September 2014 Vol. 21 No.

3 84-96 ScienceDirect
Journal of Northeast Agricultural University (English Edition) Available online at www.sciencedirect.com

High-throughput Sequencing Technology and Its Application

Zhu Qiang-long, Liu Shi, Gao Peng, and Luan Fei-shi*

College of Horticulture, Northeast Agricultural University, Harbin 150030, China

Abstract: Gene sequencing is a great way to interpret life, and high-throughput sequencing technology is a revolutionary
technological innovation in gene sequencing researches. This technology is characterized by low cost and high-throughput data.
Currently, high-throughput sequencing technology has been widely applied in multi-level researches on genomics, transcriptomics and
epigenomics. And it has fundamentally changed the way we approach problems in basic and translational researches and created many
new possibilities. This paper presented a general description of high-throughput sequencing technology and a comprehensive review
of its application with plain, concisely and precisely. In order to help researchers finish their work faster and better, promote science
amateurs and understand it easier and better.
Key words: high-throughput sequencing, data analysis, genome sequence, transcriptome sequence, bioinformatics
CLC number: S6 Document code: A Article ID: 1006-8104(2014)-03-0084-13

become one of the most important methods of

Introduction
With the indepth study of life sciences and further
development of bio-technology, more and more
scientists recognize that the whole genome sequencing
of a species will be the fundamental basis and
important clue to help them reveal the nature of life
of the species. The discovery of DNA double helix
(Watson and Crick, 1953), cracking genetic code
(Nirenberg et al., 1966), and the successful completion
of the first one complete genome map (Sanger et al.,
1977) have undoubtedly become a series of important
journey milestones in the history of life scientific
development, and make more scientists profoundly
recognize that sequencing technology plays an
important role in life science researches. The rapid
sequencing technology would make DNA sequencing
molecular analysis (Sanger et al., 1992). This
technology provides important data for basic biology
study, such as disclosure of genetic information and
regulation of gene expressions. With the appearence
of Roche's 454 technology (2005), Illumina's Solexa
technology (2006) and ABI's SOLiD technology
(2007), high-throughput sequencing technology
has got enormous developments, thus amounts of
genetic information is successively revealed, which
allow us to explore the essence of life in detail, to
uncover the huge diversity of novel genes that are
currently inaccessible, to understand nucleic acid
therapeutics, to better integrate biological information
for a complete picture of health and disease at a
personalized level and to move to advance that we can
not yet imagine (Kahvejian et al., 2008). Therefore, a
number of bioinformatics methods and softwares have

Received 29 October 2013

Supported by the National Natural Science Foundations of China (31272186; 31301791)
Zhu Qiang-long (1989-), male, Master, engaged in the research of bioinformatics and watermelon molecular breeding. E-mail: longzhu2011@126.com
* Corresponding author. Luan Fei-shi, professor, supervisor of Ph. D students, engaged in the research of watermelon and melon molecular breeding.
E-mail: luanfeishi@sina.com

E-mail: xuebaoenglish@neau.edu.cn
Zhu Qiang-long et al. High-throughput Sequencing Technology and Its Application
been created to accelerate high-throughput sequencing
technology to be widely applied in aspects of geno-
mics researches on genomics, transcriptomics and
epigenetics. High-throughput sequencing technology
has fundamentally changed the way we approached
problems in basic and translational researches and
created many new possibilities. Whereas, it has also
brought new challenges for bioinformatics: how to
effectively process and analyze these massive data and
extract valuable bio-information form it, which have
become an important key to decide if high-throughput
sequencing technology plays a major role in the
scientific exploration. In this article, we intended to
present a comprehensive and systematic introduction
of high-throughput sequencing technology and its
applications to the enthusiast of biological science with
plain, concisely and precisely hope to help researchers
finish their work faster and better, to promote science
amateurs understand it easier and better. Meanwhile,
we tried to take data generated from Illumina Hiseq
2000 sequencing platform as an example to present a
more complete description of the basic procedure, key
methods and existing software of the sequencing data
generating process, data processing and analysis.
History of High-throughput Se-
quencing Technology Development
High-throughput sequencing technology is the second
generation sequencing technology launched by
Roche/454 Company, Illumina/Solexa Company and
ABI/SOLiD Company based on Sanger sequencing
and single-molecule sequencing technologies an-
TM
nounced by Helicos Heliscope and Pacific Bio-
sciences, which is also called as deep sequencing
technology (Sultan et al., 2008) or the next-generation
sequencing technology (NGS) (Schuster, 2008) .
The 1st generation sequencing technology
In 1977, Sanger of Cambridge and Gilbert of Harvard
almost simultaneously published their different
methods of DNA sequencing in the same magazine
·85·
(Maxam and Gilbert, 1977; Sanger et al., 1977), their
inventions first opened a door to study the genetic
code of life deeply for researchers, and brought
hope to the development of faster and more efficient
sequencing technology. Sanger method belongs to
dideoxy chain termination method, while Gilbert
method is chemical degradation method. The former
is more convenient and more suitable for optical
automatic detection gradually replaced the latter, and
became the most widely applied method of sequencing
in the field of life science. Thus, Sanger won the 1980
Nobel Prize in chemistry (Sanger, 1988). Most of the
automated DNA sequencers are based on this method.
Its principle is as below, when a nucleic acid template
is replicating under the presence of DNA polymerase,
a pair of primers, four types of single deoxynucleotide
triphosphate (dNTP, one of them labeled with a
radioactive 32P), join four kinds of dideoxynucleotide
triphosphate (ddNTP) into four reactive systems in
proportion, because dideoxynucleotide have no 3'-OH,
so long as the dideoxynucleotide append to the end of
the chain, its extension is stopped, if the single deo-
xynucleotide triphosphate append to the end of
the chain, it can continue to be extended. So that a
series of the nucleic acid fragments with the dideoxy
nucleotide at the 3' end in different length ranges
will be synthesized in each reaction system. After
termination of the reaction, different lengths of
nucleic acid fragments should be isolated by gel
electrophoresis in four lanes, where there is a differ-
ence of one nucleotide among near segments. After
autoradiography, the order of base in synthetic
fragment can be read, according to the dideoxy nucleo-
sides at the 3' end of the fragment (Xie et al., 2010).
Subsequently, a variety of DNA sequencing tech-
nologies based on this technology has been exploited,
the most important one of them is fluorescent
automated sequencing technology (Fig. 1) (http://
en.wikipedia.org/wiki/File:Sanger-sequencing.svg).
This generation sequencing technology has played a
key role in human genome project, accelerating the
completion of human genome project. The sequencer
http: //publish.neau.edu.cn
·86· Journal of Northeast Agricultural University (English Edition) Vol. 21　No. 3　2014

using this technology still be used in today, which will
continue to play an important role, because it has an
obvious advantage in the original data quality and read
length, and has been used widely in different fields,
especially in PCR products sequencing, plasmids and
bacterial artificial chromosomes terminal sequencing,
and Short Tandem Repeat (STR) genotyping (Zhou
et al., 2010). The dependence on electrophoretic
separation, however, makes it difficult to further
enhance the speed of analysis and to reduce sequencing
cost by mini-aturization. Therefore, developing new
technologies to break these limitations is needed.

① Reaction mixture
Primer and DNA template
DNA polymerase
ddNTPs with flourochromes dNTPs (dATP, dCTP, dGTP, and dTTP)

Primer
5' 3'

3' 5'
Template
ddNTPs
ddTTP
ddCTP ③ Capillary gel electrophoresis
ddATP
ddGTP separation of DNA fragments
② Primer elongation Capillary gel
and chain termination

5' 3' Laser Detector

5' 3'

5' 3'

5' 3'

5' 3'

5' 3'
④ Laser detection of flourochromes
5' 3' and computation sequence analysis
5' 3'

5' 3'
Chromatograph

Fig. 1 Sanger (chain-termination) method for DNA sequencing

A primer is annealed to a sequence; reagents are added to the primer and template, including DNA polymerase, dNTPs, and a small amount of all
the four dideoxynucleotides (ddNTPs) labeled with fluorophores. During primer elongation, the random insertion of a ddNTP instead of a dNTP
terminates synthesis of the chain because DNA polymerase cannot react with the missing hydroxyl. This produces all the possible lengths of chains;
the products are separated on a single lane capillary gel, where the resulting bands are read by a imaging system; this produces several hundred
thousand nucleotides a day, data which require storage and subsequent computational analysis.

of polymerase synthesis (2006) and ABI/SOLiD

The second generation sequencing tech-
nology
Compared with the Sanger sequencing method, the
second generation sequencing technology is also called
as next-generation sequencing technology. The second
generation sequencing technology are mainly classified
into three major sequencing techniques: Roche/454
pyrosequencing (2005), Illumina/Solexa sequencing
sequencing ligase (2007) technology. Compared with
Sanger sequencing, the common prominent feature in
three kinds of next-generation sequencing technologies
is that they could output massive data in a single
run, thus they are also known as high-throughput
sequencing technologies (Ansorge, 2009). And their
core idea is sequencing-by-synthesis. When generating
a new complementary strand of cDNA, they either

E-mail: xuebaoenglish@neau.edu.cn
Zhu Qiang-long et al. High-throughput Sequencing Technology and Its Application
added normal dNTP through enzymatic cascade
reaction to catalyze substrates to excite fluorescence
(Roche/454), or directly into the fluorescently labeled
dNTP (Illumina/Solexa) or semi-degenerate primers
(ABI/SOLiD), then when generating or connecting to
synthesize the complementary chain, the substrates
will release fluorescent signal. By capturing the
optical signal and converting to a sequencing peak, it
can be converted again to the sequence information of
complementary strand. High-throughput sequencing
technology achieved massively parallel sequencing
(MPSS), so the cost of getting a base data declined
lower than Sanger method, and it has been applied in
multi-level researches on medical science, agriculture
science and life science (Aksyonov et al., 2006).
The third generation sequencing technology
Although the second generation sequencing techno-
logy, compared with the first generation sequencing
technology, has greatly improved and been more
widely used in many aspects, but still built on the
basis of PCR amplification. In order to reduce devia-
tion and cost caused by PCR amplification, scientists
are now developing the third generation sequencing
that directly sequence a single molecule of DNA. The
most representative technologies included Heliscope
single-molecule sequencing, single molecule real-
time compositing sequencing, nanopore sequencing
technology. Helicos was a sequencing technology,
based on total internal reflection microscopy (TIRM)—
single-molecule sequencing technology. The tech-
nology completely gave up the signal amplifica-
tion process of sequencing platform based on PCR
amplification, but was still based on sequencing-
by-synthesis principle (Harris et al., 2008), which
used a new fluorescent analogs and sensitive moni-
toring system that would be directly capable of
recording fluorescent form a single nucleotide,
thereby overcoming the defect of other methods
that need to simultaneously test thousands of the
same genes to increase the signal intensity. Soon
after, PacificBiosciences developed another single
·87·
molecule sequencing technology-single molecule
real-time technology (SMRT) (Eid et al., 2009). The
sequencing technology take full advantages of DNA
polymerase, which can be vividly described as a
real-time observation on DNA polymerase through
the microscope. In a word, it records the entire
process of DNA synthesis. Nanopore sequencing
technique (Rusk, 2009) was to use the subtle changes
of electrostatic induction caused by different bases
passing the nanopore to identify the types of the base
signal. Meanwhile, it could detect some important
information, for example, whether a base was being
methylation or not.
Main Methods and Steps of High-
throughput Data Analyses
The data generated from Illumina Hiseq 2000 (Fig. 2)
(http://bitesizebio.com/13546/sequencing-by-syn-
thesis-explaining-the-illumina-sequencing-technology/)
sequencing platform was taken to present a more
complete description of the basic procedure, key
methods and existing software of the sequencing data
generating process, data processing and analysis.
Statistics and filtering of raw sequence data
Through the base calling, the original image data can
be transformed into sequence data, which is called raw
data or raw reads, which are usually storied in a file
with the format of fastq and is the most original file
that users would get, which stores not only the sequen-
ce of reads, but also quality of sequencing reads. Each
read in the fastq file is described by four lines:
 \@ WATERMALON: 1:8:6:490
 CCACTGTCATGTGAACATCACAGAGACATT
TCTTGA
 +
 bbbbbbbbbbbbbbbbbbbbbbbbbaaaaaaaaa_ \ \
 Lines 1 and 3 are sequence names generated by
the sequencing machines; line 2 is sequence; line 4
is quality letter, of which each letter corresponds to a
base in line 2; we calculate the sequencing quality of
http: //publish.neau.edu.cn
·88· Journal of Northeast Agricultural University (English Edition) Vol. 21　No. 3　2014

each base in line 2 by subtracting 64 from ASCII value
of the letter in line 4 (sequencing quality value). For
example, ASCII value of c is 99, so the corresponding
sequencing quality value is 35. Sequencing quality
values range from 2 to 35. After data is outputted,
there should be a statistics on reads obtained from the
sample sequencing, the length of reads per sample, the
number of nucleotides, GC content and so on, which
helps to assess whether the quality of data meets the
requirements to analyze. Then, the original data still
need some basic pre-processing according to the result.
For example, removing reads with adaptor, removing
to reads with N ratio greater than 5%, removing low
quality reads (the number of base with Q≤20 is 50%
or more of the total number of bases) to obtain clean
reads for the further analyses.

Genomic DNA

Shear

Select 200-300 bp fragments

Apply to flowcell
Attach adapters to
create sequencing library

Cluster generation by
solid phase PCR
(bridge amplification)

Sequencing by synthesis with reversible terminators

Fig. 2 Sequencing method of Illumina Hiseq 2000

First DNA sample is prepared into a sequencing library by fragmenting into pieces each around 200 bases long. Custom adapters are added to each
end and the library is flowed across a solid surface (the flow cell) and the template fragments bind to its surface. Following up, a solid phase bridge
amplification PCR process (cluster generation) creates approximately one milion copies of each template in tight physical clusters on the flowcell
surface. Finally data result from sequencing by synthesis with reversible terminators.

E-mail: xuebaoenglish@neau.edu.cn
Zhu Qiang-long et al. High-throughput Sequencing Technology and Its Application
Data assembly and mapping
It mainly contains re-sequencing with a reference
genome to locate reads and de novo genome sequenc-
ing assembly without reference. Re-sequencing read
paragraphs orientation: it refers to data assembly with
reference genome. When raw data generated, firstly,
all reads should be sorted by their length, then mapped
to the reference genome, and analyzed them through
comparing with reference genome to pick out all good-
match reads, which is important for all subsequent
processing and analysis. Re-assembly has been widely
applied in the model plant with reference genome
(Birol et al., 2009; Cheung et al., 2006), mostly
softwares used to assembly are: BWA (Li and Durbin,
2009), SOAP2 (Li et al., 2009), Bowtie (Langmead et
al., 2009), MAQ (Li et al., 2008), ZOOM (Lin et al.,
2008), TopHat and cufflinks (Trapnell et al., 2012) etc.
De novo sequencing assembly: first the sequencing
reads will be orderly assembled into contig, then the
contig will be assembled into the scaffold, and use N to
fill with the intermediate gap. Finally get the sequence
without N, which cannot be extended at both ends,
called unigene. And blastx alignment (evalue<0.00001)
between unigenes and protein databases like Non-
redundant (Nr), UniProt Knowledgebase (UniProtKB),
Kyoto Encyclopedia of Genes and Genomes (KEGG)
and Cluster of Orthologous Group (COG) is performed,
and the best aligning results are used to decide
sequence orientation of unigenes. If results of different
databases conflict with each other, a priority order of
Nr, UniProtKB, KEGG and COG should be followed.
When a unigene happens to be unaligned to none of
the above databases, a software named ESTScan (Iseli
et al., 1999) will be introduced to decide its sequence
direction. De novo assembly provides an efficient
way to quickly obtain expressive genes from the short
sequence and no reference sequence of assembly. Due
to longer reads of Roche/454 technology, so it was
more suitable for assembly, while it was considerable
difficult for Illumina and SOLID technology in the
splicing strategy how to splice the short length reads
·89·
into a long sequence because of the short read (Weber
et al., 2007). In recent years, researchers have designed
a variety of softwares to solve the problems to make
data from Illumina more suitable for assembly, and
achieved good effects of splicing. The technology
that contains three kinds of sequencing platforms has
been widely applied in a lot of non-model animals
and plants (Butler et al., 2008). Currently, the most
commonly used softwares are: Trinity (Grabherr et al.,
2011), SOAP denovo, Velvet ( http://www.ebi.ac.uk/-
zerbino/velvet/), etc.
Identification and functional annotation of
genes
Currently, the main principles of gene identifica-
tion and functional annotation are the followings:
(1) sequence searching. Its hypothesis: sequence
similarity=homology=similar function. (2) Sequence
motif. In case of no significant sequence homology, it's
used to find the local features of sequence. (3) COGs of
proteins. (4) Subcellular localization. It's to predict
function of gene by predicting subcellular localization.
(5) Structure comparison. First predict unknown
gene protein structure, then predict its functions
through structure comparison. (6) Proteomics. To
predict protein function by the networks of protein
interaction, or other biomolecules networks. Sequence
searching that based on the assumption "homologous
equal functionality similar" is widely used, most of
websites and softwares for annotating gene function
are primarily based on this principle at present. They
take full advantages of bioinformatics methods to
speculate the unknown genes' function, making
the unknown gene sequences (e.g. unigene) search
against public database, then obtain the highest similar
annotated sequences with the given-query sequences.
Main annotated nucleotide databases are: GenBank
(NCBI), EMBL, DDBJ, etc., protein databases are: Nr,
UNIPROTKB, TrEMBL, COG, etc. Main comparing
software: BLAST, FASTA, etc. There are mainly
two ways to annotate the currently gene function:
Gene Ontology (GO) classification and KEGG func-
http: //publish.neau.edu.cn
·90· Journal of Northeast Agricultural University (English Edition)
tional classification. GO is an international standardiz-
ed gene functional classification system which offers a
dynamic-updated controlled vocabulary and a strictly
defined concept to comprehensively describe pro-
perties of genes and their products in any organisms.
GO has three ontologies: molecular function, cellular
component and biological process, which is appli-
cable to define and describe gene function of any
species (Ashburner et al., 2000). KEGG is a database
that is able to anaylze gene product in metabolism
process and related gene function in the cellular
processes. With the help of KEGG database, we can
further study genes' biological complex behaviors
(Altermann and Klaenhammer, 2005). Softwares that
are mostly used including: Blast2go (Conesa et al.,
2005), WEGO (Ye et al., 2006), GoMiner (Zeeberg
et al., 2003), DAVIA (Dennis et al., 2003), VisANT
(Hu et al., 2009) etc.
Application of High-throughput Se-
quencing Technology
It could be argued that the greatest transformative
aspect of the Human Genome Project has not been
the sequencing of the genome itself, but the resultant
development of new technologies. Since 454 Company
developed the first full-automatic sequencer to open
the prelude to a new era of high-throughput DNA
sequencing in 2005, the technology had achieved a
leap-type development, and brought genomics level
research into a new era. Meanwhile, this technology
has already made molecular biologists increase their
basic knowledge of genomics into a higher level.
Kahvejian et al. (2008) mentioned that high-through-
put sequencing technology would allow us to move to
advances that we couldn't imagine yet.
DNA level application
Full genome sequencing
Full genome sequencing, also known as de novo
sequencing, directly sequence the whole genome of
species and then get its complete genome sequences
E-mail: xuebaoenglish@neau.edu.cn
Vol. 21　No. 3　2014
by bioinformatics methods to splice and assemble
sequence. The technology has a very important
significance for a comprehensive understanding of the
molecular evolution of a species, and its gene com-
ponent and regulation. The sequencing technology
had greatly promoted the whole-genome sequencing
work of non-model species, and helped scientists
free from the obstacles that the non-model organisms
had relatively poor genetic background and few base
researches on their genes in the past. Full genome
sequencing has been applied in multi-level researching
areas, especially in the biology. Biologists could
make the best of this technology to sequence the
genome of important species, which would help
them to know the information of gene sequence,
to elucidate the evolutionary of the species and to
better understand the molecular mechanisms of
life. Watermelon (Citrullus lanatus) is an important
cucurbit crop grown throughout the world, Guo
used high-throughput sequencing technology and
Sanger method to complete the watermelon genome
sequencing (Guo et al., 2013), and they reported a
high-quality draft genome sequence of the east Asia
watermelon cultivar 97103 (2n=2×=22) containing
23 440 predicted protein-coding genes. Comparative
genomics analysis provided an evolutionary scenario
for the origin of the 11 watermelon chromosomes
derived from a 7-chromosome paleohexaploid eudicot
ancestor. Resequencing of 20 watermelon accessions
representing three different C. lanatus subspecies
produced numerous haplotypes and identified the
extent of the genetic diversity and population structure
of watermelon germplasm. Genomic regions that were
preferentially selected during domestication were
identified. Many disease resistance genes were also
found to be lost during domestication. In addition,
integrative genomic and transcriptomic analyses
gave important insights into aspects of phloem-based
vascular signaling in common between watermelon
and cucumber and identified genes crucial to valuable
fruit-quality traits, including sugar accumulation
and citrulline metabolism. Meanwhile, genomic
Zhu Qiang-long et al. High-throughput Sequencing Technology and Its Application
information of more and more species have been
published, such as potato (Solanum tuberosum) (Xu
et al., 2011), Chinese cabbage (Brassica rapa) (Wang
et al., 2011), apple (Malus domestica Borkh) (Velasco
et al., 2010), and cucumber (Cucumissativus L.) (Huang
et al., 2009). In addition, by virtue of its sensitive
catch-capability for trace DNA, high-throughput
sequencing technology has also been widely used
in paleontology researches. Rasmusse et al. (2010)
extracted DNA from a bunch of hair of Eskimos
4 000 years ago, then sequenced its whole-genome,
gotten about 79% of its sequence and compared
with the modern human genome sequence, which
provided important information for exploring human
evolutionary history.
The whole genome re-sequencing
April 17, 2008, U.S. scientists in Nature published
the genome sequencing results of "DNA Father"
James D.Watson, which is the first whole genome re-
sequencing results through high-throughput sequencing
technology (Wheeler et al., 2008). The whole genome
re-sequencing is to sequence different individual
genomes of the same species under the condition
of knowing its reference genome, and then conduct
differential analysis among individuals or groups.
Currently, re-sequencing with reference genome is
applied widely in the field of the second generation
sequencing technology and is also rapidly becoming
one of effective methods of breeding and has great
scientific values in the whole genome for scanning
and detecting important traits of plants and animals
associated with mutation sites. By re-sequencing,
scientists in the field of agriculture can obtain a
lot of Single Nucleotide Polymorphisms (SNPs),
Insertions/Deletions (InDels), Structure Variations
(SVs), and group's polymorphism. Zheng et al. (2011)
carried out the whole genome re-sequencing for three
lines of sorghum bicolor with sequencing depth of 12
times, then they took American grain sorghum genome
sequence as a reference to conduct information
analysis. They uncovered 1 057 018 SNPs, 99 948
InDels of 1-10 bp in length, 16 487 Presence/Absence
·91·
Variations (PAVs) and 17 111 Copy Number Varia-
tions (CNVs). Meanwhile, they identified a cluster
of nearly 1 500 genes with structural differences in
sweet sorghum and sorghum grain. These genes were
involved in metabolisms of sugar and starch, synthesis
of lignin and coumarin, nucleic acid metabolism,
stress response, biological processes and DNA repair.
In addition, in the field of evolution, scientists can
apply population polymorphism analysis to explore
evolutionary model in different species; in the field of
microbiology, DNA sequencing genotyping has been
proven faster and more accurate; in the medical field,
the genome re-sequencing has important significance
in the discovery of relationship between SNPs and
major diseases.
RNA level application
Transcriptome sequencing
Transcriptome sequencing, also known as RNA-seq
or mRNA-seq, namely enrich single-stranded mRNA
from total RNA, then reverse transcription into double-
stranded cDNA, then which will be used to high-
throughput sequencing and subsequent correlation
analysis. Transcriptome is the foundation and starting
point for studying gene function and structure. With
reference genome squence, scientists can obtain much
more information, such as gene expression, alternative
splicing, optimizing-gene structure, and new genes
by comparing RNA-seq data with genomic DNA
sequences. For no reference genome species, de novo
sequencing would play an important role in trans-
criptome studies, and would be effectively used to
discover new genes and develop new molecular
markers. Guo et al. (2011) performed half Roche/454
GS-FLX to identify more than 5 000 Simple Sequence
Repeats (SSRs). Transcriptional regulation is the most
important regulation, and transcriptome sequencing
studies built on the basis of high-throughput sequenc-
ing have gradually substituted for gene chip technology
to be one of the current main approaches to study
gene expression on the level of the whole-genome.
By transcriptome sequencing, researchers could get
http: //publish.neau.edu.cn
·92· Journal of Northeast Agricultural University (English Edition)
abundance expression of transcript, transcriptional
loci, alternative splicing, SNP and other important
information. Zhang et al. (2010) took Oryza sativa
L. ssp. indica cv. 9311 as material to researching rice
transcriptome , they extracted total RNA from callus,
root at seedling stage of 14 days, shoot at seedling
stage of 14 days, flag leaves at tillering stage, flag
leaves at flowering stage, panicle at booting stage,
panicle at flowering stage, and panicle at filling stage,
then sequenced the total RNA from each sample and
showed transcriptome map of different organs of
cultivated rice. They detected 7 232 novel transcript
units, which have low abundance of expression and
tissue specificity, 23 800 alternative splicing occurred
in 33% of rice genome, 1 356 highly reliable chimeric
fusions, and 234 candidate chimeric transcripts,
suggesting that the transcriptional fusion was more
common than expected to occur, those data provided
a stable foundation for future functional studies upon
complex mechanisms of transcriptional regulation of
rice. Besides that, the technology has been applied in
potato (Shan et al., 2013), watermelon (Grassi et al.,
2013; Guo et al., 2011), pea (Liu et al., 2013), green
tea (Pan et al., 2014) and so on.
Digital gene expression profiling technology
Digital Gene Expression (DGE) is to construct non-
bias cDNA library of the cells or tissue in a particular
state, through large-scale cDNA sequencing, collection
of cDNA sequence fragments, and the qualitative and
quantitative analysis about its mRNA population,
scientists could obtain types of gene expression and
abundance information of the certain cell or tissue in
the state. Gene expression profiling in the past mainly
relied on conventional microarray technology, which
relied on known gene sequences to design probes
with fluorescence labeling and hybridization, then
calculated the amount of expression according to
fluorescence intensity, whereas its error was huge, and
it has no ability to detect unknown gene expression. In
contrast, DGE is more sensitive, accurate and suitable
for comparing gene expression studies, and gradually
takes the place of the gene chip technology in order to
E-mail: xuebaoenglish@neau.edu.cn
Vol. 21　No. 3　2014
avoid many of the inherent limitations of microarray
analyses. The combination of transcriptome sequencing
and DGE technologies can effectively explore new
functional genes for species with reference genome
or without. Luan et al. (2011) used DGE method to
analyze the gene expression variations between the
nonviruliferous and viruliferous whiteflie, then they
revealed the relationship of coevolved adaptations
between begomoviruses and whiteflies and would
provide a road map for future investigations into the
complex interactions between plant viruses and their
insect vectors. In addition, Gao et al. (2014) performed
DGE to investigate the gene expression profiles of
4008 and p50 silkworm strains to provide important
clues on the molecular mechanism of BmCPV
invasion and resistance mechanism of silkworms
against BmCPV infection. Yan et al. (2014) applied
comparative DGE and quantitative real time PCR to
figure out five transcripts encoding proteins putatively
associated with scent biosynthesis in roses and
provided a foundation for scent-related gene discovery
in roses.
MicroRNA sequencing
MicroRNA is a non-coding RNA, only about 20-30
nucleotides, while it plays a significant role in vivo.
Post-transcriptional gene regulation by microRNA is
a novel biological mechanism of gene regulation. In
recent years, the technology has been brought into a
wide focus in the scientific community. And the rise
of high-throughput sequencing has brought new ideas
to microRNA research. Although the high-through-
put sequencing has the bottleneck of short sequence
difficult to break, it is very suitable for sequencing
microRNA. Researchers could take its advantage
to predict new microRNA, research conserved
microRNA, establish microRNA expression profiling,
compare miRNA expression abundance as well as find
other non-coding RNA through sequencing. Wei et al.
(2009) used high-throughput sequencing to research
small RNAs of the locusts. By similarity searching
against microRBase database, they identified 50
conserved microRNA families, and identified 185
Zhu Qiang-long et al. High-throughput Sequencing Technology and Its Application
unique microRNAs families of locust through bioinfor-
matics analysis. And the analysis of microRNAs
expression between gregarious and solitary locust
revealed that microRNAs expression of the solitary
is richer than the gregarious, and drew expression
profiles of microRNAs of two different lifestyles.
The technology, currently, has been succeeded in
researching rice (Hu et al., 2014; Liu et al., 2014;
Mittal et al., 2013; You et al., 2014) and peach
(Zhenlin, 2013).
Epigenomics applications
Chromatin immunoprecipitation sequencing
Chromatin immunoprecipitation sequencing (ChIP-
Seq) technology is a powerful tool to study the
interactions between protein and DNA in vivo,
which combines the advantages of both Chromatin
immunoprecipitation (ChIP) and high-throughput
sequencing technology and have been successfully
applied in the genome-wide study, such as protein
binding sites, transcription factor binding sites and
specific histone modification sites studies. Thus,
scientists could get the information from segment of
DNA interacted with transcription factors or histone
in full genome-wide. Li et al. (2014) used ChIP-seq to
predict estrogen receptor (ER) biding sites in human
breast cancer cell line MCF7, their result showed that
E2 stimulated breast cancer cell growth through ER,
which might infer the function of ER in occurrence
and development of breast cancer. In recent years,
ChIP-Seq has also been applied mainly in studies on
rats (Corbo et al., 2010; Hull et al., 2013; Rintisch
et al., 2014; Triff et al., 2013) and human (Liu and
Cheung, 2014; Pinho et al., 2013; Xing et al., 2013;
Zheng et al., 2013).
DNA methylation sequencing
DNA methylation is another important way of gene
regulation, which can control gene expression by
altering chromatin structure, stability of DNA and
DNA-protein interactions. Currently, there are at
least three kinds of DNA methylation analysis techni-
que established on high-throughput sequencing:
·93·
methylated DNA immunoprecipitation sequencing
(MeDIP-Seq) (Down et al., 2008), methyl-binding
protein sequencing (MBD-Seq) and bisulfite se-
quencing (BS-Seq) (Cokus et al., 2008). High-
throughput sequencing technology also provides an
efficient solution to detect genome-wide methylation
sites. Taylor et al. (2007) applied 454 sequencing
technology to reveal an association between a single
nucleotide polymorphism and the methylation
present in LRP1B promoter. They finally concluded
that this new generation of methylome sequencing
would provide digital profiles of the aberrant DNA
methylation for individual human cancers and offer
a robust method for the epigenetic classification
of tumor subtypes. Currently, DNA methylation
sequencing technology has achieved fruitful research
results in DNA methylation studies on CpG (Li et
al., 2013; Nan et al., 1998; Shanmuganathan et al.,
2013), cancer (Calcagno et al., 2013), and provided
an important alternative to conventional approaches in
human brain studies (Houston et al., 2013).
Conclusions
High-throughput sequencing technology is still at its
early stage of development, but we could foresee that
it will be the golden time for the rapid development
of the third generation sequencing technology and
the coexistence of sequencing technologies of three
generations in the next few years. With the appearance
of new sequencing technologies, the cost of sequencing
would continue to decline rapidly. Development of
new drug for incurable diseases, molecular breeding
technology for fine breeds will become easier and
faster. Therefore, scientists in different fields will be
allowed to spend less and less money on sequencing
genome or transcriptome of species to achieve better
experimental design and obtain more new discoveries.
In addition, how to analyze the massive sequencing
data generated by high-throughput sequencing
technology and extract valuable bio-information from
will become a hot research in the future.
http: //publish.neau.edu.cn
·94· Journal of Northeast Agricultural University (English Edition) Vol. 21　No. 3　2014

Grabherr M G, Haas B J, Yassour M, et al. 2011. Full-length

References transcriptome assembly from RNA-seq data without a reference

Aksyonov S A, Bittner M, Bloom L B, et al. 2006. Multiplexed DNA genome. Nature Biotechnology, 29(7): 644-650.

sequencing-by-synthesis. Analytical Biochemistry, 348(1): 127-138. Grassi S, Piro G, Lee J M, et al. 2013. Comparative genomics reveals

Altermann E and Klaenhammer T R. 2005. Pathway voyager: pathway candidate carotenoid pathway regulators of ripening watermelon

mapping using the Kyoto Encyclopedia of Genes and Genomes fruit. BMC Genomics, 14(1): 781-793.

(KEGG) database. BMC Genomics, 6: 49-55. Guo S, Liu J, Zheng Y, et al. 2011. Characterization of transcriptome

Ansorge W J. 2009. Next-generation DNA sequencing techniques. New dynamics during watermelon fruit development: sequencing,

Biotechnology, 25(4): 195-203. assembly, annotation and gene expression profiles. BMC Genomics,

Ashburner M, Ball C A, Blake J A, et al. 2000. Gene ontology: tool for 12: 454.

the unification of biology. Nature genetics, 25(1): 25-29. Guo S, Zhang J, Sun H, et al. 2013. The draft genome of watermelon

Birol I, Jackman S D, Nielsen C B, et al. 2009. De novo transcriptome (Citrullus lanatus) and resequencing of 20 diverse accessions. Nat

assembly with ABySS. Bioinformatics, 25(21): 2872-2877. Genet, 45(1): 51-58.

Butler J, MacCallum I, Kleber M, et al. 2008. ALLPATHS: de novo Harris T D, Buzby P R, Babcock H, et al. 2008. Single-molecule DNA

assembly of whole-genome shotgun microreads. Genome Res, 18(5): sequencing of a viral genome. Science, 320(5872): 106-109.

810-820. Houston I, Peter C J, Mitchell A, et al. 2013. Epigenetics in the human

Calcagno D Q, Gigek C O, Chen E S, et al. 2013. DNA and brain. Neuropsychopharmacology, 38(1): 183-197.

histone methylation in gastric carcinogenesis. World Journal of Hu W, Wang T, Yue E, et al. 2014. Flexible microRNA arm selection

Gastroenterology, 19(8): 1182-1192. in rice. Biochemical and Biophysical Research Communications,

Cheung F, Haas B J, Goldberg S M D, et al. 2006. Sequencing 447(3): 526-530.

medicago truncatula expressed sequenced tags using 454 life sciences Hu Z, Hung J-H, Wang Y, et al. 2009. VisANT 3.5: multi-scale network

technology. BMC Genomics, 7: 272-283. visualization, analysis and inference based on the gene ontology.

Cokus S J, Feng S, Zhang X, et al. 2008. Shotgun bisulphite sequencing Nucleic Acids Research, 37: 115-121.

of the Arabidopsis genome reveals DNA methylation patterning. Huang S, Li R, Zhang Z, et al. 2009. The genome of the cucumber,

Nature, 452(7184): 215-219. Cucumis sativus L. Nat Genet, 41(12): 1275-1281.

Conesa A, Gotz S, Garcia-Gomez J M, et al. 2005. Blast2GO: a Hull R P, Srivastava P K, Souza Z, et al. 2013. Combined ChIP-seq and

universal tool for annotation, visualization and analysis in functional transcriptome analysis identifies AP-1/JunD as a primary regulator

genomics research. Bioinformatics, 21(18): 3674-3676. of oxidative stress and IL-1 beta synthesis in macrophages. BMC

Corbo J C, Lawrence K A, Karlstetter M, et al. 2010. ChIP-seq reveals Genomics, 14: 5-16.

the cis-regulatory architecture of mouse photoreceptors. Genome Iseli C, Jongeneel C V, Bucher P. 1999. ESTScan: a program for

Research, 20(11): 1512-1525. detecting, evaluating, and reconstructing potential coding regions in

Dennis G, Sherman B T, Hosack D A, et al. 2003. DAVID: database for EST sequences. Proceedings International Conference on Intelligent

annotation, visualization, and integrated discovery. Genome Biology, Systems for Molecular Biology; ISMB. International Conference on

4(9): 12-22. Intelligent Systems for Molecular Biology, 12: 138-148.

Down T A, Rakyan V K, Turner D J, et al. 2008. A bayesian Kahvejian A, Quackenbush J, Thompson J F. 2008. What would you

deconvolution strategy for immunoprecipitation-based DNA do if you could sequence everything. Nature Biotechnology, 26(10):

methylome analysis. Nature Biotechnology, 26(7): 779-785. 1125-1133.

Eid J, Fehr A, Gray J, et al. 2009. Real-time DNA sequencing from Langmead B, Trapnell C, Pop M, et al. 2009. Ultrafast and memory-

single polymerase molecules. Science, 323(5910): 133-138. efficient alignment of short DNA sequences to the human genome.

Gao K, Deng X, Qian H, et al. 2014. Cytoplasmic polyhedrosis virus- Genome Biol, 10(3): 25-29.

induced differential gene expression in two silkworm strains of Li H, Durbin R. 2009. Fast and accurate short read alignment with

different susceptibilities. Gene, 539(2): 230-237. burrows-wheeler transform. Bioinformatics, 25(14): 1754-1760.

E-mail: xuebaoenglish@neau.edu.cn
Zhu Qiang-long et al. High-throughput Sequencing Technology and Its Application ·95·
Li H, Ruan J and Durbin R. 2008. Mapping short DNA sequencing on to inhibit lung tumorigenesis. Molecular Carcinogenesis, 53(1):

reads and calling variants using mapping quality scores. Genome 19-29.

Research, 18(11): 1851-1858. Pinho F G, Frampton A E, Nunes J, et al. 2013. Downregulation of

Li Q, Wang H, Yu L, et al. 2014. ChIP-seq predicted estrogen receptor microRNA-515-5p by the estrogen receptor modulates sphingosine

biding sites in human breast cancer cell line MCF7. Tumor Biology, kinase 1 and breast cancer cell proliferation. Cancer Research,

35(5): 4779-4784. 73(19): 5936-5948.

Li R, Yu C, Li Y, et al. 2009. SOAP2: an improved ultrafast tool for Rasmussen M, Li Y, Lindgreen S, et al. 2010. Ancient human genome

short read alignment. Bioinformatics, 25(15): 1966-1967. sequence of an extinct Palaeo-Eskimo. Nature, 463(7282): 757-762.

Li Z-G, Jiao Y, Li W-J, et al. 2013. Hypermethylation of two CpG Rintisch C, Heinig M, Bauerfeind A, et al. 2014. Natural variation of

sites upstream of CASP8AP2 promoter influences gene expression histone modification and its impact on gene expression in the rat

and treatment outcome in childhood acute lymphoblastic leukemia. genome. Genome Research, 24(6): 942-953.

Leukemia Research, 37(10): 1287-1293. Rusk N. 2009. Cheap third-generation sequencing. Nature Methods,

Lin H, Zhang Z, Zhang M Q, et al. 2008. ZOOM! Zillions of oligos 6(4): 244-245.

mapped. Bioinformatics, 24(21): 2431-2437. Sanger F. 1988. Sequences, sequences, and sequences. Science,

Liu H, Guo S, Xu Y, et al. 2014. OsmiR396d regulated OsGRFs 280(5369): 1515-1515.

function in floral organogenesis in rice through binding to their Sanger F, Nicklen S and Coulson A R. 1977. DNA sequencing with

targets OsJMJ706 and OsCR4. Plant Physiology, 165(1): 160-174. chain-terminating inhibitors. Proceedings of the National Academy of

Liu M H, Cheung E. 2014. Estrogen receptor-mediated long-range Sciences of the United States of America, 74(12): 5463-5467.

chromatin interactions and transcription in breast cancer. Molecular Schuster S C. 2008. Next-generation sequencing transforms today's

and Cellular Endocrinology, 382(1): 624-632. biology. Nature Methods, 5(1): 16-18.

Liu Z, Ma L, Nan Z, et al. 2013. Comparative transcriptional profiling Shan J, Song W, Zhou J, et al. 2013. Transcriptome analysis reveals

provides insights into the evolution and development of the novel genes potentially involved in photoperiodic tuberization in

zygomorphic flower of Vicia sativa (Papilionoideae). PLoS One, potato. Genomics, 102(4): 388-396.

8(2): 573-588. Shanmuganathan R, Basheer N B, Amirthalingam L, et al. 2013.

Luan J-B, Li J-M, Varela N, et al. 2011. Global analysis of the Conventional and nanotechniques for DNA methylation profiling.

transcriptional response of whitefly to tomato yellow leaf curl china Journal of Molecular Diagnostics, 15(1): 17-26.

virus reveals the relationship of coevolved adaptations. Journal of Sultan M, Schulz M H, Richard H, et al. 2008. A global view of gene

Virology, 85(7): 3330-3340. activity and alternative splicing by deep sequencing of the human

Maxam A M and Gilbert W. 1977. A new method for sequencing DNA. transcriptome. Science, 321(5891): 956-960.

Proceedings of the National Academy of Sciences of the United States Taylor K H, Kramer R S, Davis J W, et al. 2007. Ultradeep bisulfite

of America, 74(2): 560-564. sequencing analysis of DNA methylation patterns in multiple gene

Mittal D, Mukherjee S K, Vasudevan M, et al. 2013. Identification of promoters by 454 sequencing. Cancer Res, 67(18): 8511-8518.

tissue-preferential expression patterns of rice miRNAs. Journal of Trapnell C, Roberts A, Goff L, et al. 2012. Differential gene and

Cellular Biochemistry, 114(9): 2071-2081. transcript expression analysis of RNA-seq experiments with TopHat

Nan X, Ng H H, Johnson C A, et al. 1998. Transcriptional repression and Cufflinks. Nature Protocols, 7(3): 562-578.

by the methyl-CpG-binding protein MeCP2 involves a histone Triff K, Konganti K, Gaddis S, et al. 2013. Genome-wide analysis of the

deacetylase complex. Nature, 393(6683): 386-389. rat colon reveals proximal-distal differences in histone modifications

Nirenberg M, Caskey T, Marshall R, et al. 1966. The RNA code and and proto-oncogene expression. Physiological Genomics, 45(24):

protein synthesis. Cold Spring Harbor Symposia on Quantitative 1229-1243.

Biology, 31: 11-24. Velasco R, Zharkikh A, Affourtit J, et al. 2010. The genome of the

Pan J, Zhang Q, Xiong D, et al. 2014. Transcriptomic analysis by RNA- domesticated apple (Malus x domestica Borkh). Nature Genetics,

seq reveals AP-1 pathway as key regulator that green tea may rely 42(10): 833-840.

http: //publish.neau.edu.cn
·96· Journal of Northeast Agricultural University (English Edition) Vol. 21　No. 3　2014

Wang X, Wang H, Wang J, et al. 2011. The genome of the annotations. Nucleic Acids Research, 34: 293-297.

mesopolyploid crop species Brassica rapa. Nature Genetics, 43(10): You J, Zong W, Du H, et al. 2014. A special member of the rice

1035-1157. SRO family, OsSRO1c, mediates responses to multiple abiotic

Watson J D and Crick F H. 1953. Molecular structure of nucleic acids; a stresses through interaction with various transcription factors. Plant

structure for deoxyribose nucleic acid. Nature, 171(4356): 737-738. Molecular Biology, 84(6): 693-705.

Weber A P M, Weber K L, Carr K, et al. 2007. Sampling the Zeeberg B R, Feng W, Wang G, et al. 2003. GoMiner: a resource

arabidopsis transcriptome with massively parallel pyrosequencing. forbiological interpretation of genomic and proteomic data. Genome

Plant Physiology, 144(1): 32-42. Biol, 4(2): 28-32.

Wei Y, Chen S, Yang P, et al. 2009. Characterization and comparative Zhang G, Guo G, Hu X, et al. 2010. Deep RNA sequencing at single

profiling of the small RNA transcriptomes in two phases of locust. base-pair resolution reveals high complexity of the rice transcriptome.

Genome Biology, 10(1): 45-60. Geome Res, 20(5): 646-654.

Wheeler D A, Srinivasan M, Egholm M, et al. 2008. The complete Zheng L Y, Guo X S, He B, et al. 2011. Gemome-wide patterns of

genome of an individual by massively parallel DNA sequencing. genetic variation in sweet and grain sorghum (Sorghum bicolor).

Nature, 452(7189): 872-885. Geome Biol, 12(11): 114-120.

Xing Y, Yang Y, Zhou F, et al. 2013. Characterization of genome-wide Zheng Y, Zha Y, Spaapen R M, et al. 2013. Egr2-dependent gene

binding of NF-kappa B in TNF alpha-stimulated HeLa cells. Gene, expression profiling and ChIP-Seq reveal novel biologic targets in T

526(2): 142-149. cell anergy. Molecular Immunology, 56(4): 530-536.

Xu X, Pan S, Cheng S, et al. 2011. Genome sequence and analysis of Zhenlin W. 2013. Identification and characterization of microRNAs

the tuber crop potato. Nature, 475(7355): 189-194. and their targets in peach (Prunus persica). International Journal of

Yan H, Zhang H, Chen M, et al. 2014. Transcriptome and gene Agriculture and Biology, 15(5): 1017-1020.

expression analysis during flower blooming in Rosa chinensis Zhou X G, Ren L F, Li Y T, et al. 2010. The next-generation sequencing

'Pallida'. Gene, 540(1): 96-103. technology: a technology review and future perspective. Sci China

Ye J, Fang L, Zheng H, et al. 2006. WEGO: a web tool for plotting GO Life Sci, 53(1): 13-25.

E-mail: xuebaoenglish@neau.edu.cn