (2012) Success
exchange in yeast. Genetics 123:695–713 of a suicidal defense strategy against infection in
a structured habitat. Sci Rep 2:238. https://doi.
3. Nakayama K, Kusano K, Irino N, Nakayama H org/10.1038/srep00238
(1994) Thymine starvation-induced structural
Chapter 14
Detection of Bleomycin-Induced DNA Double-Strand Breaks

in Escherichia coli by Pulsed-Field Gel Electrophoresis
Using a Rotating Gel Electrophoresis System
Naomi Inoue, Hisashi Narahara, Yoshihiro Nishida, and Katsuhiro Hanada
Abstract
DNA double-strand break (DSB) is one of the most genotoxic lesions, and unrepaired DSBs can lead to
chromosomal instability and eventually cause cell death. Quantitative markers, such as phosphorylated
histone H2AX (γ-H2AX) and p53-binding protein 1 (53BP1) foci in mammalian cells, are not available for
the detection of DSBs in prokaryotes. Therefore, as an alternative method, pulsed-field gel electrophoresis
(PFGE) is widely used to analyze broken DNA molecules by separating them from intact DNA. Here, we
examined the accumulation of bleomycin (BLM)-induced DSBs by PFGE, using a rotating gel electropho-
resis (RGE) system. We defined two sets of parameters with distinct advantages; the first one focuses on the
analysis of the size of the broken DNA fragments, whereas the second allows for the direct comparison of
the accumulation of DSBs among strains and treatments. This method represents a powerful tool for the
study of genomic integrity and the characterization of genotoxic substances.
Key words Genomic integrity, DNA-damaging agents, Homologous recombination, Oxidative DNA
damage, Chromosomal instability
1 Introduction
Genomic integrity is essential for various aspects of DNA metabo-

lism; therefore, DSBs represent a serious challenge for all living
organisms [1–3]. In Escherichia coli, chromosome breaks often
result from spontaneous DSBs that can occur when DNA replica-
tion forks encounter various problems, such as DNA damage,
nucleotide starvation, and DSB repair dysfunction [3–5]. Several
exogenous DNA damaging agents are also known to cause DSBs
[4]. In E. coli, homologous recombination (HR) is the predomi-
nant DSB repair pathway and is essential to prevent the accumula-
tion of DSBs and maintain genomic integrity [6]. If HR fails, DSB
repair can occur through illegitimate recombination, a significant
source of chromosomal instability [7, 8]. In the first step of HR, the
RecBCD helicase-nuclease binds to a broken DNA end and starts
155
156 Naomi Inoue et al.
degrading DNA with its exo- and endonuclease activities

[9, 10]. When RecBCD encounters a specific sequence called a
crossover hotspot instigator (Chi), its processing mode changes
to adopt a 50 to 30 exonuclease activity that results in the production
of a 30 -overhang single-stranded DNA region. In the second step of
HR, the RecA protein polymerizes on the 30 -overhang region,
which results in the formation of a RecA-DNA nucleoprotein
filament [11]. This nucleoprotein filament drives homology search
and catalyzes a strand exchange reaction between two homologous
sequences, which produces a triple-stranded DNA structure
[11]. In E. coli, RecA can catalyze an additional reaction to convert
a triple-stranded DNA structure into a quadruple-stranded struc-
ture with a four-way junction, which is called a Holliday junction
[12]. In the final step of HR, the Holliday junction is cleaved by a
structure-specific endonuclease called Holliday junction resolvase
[13], which separates the two homologous DNA molecules.
In eukaryotic cells, various markers, such as γ-H2AX and
53BP1, can be used to visualize and quantify DSB sites, but there
is limited availability of this type of marker in prokaryotes
[14, 15]. Therefore, PFGE is often used to detect spontaneous
and damage-induced DSBs in prokaryotes [5, 16, 17]. Here, we
detail a protocol of PFGE for the detection of BLM-induced DSBs
using an RGE system. BLM is an oxidative DNA damaging agent
that can cause various DNA lesions, including 8-oxoguanines and
both single- and double-strand DNA breaks [18, 19]. E. coli wild-
type, recA13, and recB21 strains were treated for 30 min with
increasing concentrations of BLM, and the resulting accumulation
of DSBs was analyzed by PFGE using two different sets of para-
meters. The accumulation of DSBs was first analyzed using typical
PFGE parameters (Version 1, typical setting), which are detailed
below. Since BLM-induced DSBs occur randomly, the resulting
broken DNA consists of a mixture of DNA fragments of various
sizes, which appear as smeared bands in PFGE (Fig. 1).
BLM-induced DSBs are hardly detectable in the wild-type and
recA mutant strains, whereas a dose-dependent accumulation of
DSBs is visible in the recB mutant strain (Fig. 1). The main advan-
tage of this setting is to determine the sizes of the broken DNA
fragments. However, with this setting, it is difficult to compare the
intensity of the smeared bands among different samples.
Next, the same samples were analyzed using modified para-
meters (Version 2, modified setting), which are detailed below.
With this modified setting, the DNA fragments between 500 kb
and 2 Mb are compacted in a single band, which greatly facilitate
the visualization of DNA fragments over 500 kb and the compari-
son among different samples (Fig. 2). While a dose-dependent
accumulation of DSBs is visible in the recB mutant strain, a modest
accumulation of DSBs is also detected in the wild-type and recA
mutant strains (Fig. 2). Importantly, with the modified PFGE
Analysis of DSBs in E. coli by PFGE 157
Fig. 1 Analysis of BLM-induced DSBs by PFGE. The PFGE parameters were optimized to analyze a wide range
of DNA sizes. Saccharomyces cerevisiae chromosomes were used as DNA size markers for PFGE
Fig. 2 Analysis of BLM-induced DSBs by PFGE. The PFGE parameters were optimized to compact the DNA
fragments between 500 kb and 2 Mb in a single band length. Saccharomyces cerevisiae chromosomes were
used as DNA size markers for PFGE
parameters, a moderate but clear induction of DSBs in the wild-

type and recA mutant strains can be detected after treatment with
12 μM BLM, which is not the case with the typical PFGE para-
meters (Figs. 1 and 2). Therefore, the modified setting is optimal to
compare the accumulation of DSBs among samples.
To summarize, we show that DSBs induced by DNA damaging
agents can be detected by PFGE using an RGE system. Two
different sets of parameters give two distinct presentations, focus-
ing on the sizes of the broken DNA fragments and the relative
accumulation of DSBs, respectively. This method therefore repre-
sents a powerful tool for the study of genomic integrity in prokar-
yotes and the characterization of genotoxic substances.
2 Materials
2.1 Bacterial Culture 1. 14 mL round-bottom polystyrene tubes.

2. Luria-Bertani (LB) medium.
3. 10 mM Bleomycin (BLM) stock solution. Dissolve 5 g BLM in
350 μL dimethyl sulfoxide (DMSO), prepare 50 μL aliquots,
and store at 20 C. Keep protected from light.
4. Bacterial strains: All strains were E. coli K12 derivatives and
were obtained from the National BioResource Project (NBRP)
E. coli Strain collection (Microbial Genetics Laboratory,
National Institute of Genetics, Mishima, Japan). AB1157 is a
control strain (wild-type), whereas AB2463 and AB2470 are
both isogenic strains of AB1157 that carry mutations in the
recA (recA13) and recB (recB21) genes, respectively.
2.2 Sample 1. 1.5 mL and 2 mL sample tubes.

Preparation (Plugs 2. 1% agarose: Add 1 g of certified megabase agarose (Bio-Rad) to
for PFGE) 100 mL of pure water. Melt the agarose using a microwave just
before preparing the plugs.
3. Dulbecco’s phosphate-buffered saline () (D-PBS; WAKO).
Autoclave and store at RT.
4. 1 M Tris-HCl, pH 8.0. Autoclave and store at RT.
5. 0.5 M EDTA, pH 8.0. Autoclave and store at RT.
6. Lysis buffer: 100 mM EDTA, 0.2% sodium deoxycholate, 1%
sodium lauryl sarcosine. Dissolve 2 g of sodium deoxycholate
and 10 g of sodium lauryl sarcosine in 800 mL of ultrapure
water and then add 200 mL of 0.5 M EDTA. Do not autoclave.
Store at RT.
7. 10 mg/mL Proteinase K stock solution. Dissolve 100 mg of
proteinase K in 10 mL of ultrapure water. Prepare 500 μL and
store at 20 C.
8. Proteinase K buffer: 100 mM EDTA, 0.2% sodium deoxycho-

late, 1% sodium lauryl sarcosine, 1 mg/mL proteinase K. Mix
900 μL of lysis buffer with 100 μL of 10 mg/mL proteinase K
stock solution. Prepare this solution just before use.
9. Lysozyme solution: 100 mM EDTA, 0.2% sodium deoxycho-
late, 1% sodium lauryl sarcosine, 1 mg/mL lysozyme. Dissolve
10 mg of lysozyme in 10 mL of lysis buffer. Prepare this
solution just before use.
10. Tris-EDTA (TE) buffer for PFGE: 10 mM Tris-HCl, 100 mM
EDTA. Mix 10 mL of 1 M Tris-HCl with 200 mL of 0.5 M
EDTA and then adjust the volume to 1 L with ultrapure water.
Autoclave and store at RT.
2.3 PFGE 1. PFGE apparatus (Rotaphor 6.0 RGE system, Analytik Jena).
2. 10 Tris-Borate-EDTA (TBE) buffer: Dissolve 108 g of Tris
and 55 g of boric acid in 800 mL of pure water, add 40 mL of
0.5 M EDTA, and adjust the volume to 1 L with pure water.
Store at RT.
3. 0.9% agarose running gel: Mix 10 mL of 10 TBE with
390 mL of pure water and then add 3.6 g of PFGE-grade
agarose. Melt the agarose using a microwave, cool down to
approximately 50 C, and pour on a gel tray. Keep at RT until
the agarose gel is set.
4. 0.25 TBE Running buffer: 40 times dilution of 10 TBE.
For 2.4 L of running buffer, mix 60 mL of 10 TBE with
2.34 L of pure water. Store this buffer in the refrigerator or
keep on ice until used (see Note 1).
3 Methods
3.1 Plugs 1. Dilute overnight cultures with LB medium (30 μL overnight

Preparation cultures in 3 mL LB medium (100-fold dilution) for wild type
strain, 150 μL overnight cultures in 3 mL LB medium (20-fold
dilution) for recB mutant strain) and then incubate them at
37 C with aeration until they reach the exponential growth
phase (defined as OD600 ¼ 0.6). The necessary incubation time
is approximately 3 h.
2. When each culture reaches the exponential growth phase, treat
the bacteria as desired (e.g., add defined amounts of a chemical
of interest to the cultures and incubate for a certain amount of
time). Here, we treated various E. coli strains with increasing
amounts of BLM (3, 6, and 12 μM) and then incubated the
cultures for 30 min.
3. After the BLM treatment, transfer 2 mL of each bacterial
culture into a fresh 2 mL tube (see Note 2).
4. Centrifuge at 5000 g for 1 min to harvest the bacteria.

5. Discard the growth medium, add 1 mL of D-PBS to the pellet,
and resuspend the bacteria by vortex.
6. Centrifuge at 5000 g for 1 min to harvest the bacteria.
7. Discard the supernatant and resuspend the pellet in 200 μL of
D-PBS.
8. Add the same volume of melted 1% agarose (i.e., 200 μL) to
each sample, mix well by pipetting, and load immediately the
cell suspension into the plug mold. This step is time sensitive
and should be performed as quickly as possible (see Note 3).
9. Leave the plug mold at RT or 4 C until the agarose is set.
10. For each sample, transfer 1 mL of lysozyme solution into a
fresh 1.5–2 mL tube.
11. When the agarose plugs are set, drop the plugs into the lyso-
zyme solution and incubate the plugs in lysozyme solution for
1 h at 37 C.
12. Discard the lysozyme solution.
13. [Optional] Wash the plugs twice with 500 μL of lysis buffer.
14. Add 1 mL of proteinase K buffer to each tube and incubate the
plugs in proteinase K buffer overnight at 37 C.
15. [Optional] Plugs can be stored at 4 C for several months.
Before storing the plugs, wash the plugs three times with
1 mL of TE buffer for PFGE (15 min per wash with shaking).
DO NOT freeze the plugs.
3.2 PFGE 1. Set a 0.9% agarose running gel using the gel tray. We usually use
the large casting frame (20 cm 20 cm).
2. Remove the comb and fill all the wells with TE buffer
for PFGE.
3. Slide each plug into a well (see Note 4).
4. After loading the plugs into the wells of the gel, remove the TE
buffer for PFGE remaining in the wells with a pipettor and
wipe the running gel with a paper towel.
5. Seal all the wells with 0.9% agarose running gel melted prepa-
ration and wait until the agarose is set.
6. Remove the gel frame and transfer the gel tray to the RGE
apparatus.
7. Use one of the sets of parameters described below, and start the
PFGE.
(a) <Version 1, typical PFGE setting (representative data are
shown Fig. 1)>
Running time: 24 h.
Running temperature: 13 C.
Pulse time: 100 s to 20 s, logarithmic.

Voltage: 200 V to 150 V, logarithmic.
Angle: 120 to 110 , linear.
Buffer: 2.4 L of running buffer.
No inverse.
(b) <Version 2, modified PFGE setting (representative data
are shown Fig. 2)>.
Duration: 23 h.
Temperature: 13 C.
Pulse time: 30 s to 5 s, logarithmic.
Voltage: 180 V to 120 V, logarithmic.
Angle: 120 to 110 , linear.
Buffer: 2.4 L of running buffer.
No inverse.
8. At the end of the electrophoresis, transfer the gel to a plastic
container, and stain overnight at RT with 0.5 mg/m + ethidium
bromide in 0.25 TBE (see Note 5).
9. After staining, wash the gel on a shaker, overnight at RT with
water. If necessary, destain the gel for 30 min with 500 mL of
0.25 TBE buffer.
10. Analyze the gel with a gel imaging system. We used a Typhoon
FLA 7000 scanner (GE).
11. [Optional] If required, use a gel and image analysis software to
obtain quantitative data. We used the ImageQuant software
(GE) for the quantitative analysis of our results.
4 Notes
1. Temperature is critical for PFGE. Running buffer is usually

prepared using cold water. Running buffer prepared with
water below 13 C can usually be used for PFGE without any
problem.
2. Our standard procedure does not include 2,4-dinitrophenol, a
reagent often used to block the cellular metabolism. If
required, add 5 μL of 2% 2,4-dinitrophenol to 1 mL of bacteria
culture (the final concentration is 0.01%) to block the cellular
metabolism.
3. Here, we prepared the plugs using a Bio-Rad plug mold sys-
tem. Each plug on this plug mold system has a set volume of
80 μL. Therefore, one plug requires a minimum amount of
50 μL of bacterial suspension and 50 μL of 1% agarose. After
loading the samples into the plug mold, leave the plug mold at
RT or 4 C until the agarose is set.
4. The wells must be filled with TE buffer for PFGE to load the
plugs into the wells of the agarose gel. After filling the wells
with TE buffer for PFGE, slide each plug into a well. To
facilitate this step, we usually use microscopy coverslips to
slide the plugs into the wells.
5. Ethidium bromide staining of PFGE gels is less efficient than
that of regular electrophoresis agarose gels. Therefore, we
recommend performing overnight ethidium bromide staining.
Alternatively, SYBR dyes, such as SYBR Gold and SYBR Green,
can be used to improve detection sensitivity.
Acknowledgments
All bacterial strains used in this study were provided by the National
BioResource Project (NBRP) E. coli Strain collection (Microbial
Genetics Laboratory, National Institute of Genetics, Mishima,
Japan).
References
1. Hanada K, Yamashita T, Shobuike Y, Ikeda H 8. Hanada K, Iwasaki M, Ihashi S, Ikeda H

(2001) Role of DnaB helicase in UV-induced (2000) UvrA and UvrB suppress illegitimate
illegitimate recombination in Escherichia coli. J recombination: synergistic action with RecQ
Bacteriol 183:4964–4969 helicase. Proc Natl Acad Sci U S A
2. Shiraishi K, Ogata Y, Hanada K, Kano Y, Ikeda 97:5989–5994
H (2007) Roles of the DNA binding proteins 9. Courcelle J, Wendel BM, Livingstone DD,
H-NS and StpA in homologous recombination Courcelle CT (2015) RecBCD is required to
and repair of bleomycin-induced damage in complete chromosomal replication: implica-
Escherichia coli. Genes Genet Syst 82:433–439 tions for double-strand break frequencies and
3. Michel B, Sinha AK, Leach DRF (2018) Repli- repair mechanisms. DNA Repair (Amst)
cation fork breakage and restart in Escherichia 32:86–95
coli. Microbiol Mol Biol Rev 82 10. Smith GR (2012) How RecBCD enzyme and
4. Seigneur M, Bidnenko V, Ehrlich SD, Michel B Chi promote DNA break repair and recombi-
(1998) RuvAB acts at arrested replication nation: a molecular biologist’s view. Microbiol
forks. Cell 95:419–430 Mol Biol Rev 76(2):217–228
5. Handa N, Kobayashi I (2003) Accumulation of 11. Bell JC, Kowalczykowski SC (2016) RecA: reg-
large non-circular forms of the chromosome in ulation and mechanism of a molecular search
recombination-defective mutants of Escheri- engine. Trends Biochem Sci 41:491–507
chia coli. BMC Mol Biol 4:5 12. Muller B, Jones C, West SC (1990) T7 endo-
6. Kowalczykowski SC (2015) An Overview of nuclease I resolves Holliday junctions formed
the molecular mechanisms of recombinational in vitro by RecA protein. Nucleic Acids Res
DNA repair. Cold Spring Harb Perspect Biol 7: 18:5633–5636
a016410 13. West SC (1997) Processing of recombination
7. Hanada K, Ukita T, Kohno Y, Saito K, Kato J, intermediates by the RuvABC proteins. Annu
Ikeda H (1997) RecQ DNA helicase is a sup- Rev Genet 31:213–244
pressor of illegitimate recombination in 14. Rogakou EP, Boon C, Redon C, Bonner WM
Escherichia coli. Proc Natl Acad Sci U S A (1999) Megabase chromatin domains involved
94:3860–3865 in DNA double-strand breaks in vivo. J Cell
Biol 146:905–916
15. Huyen Y, Zgheib O, Ditullio RA Jr, Gorgoulis 18. Gutteridge JM, West M, Eneff K, Floyd RA
VG, Zacharatos P, Petty TJ, Sheston EA, Mel- (1990) Bleomycin-iron damage to DNA with
lert HS, Stavridi ES, Halazonetis TD (2004) formation of 8-hydroxydeoxyguanosine and
Methylated lysine 79 of histone H3 targets base propenals. Indications that xanthine oxi-
53BP1 to DNA double-strand breaks. Nature dase generates superoxide from DNA degrada-
432:406–411 tion products. Free Radic Res Commun
16. Michel B, Ehrlich SD, Uzest M (1997) DNA 10:159–165
double-strand breaks caused by replication 19. Chen J, Ghorai MK, Kenney G, Stubbe J
arrest. EMBO J 16:430–438 (2008) Mechanistic studies on bleomycin-
17. Xu T, Brown W, Marinus MG (2012) Bleomy- mediated DNA damage: multiple binding
cin sensitivity in Escherichia coli is medium- modes can result in double-stranded DNA
dependent. PLoS One 7:e33256 cleavage. Nucleic Acids Res 36:3781–3790
Chapter 15
Circle-Seq: Isolation and Sequencing

of Chromosome-Derived Circular DNA Elements in Cells
Henrik Devitt Møller
Abstract
Chromosome-derived extrachromosomal circular DNA elements (eccDNAs) are detected in all eukaryotes
examined so far. Here I describe the Circle-Seq protocol, applicable for physical enrichment of eccDNAs of
a broad size range, combined with sequence confirmation of circular structures.
Briefly, by concise alkaline treatment and gentle gravity flow-through an ion-exchange column, eccDNAs
are enriched in the eluate fraction. EccDNAs are enzymatically isolated by extensive Plasmid-Safe DNase
digestion of linear chromosomes and further enriched by φ29 rolling circle amplification. By means of high
throughput sequencing of amplified eccDNA and custom eccDNA mapping software, around
ten-thousand unique eccDNA types could be detected at nucleotide resolution in a million human muscle
nuclei by this method.
Key words Circular DNA purification, Circle-Seq, eccDNA, Episomes, Double minutes, Extrachro-
mosomal, DNA circle
1 Introduction
Deoxyribonucleic acid (DNA) in the nucleus of eukaryotes is

organized in linear strands of chromosomes. However,
chromosome-derived circular elements are also found in all tested
eukaryotes (for reviews [1, 2]) yet our knowledge about their
biogenesis, maintenance and fate over time is limited.
Extrachromosomal circular DNA (eccDNA) can excise or form
from any chromosome [3, 4] and are a source of genetic hetero-
geneity that can contribute to phenotypic diversity between cells
[4–9]. In eukaryotes, eccDNAs can vary greatly in size, sequence
content and abundance [3, 4, 8, 10–14]. The predominant
eccDNA pool in mice, chicken and human cells is below 2 kilobases
(kb) [4, 9, 10, 15] but also 2–25 kb eccDNAs are commonly
detected in healthy human tissue, along with less frequent occur-
ring >25 kb eccDNAs [4]. In many human tumor cells, high
molecular weight eccDNAs (also known as episomes or double
165
166 Henrik Devitt Møller
minutes) are diagnosed and, in certain cases, sizes can exceed

beyond 1,000 kb [8, 16–19]. In addition, ring chromosomes con-
taining more than 10,000 kb can exist in human patients [20–22].
Selective isolation of low-molecular weight eccDNAs (<20 kb)
is normally accomplished from cell lysates, using either high-speed
centrifugation through a cesium chloride solution [23, 24] or by
size-exclusion columns [10, 13, 15]. Although, in order to obtain a
comprehensive picture of the overall landscape of eccDNA sizes and
content in cell populations, purification by strong shearing forces
(e.g., extensive pipetting) or size-selective columns should be
omitted.
Here, I describe Circle-Seq, a gentle circular DNA purification
protocol that is without any size-exclusion step, allowing for isola-
tion and detection of the pool of endogenous eccDNAs within a
cell population by next-generation sequencing [3, 4]. The protocol
is applicable for all types of eukaryotes, prokaryotes or ex vivo DNA
samples. Circle-Seq also allows for sensitive detection of expected
or known eccDNAs in cells by outward polymerase chain reaction
(PCR) or quantitative PCR [4, 25]. Circle-Seq is optimized [4]
and based on few pipetting and centrifugation steps, to minimize
shearing forces that can lead to breakage of eccDNA. It consists of
five major steps: cell lysis, column chromatography, linear DNA
removal, rolling circle amplification by φ29 polymerase and
sequencing. The method has been tested and validated on nuclei
of human muscle tissue and human leukocytes [4], mammalian
tissue-culture cells [25] as well as on budding yeast [3, 26, 27].
2 Materials
Prepare and store all reagents at room temperature (unless specified

otherwise). Prepare all solutions using analytical grade reagents and
ultrapure water (deionized water, 18 MΩ-cm at 25 C). For list of
equipment, see Table 1.
2.1 Cell Lysis 1. Proteinase: >600 U/mL (20 mg/mL) Proteinase K. Store at
20 C.
2. Tweezers and scalpel, sterile (for plants and somatic tissue).
Alternatively, use a tissue grinder or a mortar.
3. 2.0 mL safe-lock tube.
4. Lysis buffer (optional): 50 mM KCl, 1.5 mM MgCl2, 0.5%
(vol/vol) NP40 and 0.5% (vol/vol) tween-20, 10 mM Tris-Cl,
pH 8.5.
5. Zymolyase (only for yeast): Mix 50 mg (100 U/mg) zymolyase
in 2.5 mL buffer, consisting of a 1:1 mixture of 0.06 M
K2HPO4 and KH2PO4, pH 7.5. Store at 20 C.
Chromosome-Derived Circular DNA in Cells 167
Table 1
List of equipment. Alternative apparatus can be used
Equipment Company Comment

Analytical scale Mettler Toledo, USA
Nucleocounter ChemoMetec, DK Model NC-3000
Centrifuge Eppendorf, Germany Model 5417R
Thermomixer Eppendorf, Germany
Qubit fluorometer Thermo Scientific, USA Measuring DNA concentration,
using dsDNA high sensitivity assay
Vacuum concentrator Thermo Scientific, USA Savant SpeedVac.
(optional)
Magnet (optional) Thermo Scientific, USA DynaMag Magnetic Rack
DNA bioanalyzer Agilent 2100, USA
Ultrasonicator Covaris, USA Covaris LE220, microTUBE AFA Fiber tubes
DNA library build IntegenX Robotic Apollo 324 library-build system
Sequencing platform Illumina Inc. Illumina HiSeq 2000 DNA sequencing platform
PCR machine Techne, UK Model PrimeG
QPCR machine Applied Biosystems, USA Model Quant Studio 7 Flex
6. RNase: Mix of 2 mg/mL RNase A and 5000 U/mL RNase T1.

Store at 20 C.
2.2 Column 1. DNA purification kit: Plasmid Mini AX kit, A&A Biotechnol-
Chromatography ogy, Poland. Store at 4 C.
2. Ethanol: 70% ethanol, freshly made by mixing 35 mL 99.9%
ethanol with 15 mL ultrapure water.
3. DNA resuspension buffer: 5 mM Tris-CL, pH 8.0 in ultrapure
water.
2.3 Linear DNA 1. Endonuclease (optional): Based on species and eccDNA of

Removal interest, purchase a specific restriction enzyme (see Note 1).
Store at 20 C.
2. Exonuclease: Plasmid-Safe ATP-dependent DNase kit, Epicen-
tre, USA. Store at 20 C.
2.4 Quantification 1. Quantitative PCR (e.g., SYBR Green PCR Master Mix). Store
of DNA at 20 C.
2. Quantitative PCR plate (e.g., MicroAmp Optical 384-well
Reaction Plate).
3. Quantitative PCR oligos (e.g., the human gene locus COX5B

(hg38_chr2:97,646,040-97,648,383): 50 GGGCACCATTTT
CCTTGATCAT 30 and 50 AGTCGCCTGCTCTTCATCAG 30
or the human mitochondrial gene MT-CO1 (hg38_chrM:5904-
7445): 50 GCCCACTTCCACTATGTCCT 30 and 50 GATTTT
GGCGTAGGTTTGGTCT 30 ).
2.5 Concentrate DNA 1. DNA cleanup: Magnetic beads (e.g., Agencourt AMPure XP
(Optional) beads). Store at 4 C.
2. 70% (vol/vol) ethanol.
3. 5 mM Tris-Cl, pH 8.0.
2.6 Rolling-Circle 1. Rolling-circle ø29 amplification kit (e.g., REPLI-g Mini or

Amplification & Midi kit). Store at 80 C.
Sequencing 2. 1.5 mL safe-lock tube.
3. DNA cleanup: Magnetic beads (e.g., NEBNext Ultra II FS
DNA Library Prep Kit).
4. DNA Library build (e.g., SMARTer PrepX DNA Library Kit).
Store at 20 C.
5. PCR: Standard PCR reagents, 0.2 mL PCR tubes, and specific
oligos. Store at 20 C.
6. PCR cleanup kit (e.g., from Macherey-Nagel, Qiagen, or
Agencourt).
3 Methods
Carry out all procedures at room temperature, unless specified

otherwise.
3.1 Cell Lysis Cells from eukaryotes, prokaryotes or ex vivo DNA samples can be
used as entry material for this method (see Note 2).
1. To a 2 mL safe-lock tube, containing either 1–10 mg air-dried
somatic tissue (see Note 3) or a cell pellet with up to ten million
nuclei [e.g., blood (see Note 4) or yeast cells (see Note 5)], add
0.6 mL L1 suspension solution (A&A Biotechnology kit) [28].
2. Add 15 μL Proteinase K to the cell suspension (see Note 6).
3. Place the tube in a heating block at 50 C with agitation,
700 rounds per minute (rpm).
4. Incubate for 16–24 h.
5. Next day, confirm the suspension is homogeneous (no cell
clumps). If heterogeneous, add additionally 15 μL Proteinase
K and incubate the suspension at 50 C, 700 rpm, for an extra
1–2 days (see Note 7).
6. Allow the cell lysate to cool down to room temperature.

7. Optional step: After completed cell lysis, spike-in control plas-
mids to the sample (see Note 8).
8. Optional step: Add 2 μL RNase to degrade the RNA in the
solution at room temperature for 5–10 min (see Note 9).
3.2 Column Follow the protocol of a column plasmid purification kit (see
Chromatography Note 10). Adapted from manufacturer’s protocol [28], using
included solutions in the kit: L1 (suspension solution), L2 (alkaline
solution), L3T (neutralization buffer), K1 (equilibrating solution),
K2 (washing solution), K3 (elution solution), and PM (precipitation
mixture).
1. Treat a lysed cell suspension (0.6 mL L1 solution in a 2 mL
safe-lock tube) with equivalent 0.6 mL L2 solution (see
Note 11).
2. Invert the tube gently 1–2 times.
3. Let the solution stand for exactly 3 min at room temperature.
4. Add 0.6 mL L3T solution (see Note 12) and mix gently the
solution by flipping the tube 10–15 times.
5. Centrifuge at 9788 g for 5 min.
6. Meanwhile, equilibrate the column with 1 mL K1 equilibrating
solution.
7. Allow the liquid to run through the column by gravity.
8. After completed centrifugation, quickly load the clear superna-
tant lysate onto the column.
9. Wait until the solution has passed through the resin.
10. Wash the column with 4 mL K2 washing solution.
11. Allow the resin to empty completely.
12. Add 0.3 mL K3 elution solution to replace most of the void
volume of the column (0.35 mL).
13. Transfer the column to a 2 mL collection tube (included in the
kit).
14. Add 1 mL K3 elution solution to the column.
15. Allow the resin to empty completely and then remove the
column.
16. Precipitate the DNA by adding 0.8 mL PM precipitation mix-
ture (see Note 13).
17. Optional step: Incubate the solution at 20 C for 45–50 min
(see Note 14).
18. Centrifuge at 9788 g for 30 min at 2 C (see Note 15).
19. Carefully decant the supernatant to a waste bin without losing

the DNA pellet (light blue pellet should be visible in the
bottom of the tube).
20. Add 0.5 mL ice-cold 70% ethanol to the DNA pellet.
21. Centrifuge at 9788 g for 5 min.
22. Carefully decant the supernatant to a waste bin.
23. Air-dry the tube upside down for 5 min.
24. Turn the tube and allow evaporation of any remaining ethanol
for maximum 5–10 min.
25. Gently dissolve the air-dried DNA in 25 μL ultrapure water (see
Note 16).
26. Optional step: Measure the concentration of the resuspended
DNA (see Note 17).
3.3 Linear DNA For optimal linear DNA removal, use a specific restriction enzyme
Removal (optional step, see Note 18) to create additional accessible DNA
ends for exonuclease digestion or proceed directly to Subheading
3.3, step 4.
1. Optional step: In a total reaction volume of 25 μL, mix:
(a) 20.5 μL DNA solution from Subheading 3.2, step 25.
(b) 2.5 μL 10 digestion buffer
(c) 2 μL restriction enzyme (2 units)
2. Optional step: Incubate the solution at 37 C for 1–16 h (see
Note 19).
3. Optional step: Heat-inactivate the enzyme according to the
manufacturer’s specification.
4. Adapted from manufacturer’s protocol (Epicentre) [29], set up
Plasmid-Safe DNase treatment (see Note 20) in a total volume
of 50 μL:
(a) 25 μL cleaved DNA solution
(b) 5 μL 10 reaction buffer
(c) 2 μL ATP solution (25 mM)
(d) 15.5 μL sterile water
(e) 2.5 μL Plasmid-Safe DNase (10 U/μL)
5. Incubate the Plasmid-Safe DNase solution at 37 C, either in a
PCR machine with a hot lid or in a heating block for 1–3 days
(see Note 21).
6. At every third or twelfth to sixteenth hour (layover during

night time), spin down the tube shortly for 3 s and add extra
Plasmid-Safe DNase mixture to the reaction:
(a) 0.5 μL 10 reaction buffer
(b) 2 μL ATP solution (25 mM)
(c) 2.5 μL Plasmid-Safe DNase (10 U/μL)
7. After reaching 125–200 Plasmid-Safe DNase units per sample,
heat inactivate the enzyme at 70 C for 30 min.
3.4 Quantify DNA To validate complete digestion of linear chromosomal DNA or to

(Optional Step) quantify specific eccDNA amounts, set up a quantitative polymer-
ase chain reaction (qPCR), for example, using SYBR Green PCR
Master Mix [30].
1. In a 10 μL qPCR reaction volume, mix at room temperature:
(a) 1 μL Plasmid-Safe DNase-digested solution
(b) 5 μL SYBR Green PCR Master Mix
(c) 0.6 μL 5 μM forward primer
(d) 0.6 μL 5 μM forward primer
(e) 2.8 μL sterile water
2. Load the entire reaction to a single well on a qPCR reaction
plate (e.g., 384-well format).
3. Load reference reactions, containing genomic DNA with
known serially diluted concentrations (e.g., 1/10, 1/100,
1/1.000, 1/10.000, 1/100.000) to the plate.
4. Run preferentially each qPCR reaction in quadruplicates on a
qPCR machine (e.g., Quant Studio, see Table 1).
Program
1 cycle 10 min, 95 C
40 cycles 15 s, 95 C
60 s, 60 C
1 cycle 15 s, 95 C
15 s, 60 C
5. As an indicator of reaction specificity, assess the melting curve

(~one peak) after qPCR.
6. Analyze the qPCR product visually by conventional agarose gel
electrophoresis to confirm a single amplicon.
7. Purify the qPCR product with a conventional PCR cleanup kit.
8. Confirm the sequence of the qPCR product by Sanger

sequencing.
9. Quantify the DNA concentration in each sample, based on the
standard curve generated from the qPCR reactions of the
reference (see Note 22) [31].
3.5 Clean Up This step is optional but recommended as it concentrate eccDNA

and Concentrate DNA further and clean-up DNA from salts and proteins by magnetic
(Recommended) beads (see Note 23) before subsequent φ29-rolling circle amplifi-
cation. Adapted from manufacturer’s protocol (Agencourt
AMPure XP beads) [32] (see Note 24):
1. In a 1.5 mL tube at room temperature mix 1.8 μL AMPure XP
beads per 1 μL sample.
2. Allow the DNA to bind to the beads at room temperature for
5 min.
3. Attach the tube to a magnet rack to separate contaminants
from DNA-beads.
4. Wait for >2 min, until the solvent is clear.
5. Leave the tube on the magnet, open the lid and remove with a
sterile pipette tip nearly all the liquid, that is, leave ~5 μL
behind to prevent removal of beads.
6. First wash: While the tube is fixed on the magnet, wash the
beads with 0.2 mL freshly made 70% ethanol.
7. Remove carefully all ethanol with a sterile pipette tip without
removing any beads.
8. Second wash: Wash with 0.2 mL 70% ethanol.
9. Remove carefully all ethanol with a sterile pipette tip without
removing any beads.
10. Remove the tube from magnet (see Note 25).
11. First elution: Add 44 μL 50 C prewarmed 5 mM Tris-Cl,
pH 8.0 elution buffer to the beads without touching possible
ethanol leftovers on the tube edges.
12. Incubate the elution solution in a heating block at 50 C for
4 min.
13. Place tube on the magnet for 2 min.
14. Carefully pipet 40 μL eluted DNA to a new tube without
transferring any beads, that is, leave ~4 μL on the beads.
15. Remove the tube from magnet.
16. Second elution: Add 40 μL 50 C prewarmed 5 mM Tris-Cl,
pH 8.0 elution buffer to the beads.
4 min.

19. Carefully pipet 40 μL eluted DNA to the tube with the first
elution without transferring any beads, that is, leave ~4 μL on
the beads.
20. Third elution: Add 40 μL 50 C prewarmed 5 mM Tris-Cl,
pH 8.0 elution buffer to the beads.
4 min.
23. Carefully pipette 40 μL eluted DNA to the tube with the
1st + 2nd elution without transferring any beads, that is,
leave ~4 μL on the beads.
24. Concentrate the eluted DNA to a total volume of 20–25 μL by
evaporation, using a speedvac evaporator (see Note 26).
3.6 Rolling Circle Conduct random eccDNA amplification with φ29 DNA polymer-
Amplification ase and random hexamer oligos according to manufacturer’s pro-
tocol. Adapted from the REPLI-g kit [33] (see Note 27):
1. To a safe-lock tube, add eccDNA solution (5 μL) from Sub-
heading 3.3, step 7 or Subheading 3.5, step 24.
2. Mix the enriched eccDNA solution (5 μL) 1:1 with denatur-
ation buffer (5 μL).
3. Leave for 3 min at room temperature.
4. Add neutralization buffer (10 μL) and mix gently with the
pipette tip.
5. Add reaction buffer (29 μL) and φ29 DNA polymerase (1 μL).
6. Incubate the φ29 multiple displacement reaction at 30 C for
48 to 60-h (see Note 28).
7. At every sixth to twelfth hour, spin down the tube for 3 s to
minimize liquid in the lid.
8. Heat inactivate the φ29 DNA polymerase at 65 C for 3 min.
9. Measure the double-stranded DNA concentration of the φ29-
completed reaction fluorometrically, for example using a Qubit
fluorometer (see Note 29).
3.7 DNA Library 1. Shear all the φ29-amplified DNA with a focused ultrasonicator
Preparation (e.g., Bioruptor or Covaris LE220) to a mean fragment size of
and Sequencing 300–500 base pairs. For a 130 μL DNA sample use following
settings: 450 W peak intensity power, 60 s treatment, 30% duty
factor, 200 cycles per burst, temperature 7 C.
2. Purify sheared DNA according to manufacturer’s protocol, for
example, with purification beads.
3. Measure DNA concentration and quality (BioAnalyzer QC).
4. Adjust DNA concentration to 20 ng/μL.

5. Prepare DNA library by standard methods; for example, load
~300 ng purified fragmented DNA per sample onto a robotic
Apollo 324 system for library preparation, adding adapters and
barcode index labels (see Note 30).
6. Load DNA library onto a high-throughput sequencing plat-
form (e.g., Illumina HiSeq, see Table 1).
7. Run paired-end sequencing (e.g., 2 150-nucleotide reads).
3.8 Data Analysis 1. EccDNA sequence data:

(a) If sequencing multiple samples, demultiplex your data by
splitting index barcodes, allowing no mismatches.
(b) Trim off any low-quality bases (Q < 10) and adapter
sequences by Cutadapt [34].
(c) Map reads to the reference genome under investigation,
for example, using Burrows–Wheeler aligner
(BWA-MEM) [35] or Bowtie2 [36].
(d) Allow reads to map to multiple regions. Ideally, set the
mapping software on a sensitive search-mode to facilitate
accurate alignment of structural-read variants.
(e) Identify chromosomal coordinates where an eccDNA
could have originated from, based overlapping
structural-read variants (see Note 31).
2. Circular structure validation by outward PCR:
(a) Design sequence specific outward directing oligos to
the linear genome of interest (see Fig. 1) to validate bio-
informatic recording of a chromosomal coordinate, where
a putative circular DNA element originated from (see
Note 32).
(b) Include PCR controls by designing specific inward direct-
ing oligos within the circularized locus as well as an
oligo pair annealing outside the inspected region (linear
DNA control). As a positive control, design a primer-set
that amplifies a known locus of endogenous circular
DNA (e.g., human mitochondrial DNA, MT-CO1
(hg38_chrM:5904-7445) 50 GCCCACTTCCACTATG
TCCT 30 and 50 GATTTTGGCGTAGGTTTGGTCT 30 )
(see Fig. 1).
(c) Optional: Design PCR oligos to amplify the sequence
across the possible deleted DNA junction on the chromo-
some (see Fig. 1).
(d) Set up a 50-μL PCR reaction, for example, as follows:
l 1–200 ng φ29-amplified template or 1–5 μL DNase-
treated template
5F 2F 1F 3F
Chr
1R 2R 5R 3R
2 DSB’s
Chr
DNA fragment
End-joining
DNA circle
4F
mtDNA
4R
DNA deletion Chr
Fig. 1 Circular DNA validation by PCR. Model of circular DNA formation after two double-stranded DNA breaks
(DSB’s), erroneous repair by end joining, leading to a DNA circle, based on the deleted DNA fragment, and a
DNA deletion on the chromosome. Sequence-specific oligos can be used for PCR diagnostics to confirm
genotypes. First, validate the presence of a DNA circle by outward PCR amplification across the circular
junction (blue oligos, 1F-1R). Secondly, test for an intact sequence of the DNA circle by regular inward PCR
(black oligos, 2F-2R). Thirdly, assess linear DNA removal with primers adjacent to region of interest (gray
oligos, 3F-3R) and fourthly, as a positive control, amplify a known endogenous circular DNA sequence (orange
oligos, 4F-4R) such as mitochondrial DNA (mtDNA). Lastly, PCR amplify the junction across the expected
chromosomal DNA deletion (red oligos, 5F-5R), using a DNA template prior exonuclease treatment. For each
PCR-amplified DNA product, validate the expected size by gel electrophoresis and confirm genotypes by
Sanger sequencing
l 200–500 nM primer
l 0.2 mM dNTP mix
l 1 DNA polymerase buffer, incl. 7.5 mM MgCl2
l DNA polymerase.
l Ultrapure water up to 50 μL.
(e) Run PCR for 35 cycles in a PCR cycler under standard
PCR conditions.
(f) Assess the sizes of PCR products by gel electrophoresis
(agarose 0.6–1.5%).
(g) Purify the outward PCR product, using a conventional
PCR clean-up kit.
(h) Sequence the PCR product by Sanger sequencing to con-
firm the amplicon content and the circular topology.
4 Notes
1. Endonuclease suggestions; MssI (GTTT^AAAC), an

8-basepair endonuclease that cuts human mitochondrial DNA
once. NotI (GC^GGCCGC), a rare-cutting endonuclease
introducing relatively few double-stranded DNA breaks in a
genome. Swa1 (ATTT^AAAT), cuts the 2-micron plasmid
once in Saccharomyces cerevisiae. PacI (TTAAT^TAA), a more
frequent cutting restriction enzyme.
2. To avoid clogging of the column, start out with less than ten
million nuclei, especially if analyzing genomes larger than
100 megabases (Mb). For eukaryotes with smaller genomes,
such as budding yeast Saccharomyces cerevisiae (genome size
12.2 Mb), up to ten billion lysed cells has been used as entry
material [3, 26]. As well, in the lower range, one million lysed
yeast cells have been analyzed successfully [27]. For mamma-
lian cells, between 10,000 and 1 million nuclei has been ana-
lyzed without clogging the column [4].
3. Preparation of air-dried muscle tissue is performed under sterile
conditions, using minimum 100 mg muscle tissue (snap-frozen
in liquid nitrogen or frozen at 80 C after 24-h suspension in
RNAlater, Qiagen). Under a binocular, the muscle sample is
placed with sterile tweezers and sliced into thin pieces with a
sterile scalpel. Alternative use a tissue grinder or a mortar to
homogenize the tissue. At room temperature, the tissue is
air-dried for 1–2 h before weighing 6 mg tissue on an analytical
scale (Mettler Toledo). One million nuclei correspond to
approximately six mg air-dried human muscle tissue (vastus
lateralis), that is, based on quantitative PCR analysis of skeletal
muscle biopsies from men in the age of 60–65 years [4]. Please
note for human research, ethical approval needs to be granted
by local ethical authorities. The research should be conducted
in accordance to the World Medical Association Declaration of
Helsinki.
4. A unique feature of mammals is that red blood cells are nuclei-
free [37] unlike other animals. If needed, one can enrich for
nuclei-containing cells (leukocytes, white blood cells) by cen-
trifugation of blood at 2.6 g for 15 min at 4 C (Eppendorf
5702 R). Collect the middle buffy coat layer (leukocytes) and
count nuclei in a nucleocounter (e.g., ChemoMetec).
5. Perform lysis of the plasma cell wall of yeast with 10 units
zymolyase (2000 U/mL) for 1.5 h at 35 C with agitation,
300 rounds per minute (rpm). Ten units of zymolyase can
disrupt 5 107 cells within 1.5 h at 35 C (tested on Saccharo-
myces cerevisiae). Inactivate the zymolyase at 60 C for 5 min
and proceed to Subheading 3.1, step 6. Lyticase is an
alternative to zymolyase (USBiological). Alternatively, add

0.5 mm glass beads to suspended yeast cells, equivalent to
1/3 of the total suspension volume and vortex at maximum
velocity for 10 min to disrupt the plasma cell wall of yeast as
previously described [26].
6. A broad-spectrum serine protease can be used to disrupt the
plasma membrane of higher eukaryotes and to remove DNases
and RNases from cells [38, 39]. Proteinase K does not degrade
single-stranded and double-stranded DNA nor does it convert
closed circular DNA into nicked DNA (Thermo Scientific).
7. To speed up cell lysis time in the resuspension solution, pro-
teinase K digestion can be stimulated by addition of detergents
(e.g., 1–4 mM urea or 0.2–1% sodium dodecyl sulfate [39]).
Alternatively, substitute the resuspension solution with cell lysis
buffer and incubate for 0.5–2.5 h at 55 C [25]. Be aware, the
impact of detergents during the subsequent column chroma-
tography step has not been tested and could possibly influence
the final eccDNA yield.
8. Plasmids can be spiked into the DNA sample as internal con-
trols, which can be desirable in downstream analyses. Be aware,
it is recommended to use highly diluted plasmids to maintain
detection resolution of endogenous eccDNAs. For instance,
ten-thousand plasmids (4 kb in size) correspond to approxi-
mately 4.3 105 ng.
9. Adding RNase A or RNase T1 alone is possible, although a
higher level of RNA degradation can be obtained by mixing
RNase A together with RNase T1. These RNases are known to
hydrolyze RNA residues at C and U or at G, respectively
(Thermo Scientific).
10. The commercially available kit (Plasmid Mini AX, A&A Bio-
technology) [28] is designed to purify plasmids from bacteria
but works well with lysed eukaryotic cells. Other kits or related
column-based products (e.g., Plasmid Mini AX gravity kit) can
possibly be used but have not been tested. In addition, alterna-
tive eccDNA protocols exist, for example, using magnetic
beads [40] or the Hirt procedure [41].
11. Alternatively, add 0.6 mL from a 200 mM NaOH, 1% SDS lysis
buffer (Qiagen, buffer P2).
12. Alternatively, add 0.6 mL from a 3 M potassium acetate,
pH 5.5 neutralization buffer (Qiagen, buffer P3).
13. In the tested kit (Plasmid Mini AX, A&A Biotechnology) [28],
DNA precipitation is facilitated by a precipitation enhancer. If
using another kit without a precipitation enhancer, one can add
an inert carrier like glycogen (0.05–1 μg/μL) to significantly
increase the recovery of nucleic acids.
14. At lower temperature DNA precipitate more easily.

15. A centrifugation force <10,000 g is used as a precaution to
minimize the risk of eccDNA breakage during centrifugation.
16. Preferentially, proceed directly to Subheading 3.3. The DNA
can alternatively be resuspended in 5 mM Tris–Cl, pH 8.0 for
longer term storage <5 C.
17. Use a fluorometer for sensitive measurement of the double-
stranded DNA concentration. Alternatively, use a spectropho-
tometer. Preferentially, leave the resuspended DNA at room
temperature for 1–2 h, or at 50 C, to obtain a more accurate
measurement.
18. Different endonucleases can be used to create additional acces-
sible 50 -30 DNA ends. A specific restriction enzyme can assist
both the subsequent removal of linear chromosomal DNA by
exonuclease but also perform targeted cleavage of abundant
endogenous plasmid DNA that may be undesirable during
sequencing (e.g., the 2-micron in yeast, which can be cut
once by SwaI [27] or the human mitochondrial DNA, cleaved
once by MssI [4]). Alternatively, perform random shearing of
the DNA by vortex at high velocity for 0.5–1 min or perform a
brief sonication for 1–5 s.
19. Be aware of possible star activity of the restriction enzyme.
Check manufacturer’s instructions and incubate the endonu-
clease mixture at 37 C, according to recommendations.
20. This Plasmid-Safe DNase enzyme has no reported activity on
closed and nicked double-stranded circular DNA (Epicentre).
Alternative exonucleases, such as exonuclease V and exonucle-
ase VIII (New England Biolabs), have been tested and can
be used.
21. Chromosomal DNA digestion was initially carried out contin-
uously for 6 days [4]. Additional experiments support that
hydrolysis of linear single-stranded and double-stranded
DNA by Plasmid-Safe DNase can be added more frequently
[25], that is, add DNase mix every 2–4 h continuously for
2 days (75–100 units per day).
22. The DNA in a human diploid cell weigh approximately
6.77 103 ng, assuming a molar mass per base pair of
650 g/mol, a genome length of 3.14 109 bp, and two copies
of the gene of interest.
23. Make sure not to transfer magnetic beads to the eluted DNA,
that is, leave 3–4 μL elution buffer behind on the beads. To
minimize DNA loss, perform the elution step two or three
times. An alternative to magnetic beads is to use a vacuum
centrifuge to reduce the total liquid volume by 50–75%.
24. Similar products can likely be used.
25. Add the elution buffer right away. Do not allow the DNA to
dry out on the magnetic beads after the last ethanol wash, as
the DNA can bind more tightly to the beads, making it difficult
to elute off.
26. Perform an evaporation test to determine the approximate
centrifugation time under vacuum required to concentrate
the elution volume to 20 μL, for example, using a speedvac
evaporator or alternatively a desiccator under vacuum. In case
the sample liquid is evaporated below 10–20 μL, add sterile
water up to 20 μL since a high salt concentration can influence
DNA amplification by φ29 polymerase.
27. An alternative φ29 multiple displacement amplification kit can
be used, which include a DNA primase instead of random
hexamer oligos [42] (e.g., TruePrime, Expedeon (SYGNIS),
Germany).
28. A long incubation time is recommended to ensure that the
majority of amplified DNA is converted into double-stranded
DNA [43] before proceeding to DNA library preparation. A
shorter φ29-amplification time can be used (e.g., 16 h), if
testing for eccDNA by PCR or qPCR.
29. It is recommended to measure the DNA quantity by fluorom-
etry at this step, due to the presence of random hexamer
primers and potential presence of single-stranded DNA in the
φ29 reaction mixture.
30. Other kits can be used.
31. To define putative eccDNA coordinates, it is recommended to
use minimum two overlapping structural-read variants from a
combination of soft-clipped reads (mapped to one position),
split reads (mapped to two positions on the same chromo-
some) as well as discordant paired-end reads (reverse-forward
reads, aligned at to two positions on same chromosome but
having a mapping-distance significantly larger or smaller than
the size of the sequenced DNA fragments). For more informa-
tion, please consult previous publications for further bioinfor-
matic details [4, 10, 13]. In addition, one can use Circle-
Map [47], a freely available software code at github: https://
github.com/iprada/Circle-Map. The website explains how to
convert raw sequence reads into interpretable results.
32. Primers should have a 50 -30 orientation pointing away from
each other. It is recommended to design 20–25 nucleotide
long oligos with an annealing temperature at 58–62 C. As
well, blast oligo sequences against a repeat library (e.g.,
RepeatMasker Web Server [44]), to confirm primers do not
contain any repeat sequences. Oligos should preferentially be
placed close to the expected eccDNA junction (0.2–0.6 kb).
This will facilitate complete Sanger sequencing across the junc-

tion to confirm a circular structure. Free software is available
for oligo design (e.g., Primer3web [45, 46]).
Acknowledgments
I would like to thank Birgitte Regenberg and Ruth Kroschewski for

constructive feedback on the manuscript. Funding support
from the Carlsberg foundation CF17-0226 and CF18-0431.
References
1. Gaubatz JW (1990) Extrachromosomal circu- 10. Shibata Y, Kumar P, Layer R et al (2012) Extra-
lar DNAs and genomic sequence plasticity in chromosomal microDNAs and chromosomal
eukaryotic cells. Mutat Res 237:271–292 microdeletions in normal tissues. Science
2. Paulsen T, Kumar P, Koseoglu MM et al 336:82–86
(2018) Discoveries of extrachromosomal cir- 11. Zhu J, Zhang F, Du M et al (2017) Molecular
cles of DNA in normal and tumor cells. Trends characterization of cell-free eccDNAs in human
Genet 34:270–278 plasma. Sci Rep 7:10968
3. Møller HD, Parsons L, Jørgensen TS et al 12. Shoura MJ, Gabdank I, Hansen L et al (2017)
(2015) Extrachromosomal circular DNA is Intricate and cell type-specific populations of
common in yeast. Proc Natl Acad Sci 112: endogenous circular DNA (eccDNA) in Cae-
E3114–E3122 norhabditis elegans and Homo sapiens. G3
4. Møller HD, Mohiyuddin M, Prada-Luengo I (Bethesda) 7:3295–3303
et al (2018) Circular DNA elements of chro- 13. Lanciano S, Carpentier M-C, Llauro C et al
mosomal origin are common in healthy human (2017) Sequencing the extrachromosomal cir-
somatic tissue. Nat Commun 9:1–12 cular mobilome reveals retrotransposon activity
5. Pauletti G, Lai E, Attardi G (1990) Early in plants. PLoS Genet 13:
appearance and long-term persistence of the e1006630–e1006620
submicroscopic extrachromosomal elements 14. Kumar P, Dillon LW, Shibata Y et al (2017)
(amplisomes) containing the amplified DHFR Normal and cancerous tissues release extra-
genes in human cell lines. Proc Natl Acad Sci chromosomal circular DNA (eccDNA) into
87:2955–2959 the circulation. Mol Cancer Res
6. Von Hoff DD, McGill JR, Forseth BJ et al 15:1197–1205
(1992) Elimination of extrachromosomally 15. Dillon LW, Kumar P, Shibata Y et al (2015)
amplified MYC genes from human tumor Production of extrachromosomal microDNAs
cells reduces their tumorigenicity. Proc Natl is linked to mismatch repair pathways and tran-
Acad Sci 89:8165–8169 scriptional activity. Cell Rep 11:1749–1759
7. Nathanson DA, Gini B, Mottahedeh J et al 16. Vogt N, Lefèvre S-H, Apiou F et al (2004)
(2014) Targeted therapy resistance mediated Molecular structure of double-minute chro-
by dynamic regulation of extrachromosomal mosomes bearing amplified copies of the epi-
mutant EGFR DNA. Science 343:72–76 dermal growth factor receptor gene in gliomas.
8. Turner KM, Deshpande V, Beyter D et al Proc Natl Acad Sci 101:11368–11373
(2017) Extrachromosomal oncogene amplifi- 17. Storlazzi CT, Lonoce A, Guastadisegni MC
cation drives tumour evolution and genetic et al (2010) Gene amplification as double min-
heterogeneity. Nature 543:122–125 utes or homogeneously staining regions in
9. Paulsen T, Shibata Y, Kumar P et al (2019) solid tumors: origin and structure. Genome
Small extrachromosomal circular DNAs, Res 20:1198–1206
microDNA, produce short regulatory RNAs 18. Zhu J, Yu Y, Meng X et al (2013) De novo-
that suppress gene expression independent of generated small palindromes are characteristic
canonical promoters. Nucleic Acids Res. of amplicon boundary junction of double min-
53:356–311 utes. Int J Cancer 133:797–806
19. Zhang C-Z, Spektor A, Cornils H et al (2015) 35. Li H (2013), Aligning sequence reads, clone
Chromothripsis from DNA damage in micro- sequences and assembly contigs with
nuclei. Nature 522:179–184 BWA-MEM
20. Guilherme RS, Meloni VFA, Kim CA et al 36. Langmead B, Salzberg SL (2012) Fast gapped-
(2011) Mechanisms of ring chromosome for- read alignment with Bowtie 2. Nat Methods
mation, ring instability and clinical conse- 9:357–359
quences. BMC Med Genet 12:171 37. Ji P, Murata-Hori M, Lodish HF (2011) For-
21. Alosi D, Klitten LL, Bak M et al (2015) Dysre- mation of mammalian erythrocytes: chromatin
gulation of FOXG1 by ring chromosome 14. condensation and enucleation. Trends Cell
Mol Cytogenet 8:24 Biol 21:409–415
22. Ji X, Liang D, Sun R et al (2015) Molecular 38. Wiegers U, Hilz H (1971) A new method
characterization of ring chromosome 18 by using “proteinase K” to prevent mRNA degra-
low-coverage next generation sequencing. dation during isolation from HeLa cells. Bio-
BMC Med Genet 16:57 chem Biophys Res Commun 44:513–519
23. Hirt B (1967) Selective extraction of polyoma 39. Hilz H, Wiegers U, Adamietz P (1975) Stimu-
DNA from infected mouse cell cultures. J Mol lation of proteinase K action by denaturing
Biol 26:365–369 agents: application to the isolation of nucleic
24. van Loon N, Miller D, Murnane JP (1994) acids and the degradation of “masked” pro-
Formation of extrachromosomal circular teins. Eur J Biochem 56:103–108
DNA in HeLa cells by nonhomologous recom- 40. MacArthur I, Koche R, Dorado-Garcı́a H et al
bination. Nucleic Acids Res. 22:2447–2452 (2019) Purification and sequencing of large
25. Møller HD, Lin L, Xiang X et al (2018) circular DNA from human cells. Protocol
CRISPR-C: circularization of genes and chro- Exchange. https://doi.org/10.1038/protex.
mosome by CRISPR in human cells. Nucleic 2019.006
Acids Res 43:1565–1513 41. Arad U (1998) Modified Hirt procedure for
26. Møller HD, Bojsen RK, Tachibana C et al rapid purification of extrachromosomal DNA
(2016) Genome-wide purification of extra- from mammalian cells. BioTechniques
chromosomal circular DNA from eukaryotic 24:760–762
cells. J Vis Exp:e54239 42. Picher ANJ, Budeus B, Wafzig O et al (2016)
27. Møller HD, Larsen CE, Parsons L et al (2015) TruePrime is a novel method for whole-
Formation of extrachromosomal circular DNA genome amplification from single cells based
from long terminal repeats of retrotransposons on TthPrimPol. Nat Commun 7:1–16
in Saccharomyces cerevisiae. G3 (Bethesda) 43. Ducani C, Bernardinelli G, Hogberg B (2014)
6:453–462 Rolling circle replication requires single-
28. A. A Biotechnology (2017) Protocol for plas- stranded DNA binding protein to avoid termi-
mid mini AX_EN nation and production of double-stranded
29. Epicentre (2013) Protocol for plasmid-safe™ DNA. Nucleic Acids Res. 42:10596–10604
ATP-dependent DNase, 1–4 44. Smit AFA, Hubley R, Green P (2019)
30. L. Technologies (2011) SYBR® Green PCR RepeatMasker
master mix and SYBR® green RT-PCR 45. Untergasser A, Cutcutache I, Koressaar T et al
reagents kit user guide (Part no. 4310251g), (2012) Primer3—new capabilities and inter-
1–48 faces. Nucleic Acids Res. 40:e115–e115
31. Nolan T, Huggett J, Sanchez E (2013) Good 46. Koressaar T, Remm M (2007) Enhancements
practice guide for the application of quantita- and modifications of primer design program
tive PCR (qPCR), LGC Primer3. Bioinformatics 23:1289–1291
32. Coulter B (2016) Protocol for Agencourt 47. Sensitive detection of circular DNA at single-
AMPure XP, 1–36 nucleotide resolution using guided realign-
33. Qiagen (2011) REPLI-g Mini/Midi Hand- ment of partially aligned reads Inigo Prada-
book, 1–36 Luengo, Anders Krogh, Lasse Maretty, Birgitte
Regenberg bioRxiv 654194; doi: https://doi.
34. Martin M (2011) Cutadapt removes adapter org/10.1101/654194
sequences from high-throughput sequencing
reads. EMB J 17:10–12
Chapter 16
Chromatin Pull-Down Methodology Based on DNA Triple

Helix Formation
Asako Isogawa, Robert P. Fuchs, and Shingo Fujii
Abstract
Identification of the protein complexes associated with defined DNA sequence elements is essential to
understand the numerous transactions in which DNA is involved, such as replication, repair, transcription,
and chromatin dynamics. Here we describe two protocols, IDAP (Isolation of DNA Associated Proteins)
and CoIFI (Chromatin-of-Interest Fragment Isolation), that allow for isolating DNA/protein complexes
(i.e., nucleoprotein elements) by means of a DNA capture tool based on DNA triple helix (triplex)
formation. Typically, IDAP is used to capture proteins that bind to a given DNA element of interest
(e.g., a specific DNA sequence, an unusual DNA structure, a DNA lesion) that can be introduced at will
into plasmids. The plasmids are immobilized by means of a triplex-forming probe on magnetic beads and
incubated in nuclear extracts; by using in parallel a control plasmid (that lacks the DNA element of interest),
proteins that preferentially bind to the DNA element of interest are captured and identified by mass
spectrometry. Similarly, CoIFI also uses a triplex-forming probe to capture a specific chromatin fragment
from a cultured cell line that has been engineered to contain multiple copies of the DNA element of interest.
Key words DNA-based chromatin capture, Reverse-ChIP, Replication, Repair, Transcription, Prote-
omics, Chromatin, Epigenetics, Drug screening
1 Introduction
Characterization of proteins involved in various DNA transactions

is needed to understand functional control of protein networks
during all DNA transactions. For example, when taking into
account numerous studies, the control of transcription in vivo is
best described as a complex protein network [1]. A straightforward
way to delineate a protein network on DNA is to isolate and
characterize nucleoprotein fragments of interest from living cells.
In recent years, such approaches have been successfully applied in
various studies [2–6].
The formation of DNA triple helices has been well character-
ized and implemented in numerous applications including thera-
peutic purposes [7, 8]. The principle of triplex formation is that a
183
184 Asako Isogawa et al.
third strand (i.e., triplex-forming oligonucleotide (TFO)) consist-

ing of either a pyrimidine-rich or a purine-rich sequence, forms
Hoogsteen (or reverse Hoogsteen) base pairs with a complemen-
tary purine-rich strand in the major groove of double-stranded
DNA (dsDNA) without disrupting its canonical Watson–Crick
base pairs. In order to practically utilize triplex formation in appli-
cations, numerous efforts were implemented to increase stability of
triplexes. As a consequence, the stability of triplexes was largely
improved by using modified TFO probes composed of chemically
altered nucleotides (e.g., peptide nucleic acid (PNA), locked
nucleic acid (LNA)) [9, 10] and by the introduction of a DNA
intercalator (e.g., acridine, psoralen) to one of the extremities of the
probe [11–13].
By utilizing the unique feature of triplex formation, we devel-
oped a robust experimental workflow in order to capture, identify
and characterize proteins assembled, in vivo (CoIFI) or in vitro
(IDAP), on a given DNA sequence of interest [14]. Here, we
introduce some applications of IDAP and CoIFI as model cases.
2 Materials
All buffers are freshly prepared, unless otherwise stated. When

using H2O, it is ultrapure water.
2.1 TFO-Conjugated 1. TE: 10 mM Tris-Cl (pH 7.5), 1 mM EDTA. Store at room

Plasmid for IDAP temperature (RT).
2. TFO probes: Dissolve the probes in TE (Fig. 1) (see Note 1).
Store at 20 C.
3. Plasmids: pAS114.1γ and its linearized form in TE (Fig. 2) (see
Note 2). Store at 20 C.
4. TF2: 10 mM Tris-Cl (7.5), 70 mM NaCl, 0.02% NP40.
5. A UVA lamp.
2.2 Human Nuclear 1. Cells: Cultivate human HEK293 cells on plates.

Extracts for IDAP 2. CM-Lysis buffer: 10 mM HEPES (7.9), 10 mM KCl, 1.5 mM
MgCl2, 1 mM DTT, 0.3 M Sucrose, 1% NP40, 0.1 mM EDTA,
Protease inhibitor cocktail.
3. SG buffer: 10 mM HEPES (7.9), 10 mM KCl, 1.5 mM MgCl2,
1 mM DTT, 1.5 M Sucrose, 0.1 mM EDTA, Protease inhibitor
cocktail.
4. NW buffer: 10 mM HEPES (7.9), 10 mM KCl, 1.5 mM
MgCl2, 1 mM DTT, 0.1 mM EDTA, Protease inhibitor
cocktail.
Triplex-Mediated Nucleoprotein Capture 185
Fig. 1 A schematic view of triplex formation. A TFT region on DNA is shown in

blue. A red line in the TFO probe represents an oligonucleotide that can form a
triplex with the TFT
Fig. 2 Construction of pAS114.1γ. ori: high copy number pUC origin in E. coli. Ap:
ampicillin resistance gene. TFT: triplex-forming tag. SV40: SV40 early enhancer/
promoter. Hyg: hygromycin resistance gene. RE: restriction enzyme cut site.
CDKN1A regulatory region: a transcriptional regulatory region of human CDKN1A
gene. Luc: Luciferase gene for a reporter assay, whose expression is controlled
by the CDKN1A regulatory region
5. Extraction buffer: 20 mM HEPES (7.9), 1.5 mM MgCl2,

0.42 M NaCl, 1 mM DTT, 0.2 mM EDTA, 25% (v/v) Glyc-
erol, Protease inhibitor cocktail.
6. Streptavidin magnetic beads (10 mg/ml).
7. A magnetic stand.
8. Liquid nitrogen.
2.3 Nucleoprotein 1. Streptavidin magnetic beads (10 mg/ml).

Isolation Via IDAP 2. BSA.
3. NCL: 20 mM Tris-Cl (7.5), 4% glycerol, 8 mM DTT, 4 mM

MgCl2, 0.5 mM EDTA, 0.1% NP40.
4. NCL250: NCL with 250 mM NaCl.
5. NCL50: NCL with 50 mM NaCl.
6. 2 PM2: 40 mM Tris-Cl (7.5), 8% glycerol, 16 mM DTT,
8 mM MgCl2, 5 mM ATP, 0.04% NP40.
7. CB3: 15 mM Tris-Cl (7.9), 70 mM NaCl, 0.1 mM EDTA,
0.5 mM EGTA, 0.1% Sarkosyl, 0.2% SDS.
2.4 IDAP Under 1. CLB1: 20 mM HEPES (7.9), 4 mM MgCl2, 50 mM NaCl,

Cross-Linking 0.02% NP40.
Conditions 2. Formaldehyde (HCHO): 1% HCHO in CLB1.
3. CQ3: 1.4 M Tris-Cl (7.4), 250 mM NaCl.
4. DTT.
5. 4 LDS buffer: 0.8 M Triethanolamine-Cl (7.6), 4% Lithium
dodecyl sulfate, 4% Ficoll 400, 0.025% Phenol red, 0.025%
Coomassie G250, 2 mM EDTA, 40% Glycerol.
2.5 A Specific DNA 1. Plasmids: pAS200.2 and pAS203 in TE (see Note 3). Store at
Substrate for IDAP 20 C.
2. Nickases: Nb.BsrD1 and Nt.BspQ1.
3. Nick buffer: 50 mM Tris-Cl (7.9), 100 mM NaCl, 10 mM
MgCl2, 0.1 mg/ml BSA.
4. 6 BPB buffer: 0.01% Bromophenol blue, 30% Glycerol,
1 mM EDTA.
5. A gel extraction kit.
6. Annealing buffer: 20 mM Tris-Cl (7.5), 250 mM NaCl.
7. A 12-mer oligo (see Note 4).
8. Ligase buffer: 50 mM Tris-Cl (7.5), 10 mM DTT, 10 mM
MgCl2, 1 mM ATP.
9. T4 DNA Ligase.
2.6 Specific Capture 1. Plasmids: pAS200.2, pAS203, pAS203(rcc), pAS203(gap),

of the Constructed pAS203(cSL) in TE (see Note 5).
Plasmids in IDAP 2. Streptavidin magnetic beads (10 mg/ml).
3. TS1: 10 mM Tris-Cl (7.4), 250 mM NaCl, 0.5 mM EDTA,
0.1% NP40.
2.7 Cross-Linking 1. A human cell line, clone H62 (see Note 6).
Conditions of a Human 2. An aspirator.
Cell Line for CoIFI
3. PBS: 3 mM Na2HPO4, 1 mM KH2PO4, 155 mM NaCl.
4. Formaldehyde (HCHO): 3% HCHO in PBS.
5. CQ2: 1.4 M Tris-Cl (7.4), 150 mM NaCl.

6. A cell scraper.
2.8 Input Sample 1. Pre-lysis buffer: 10 mM HEPES (7.9), 10 mM KCl, 1.5 mM

Preparation for CoIFI MgCl2, 1% Triton X-100, 0.3 M Sucrose.
2. Lysis2 buffer: 10 mM HEPES (7.9), 10 mM KCl, 1.5 mM
MgCl2, 1 mM DTT, 0.1 mM EDTA, 0.5 mM EGTA, 0.6%
NP40, 0.25% Triton X-100, 0.3 M Sucrose, Protease inhibitor
cocktail.
3. A Dounce homogenizer with a tight pestle.
4. PBST: PBS with 0.25% Triton X-100.
5. RNaseA.
6. CB1.3: 15 mM Tris-Cl (7.9), 1 mM EDTA, 0.5 mM EGTA,
0.1% Sarkosyl, 0.2% SDS, Protease inhibitor cocktail.
7. A sonicator.
8. Streptavidin polyacrylamide resin (50% slurry).
2.9 Nucleoprotein 1. TFO probes: TFO-1, TFO-3, Scr-1, and Scr-2 (see Note 1).
Isolation Via CoIFI Store at 20 C.
2. CB3.1: 15 mM Tris-Cl (7.9), 50 mM NaCl, 0.1 mM EDTA,
0.5 mM EGTA, 0.1% Sarkosyl, 0.2% SDS.
3. Streptavidin magnetic beads (10 mg/ml).
4. CB4: 15 mM Tris-Cl (7.9), 70 mM NaCl, 0.1 mM EDTA,
0.5 mM EGTA, 0.1% Sarkosyl, 1% SDS.
5. DIT4: 10 mM Tris-Cl (7.4), 30 mM NaCl, 0.2% SDS.
6. ER2: 10 mM Tris-Cl (7.4), 250 mM NaCl, 0.5 mM EDTA,
0.2% SDS, 20 mM D-biotin.
3 Methods
All procedures are implemented at RT or in an incubator set at

25 C unless otherwise stated. When using H2O, it is ultrapure
water.
3.1 TFO-Conjugated 1. 600 ng of plasmids (pAS114.1γ and its linearized form) are
Plasmid for IDAP adjusted to 15 μl by TF2 containing 10 mM MgCl2 and 3 pmol
TFO-1.
2. Incubate with mixing for 17–18 h.
3. Transfer the mixture onto a plastic support (see Note 7).
4. Irradiate the mixture with UVA (365 nm) for 0.2 J/cm2
(Fig. 3) (see Note 8).
5. Store the sample at 20 C until use.
Fig. 3 A schematic view of IDAP approach
3.2 Human Nuclear 1. Prepare 4 107 cells of human HEK293 as a pellet.

Extracts for IDAP 2. Dissolve the pellet thoroughly with 400 μl of CM-Lysis buffer
through vigorous pipetting.
3. Overlay each half of the suspension onto 1 ml of SG buffer in
tubes (total two tubes).
4. Centrifuge at 13,400 g for 1 min at 4 C, followed continu-
ously by at 1000 g for 8 min at 4 C. Discard supernatant.
5. Resuspend all pellets of the two tubes with 1 ml of NW buffer
(total one tube).
6. Centrifuge at 13,400 g for 30 s at 4 C. Discard supernatant.
7. Mix gently the pellet with 20 μl of Extraction buffer.
8. Incubate on ice for 1 h.
9. Centrifuge at 20,400 g for 5 min at 4 C. Recover superna-
tant into a tube.
10. Rinse the pellet with 4 μl of Extraction buffer. Recover super-
natant into the above tube.
11. The recovered supernatant is mixed with 10 μl of streptavidin

magnetic beads (see Note 9).
12. Incubate with mixing for 10 min. Recover supernatant via a
magnetic stand.
13. Repeat the steps 11 and 12.
14. Freeze the recovered supernatant by liquid nitrogen. Store the
sample at 70 C until use.
3.3 Nucleoprotein 1. 40 ng of TFO-conjugated plasmids (pAS114.1γ and its linear-

Isolation Via IDAP ized form) prepared in Subheading 3.1 is mixed with 3 μl of
streptavidin magnetic beads (see Note 10). As a negative con-
trol, 40 ng of pAS114.1γ in absence of TFO is mixed with 3 μl
of streptavidin magnetic beads as well (see Note 10).
2. Incubate with mixing for 30 min. Discard supernatant via a
magnetic stand (Fig. 3).
3. Wash the beads with 100 μl of the following buffers:
NCL250 3 times, then NCL50 2 times.
4. Resuspend the beads with 5 μl of 2 PM2 and 3.8 μl of H2O.
5. Add 1.2 μl of the human nuclear extracts prepared in Subhead-
ing 3.2.
6. Incubate with mixing for 1 h (see Note 11).
7. Discard supernatant via a magnetic stand.
8. Wash the beads with 100 μl of NCL50 3 times.
9. Resuspend the beads with 10 μl of CB3.
10. Incubate at 98 C for 1.5 min.
11. Transfer supernatant into a new tube via a magnetic stand.
12. Analyze the recovered supernatant (Fig. 4a).
3.4 IDAP Under 1. Implement the same protocol until the step 6 in Subheading
Cross-Linking 3.3.
Conditions 2. Add 190 μl of 1% HCHO in CLB1.
3. Incubate with mixing for 10 min.
4. Add 128 μl of CQ3.
5. Incubate with mixing for 5 min. Discard supernatant via a
magnetic stand.
6. Wash the beads with 100 μl of NCL250 3 times.
7. Resuspend the beads with 6.5 μl of CB3.
8. Add 1 μl of 0.5 M DTT and 2.5 μl of 4 LDS buffer. Incubate
at 99 C for 25 min.
9. Analyze the sample (Fig. 4b).
Fig. 4 Nucleoprotein isolation in IDAP. (a) 40% of the elution products are analyzed via silver staining following
SDS-PAGE. Lane 1 is pAS114.1γ in absence of TFO (as a negative control). Lanes 2 and 3 are pAS114.1γ with
TFO and its linearized form with TFO, respectively. Input (nuclear extracts) from 2.5 104 cells is loaded.
MW: molecular weight marker. Non-CL: non-cross-link. ∗: streptavidin. Samples corresponding to lanes 1–3
are also analyzed for presence of plasmid DNA by PCR and histone H3 by western blotting (WB). In PCR, 0.01%
of the elution products are used as a template. In WB, 50% of the elution products are used. (b) 21% of the
elution products are analyzed via silver staining following SDS-PAGE. Lane 1 is pAS114.1γ in absence of TFO.
Lanes 2 and 3 are pAS114.1γ with TFO and its linearized form with TFO, respectively. CL: cross-link. ∗:
streptavidin. All of data clearly show high specificity for isolation of nucleoprotein complexes in IDAP. It notes
that band patterns on silver staining are somewhat different depending upon experimental setups (i.e., circular
DNA vs linear DNA; Non-CL vs CL)
3.5 A Specific DNA 1. Mix 18 μg of pAS203 with 180 units of Nb.BsrD1 and
Substrate for IDAP 100 units of Nt.BspQ1 in 360 μl of Nick buffer (Fig. 5).
2. Incubate at 50 C for 2.5 h.
Fig. 5 Construction of pAS200.2 and pAS203. pUC ori: high copy number pUC origin in E. coli. Tet: tetracycline
resistance gene. TFT: triplex-forming tag. CAG on pAS203: it contains seven tandemly repeated CAG·CTG
triplets and two nickases’ recognition sites surrounding the triplet repeat
3. Purify DNA by EtOH precipitation following phenol–CHCl3

extraction.
4. Resuspend it with 180 μl of TE.
5. Incubate at 75 C for 10 min, followed by on ice for 10 min (see
Note 12).
6. Add 36 μl of 6 BPB buffer.
7. Separate a gapped pAS203 from a short DNA fragment
(33-mer) detached from the region of CAG triplet repeat
through 0.7% agarose with 0.5 μg/ml ethidium bromide
(EtBr) gel electrophoresis.
8. Cut out the separated gapped pAS203 from the agarose gel.
9. Extract DNA from the piece of agarose gel using a gel extrac-
tion kit. This extracted DNA is named pAS203(gap) (Fig. 6a).
10. Mix 2 μg of pAS203(gap) with ten-fold relative molar excess of
a 12-mer oligo to pAS203(gap) in 20 μl of annealing buffer
(Fig. 6a).
11. Incubate at 75 C for 5 min, 65 C for 15 min, 45 C for
10 min, then keep it on bench for 1 h (see Note 13).
12. Add 2000 units of T4 DNA ligase in 60 μl of ligase buffer.
Incubate the mixture at 16 C for 2.5 h.
Fig. 6 Construction of pAS203 with a closed stem-loop. (a) pAS203 is introduced double nicks by using two
nickases indicated in Fig. 5. A short DNA fragment produced by the double nicks is released by a heat
treatment in order to generate a gapped pAS203 (named pAS203(gap)). pAS203(gap) is treaded by heat for a
stem-loop formation composed of the CAG triplet repeat. Subsequently, a 12-mer oligo serves as a molecular
splint to fix the extruded stem-loop through ligation reaction. (b) The resultant ligation products using various
amounts (0 to 50-fold) of the 12-mer oligo are analyzed on 2% agarose gel containing 0.5 μg/ml EtBr. The gel
clearly shows that formation of pAS203 with a closed stem-loop (named pAS203(cSL)) depends upon
presence of the 12-mer oligo. Lane Gap is pAS203(gap) as a control. The oc and cc labeled on right side of
the gel indicate positions of open circular and closed circular DNA, respectively. The positions of oc and cc
reflect positions of pAS203(gap) and pAS203(cSL), respectively
13. Purify the ligated product by means of cut-out from an agarose

gel as in steps 6–9. The extracted DNA is named pAS203(cSL)
(Fig. 6).
14. Analyze the sample (Fig. 7).
3.6 Specific Capture 1. 50 ng of plasmids (pAS200.2, pAS203, pAS203(rcc), pAS203

of the Constructed (gap), and pAS203(cSL)) is adjusted to 15 μl by CB3 contain-
Plasmids in IDAP ing 10 mM MgCl2 and 0.5 pmol TFO-1.
3. Mix with 5 μl of streptavidin magnetic beads (see Note 14).
Fig. 7 Confirmation of characteristic properties of pAS203 derivatives. (a) Lane sc is a supercoiled form of
plasmid, which is the natural form prepared from E. coli. Lane rcc is a relaxed closed circular form of plasmid
(see Note 5). On the upper gel, plasmids are analyzed on 2% agarose gel containing 0.5 μg/ml EtBr. On the
lower gel, plasmids are analyzed on 2% agarose gel in absence of EtBr. As expected, pAS203(rcc) and pAS203
(cSL) show representative patterns of relaxed forms of ccDNA. (b) Plasmids are treated by RsaI that cuts two
sites on plasmids as drawn. By this treatment, a short DNA fragment, 181 bp from pAS200.2 and 225 bp from
pAS203, is produced. The treated plasmids are analyzed via 8% native polyacrylamide gel electrophoresis. As
shown on the gel, all short DNA fragments from pAS203 derivatives are differently migrated. It reveals all
fragments are consisted of different structures
4. Incubate with mixing for 1 h. Discard supernatant via a mag-

netic stand.
5. Wash the beads with 50 μl of TS1 with 5 mM MgCl2 3 times.
6. Resuspend the beads with 10 μl of CB3.
7. Incubate at 98 C for 1.5 min.
9. Analyze the recovered supernatant (Fig. 8).
3.7 Cross-Linking 1. Cultivate a human cell line, clone H62, until 7 107 cells on
Conditions of a Human plastic dishes in order to prepare input samples for CoIFI
Cell Line for CoIFI approach (Fig. 9).
Fig. 8 The constructed plasmids capture via TFO-mediated triplex formation. 40% of the elution products are
analyzed on 2% agarose gel containing 0.5 μg/ml EtBr. As a control, 13 ng of each input (pAS200.2, pAS203,
pAS203(rcc), pAS203(gap), and pAS203(cSL)) are loaded on the same gel. Recovery yields of all plasmids
through the TFO-mediated plasmid capture are nearly same (65% of input). Thus, the constructed plasmids
are suitable to use as DNA substrates in the IDAP approach
Fig. 9 Schematic views of construction of a human stable cell line and isolation of nucleoproteins in CoIFI
approach
2. Discard cell culture media in the dishes by an aspirator.

3. Cross-link the cells by 5 ml of 3% HCHO in PBS per dish for
30 min with mixing.
4. Add 5 ml of CQ2 per dish.
5. Incubate with mixing for 5 min.

6. Detach the attached cells on dishes by a cell scraper, and collect
the cells from all dishes into a tube.
7. Centrifuge at 1000 g for 2 min at 4 C. Discard supernatant.
8. Wash the collected cells with 25 ml of PBS.
10. Repeat two times for the steps 8 and 9.
11. Store the sample at 70 C until use.
3.8 Input Sample 1. Place a tube containing the cross-linked cell pellet (H62:
Preparation for CoIFI 7 107 cells) prepared in Subheading 3.7 on ice.
2. Resuspend the pellet with 582 μl of pre-lysis buffer.
4. Resuspend the pellet with 660 μl of Lysis2 buffer.
5. Homogenize the mixture in a 1 ml Dounce homogenizer with
a tight pestle (20 strokes on ice).
7. Wash the pellet with 840 μl of PBST.
9. Repeat the steps 7 and 8.
10. Resuspend the pellet with 840 μl of PBST containing a protease
inhibitor cocktail and 1 mg/ml of RNaseA.
11. Incubate with mixing for 1 h at 37 C.
13. Wash the pellet with 1.4 ml of PBST.
15. Repeat two times for the steps 13 and 14.
16. Resuspend the pellet with 840 μl of CB1.3.
18. Resuspend the pellet with 690 μl of CB1.3 on ice.
19. Treat the mixture by a sonicator at 4 C (see Note 15).
20. Centrifuge at 16,000 g for 15 min. Recover supernatant and
measure its volume.
21. Add final 50 mM NaCl and final 1 mg/ml RNaseA, followed
by incubation for 21 h at 37 C.
22. The supernatant is mixed with 28 μl of streptavidin polyacryl-
amide resin for 1 h (see Note 16).
23. Centrifuge at 16,000 g for 15 min. Recover supernatant.
24. Freeze the recovered supernatant (i.e., input sample) by liquid

nitrogen. Store the sample at 70 C until use.
3.9 Nucleoprotein 1. Prepare 20 μl of a mixture containing the input sample

Isolation Via CoIFI (1 106 cells equivalent) prepared in Subheading 3.8,
10 mM MgCl2 and each 1.5 pmol of TFO-1 and TFO-3,
adjusted the volume by CB3.1. As a negative control, use
Scr-1 and Scr-2 instead of the TFOs.
3. Mix the sample with 4.8 μl of streptavidin magnetic beads (see
Note 17).
4. Incubate with mixing for 2 h. Discard supernatant via a mag-
netic stand.
5. Wash the beads with 100 μl of the following buffers: CB3 with
7 mM MgCl2, CB4 with 7 mM MgCl2, TS1, DIT4 2 times
(incubate at 55 C for 5 min in each time), TS1 (discard
supernatant after transferring the mixture (the beads in TS1)
into a new tube), then TS1.
6. Resuspend the beads with 10 μl of ER2.
7. Incubate with mixing for 1 h, followed by incubation at 98 C
for 1.5 min.
9. Analyze the recovered supernatant (Fig. 10).
4 Notes
1. Specific DNA isolation via triplex formation requires two core

components, a TFO probe and a TFT (triplex-forming tag)
site. The TFO probe is composed of a psoralen residue, an
LNA/DNA mixed oligonucleotide, and a spacer arm conju-
gated with a desthiobiotin residue (Fig. 1). The TFT site is
consisted of a complementary dsDNA to form triplex with the
TFO probe. We are using four different 22-mer TFO probes
(TFO-1, TFO-3, Scr-1, Scr-2), two different 22 bp TFTs
(TFT-1, TFT-2), and a TFT cassette. TFO-1 and TFO-3
form triplexes with TFT-1 and TFT-2, respectively. Scr-1 and
Scr-2 are negative controls not form triplexes with the above
TFTs because their sequences are not complementary. The
TFT cassette is a 61-bp dsDNA containing both TFT-1 and
TFT-2. Detailed sequence compositions of the TFO probes are
described in [14].
2. In order to isolate proteins binding to a transcriptional regu-
latory region, pAS114.1γ derived from pGL4.12 (Promega) is
constructed (Fig. 2). This plasmid is cloned a transcriptional
Fig. 10 Nucleoprotein isolation in CoIFI. (a) Genomic DNA is purified from the
input sample for CoIFI through deproteinization and reverse cross-link. The
sample is analyzed on 0.7% agarose gel. (b) Plasmid detection via PCR. 0.1%
of the elution products are used as a template to amplify a DNA segment in the
CDKN1A regulatory region. Lane sTFO corresponds to the elution product in CoIFI
using Scr-1 and Scr-2 as a negative control. Lane tTFO corresponds to the
elution product in CoIFI using TFO-1 and TFO-3. An estimated recovery yield in
CoIFI for the tTFO sample is 30% of input. The way how to determine recovery
yields based upon PCR is described in [14]. (c) Histone H3 detection via
WB. 79% of the elution products and input from 40 cells equivalent is
loaded. Both PCR and WB clearly show high specificity for isolation of the
specific nucleoprotein complexes in CoIFI
regulatory region of human CDKN1A gene encoding p21

[15, 16], whose cloning region is from 4554 to +45 bp
around its transcription start site at +1 bp. A region between
1181 and 792 bp of the transcriptional regulatory region is
replaced by a TFT site composed of six tandemly repeated TFT
cassettes. A hygromycin resistant gene is derived from a region
between BamHI and SalI of pGL4.32 (Promega). A linearized
form of pAS114.1γ is prepared by treatment of restriction
enzymes at sites depicted as RE (two sites) in Fig. 2. By the
restriction enzyme treatment, two DNA fragments (~3.9 kbp
and ~6.8 kbp) is produced and the larger fragment contains the
TFT site.
3. A plasmid pAS200.2 contains the tetracycline resistance gene
from pBR322, the pUC origin from plasmid pAS03 [14], and a
TFT site composed of four tandemly repeated TFT-1 (Fig. 5).

In order to isolate proteins binding to a DNA triplet repeat
whose genetic instability causes neurological diseases [17], a
plasmid pAS203 is constructed through insertion of a 44 bp
dsDNA cassette into the cloning site on pAS200.2 depicted in
Fig. 5. The dsDNA cassette contains seven tandemly repeated
CAG·CTG triplets and two nickases’ recognition sites sur-
rounding the triplet repeat (Fig. 5).
4. A 12-mer oligo is used as a scaffold to obtain pAS203 with a
closed stem-loop. The oligo is annealed on both six nucleotides
flanking the CAG triplet repeat (Fig. 6a).
5. pAS203(rcc) is a relaxed closed circular form of pAS203 and is
constructed as follows: Introduce a nick on pAS203 by a nickase.
Self-ligate the nicked pAS203. Cut out the ligated DNA from an
agarose gel. The extracted DNA is named pAS203(rcc).
6. A human cell line, 293 F cells (Invitrogen) are transfected with
pAS114.1γ linearized by SalI (Fig. 9). Monoclonal cell lines
that have stably integrated the plasmid are selected by hygro-
mycin. One of stably integrated cell lines (named clone H62) is
used in the CoIFI approach. Its integrated plasmid copy num-
ber is 688 deduced from a semiquantitative PCR analysis
whose protocol is described in [14]. Biological functionality
of the cloned CDKN1A regulatory region is confirmed by a
luciferase reporter assay using a Luciferase assay system in
presence of trichostatin A (TSA).
7. We use a plastic cap of a plastic centrifugation tube.
8. By UVA irradiation, the psoralen on TFO probe intercalated in
dsDNA as depicted in Fig. 1 is covalently cross-linked with
adjacent thymine(s) [14].
9. Before using the beads, they are washed two times with Extrac-
tion buffer.
10. Before mixing a plasmid, the beads are washed two times with
NCL250. Then, the beads are resuspended in 10 μl of
NCL250 with 1.25 mg/ml BSA. The indicated amount of
plasmid is added into the prepared beads solution.
11. Depending upon experimental purposes, the incubation time is
flexibly varied.
12. A short DNA fragment (33-mer) generated by the double
nicks on the plasmid is released via this heat step.
13. During this heat step, it is expected that the CAG triplet repeat
forms a stem-loop as drawn in Fig. 6a. Owing to the stem–loop
formation, 6 nt ssDNA regions flanking the CAG triplet repeat
are closely placed. Subsequently, the 12-mer oligo is annealed
to the proximate 6 nt ssDNA regions.
14. Before using the beads, they are washed two times with CB3.
15. Outcomes of sonication (i.e., patterns of genomic DNA frag-

mentation) are largely influenced by buffer components, types
of cell lines, cell density, cross-link conditions, and so on. The
sonication condition needs to be optimized.
16. Before using the resin, it is washed two times with CB1.3 with
50 mM NaCl.
17. Before mixing the sample, the beads are washed two times with
CB3.1. Then, the beads are resuspended in 10 μl of CB3.1 with
1.25 mg/ml BSA.
References
1. Kim T-K, Shiekhattar R (2015) Architectural 10. Sørensen MD, Meldgaard M, Raunkjaer M
and functional commonalities between enhan- et al (2000) Branched oligonucleotides con-
cers and promoters. Cell 162:948–959. taining bicyclic nucleotides as branching points
https://doi.org/10.1016/j.cell.2015.08.008 and DNA or LNA as triplex forming branch.
2. Sirbu BM, Couch FB, Feigerle JT et al (2011) Bioorg Med Chem Lett 10:1853–1856
Analysis of protein dynamics at active, stalled, 11. Sun JS, François JC, Montenay-Garestier T
and collapsed replication forks. Genes Dev et al (1989) Sequence-specific intercalating
25:1320–1327. https://doi.org/10.1101/ agents: intercalation at specific sequences on
gad.2053211 duplex DNA via major groove recognition by
3. Kliszczak AE, Rainey MD, Harhen B et al oligonucleotide-intercalator conjugates. Proc
(2011) DNA mediated chromatin pull-down Natl Acad Sci U S A 86:9198–9202
for the study of chromatin replication. Sci 12. Takasugi M, Guendouz A, Chassignol M et al
Rep 1:95. https://doi.org/10.1038/ (1991) Sequence-specific photo-induced
srep00095 cross-linking of the two strands of double-
4. Antão JM, Mason JM, Déjardin J, Kingston RE helical DNA by a psoralen covalently linked to
(2012) Protein landscape at drosophila mela- a triple helix-forming oligonucleotide. Proc
nogaster telomere-associated sequence repeats. Natl Acad Sci U S A 88:5602–5606
Mol Cell Biol 32:2170–2182. https://doi. 13. Brunet E, Corgnali M, Perrouault L et al
org/10.1128/MCB.00010-12 (2005) Intercalator conjugates of pyrimidine
5. Ide S, Déjardin J (2015) End-targeting prote- locked nucleic acid-modified triplex-forming
omics of isolated chromatin segments of a oligonucleotides: improving DNA binding
mammalian ribosomal RNA gene promoter. properties and reaching cellular activities.
Nat Commun 6:6674. https://doi.org/10. Nucleic Acids Res 33:4223–4234. https://
1038/ncomms7674 doi.org/10.1093/nar/gki726
6. Liu X, Zhang Y, Chen Y et al (2017) In situ 14. Isogawa A, Fuchs RP, Fujii S (2018) Versatile
capture of chromatin interactions by biotiny- and efficient chromatin pull-down methodol-
lated dCas9. Cell 170:1028–1043.e19. ogy based on DNA triple helix formation. Sci
https://doi.org/10.1016/j.cell.2017.08.003 Rep 8:5925. https://doi.org/10.1038/
7. Jain A, Wang G, Vasquez KM (2008) DNA s41598-018-24417-9
triple helices: biological consequences and 15. Gartel AL, Tyner AL (1999) Transcriptional
therapeutic potential. Biochimie regulation of the p21((WAF1/CIP1)) gene.
90:1117–1130. https://doi.org/10.1016/j. Exp Cell Res 246:280–289. https://doi.org/
biochi.2008.02.011 10.1006/excr.1998.4319
8. Duca M, Vekhoff P, Oussedik K et al (2008) 16. Georgakilas AG, Martin OA, Bonner WM
The triple helix: 50 years later, the outcome. (2017) p21: a two-faced genome guardian.
Nucleic Acids Res 36:5123–5138. https://doi. Trends Mol Med 23:310–319. https://doi.
org/10.1093/nar/gkn493 org/10.1016/j.molmed.2017.02.001
9. Nielsen PE, Egholm M (2001) Strand displace- 17. Iyer RR, Pluciennik A, Napierala M, Wells RD
ment recognition of mixed adenine-cytosine (2015) DNA triplet repeat expansion and mis-
sequences in double stranded DNA by match repair. Annu Rev Biochem 84:199–226.
thymine-guanine PNA (peptide nucleic acid). https://doi.org/10.1146/annurev-biochem-
Bioorg Med Chem 9:2429–2434 060614-034010
Chapter 17
DNA Fragment Agarose Gel Electrophoresis for Chromatin

Immunoprecipitation (ChIP)
Mayu Isono and Satoru Hashimoto
Abstract
Chromatin immunoprecipitation (ChIP) is a versatile method to investigate the interaction between specific
proteins and DNA regions in vivo. The success of ChIP experiments is highly dependent on the quality of
chromatin preparation and especially DNA fragmentation. To ascertain whether DNA fragmentation is
appropriate for ChIP experiments, agarose gel electrophoresis is required. Here we describe the experi-
mental procedure of agarose gel electrophoresis to verify whether DNA fragmentation is appropriate for
ChIP-slot blot experiments.
Key words ChIP, Slot blot, Sonication, DNA fragmentation, Agarose gel electrophoresis, Cyclo-
butane pyrimidine dimers (CPDs), RNA polymerase, Transcription coupled repair (TCR)
1 Introduction
Specific protein–DNA interactions define the chromatin conforma-

tion and regulate the nuclear homeostasis. Chromatin immunopre-
cipitation (ChIP) was developed to examine the interaction
between specific proteins and DNA regions in vivo. The conven-
tional method of ChIP consists of four steps as follows: (1) Cross-
linking between proteins and DNA in living cells or tissues.
(2) Chromatin shearing. (3) Immunoprecipitation of interested
protein–DNA complex. (4) Decrosslinking and purification of pro-
tein associated DNA fragments. Since the success of ChIP experi-
ments is highly dependent on the quality of chromatin preparation,
chromatin shearing is the critical step among the above four steps.
Sonication is a commonly used method for chromatin shearing,
although the shearing results may not be consistent between each
experiment. Aside from sonication, an enzymatic method is also an
option for chromatin shearing. An enzymatic method often creates
biased sequences susceptible to digestion, but it also has the benefit
of avoiding chromatin emulsification, which is a problem with
fragmentation by sonication. The preparation of chromatin
201
202 Mayu Isono and Satoru Hashimoto
Step 1: Crosslink
UV
Formaldehyde
RNA Polymerase II DNA CPD
Step 2: Sonication
Step 3: Agarose gel electrophoresis
Step 4: Immunoprecipitation and de-crosslink

Anti PolII antibody
and
Magnet beads
de-crosskink
Step 5: Slot blot
denature
Slot blot
Immuno detection
Fig. 1 Flowchart depicting each steps of ChIP-slot blot for the detection of UV
induced DNA damage, CPD, which associated with stalled RNA polymerase II
(PolII). Step 1: After UV irradiation, cells were cross-linked with formaldehyde,
extracted chromatin lysate. Step 2: Chromatin lysate is sonicated to shear DNA
Agarose Gel Electrophoresis for ChIP 203
fragments by sonication depends on the condition of the sample

(cross-linking time, buffer composition, chromatin concentration,
etc.) and the procedure time as well as power of the sonicator used;
notably the difference of only a few minutes results in oversheared
chromatin fragments [1, 2]. Because of the above reasons, agarose
gel electrophoresis is required to determine whether DNA frag-
mentation is appropriate for ChIP experiments.
After the first report of in vivo chromatin analysis by immuno-
precipitation using formaldehyde cross-linking [3, 4], ChIP has
become a versatile method. ChIP combined with quantitative
PCR has unveiled the many DNA associations with histone binding
proteins, transcription factors, DNA replication factors, and DNA
repair factors. In addition to PCR, ChIP assay also can be combined
with various techniques: slot blot hybridization [5], footprinting
technique [6], Western blot [7], and also with next generation
sequencing (ChIP-seq) to analyze protein–DNA interaction at the
genome wide level [8].
In this issue, we describe an example of ChIP based experi-
ment, ChIP-slot blot assay, which shows the linkage between the
transcription and DNA repair. DNA can undergo various modifica-
tions, including strand breaks, base damage, helix distortion and
strand cross-linking from exogenous and endogenous sources.
Nucleotide excision repair (NER) is an important and highly con-
served repair system responsible for removing UV induced DNA
lesions, which are bulky DNA adducts called cyclobutane pyrimi-
dine dimers (CPDs) and (6-4) photoproducts (6-4 PPs). NER
proceeds via two different pathways; one is global genomic repair
(GGR), which removes lesions in any sequence of the genome, and
the other is transcription coupled repair (TCR), which removes
lesions only in the actively transcribed DNA strand [9]. Upon
TCR initiation, RNA polymerase II (PolII) stalling at the lesions
plays an important role in triggering of NER factors recruitment
[10]. Here we describe the procedure of ChIP-slot blot assay for
the visualization of the CPD associated with stalled PolII, and also
for the evaluation of DNA fragments size by agarose gel electro-
phoresis through the experiment (Fig. 1).
Fig. 1 (continued) to an average fragment size of 100–500 bp. Step 3: Soni-

cated DNA fragments are decrosslinked and migrated in agarose gel to confirm
an extent of suitable DNA fragments for ChIP. Step 4: The DNA fragments are
immunoprecipitated with anti-PolII antibody. IP sample is decrosslinked with
elution buffer over night at 65 C. Step 5: Precipitated DNA fragments are
denatured 10 min at 100 C and blotted on membrane using slot blotter. CPD
is finally visualized by chemiluminescence immune detection
2 Materials
All materials and equipment must be DNase free.
2.1 Cross-Linking 1. PBS: 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM

KH2PO4.
2. Formaldehyde (see Note 1).
3. 50x Proteasome Inhibitor: Dissolve the one tablet of cOm-
pleteⓇ EDTA free proteasome inhibitor (Roche) in 1 ml water
(store in 20 C).
4. Buffer A: 0.25% Triton X-100, 10 mM EDTA, 0.5 mM EGTA,
20 mM HEPES (pH 7.6).
5. Buffer B: 150 mM NaCl, 1 mM EDTA, 0.5 mM, EGTA,
6. ChIP buffer: 0.24% SDS, 1% Triton X-100, 150 mM NaCl,
1 mM EDTA, 0.5 mM EGTA, 20 mM HEPES (pH 7.6).
2.2 Sonication 1. M220 sonication system.

2. microTUBE AFA Fiber Pre-Slit Snap-Cap (Covaris).
3. 5 ChIP buffer: 0.75% SDS, 5% Triton X-100, 750 mM NaCl,
2.3 Agarose Gel 1. Agarose: standard grade.

Electrophoresis 2. 50 TAE: 2 M Tris, 1 M acetic acid, 50 mM EDTA.
3. 6 Loading buffer: 0.25% Bromophenol blue, 30% glycerol,
5 mM EDTA.
4. Ethidium bromide (10 mg/ml).
5. 100 bp DNA ladder and/or 50 bp DNA ladder.
2.4 Immunopreci- 1. Rabbit anti-RNA Polymerase II Antibody (Cat. No. A304-

pitation and 405A, Bethyl).
DeCrosslinking 2. Dynabeads™ Protein G (Thermo Fisher Scientific).
3. Wash Buffer 1: 0.1% SDS, 0.1% deoxycholate, 1% Triton
X-100, 150 mM NaCl, 1 mM EDTA, 0.5 mM EGTA,
4. Wash Buffer 2: 0.1% SDS, 0.1% deoxycholate, 1% Triton
X-100, 500 mM NaCl, 1 mM EDTA, 0.5 mM EGTA,
5. Wash Buffer 3: 250 mM LiCl, 0.5% deoxycholate, 0.5% NP-40,
6. Wash Buffer 4: 1 mM EDTA, 0.5 mM EGTA, 20 mM HEPES
(pH 7.6).
7. Elution Buffer: 1% SDS, 10 mM DTT, 50 mM Tris (8.0),

1 mM EDTA.
8. RNase A (10 mg/ml).
9. Proteinase K (10 mg/ml).
10. 5 M NaCl.
11. 0.5 M EDTA.
12. MinElute PCR Purification Kit (Qiagen).
13. TE: 10 mM Tris (pH 8.0), 1 mM EDTA.
14. 10% BSA.
15. Eppendorf ThermoMixer®.
2.5 Slot Blot 1. Bio-Dot SF Microfiltration System (Bio-Rad).

2. Hybond-N+ (GE Healthcare).
3. Filter paper.
4. 2 N HCl.
5. TBST: 50 mM Tris (pH 7.4), 150 mM NaCl, 0.05% Tween 20.
6. Skim milk.
7. Mouse anti-CPDs antibody (Cosmo Bio).
8. Anti-mouse IgG, HRP-linked antibody (Cell Signaling
Technology).
9. ECL Western Blotting Detection Reagents (GE Healthcare).
10. ImageQuant LAS 4000 (GE Healthcare).
3 Methods
3.1 Cross-Linking Before starting, add the appropriate amount of 50 PIC to adjust
the required 1 PIC containing buffer, and prepare 11% formalde-
hyde in PBS.
1. Spread cells on 10 cm dishes to be subconfluent (see Note 2).
2. Wash the dishes with PBS two times, and add 10 ml PBS per
dish as well as 1 ml of 11% formaldehyde in PBS per dish.
3. Incubate for 5 min at room temperature, while shaking (see
Note 3).
4. Add 1 ml of 1.25 M glycine per dish to quench the formalde-
hyde cross-linking. Incubate for 1 min at room temperature,
while shaking.
5. Wash the dishes with cold PBS two times.
6. Scrape the cells with 2 ml Buffer A and collect them into 15 ml
tube. Incubate on ice 10 min.
7. Centrifuge for 5 min at 1000 g at 4 C by swing rotor and

remove supernatant (see Note 4).
8. Resuspend the cells with 5 ml/1 107 cells Buffer B and
incubate for 10 min at 4 C, while rotating.
9. Centrifuge for 5 min at 1000 g at 4 C by swing rotor and
discard the supernatant.
3.2 Sonication Chromatin lysate is sonicated to shear DNA to an average fragment

size of 100–500 (maximum 1000) bp (see Note 5). The conditions
of sonication require optimization, as different cell lines require
different time and power. This protocol is designed for the M220
DNA shearing system (Covaris) (see Note 6).
1. Resuspend the cross-linked cell pellets with 0.1 ml/5 106
cells 1 ChIP buffer.
2. Transfer the 130 μl of chromatin lysate into microtubes (see
Note 7).
3. Sonicate under the optimized conditions (see Note 8).
4. Collect the sonicated sample into one tube.
5. Centrifuge for 20 min at max speed (≧14,000 g) at 4 C and
pool all supernatants per condition into a new tube.
3.3 Agarose Gel Before starting, prepare enough 1 TAE and 2% agarose gel (1
Electrophoresis TAE) to achieve optimal separation for 100–500 bp DNA fragment
size.
1. For agarose gel electrophoresis, decrosslink 10 μl of each con-
dition test sample with ~1 μl RNAse A and ~1 μl proteinase K at
65 C for at least an hour.
2. Add 2 μl of 6 Loading buffer into the decrosslinked samples
and mix the solution by pipetting up and down.
3. Load sample, and DNA ladder marker (100 bp and/or 50 bp)
that facilitate estimation of DNA migration distance, on the 2%
agarose gel in the tank filled with 1 TAE.
4. Connect to the power supply and set the voltage at ~150 V (see
Note 9).
5. Put the gel into a container and pour 1 TAE buffer contain-
ing 50 μl of ethidium bromide—just enough to cover the gel.
Incubate for an hour with mild shaking (see Note 10).
6. Transfer gel from the container on the saran wrap, and then put
them onto the transilluminator to visualize the DNA frag-
ments. An example is shown in Fig. 2 (see Note 11).
a b
1000bp
1000bp 500bp
500bp
100bp
100bp
Time (min) 1 5 10 15 Time (min) 1 5 10 15 5 10

peak incident 75 60
power (W)
Fig. 2 Sonicated DNA fragments detection by agarose gel electrophoresis.

Chromatin lysate isolated from HeLa cells were sonicated by M220 DNA shear-
ing system (Covaris) under the following conditions with various treat times: (a)
Peak incident power 75 W, duty factor 10%, cycles per burst 200. (b) Peak
incident power 75 and/or 60 W, duty factor 2%, cycles per burst 200. In
condition (a), chromatin was fragmented into 100–200 bp in 5 min sonication,
although hardly fragmented in one minutes. In addition, the size of DNA was
almost same as condition (a) if the duty factor was 2%, while chromatin was less
fragmented when the duty factor was 2% and the peak incident power was 60 W
3.4 Immunopreci- 1. Mix 40 μl chromatin sample (2 106 cells) with 5 μl BSA (final
pitation and conc. 10%), 10 μl of 50 PIC, 445 μl ChIP incubation buffer,
DeCrosslinking and 2 μg anti RNA polymerase II antibody per sample (see
Note 12).
2. Incubate overnight, while rotating at 4 C.
3. Prepare protein G magnetic beads: wash two times with 800 μl
ChIP incubation buffer and resuspend with ChIP incubation
buffer containing 0.1% BSA.
4. Add 20 μl Dynabeads to each ChIP sample and incubate for 4 h
while rotating at 4 C.
5. Wash the beads two times with Buffer 1, one time with
Buffer 2, one time with Buffer 3, and two times with
Buffer 4 (see Note 13).
6. Incubate with 100 μl elution buffer in the Eppendorf Thermo-
Mixer® (15 min, 1000 rpm at 65 C).
7. Quickly spin down all the fluid in the bottom of tube and put
the tube on the magnetic rack.
8. Transfer the eluted supernatant to the new tubes.
9. Repeat elution (step 6). Total volume is 200 μl.
10. For input sample, mix up to 200 μl with elution buffer.
11. Add 8 μl 5 M NaCl and 1 μl RNase A (10 mg/ml) to each

sample.
12. Incubate samples overnight (around 16 h) at 65 C.
13. Add 3 μl 0.5 M EDTA and 1 μl Proteinase K (10 mg/ml) to
each sample.
14. Incubate for 2 h at 42 C.
15. Purify decrosslinked samples by MinElute PCR purification kit
and elute in 50 μl TE.
3.5 Slot Blot 1. Mix DNA samples up to 200 μl with TE.

2. Boil for 10 min. Put them on ice immediately while preparing
the Bio-Dot SF apparatus.
3. Prewet the HyBond-N+ membrane with water and assemble
the Bio-Dot SF apparatus according to the instructions.
4. Apply 200 μl of denatured DNA into the well.
5. After sample filtration, add 500 μl TE to each well and apply the
vacuum.
6. Disassemble the Bio-Dot SF apparatus and remove the
membrane.
7. After air drying, bake the membrane at 80 C for 2 h.
8. Incubate the membrane with 2 N HCl for 20 min at room
temperature, and then wash it with TBST.
9. Block the membrane with 5% skim milk in TBST for 1 h.
10. Add anti-CPD antibody (TDM2, 1:1000 in TBST) to the
membrane and incubate for 2 h.
11. Wash three times with TBST, 5 min each time.
12. Add appropriate HRP conjugated anti-mouse IgG and incu-
bate for an hour.
13. Wash three times with TBST, 5 min each time.
14. Add appropriate ECL solutions and detect the chemilumines-
cence by LAS 4000. CPDs precipitated with PolII are shown in
Fig. 4.
4 Notes
1. Choose methanol-free formaldehyde. According to the canon-

ical protocol, chromatin is cross-linked with 37% formalin
solution (containing methanol as a stabilizer), but methanol
treatment leads to over cross-linking, resulting in the uncut
form of chromatin.
2. Prepare an additional dish for counting the number of cells.
During the formaldehyde cross-linking period, the number of
cells is counted to prepare the appropriate concentration of

chromatin lysate.
3. The reaction time with formaldehyde affects the efficiency of
DNA cleavage by the sonication. Overtreatment causes exces-
sive cross-linking and reduces DNA cleavage efficiency.
4. One can pause the experiment by storing the sample in 80 C
after flash-freezing in nitrogen liquid.
5. The size of DNA fragments has to be determined according to
the purpose of the experiment, since the longer fragments will
deteriorate the efficacy of ChIP and the shorter DNA frag-
ments may inhibit the PCR amplification.
6. Depending on the sonication system, the concentration as well
as the volume of chromatin lysate should be adjusted.
7. The microtube can be reused after washing.
8. Since the DNA cleavage efficiency depends on the cell lines
used, the composition of the buffers, and the concentration of
chromatin, it is necessary to determine the optimal conditions
of the sonication. The first thing to optimize is the treatment
time from the default settings. Prolonged sonication increases
the amount of cleaved DNA fragments (Fig. 1a), but overtreat-
ment may destroy an epitope of a protein recognized by an
antibody used in immunoprecipitation. It is effective to change
the output of the sonicator to gain the appropriate size of DNA
fragments (Fig. 1b).
9. While determining optimal conditions, observe the dyes loaded
on the gel to ensure that the current is applied in the correct
direction. Also, TAE buffer can be reused.
10. Ethidium bromide is a carcinogen (DNA intercalator) and has
to be handled carefully. There are alternative safe DNA stains
available. Since postrunning gel staining is laborious, there is
also an option to use gel premixed with an ethidium bromide
(add it to the melted agarose/1 TAE to a final concentration
of 0.05 μg/ml). However, premixing can perturb DNA migra-
tion compared to postrunning gel staining.
11. Alternatively, choose the microchip electrophoresis technique
to analyze the size of DNA fragments more quantitatively and
more precisely instead of agarose gel electrophoresis. An exam-
ple is the use of Bioanalyzer 2100 (Agilent) shown in Fig. 3.
12. Prepare sample without an antibody as a negative control
besides the ChIP sample, in addition use a tube of 4 μl chro-
matin as an input sample (store at 4 C).
13. Spin down all the fluids in the tube and then put the tube in a
magnetic rack. Remove supernatant and add 500 μl washing
buffer. Put back them in the rotator.
Fig. 3 Measuring the size of DNA fragments by microchip electrophoresis. (a) The same sample as Fig. 1a lane
6 was loaded onto bioanalyzer 2100 (Agilent) using Agilent DNA1000 kit. DNA fragments were migrated to
around 100 bp. (b) Electropherogram showed the exact size and amount of each length of DNA fragments
ChIP
0.1% Input Control PolII
CPD
Fig. 4 Immune detection of PolII associated CPDs. HeLa cells were lysed at 30 min after UVC irradiation
(20 J/m2). UV irradiated chromatin fragments were precipitated with PolII and blotted on the Hybond-N+
membrane using a slot blotter. PolII associated CPDs were then visualized using immuno chemiluminescence
method
Acknowledgments
We are grateful to Alexander Zhovmer for critical reading of the

manuscript. This work was supported by Grant-in-Aid for Scientific
Research B (19H04266) from MEXT and JSPS.
References
1. Pchelintsev NA, Adams PD, Nelson DM 6. Kang SH, Vieira K, Bungert J (2002) Combin-
(2016) Critical parameters for efficient sonica- ing chromatin immunoprecipitation and DNA
tion and improved chromatin immunoprecipi- footprinting: a novel method to analyze
tation of high molecular weight proteins. PLoS protein-DNA interactions in vivo. Nucleic
One 11(1):e0148023. https://doi.org/10. Acids Res 30(10):e44
1371/journal.pone.0148023 7. Coin F, Oksenych V, Mocquet V, Groh S,
2. Schoppee Bortz PD, Wamhoff BR (2011) Blattner C, Egly JM (2008) Nucleotide exci-
Chromatin immunoprecipitation (ChIP): revi- sion repair driven by the dissociation of CAK
siting the efficacy of sample preparation, soni- from TFIIH. Mol Cell 31(1):9–20. https://
cation, quantification of sheared DNA, and doi.org/10.1016/j.molcel.2008.04.024
analysis via PCR. PLoS One 6(10):e26015. 8. Mikkelsen TS, Ku M, Jaffe DB, Issac B,
https://doi.org/10.1371/journal.pone. Lieberman E, Giannoukos G, Alvarez P,
0026015 Brockman W, Kim T-K, Koche RP, Lee W,
3. Solomon MJ, Larsen PL, Varshavsky A (1988) Mendenhall E, O’Donovan A, Presser A,
Mapping protein-DNA interactions in vivo Russ C, Xie X, Meissner A, Wernig M,
with formaldehyde: evidence that histone H4 Jaenisch R, Nusbaum C, Lander ES, Bernstein
is retained on a highly transcribed gene. Cell 53 BE (2007) Genome-wide maps of chromatin
(6):937–947 state in pluripotent and lineage-committed
4. Solomon MJ, Varshavsky A (1985) cells. Nature 448(7153):553–560. https://
Formaldehyde-mediated DNA-protein cross- doi.org/10.1038/nature06008
linking: a probe for in vivo chromatin struc- 9. Spivak G (2015) Nucleotide excision repair in
tures. Proc Natl Acad Sci U S A 82 humans. DNA Repair (Amst) 36:13–18.
(19):6470–6474 https://doi.org/10.1016/j.dnarep.2015.09.
5. Kuo MH, Allis CD (1999) In vivo cross- 003
linking and immunoprecipitation for studying 10. Mullenders L (2015) DNA damage mediated
dynamic protein:DNA associations in a chro- transcription arrest: step back to go forward.
matin environment. Methods (San Diego, DNA Repair (Amst) 36:28–35. https://doi.
Calif) 19(3):425–433. https://doi.org/10. org/10.1016/j.dnarep.2015.09.005
1006/meth.1999.0879
Chapter 18
Postlabeling/PAGE Method for Detection of DNA Adducts

Kazuhiro Shiizaki
Abstract
In DNA adduct analysis, the 32P-postlabeling technique is a powerful tool due to its high detection
sensitivity. It is performed by enzymatic digestion of DNA samples, enrichment of the adduct nucleotides,
and then 50 -labeling with 32P. This method is particularly useful for detection of bulky adducts. An
additional advantage is that only a small amount of DNA is required for detecting DNA adducts. This
chapter describes the experimental procedure for separation and detection of DNA adducts by polyacryl-
amide gel electrophoresis, which is an attractive method for visually assessing differences in adduct
formation between samples.
32
Key words DNA adduct, P-postlabeling, Polyacrylamide gel electrophoresis, Chemical mutagen,
Autoradiography
1 Introduction
Many mutagens and carcinogens cause mutations by forming DNA

adducts. This process often requires the activation of specific che-
micals by metabolic enzymes. In most cases, DNA adducts are
repaired and only few are responsible for genetic mutations. DNA
adducts found in biological samples, such as urine and lympho-
cytes, can serve as a good biomarker of DNA damage and are
thought to reflect exposure to mutagens and carcinogens. Thus,
detection of DNA adducts is important for characterization and
quantification of mutagens as well as for studying the metabolic
enzymes that produce mutagenicity.
Various methods for detecting DNA adducts are available. In
recent years, tandem mass spectrometry (MS/MS) analysis has
become the standard. However, the postlabeling method using
radioisotopes is extremely sensitive and thus suitable for detecting
small amounts of adducts. Initially, detection of DNA adducts by the
postlabeling method was performed mainly by silica gel-based thin
layer chromatography [1]. Subsequently, the detection method
using high concentration polyacrylamide gel electrophoresis has
213
214 Kazuhiro Shiizaki
allowed simultaneous analysis multiple samples in a single autoradio-

gram. As the differences between samples can be recognized intui-
tively, the data have visual appeal—especially when comparing
adduct formation in several concentrations of mutagens or multiple
chemical treatments [2]. This 32P-postlabeling and PAGE method
was first developed and reported by Dr. Isamu Terashima at the
Shibutani Laboratory at the State University of New York [3].
32
P-postlabeling and PAGE analysis is a method of separating
adduct DNA and normal nucleotides by polyacrylamide gel elec-
trophoresis after radio labeling. Due to the small amount of adduct
DNA (<single adduct/105 nucleotides), phosphorylation labeling
by 32P is necessary for detection. However, the amount of [γ-32P]-
ATP that can be used is limited. Therefore, two methods for
enrichment of adduct concentration are utilized: (1) a separation
method based on the hydrophobicity of the adducted nucleotides
and (2) a method in which only adducted nucleotides are labeled.
DNA containing adducts should be digested into mononucleotides
by two types of nucleases. Micrococcal nuclease (MN) is an endo-
nuclease catalyzing cleavage of DNA to 30 -phosphonucleotides
[4]. Spleen phosphodiesterase II (SPD) is an exonuclease that
hydrolyzes DNA to 30 -phosphomononucleotides [5]. After diges-
tion of adduct-containing DNA to mononucleotides, nuclease P1
treatment is used to efficiently enrich the adducted nucleotides.
Nuclease P1 (from Penicillium citrinum) is a unique enzyme that
dephosphorylates unmodified deoxyribonucleoside-30 -monophos-
phate. However, as adduct-containing nucleotides are not substrates
for this enzyme, a small amount of adduct-containing nucleotides
remain 30 -monophosphate while most nucleotides are dephosphory-
lated. Labeling of the nucleotides is carried out by T4 polynucleotide
kinase (30 -phosphatase free); however, this enzyme can only phos-
phorylate the 50 -hydroxyl end of the polynucleotide and nucleoside
30 -monophosphate. Therefore, only adduct-containing nucleotides
can be substrates of T4 polynucleotide kinase and be radiolabeled
with [γ-32P]-ATP (Fig. 1).
The other procedure for enrichment of DNA adducts is sepa-
ration by n-butanol–water two-phase solvent system. Bulky DNA
adducts commonly increase hydrophobicity compared to normal
nucleosides. In particular, many bulky adducts exhibit increased
hydrophobicity by binding of chemicals capable of diffusing
through the plasma membrane due to their hydrophobicity. There-
fore, they can be isolated from normal nucleotides using an aque-
ous two-phase system.
The postlabeling method is performed in the following four
steps:
(a) Extraction of DNA containing adducts.
(b) Digestion of DNA into individual nucleotides and
dephosphorylation.
Post-labeling/PAGE Analysis to Detect DNA Adducts 215
Adduct
base base base base base
5’ 3’
P P P P P OH
Hydrolysis by MN and SPDII
5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’
HO P HO P HO P HO P HO OH
Dephosphorylation by Nuclease P1
5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’
HO OH HO P HO OH HO OH HO OH
base
Butanol extraction
base
base base
5’ 3’
5’ 3’ HO OH
5’ 3’ 5’ 3’ HO OH base
HO OH HO P
5’ 3’
Phosphorylation by T4 PNK with -32P ]ATP HO OH
Adduct
base base
5’ 3’ 5’ 3’
HO OH 32P
P
Fig. 1 Principle of DNA adduct enrichment. DNA containing adducts is treated with micrococcal nuclease (MN)
and spleen phosphodiesterase II (SPDII). These enzymes digest DNA into 30 -phosphomononucleotides. After
digestion, nuclease P1 dephosphorylates normal (unmodified) deoxyribonucleoside-30 -monophosphate to
generate deoxyribonucleosides. However, adduct-containing nucleotides remain as 30 -monophosphates
since nuclease P1 cannot dephosphorylate modified nucleotides. As the nucleotides containing adducts
indicate an increase in hydrophobicity, they can be isolated from normal nucleotides using a 1-butanol–water
biphasic solvent system. T4 polynucleotide kinase can phosphorylate the nucleoside 30 -monophosphate but
not deoxyribonucleosides without a phosphate group. Finally, only the adduct-containing nucleoside 3-
0
-monophosphate can be phosphorylation labeled with [γ-32P]-ATP
(c) Enrichment of adduct nucleotides using a two-phase

separation.
(d) Enzymatic labeling of nucleosides with 32P.
After these procedures, the labeled adduct-containing nucleo-
tides can be separated by thin layer chromatography or polyacryl-
amide gel electrophoresis and visualized by autoradiography. This
chapter focuses on the method using high concentration polyacryl-
amide gel electrophoresis and explains its procedures in detail.
2 Materials
2.1 Equipment 1. Microtube centrifuge, maximum RCF 10,000 g.

and Accessories 2. Multitube vortex mixer.
3. Vacuum concentration system [e.g., SpeedVac (Thermo Fisher
Scientific)].
4. Dry block incubator, with 65 C setting.
5. 30 cm 40 cm glass plates with 0.35 mm spacer and comb.
6. Electrophoresis power supply (1500 V output possible).
7. X-ray film cassette, 14 17 inch.
8. Plastic wrap, wider than the width of the glass plate.
9. Spatula or painting knife.
10. Phosphor imaging scanner [e.g., Storm or Typhoon (Amer-
sham/GE Healthcare) or BAS-2500 (Fujifilm)].
11. Image analysis software [e.g., ImageQuant TL software
(GE Healthcare)].
2.2 In Vitro 1. Recombinant drug metabolizing enzymes [e.g., Supersomes™

Activation (Corning®)].
of Chemicals by 2. NADPH Regeneration System (Promega).
Recombinant Enzymes
3. Phosphate buffer: 1 M K2HPO4 and 1 M KH2PO4 and mix to
and DNA Isolation pH 7.4.
4. DNA solution: arbitrary DNA such as calf thymus DNA,
salmon sperm DNA, or plasmid DNA.
5. Commercially available DNA purification kit with silica-based
membrane (e.g., Blood & Cell Culture DNA Mini Kit, Qia-
gen) (see Note 1).
2.3 Nucleotide 1. 2 MN/SPD buffer (pH 6.0): 34 mM succinic acid disodium,

Digestion and 16 mM CaCl2 (see Note 2).
Dephosphorylation 2. Micrococcal Nuclease (Worthington): 10 unit/μL.
3. Spleen phosphodiesterase II (Worthington): 0.03 unit/μL.
4. Nuclease P1 (FUJIFILM Wako Pure Chemical Corporation):

1 unit/μL.
5. n-butanol.
2.4 Phosphorylation 1. T4 Polynucleotide Kinase, 30 -phosphatase free.

Labeling with 32P 2. 10 T4 Polynucleotide Kinase Buffer: 500 mM Tris-HCl,
100 mM MgCl2, 50 mM DTT, 1 mM spermidine, pH 8.2
(at +25 C).
3. [γ-32P]-ATP (111 TBq/mmol, 3000 Ci/mmol).
4. 5 loading dye: 0.05% BPB/XC, 20 mM EDTA (pH 8.0) in
50% formamide (see Note 3).
2.5 Polyacrylamide 1. 40% Acrylamide solution or 40% acrylamide–bis 19:1 solution

Electrophoresis (see Note 4).
2. 10 TBE buffer (pH 7.0): 1 M Tris base, 2.24 M boric acid,
25.5 mM EDTA.
3. 10% Ammonium persulfate (see Note 5).
4. N,N,N,N-Tetramethylethylenediamine (TEMED).
3 Methods
3.1 DNA Isolation 1. Prepare cells at a density of 2–5 106 on a 6-well plate or
from Cell Culture 35 mm culture dish.
2. Add the mutagen to the medium and incubate for the appro-
priate period. In the case of a mutagen requiring metabolic
activation (e.g., benzo[a]pyrene), 4–12 h exposure is required.
3. After incubation, wash cells with PBS and lyse directly on the
dish by adding the lysis buffer contained in the preferred DNA
extraction kit.
4. Follow the kit instruction manual for the extraction procedure.
The concentration of DNA solution should be adjusted to
1 μg/μL.
3.2 In Vitro DNA 1. Incubate the mutagen of interest and DNA with S9 mix or
Adduct Formation by microsomes purified from mammalian cells. The use of micro-
Activation somes purified from recombinant insect cells expressing cloned
of Chemicals Using human enzymes has several advantages like identification of
Microsomes mutagen activation enzymes. In most cases, addition of a
NADPH regenerating system will be required.
2. After incubation, stop the reaction by adding the DNA extrac-
tion buffer contained in the DNA extraction kit to the reaction
mixture. Next, follow the kit instruction manual for the extrac-
tion procedure.
3. An example of the reaction is shown below.

Mix the following components in a 1.5 mL microcentri-
fuge tube:
20 μL Calf thymus DNA (0.5 μg/μL)

5 μL Phosphate buffer (pH 7.4)
11 μL D.W.
10 μL Human CYP1A1 + Oxidoreductase
Total 46 μL.
Preincubate for 5 min at room temperature.
4. Add the following reagents to the tube:
1 μL 100 μM benzo[a]pyrene in 1% DMSO

2.5 μL Solution A—NADPH Regeneration System
0.5 μL Solution B—NADPH Regeneration System
Total 50 μL.
Incubate for 1 h at 37 C.
5. Stop the reaction by adding the premixed solution consisting of
80 μL Buffer ATL and 20 μL proteinase K contained in the
DNeasy Blood & Tissue Kit.
6. Add 200 μL Buffer AL and mix by vortexing for 15 s. Incubate
for 10 min at 56 C.
After incubation, add 200 μL ethanol and mix thoroughly
by vortexing.
7. Transfer the reaction solution into QIAamp MinElute. Centri-
fuge at 6000 g for 1 min.
8. Discard the flow-through, add 500 μL of Buffer AW1, and
centrifuge at 6000 g for 1 min. Wash the column with Buffer
AW2 using the same procedure.
9. Place the QIAamp MinElute column in a 1.5 mL microcentri-
fuge tube and centrifuge at full speed for 3 min to dry the
membrane completely.
10. Transfer the QIAamp MinElute column to a new 1.5 mL
microcentrifuge tube. Apply 100 μL Buffer AE to the center
of the membrane. Incubate at room temperature for 1 min,
then centrifuge at full speed for 1 min. For efficient DNA yield,
these elution steps should be repeated one more time.
11. The eluted DNA must be concentrated by ethanol precipita-
tion. Reconstitute the DNA in D.W. at a concentration of
1 μg/μL.
3.3 Nucleotide 1. Mix the following reagents in a 1.5 mL microcentrifuge tube:

Digestion and
Dephosphorylation/ 5 μL DNA (1 μg/μL)
Enrichment of DNA 5 μL 2 MN/SPD buffer
Adducts by Nuclease
1 μL Micrococcal nuclease (10 unit/μL)
P1
2.5 μL Spleen phosphodiesterase (0.03 unit/μL)
Total 13.5 μL.

Incubate at 37 C for 2 h.
2. In order to quantify adduct-containing nucleotides by referring
to the radioactivity of labeled normal nucleotides, stock a por-
tion of the reaction solution in this step. Transfer 1 μL of the
reaction solution to a new 1.5 mL microcentrifuge tube con-
taining 119 μL D.W. and store until labeling reaction (see
Subheading 3.5, step 2). This diluted sample contains
10 pmol/μL 20 -deoxynucleotide 30 -monophosphate (dN30 p)
when the average molecular weight of the hydrolyzed nucleo-
tides from human genomic DNA is approximately 309.
3. Add 1 μL nuclease P1 (1 unit/μL) to the reaction and incubate
at 37 C for 1 h.
3.4 Enrichment After digestion and P1 nuclease treatment, adduct nucleotides

of DNA Adduct Using should be concentrated by aqueous two-phase extraction, which
n-butanol–Water is an efficient procedure for enriching DNA adducts.
Two-Phase Solvent 1. Prepare water-saturated n-butanol. Mix 50 mL n-butanol and
System 50 mL of distilled water (D.W.) and shake vigorously. After
allowing the solution to stand for a few minutes, it will divide
into two phases. Use the top layer for enrichment of DNA
adducts, but do not completely discard the lower layer (n-
butanol-saturated water). Store at room temperature.
2. Add 200 μL D.W. and 200 μL water-saturated butanol. Agitate
by vigorously vortexing for 10 min. A multitube vortex mixer is
useful and can reduce differences in extraction efficiency
between samples.
3. Centrifuge at 18,000g for 2 min. Transfer the upper layer
(approximately 160 μL) to a new microcentrifuge tube.
4. Add 200 μL water-saturated butanol to the remaining lower
layer and mix vigorously for 10 min.
5. Centrifuge at 18,000g for 2 min. Transfer the upper layer
(approximately 180 μL) to the tube containing the upper layer
of the previous centrifugation.
6. Back-extract the nonadducted nucleosides by adding 100 μL
D.W. to the tube containing the recovered butanol. Mix vigor-
ously for 10 min and centrifuge at 18,000g for 2 min.
7. Transfer the upper layer (about 320 μL) to a new tube and dry
it using vacuum-drying equipment, such as SpeedVac. A visible
white pellet may appear in the dried samples; in many cases, this
is not a problem for subsequent reactions.
3.5 Phosphorylation 1. Add 10 μL D.W. to the tube containing the dried sample and
Labeling with 32P dissolve completely by heating at 65 C for 5 min.
2. If you want to prepare standards for quantifying adduct nucleo-
tides, dilute 1 μL of the dN3’p solution (stocked in Subheading
3.3, step 2) with 1 mL D.W. to make a concentration of
10 fmol/μL. Use 10 μL (100 fmol) of the dN30 p solution to
label the reaction as done for the other samples (see Note 6).
3. Add 1.5 μL T4 polynucleotide kinase buffer, 1 μL [γ-32P]-ATP,
and 0.5 μL (5 units) T4 polynucleotide kinase (30 -phosphatase
free) to each tube. It is recommended to prepare master mixes
of these reagents according to the number of samples and
dispense to each tube. Incubate at 37 C for 1 h.
4. Stop the reaction by adding 3 μL 5 loading dye to the sample.
The sample can be stored at 20 C, but should be used for
electrophoresis within 2 days.
3.6 Preparation 1. Before assembly of the glass sandwich, wash each glass plate
of 30% and wipe it with methanol or ethanol using a lint-free wiper.
Polyacrylamide Gel 2. Place the side spacers to fit exactly with the outer edge of the
glass plate. Place the notched glass plate on the glass plate and
align the outer and lower edges of both plates. Fix the glass
sandwich by clamping with binder clips (Fig. 2a). Do not pinch
the clip inside the spacer because the thickness of the gel will
become uneven (Fig. 2b). To avoid leaking of the gel mix, the
bottom spacer must adhere to the edge of the side spacers
(Fig. 2c) (see Note 7).
3. Mix the following reagents in a 50 mL disposable centrifuge
tube:
30 mL 40% Acrylamide–bis 19:1 solution (see Note 4)

5 mL 10 TBE buffer
5 mL D.W.
Total 40 mL
4. Add freshly prepared 0.6 mL 10% ammonium persulfate and
35 μL TEMED just before pouring. Mix well by swirling gently
while avoiding generation of tiny air bubbles.
5. Transfer the solution to a 50 mL disposable syringe and imme-
diately pour into the glass plate sandwich (Fig. 2d). If bubbles
get into the gel, tilt the plate upward and knock the glass plate
to remove the bubbles (see Note 8).
a b
d e
f g
Fig. 2 Important points for preparing polyacrylamide gel. The glass sandwich should be fixed with binder clips
(a). Be careful not to pinch the clip inside the spacer (b). To prevent the gel solution from leaking, the lower
spacer must be in close contact with the end of the side spacer (c). Pour the gel solution continuously from the
corners of the glass plate (d). After inserting the comb, clamp the top of the plate with a binder clip (e). The gap
between the glass plate and comb creates a thin film of gel in the well. Any remaining gel film can be removed
using filter paper strips (f). If a partition in the well is broken, cut the spacer into a wedge and insert it into the
gel to separate the wells (g)
6. These steps must be done quickly. High concentrations of

acrylamide generate heat during polymerization and will accel-
erate the reaction.
7. Insert the comb and clamp the upper part of the plate with a
binder clip. Ensure that there is no gap between the glass plate
and the comb (Fig. 2e). Allow the gel to polymerize for at least
30 min.
8. Remove the comb from the gel and check the wells. If there is a
thin gel film in the well, remove it using a strip made of filter
paper (Fig. 2f). If the partition between wells is broken, cut the
spacer into a wedge and insert it into the gel (Fig. 2g).
3.7 Electrophoresis 1. Before loading the samples, perform a prerun of the gel for
10 min at 800 V. Prerunning the gel prevents disturbance of
the bands, which is frequently observed at the tip of
electrophoresis.
2. Apply half the volume (7.0–8.0 μL) of the 32P-labeled nucleo-
side mixed with dye solution prepared in Subheading 3.5 to the
polyacrylamide gel.
3. If there is air in the gap at the bottom of the glass sandwich, the
current will not flow. Use a syringe with a bent needle to
completely remove any air from inside the gel sandwich.
4. Run electrophoresis at 800 V for 10 min, followed by 1350 V
for 4 h (see Note 9).
5. Stop electrophoresis when the bromophenol blue in the load-
ing dye moves approximately 10 cm from the well.
3.8 Autoradiography 1. After electrophoresis, remove the buffer from cathode buffer
and Quantification tank, take out the glass-plate sandwich, and wipe off the
of Radioactivity remaining buffer at the bottom of the glass plates. Since the
electrophoresis buffer in the anode tank contains 32P, handle
the glass plate carefully to avoid contamination.
2. Open the X-ray cassette and spread the thick vinyl sheet inside
of the cassette to avoid contamination. Place the glass sandwich
such that the notched glass plate is on top.
3. Remove the spacer from the glass sandwich. Next, insert a
spatula or a painting knife into the gap of the plates near the
bottom, and slowly remove the glass plate. Prying the glass
plate sandwich from the notch may damage the plate. Cover
the gel with plastic wrap to prevent drying.
4. For quantitative analysis, phosphor imaging scanners such as
Storm/Typhoon or BAS-2500 are useful. In this case, the
imaging plate should be in contact with the gel covered with
plastic wrap for about 4 h in the X-ray film cassette (see Note
10). The radioactivity on the gel is visualized and quantified
using the appropriate software, such as ImageQuant TL

software.
5. For autoradiography using X-ray film, place the gel-attached
glass plate in an X-ray cassette and contact the X-ray film to the
gel under red light in a dark room. Autoradiography requires
exposure for at least 12 h.
6. In the autoradiogram images, the bands of [γ-32P]-ATP not
used in the reaction appear at the bottom of the gel, and the
adduct-containing nucleotides appear as slower migrated
bands (Fig. 3a) (see Note 11). Insufficient DNA hydrolysis
and inadequate dissolution of the sample after drying can
cause the appearance of extra bands or a smeared background
(Fig. 3b). When the normal nucleotides kept in Method 3.3.2
are labeled and subjected to electrophoresis, the 32P-labeled
nucleotides (deoxynucleotide 30 , 50 -bisphosphate) appear at a
lower position than the band of unincorporated [γ-32P]-ATP
(Fig. 3c). By using image analysis software, the amount of
nucleotides can be quantified as the “band volume” or “band
intensity”.
7. The amount of adduct nucleotides is calculated by the follow-
ing equation:
Adduct levels (fmol/μg DNA) ¼ 21.6 (adduct nucleotides
quantity)/(total nucleotides quantity)
The “quantity of total nucleotides” refers to the sum of the
“band volume” of four normal nucleotides.
The coefficient value “21.6” in the equation is calculated as
follows:
{100 fmol (labeled normal nucleotides)/5 μg (DNA amount at
start)} {13.5 μL (hydrolysis reaction volume)/12.5 μL (labeling
reaction volume)}
4 Notes
1. Using a cartridge-based DNA purifying system is particularly

advantageous when purifying mutagen-treated DNA in vitro
with microsomes or cytosol-containing drug-metabolizing
enzymes. In this case, DNA is apt to degrade into short frag-
ments. DNA extraction by phenol treatment and isopropanol
precipitation may cause loss of DNA; furthermore, the muta-
gen will be distributed to various types of waste solutions. In
cartridge purification, fragmented DNA can be isolated with-
out loss and only a small amount of aqueous waste containing
mutagens is generated.
a b
G
A
T
C
Fig. 3 Autoradiogram of polyacrylamide gel. Typical autoradiography image for

detecting DNA adducts. HepG2 cells were treated with various concentrations of
benzo[a]pyrene (a). Unincorporated [γ-32P]-ATP appears as a thick band at the
bottom of the gel (black triangle). Adduct bands appear as slower migrated
bands (a, square bracket). Insufficient DNA hydrolysis causes the appearance of
extra bands of dinucleotides or normal deoxynucleotide 30 , 50 -bisphosphate (b,
left panel, square bracket). Inadequate dissolution of the sample after drying can
cause an increase in the background and smearing (b, right panel). A mixture of
normal 20 -deoxynucleotides 30 -monophosphate (25–100 fmol) was labeled and
underwent electrophoresis (c). Four nucleotides 30 -50 -bisphosphate appear at a
position lower than that of [γ-32P]-ATP (black triangle)
2. Enzymes provided as dry powder should be dissolved in 1

MN/SPD buffer containing 25% glycerol at an appropriate
concentration and stored at 20 C.
3. If loading the sample onto the gel is difficult, change the
formamide in the loading dye to glycerol.
4. Polyacrylamide gels with or without bis (N, N0 -methylene-bis-

acrylamide) can be used depending on researcher’s preference.
Polyacrylamide gel without bis is flexible, but its stickiness
makes it troublesome to remove the glass plates after electro-
phoresis. Alternatively, polyacrylamide gels containing bis are
easy to handle but are prone to breakage—particularly in the
well partitions. In addition, the mobility of nucleotides in gels
containing bis is slightly slower than that in gels without bis,
although the resulting bands are relatively sharp.
5. Since ammonium persulfate is highly hygroscopic and unstable
in aqueous solution, crystals should be stored in a dry condi-
tion. Fresh solution must be prepared at the time of use.
6. If 20 -deoxynucleotide 30 -monophosphate or authentic adduct
nucleotide 30 -monophosphate is obtained, more accurate
quantification can be achieved by labeling with 32P. However,
the supply of 20 -deoxynucleotide 30 -monophosphate from
Sigma-Aldrich was suspended at the time of writing
(Feb. 2019).
7. By applying a slight amount of silicone grease to the end of the
side spacer, it is possible to prevent leakage of the gel mix.
However, completely wipe the remaining grease from the
glass plate before the next use.
8. Optionally, by passing the gel mix solution through a 0.45 μm
syringe filter, dust and small air bubbles in the gel can be
prevented.
9. When high voltage is applied at the start of electrophoresis, the
temperature rises rapidly, which may break the glass plates and
disturb the band pattern. It is thus necessary to change the
voltage according to the size of the glass plate and the width of
the spacer. For example, when a 200 mm 400 mm glass plate
is used, the constant voltage should be set to 900 V.
10. If the glass plate and imaging plate cannot be placed in the
cassette, remove the gel to filter paper, cover it with plastic
wrap, and then put it in the cassette along with the imaging
plate.
11. When multiple adduct bands appear, it can be difficult to
identify which band corresponds to each DNA adduct struc-
ture. It can be determined only by purified authentic adduct.
Acknowledgments
This work was supported by JSPS KAKENHI Grant Numbers

JP15K06849. The author is grateful to Dr. Masanobu Kawanishi
and Dr. Takashi Yagi at Osaka Prefecture University for helpful
advice and support for carrying out this study.
References
1. Randerath K, Reddy MV, Gupta RC (1981) electrophoresis analysis: application to the detec-
32
P-labeling test for DNA damage. Proc Natl tion of DNA adducts. Chem Res Toxicol
Acad Sci U S A 78:6126–6129 15:305–311
2. Shiizaki K, Kawanishi M, Yagi T (2017) Modu- 4. Alexander M, Heppel L, Hurwitz J (1961) The
lation of benzo[a]pyrene-DNA adduct forma- purification and properties of micrococcal nucle-
tion by CYP1 inducer and inhibitor. Genes ase. J Biol Chem 236:3014–3019
Environ 39:14 5. Bernardi A, Bernardi G (1971) Spleen acid exo-
3. Terashima I, Suzuki N, Shibutani S (2002) nuclease. In: Boyer PD, Krebs EG (eds) The
32
P-Postlabeling/polyacrylamide gel enzymes, vol 4, 3rd edn. Academic Press,
New York
INDEX
A DNA damage......................................................... 2, 7, 10,

43, 73, 74, 76–79, 82, 89, 90, 101–109, 136, 138,
Agarose gel electrophoresis .......................................7, 15, 139, 145, 202, 213
17, 18, 25–41, 45, 61–71, 102, 123, 146, 170, DNA damaging agents ........................................... 10, 89,
201–211
90, 111, 137–138, 155, 156, 158
Agarose plugs ...................................................... 6, 10, 63, DNA double-strand breaks (DSBs) ..........................1, 29,
64, 67, 70, 97, 118, 125–127, 131, 136, 70, 74, 80, 89, 101, 111–121, 123–132, 135,
138–140, 146, 147, 149, 160
145–162, 175, 177–179, 184
Aggregatibacter actinomycetemcomitans ............ 112, 114, DNA fragmentation ................................................ 44, 45,
117, 120 89–98, 199, 203
Apoptosis ............................................................ 78, 89–97
DNA intercalation........................................................... 23
Autoradiography ..........................................216, 222–224 DNA recombination ....................................................2, 5,
43–57, 136, 145
B
DNA repair .............................................................. 2, 5, 6,
Bacterial chromosomes ................................124, 145–154 76, 79–87, 90, 101, 135, 136, 145, 203
DNA replication ...................................................... 2, 4, 5,
C 10, 43–57, 61–71, 90, 92, 123–132, 145, 155,
Caspase inhibitor, Z-VAD-FMK ..............................90, 92 203
Cetyl trimethylammonium bromide (CTAB) DNA DNA single-strand breaks (SSBs) .............................1, 74,
76, 80, 102, 156, 177, 178
extraction ..........................................45, 47, 50–51
Chemical mutagens..................................... 213, 214, 217 DNA supercoiling ......................................3–5, 15–20, 23
Chromatin ............................................................... 10, 90, DNA topoisomers .............................................. 15–23, 90
Double minutes............................................................. 165
183–199, 202, 207, 210
Chromatin immunoprecipitation
E
(ChIP)...................................................... 201–210
Chromosomal instability............................................... 155 Electrophoresis ...........................................................1–11,
Chromosomes ..........................................................2, 5–7, 15–23, 25–41, 61–71, 73, 75–77, 80, 81, 83, 87,
10, 45, 89, 102, 113, 115, 121, 124, 128–130, 101–108, 119, 123–132, 135–142, 145–154
136, 142, 145–155, 157, 165–180 Epigenetics ...................................................................... 10
Circle-Seq ............................................................. 165–180 Episomes........................................................................ 165
Circular DNA purification .......................... 166, 167, 216 EtBr, see Ethidium bromide (EtBr)
Comet assay ..............................................................2, 5–7, Ethidium bromide (EtBr)..........................................5, 17,
73–87, 101 19–23, 28, 48, 51–54, 61, 63, 66, 93, 104–106,
Contour-clamped homogenous electric field 109, 116, 121, 132, 138, 141, 153, 161, 162,
(CHEF)....................................101–109, 123, 124 191, 204, 209
Cyclobutane pyrimidine dimers Evodiamine................................................................90–93
(CPDs) ..................................................... 202, 203, Extrachromosomal ........................................................ 165
208, 210 Extrachromosomal circular DNA
(eccDNA)................................................. 165–167,
D 170, 172–174, 177–179
DNA adducts............................................ 10, 11, 76, 203,
F
213–225
DNA-based chromatin capture ........................... 183–199 Fanconi anemia ............................................................... 79
DNA circle........................................................ 4, 165–180 Fission yeast.......................................................... 135–142
https://doi.org/10.1007/978-1-0716-0323-9, © Springer Science+Business Media, LLC, part of Springer Nature 2020
227
DNA ELECTROPHORESIS: METHODS AND PROTOCOLS
228 Index
G R
Genomic integrity ....................................... 129, 155, 158 Relaxed DNA ........................................15, 16, 18, 20, 23
Repair....................................................................... 2, 5, 6,
H 10, 62, 74, 79–87, 101, 124, 129–131, 136, 142,
145, 155, 175, 203, 213
Homologous recombination (HR).................... 129, 130,
135, 155 Replication............................................................... 2, 4, 5,
10, 15, 25–41, 43–57, 61–71, 90, 101, 112,
I 123–132, 135, 145
endonucleases ................................................. 124, 178
Immunoblotting ................................................. 102, 107, forks ............................................................... 5, 43, 62,
112, 113, 116, 119–120 70, 90, 124, 129, 155
Intermediate structures of DNA ........................... 2, 5, 62 intermediates ................................................. 4, 43, 45,
Interstrand crosslinks (ICLs).........................7, 56, 79–87 53, 54, 57, 61, 70, 141
RNA polymerase (RNAP) .................................... 46, 202,
M 203, 207
Mitochondrial DNA (mtDNA) damage........................ 40
Mitochondrial DNA (mtDNA) separations .................. 26 S
Mobility ................................................................. 2–4, 23, Saccharomyces cerevisiae........................................... 43, 45,
76, 84, 145, 225 123–132, 157, 176
Shikonin....................................................... 90, 91, 93, 95
N
Single cell gel assay.......................................................... 73
Negative supercoiling ........................................ 15–20, 23 Single-strand breaks (SSBs) ......................................5, 135
Single stranded DNA (ssDNA) ............................ 1, 5, 26,
O 28, 29, 198
Size and shape ........................................................ 1, 3, 61
One-dimensional agarose gel
Slot blot ............................................................... 203, 205,
electrophoresis ............................................. 17, 26,
208, 210
28, 32, 33, 37
Sonication ............................................................ 178, 199,
Organisation for economic co-operation and
201, 204, 206, 207, 209
development (OECD) test guideline
Southern blotting.....................................................28–30,
(TG) 489 ............................................................. 73
45, 47, 48, 53–55, 57, 63, 70, 102, 107, 120, 136
Oxidative DNA damage ..................................6, 111, 156
T
P
Topoisomers ..............................................................15–23
Periodontal pathogens .................................................. 112
Transcription ..............................................................2, 10,
Polyacrylamide gel electrophoresis
15, 25–41, 183, 185, 196, 203
(PAGE) ..................................................3, 10, 193,
Transcription coupled repair (TCR) ............................ 203
213–225
Two-dimensional agarose gel
Positive supercoiling .......................................... 15–19, 23
32 electrophoresis ..................................18, 19, 61–71
P-postlabeling ................................................... 213–225
Psoralen DNA crosslinking .................................... 45, 47, U
49, 54, 56, 57
Pulsed-field gel electrophoresis Unhooking ................................................................81, 86
(PFGE).................................................89–97, 112,
123–132, 135–142, 145–162

DNA Electrophoresis

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

DNA Electrophoresis

Uploaded by

Copyright:

Available Formats

Methods in

Molecular Biology 2119

Katsuhiro Hanada Editor

For further volumes:

Methods and Protocols

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Yufu, Oita, Japan Katsuhiro Hanada

1 Introduction and Perspectives of DNA Electrophoresis . . . . . . . . . . . . . . . . . . . . . . 1

13 Detection of DNA Double-Strand Breaks by Pulsed-Field

LIANNE CASTLE • Department of Oncology, MRC Weatherall Institute of Molecular

HENRIK DEVITT MØLLER • Department of Biology, Faculty of Science, University of

Introduction and Perspectives of DNA Electrophoresis

Gel electrophoresis is one of the methods used to separate charged

The theoretical model of mobility during electrophoresis has been

Then mobility (μ) of the particle is

Frictional coefficient ( f ) is dependent on the size of the particle

The coefficient (k) of the particle is smallest when the particle is

Open circular DNA,

Coverntly colsed circular

Fig. 1 Schematic representation of gel electrophoresis of DNAs separated

separate larger DNAs. In the second dimension, a higher con-

The comet assay is a technique to quantify DNA breaks in individual

Intact DNA Broken DNA

B Step 1. Plug preparation

the neutral comet assay, samples are fractionated by electrophoresis

Here two distinct applications of the comet assay are described;

4 Analysis of DSBs by PFGE

Normal gel electrophoresis, including the comet assay, is not suit-

A Normal agarose gel electrophoresis

Fig. 3 Schematic representation of DNA fractionation during gel electrophoresis.

electrophoresis, orthogonal field-alternating gel electrophoresis,

DNA is determined by several parameters, such as the strength of

5. Temperature. Higher temperatures increase the migration rate

Trends in molecular biology are now shifting from understanding

policies as well as studies in toxicology. At present, DNA adducts in

I thank Dominic James, PhD, from Edanz Group (www.

Two-Dimensional Gel Electrophoresis to Resolve DNA

The superhelicity of DNA can have a profound effect on a number

Elizabeth G. Gibson and Alexandria A. Oviatt contributed equally to this work.

at the same rate. However, when subjected to electrophoresis

Fig. 2 One-dimensional resolution of relaxed and negatively supercoiled DNA

Time (s) Time (min)

Fig. 3 One-dimensional resolution of negatively and positively supercoiled DNA

relaxed DNA followed, by the introduction of negative supercoils.

Hence, negatively supercoiled molecules will tend to look less

Fig. 4 Schematic depicting the migration of DNA topoisomerases following

Nicked Rel Nicked Rel Nicked Rel

(-)SC (+)SC (-)SC (+)SC (-)SC (+)SC

Nicked Rel Nicked Rel Nicked Rel

(-)SC (+)SC (-)SC (+)SC (-)SC (+)SC

intermediate bands observed at 30 s are positively supercoiled, that

Prepare all reagents at room temperature using deionized water and

aliquots. For long-term storage (>1 month), store aliquots at

1. Preparation of agarose gel: mix 80 mL of Electrophoresis

Samples (20 μL of the DNA samples described above) (see

1. When mixed together, the Tris-borate-EDTA mixture should

the total sample volume. Doing so ensures that samples will

Work in the laboratory of the senior author (N.O.) was supported

Using Two-Dimensional Intact Mitochondrial DNA (mtDNA)

Mammalian mitochondrial DNA (mtDNA) is a small circular

autoimmunity [7, 8], musculoskeletal disorders [9], and aging

General instructions: All enzymes should be stored at 20 C,

2.1 Cultured Cells or 1. Stock solutions.

2.2 DNA Isolation 1. Stock solutions.

7. Proteinase K: 20 mg/mL solution in water, store at 20 C.

18. Vortex and incubate at 50 C for 1 h. Use cut yellow tips to