Infection, Genetics and Evolution 96 (2021) 105137

Contents lists available at ScienceDirect

Infection, Genetics and Evolution

journal homepage: www.elsevier.com/locate/meegid

Expressions of interferon-stimulated genes in peripheral blood

mononuclear cells from patients with secondary syphilis
Yulei Zhao *, Danmin Liu
Department of Dermatology, the Third Affiliated Hospital of Soochow University, 185 Juqian Street, Changzhou 213003, Jiangsu, China

A R T I C L E I N F O A B S T R A C T

Keywords: Background: Syphilis is a sexually transmitted disease that threatens human health worldwide. However, the
Secondary syphilis (SS) immune regulation cascade caused by treponemia pallidum (TP) infection remains still largely unclear.
Interferon-stimulated genes (ISGs) Methods: To investigate the expression of ISGs in secondary syphilis (SS), we recruited 64 patients with SS and
Peripheral blood mononuclear cells (PBMCs)
equal number of healthy participants to obtain their peripheral blood mononuclear cells (PBMCs). qRT-PCR was
performed to estimate the expression of interferon-stimulated genes (ISGs) including CXCL10, OAS3, OAS1,
MX1, IFIT3, IFIT2, IFI6 and AIM2. Receiver-operating characteristic (ROC) analysis was adapted to diagnostic
value of these genes to distinguish healthy controls and patients with SS.
Results: ISGs including CXCL10, OAS3, OAS1, MX1, IFIT3, IFIT2, IFI6 and AIM2 were all upregulated in PBMCs of
patients with SS. Area under the ROC curve (AUC) of the 8 ISGs were all more than 0.5. IFIT3 exhibited the
highest diagnostic value, followed by AIM2, IFIT2 and CXCL10, according to the Yoden Index.
Conclusion: ISGs including CXCL10, OAS3, OAS1, MX1, IFIT3, IFIT2, IFI6 and AIM2 were upregulated in patients
with SS and they have diagnostic value for syphilis.

1. Introduction immunomodulatory functions (Sen and Sarkar, 2007). In the process of

Syphilis is a sexually transmitted disease with multiple organ dam­
age caused by treponemia pallidum (TP) infection (Mattei et al., 2012).
According to statistics from the World Health Organization, there are
nearly 20 million new syphilis infections worldwide each year
(Schlueter et al., 2021). The syphilis pathogen invades through the
mucous membrane or damaged skin and forms a focal infection (For­
restel et al., 2020). After the incubation period, TP invades a variety of
tissues, including skin, bone, central nervous system and cardiovascular
system (Edmondson et al., 2018). Syphilis can be passed from an
infected pregnant woman to the fetus, threatening the health of the
newborn (Lin et al., 2018). Systemic syphilis also increases the chance of
infection by other pathogens, such as human immunodeficiency virus
(Sarigul et al., 2019).
Non-specific immunity is the most direct and effective immune
pathway for the body to fight infection, and it also plays an important
role in blocking virus infection and reducing tissue damage (Kumar and
Bot, 2018). Interferon-stimulated genes (ISGs) are an important part of
non-specific immunity (Green et al., 2018). There are about 300 kinds of
ISGs currently known, and they have a very wide range of
TP infection, type I interferon transmits signals through Interferon
Alpha/Beta Receptor (IFNAR) to regulate the expression of ISGs (Peters
et al., 2020). ISGs can be divided into 3 types according to their func­
tions. The first category is ISGs with direct antiviral function, and their
expression products block the necessary links in the process of viral
infection and replication (Schneider et al., 2014). The second type of
ISGs is involved in enhancing the host’s recognition and response to
viruses, and their expression promotes the activation of intracellular
interferon signaling pathways (Wang et al., 2017). The third type of ISGs
encode negative regulators of the interferon signaling pathway and are
responsible for suppressing the excessive activation of the immune
system (Ma et al., 2018).
In our previous work, we found that 16 ISGs were highly expressed in
secondary syphilis (SS) compared with early latent syphilis (Zhao et al.,
2016). In order to further study the expression of the 16 ISGs in sec­
ondary syphilis, we conducted qRT-PCR assay to examine the expression
of the 16 genes and identified 8 ISGs that were statistically upregulated.
We hope that our research can provide a new perspective on the immune
regulation mechanism in the development of syphilis.

* Corresponding author.
E-mail address: drzhaoyulei123@163.com (Y. Zhao).

https://doi.org/10.1016/j.meegid.2021.105137
Received 6 June 2021; Received in revised form 26 October 2021; Accepted 9 November 2021
Available online 13 November 2021
1567-1348/© 2021 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
Y. Zhao and D. Liu Infection, Genetics and Evolution 96 (2021) 105137

Table 1 volume of phosphate-buffered saline (PBS, 0.01 mol/L, pH 7.4) was used
Oligonucleotide primer sequences for qRT-PCR. to dilute the blood. The diluted cell suspension was slowly and obliquely
Gene Primer direction Sequence (5′ -3′ ) spread on the surface of 5 mL lymphocyte separation liquid, and
centrifuged at 20 ◦ C, 2000 r/min for 20 min. PBMCs were separated and
CXCL10 Forward GTGGCATTCAAGGAGTACCTC
Reverse TGATGGCCTTCGATTCTGGATT collected at the upper and middle interface. PBS was used to wash the
OAS3 Forward GAAGGAGTTCGTAGAGAAGGCG PBMCs. Cells were centrifuged at 1500 r/min for 10 min at 4 ◦ C and
Reverse CCCTTGACAGTTTTCAGCACC resuspended in PBS.
OAS1 Forward TGTCCAAGGTGGTAAAGGGTG
Reverse CCGGCGATTTAACTGATCCTG
MX1 Forward GTTTCCGAAGTGGACATCGCA
2.3. Quantitative real-time PCR
Reverse CTGCACAGGTTGTTCTCAGC
IFIT3 Forward TCAGAAGTCTAGTCACTTGGGG Appropriate amount of PBMCs were resuspended in one milliliter
Reverse ACACCTTCGCCCTTTCATTTC Trizol regent with an electric homogenizer. 200 μL of chloroform were
IFIT2 Forward AAGCACCTCAAAGGGCAAAAC
added to the mixture and it was gently mixed to homogeneity. The
Reverse TCGGCCCATGTGATAGTAGAC
IFI6 Forward GGTCTGCGATCCTGAATGGG mixture was left for 15 min to separate the liquid. The mixture was then
Reverse TCACTATCGAGATACTTGTGGGT placed in a centrifuge at 4 ◦ C and centrifuged at 12000 rpm for 15 min.
AIM2 Forward TGGCAAAACGTCTTCAGGAGG Isopropanol was used to extract RNA from the upper liquid. Universal
Reverse AGCTTGACTTAGTGGCTTTGG RT-PCR Kit (M-MLV, free Taq polymerase) (Solarbio, life sciences, CA,
GAPDH Forward GGAGCGAGATCCCTCCAAAAT
Reverse GGCTGTTGTCATACTTCTCATGG
USA) was used to reverse transcription of RNA into cDNA. TaqMan One
Step RT-qPCR Kit (SYBR green signal, Solarbio, life sciences, CA, USA)
was used for qRT-PCR assay. GAPDH was used as a negative control. The
primers used in this research was shown in Table 1.
Table 2
Demographics and clinical characteristics of the secondary syphilis (SS) and
2.4. Statistical analysis
healthy controls (HC).
Items Study group p
Box plot showing all the data were utilized to demonstrated the
SS (n = 64) HC (n = 64) continuous variables. Mann–Whitney test, receiver-operating charac­
Gender teristic (ROC) analysis and Pearson’s correlation analysis were acquired
Male 40 (62.5%) 35 (54.7%) 0.4731 respectively for the statistical analysis in this research. p < 0.05 was
Female 24 (37.5%) 29 (45.3%) considered as significant difference. GraphPad Prism software was
Age (years) 31.23 ± 10.24 33.51 ± 9.65 0.1536
applied for the final analysis of data in this study.
RPR titer
1:2 6 (9.4%) – –
1:4 13 (20.3%) – 3. Results
1:8 24 (37.5%) –
1:16 10 (15.6%) – 3.1. Demographics characteristics of the patients with SS and healthy
1:32 8 (12.5%) –
1:64 3 (4.7%) –
controls
TPPA
Positive 64 (100%) – – The demographics characteristics of the patients with SS and healthy
Negative 0 (0%) – controls were shown in Table 2. There was no statistical difference be­
Values were expressed as mean ± SD or n (percentage). p values for each group tween gender and age among the two groups (p > 0.05). And the rapid
were derived from Mann–Whitney test or Chi-square test. plasma regains (RPR) titter of patients with SS was ranged from 1:2 to
RPR: rapid plasma reagin; TPPA: Treponema pallidum particle agglutination. 1:64.

2. Methods
2.1. Study design and participants
To demonstrate the expression of ISGs in the progression of SS, we
recruited 64 patients with SS and equal number of healthy participants
to obtain their peripheral blood mononuclear cells (PBMCs). This study
was approved by the ethics committee of The Third Affiliated Hospital of
Soochow University. Written consent was derived from each participant.
The inclusion criteria of our research included: (1) Diagnosed with
stage 2 syphilis; (2) Have not received syphilis treatment; (3) The course
of the disease within 2 years; (4) HIV negative. The exclusion criteria of
our research included: (1) With systemic or immune diseases including
diabetes, kidney disease, asthma, psoriasis, dermatomyositis, etc.; (2)
HIV positive; (3) With malignant tumors or blood system diseases; (4)
With chronic infectious diseases such as tuberculosis, Helicobacter pylori
infection, and leprosy; (5) Patients who have used immunomodulators,
immunosuppressants and antibiotics within one month; (6) Drug/
alcohol abusers; (7) Pregnant or lactating women.
2.2. PBMC isolation
5 mL of the patient’s peripheral venous blood was collected. An equal
3.2. Expression levels of eight ISGs in patients with SS and healthy
controls
In our previous work, we have identified that 16 ISGs were highly
expressed in secondary syphilis (SS) compared with early latent syphilis,
including SERPING1, SIGLEC1, IFIT3, IFI44, GBP1, IFIT2, FCGR3B,
RSAD2, IFI44L, IFI6, PLSCR1, CXCL10, OAS3, OAS1, AIM2 and MX1. To
further investigate the expression levels of 16 ISGs in patients with SS,
we evaluated their RNA levels in PBMCs. As shown in Fig. 1A–H and
Fig. S1, CXCL10, OAS3, OAS1, MX1, IFIT3, IFIT2, IFI6 and AIM2 were
upregulated in PBMCs of patients with SS (p < 0.05), while SERPING1,
SIGLEC1, IFI44, GBP1, FCGR3B, RSAD2, IFI44L and PLSCR1 remained
unchanged.
3.3. Receiver-operating characteristic (ROC) analysis of the eight genes in
patients with SS
To analyze the sensitivity and specificity of CXCL10 (Fig. 2A), OAS3
(Fig. 2B), OAS1 (Fig. 2C), MX1 (Fig. 2D), IFIT3 (Fig. 2E), IFIT2 (Fig. 2F),
IFI6 (Fig. 2G) and AIM2 (Fig. 2H) to distinguish the patients with SS
from healthy people, ROC analysis was performed. ROC curve demon­
strated that these genes were all predictive factors for SS infection in
patients.
Area under the ROC curve (AUC), significance, sensitivity,

2
Y. Zhao and D. Liu Infection, Genetics and Evolution 96 (2021) 105137

Fig. 1. Expressions of CXCL10 (A), OAS3 (B), OAS1 (C), MX1 (D), IFIT3 (E), IFIT2 (F), IFI6 (G) and AIM2 (H) in peripheral blood mononuclear cells from patients
with secondary syphilis compared to healthy control. N = 64 in each group. Mann–Whitney test.

specificity, and Youden index of these genes were shown in Table 3. The the eight ISGs were all positive predictive factors for the increase of RPR
AUC of all the eight ISGs was more than 0.5. IFIT3 has the highest titer in patients.
diagnostic value, followed by AIM2, IFIT2 and CXCL10, according to the
Yoden Index. 4. Discussion

3.4. The correlation between RPR titer and ISGs expression
To further investigate the correlation between RPR titer and ISGs
expression, we performed ROC analysis of the expression of CXCL10
(Fig. 3A), OAS3 (Fig. 3B), OAS1 (Fig. 3C), MX1 (Fig. 3D), IFIT3 (Fig. 3E),
IFIT2 (Fig. 3F), IFI6 (Fig. 3G) and AIM2 (Fig. 3H) and the RPR titer,
respectively. All the ROC analysis of the eight genes demonstrated that
Syphilis is a chronic systemic, sexually transmitted disease caused by
TP infection (Nesterenko et al., 2006). The clinical manifestations,
infectivity, and destructive power of syphilis are different in different
periods. At present, the commonly used testing methods in the labora­
tory include direct microscopy, serological tests, and polymerase chain
reaction tests, etc., which can partially meet the syphilis detection in
different periods (Luu et al., 2015). In this study, we analyzed the

3
Y. Zhao and D. Liu Infection, Genetics and Evolution 96 (2021) 105137

Fig. 2. ROC analysis of CXCL10 (A), OAS3 (B), OAS1 (C), MX1 (D), IFIT3 (E), IFIT2 (F), IFI6 (G) and AIM2 (H) in peripheral blood mononuclear cells from patients
with secondary syphilis compared to healthy control.

Table 3
Diagnostic power of interferon- stimulated genes for secondary syphilis from healthy controls.
Gene AUC 95% CI of AUC p value Sensitivity (%) Specificity (%) Youden index

CXCL10 0.7405 0.6556–0.8254 <0.0001 70.31 67.19 0.375

OAS3 0.6758 0.5837–0.7678 0.0006 68.75 54.69 0.234
OAS1 0.6449 0.5496–0.7402 0.0047 59.38 62.50 0.219
MX1 0.6338 0.5380–0.7296 0.0090 78.13 46.88 0.250
IFIT3 0.7745 0.6904–0.8587 <0.0001 65.63 84.38 0.500
IFIT2 0.6943 0.6021–0.7866 0.0001 57.81 79.69 0.375
IFI6 0.6565 0.5613–0.7516 0.0023 51.56 75.00 0.266
AIM2 0.7163 0.6262–0.8064 <0.0001 84.38 57.81 0.422

ROC: receiver-operating characteristic; AUC: Area under the ROC curve; CI: confidence interval. The highest Youden index was used to identify the specificity and
sensitivity.
4
Y. Zhao and D. Liu Infection, Genetics and Evolution 96 (2021) 105137

Fig. 3. Pearson’s correlation analysis was carried out to measure the correlations between RPR titer and the mRNA expressions of CXCL10 (A), OAS3 (B), OAS1 (C),
MX1 (D), IFIT3 (E), IFIT2 (F), IFI6 (G) and AIM2 (H) in peripheral blood mononuclear cells from patients with secondary syphilis. N = 64.

expression of eight ISGs in PBMCs in the serum of patients with stage II
syphilis. We demonstrated that eight ISGs, including CXCL10, OAS3,
OAS1, MX1, IFIT3, IFIT2, IFI6 and AIM2, were significantly increased in
PBMCs of SS patients. We used ROC analysis to illustrate the sensitivity
and correlation between CXCL10, OAS3, OAS1, MX1, IFIT3, IFIT2, IFI6
and AIM2 and secondary syphilis. The AUC areas of the ROC curves of
these eight genes were greater than 0.5, which indicated that the high
expression of the eight genes CXCL10, OAS3, OAS1, MX1, IFIT3, IFIT2,
IFI6 and AIM2 can be used as a diagnostic criterion for secondary
syphilis. The upregulation of these eight ISGs were all positively corre­
lated with the increase of RPR titer in patients with SS.
Innate immunity is the body’s first barrier against the invasion of
pathogenic microorganisms (Thaiss et al., 2016). The sensor in the
cytoplasm recognizes the corresponding components of the pathogenic

5
Y. Zhao and D. Liu
microorganisms that enter the cell, activates the relevant signal trans­
duction pathways, and causes the expression of related genes, such as
type I interferon (IFN). Type I interferon transmits signals through the
transmembrane receptor IFNAR, and induces interferon-induced gene
expression. IFNAR is a transmembrane receptor formed by the combi­
nation of IFNAR1 and IFNAR2 heterodimers (Rosenfeld et al., 2002).
After binding to IFN-α and IFN-β, it induces the activation of the intra­
cellular receptor-associated protein tyrosine kinase Janus kinase 1
(JAK1) and Tyrosine kinase 2 (TYK2), phosphorylated JAK1 and TYK2
further phosphorylate receptor intracellular tyrosine residues (Zhang
et al., 2008). The phosphorylated receptor protein recruits and activates
the transcription factors STAT1 (signal transducer and activator of
transcription) and STAT2. Phosphorylated STAT1 and STAT2 dimerize
to recruit IRF9 to form a heterotrimeric complex with IFN-stimulated
gene factor 3 (ISGF3) that promotes the transcription of target genes,
and then ISGF3 transfers into the nucleus and binds to the promoter of
the subregion has the gene locus of the interferon-induced response
element (ISRE), thereby initiating the transcription of ISGs (Majoros
et al., 2017).
In this study, we found 8 genes specifically and highly expressed in
PBMCs in patients with secondary syphilis. CXCL10, OAS3, OAS1, MX1,
IFIT3, IFIT2, IFI6 and AIM2 are all ISGs. We found that the AUC of IFIT3
was as high as 0.7745, and the Youden score was as high as 0.500
through ROC analysis. In addition, AIM2, IFIT2, and CXCL10 also have
higher diagnostic value for secondary syphilis.
Interferon-induced protein with tetratricopeptide (IFITs) are inter­
feron stimulating factors produced by the body’s immune cells, which
play a role in inhibiting virus replication and proliferation and resisting
virus infection (Ishida et al., 2019). IFIT includes IFIT1, IFIT2, IFIT3 and
IFIT5. IFITs can directly bind to viral RNA and inhibit the reverse
transcription of viral RNA. IFIT1 has a large hydrophilic cavity behind
the positive charge tunnel, which can accommodate the RNA cap
structure. It has been reported that IFIT3 can combine with IFIT1 to form
a dimer through the YxxxL motif, so that IFIT1 can be stably expressed
(Zhao et al., 2017). The combination of IFIT3 may also promote the
closed conformation of IFIT1 and stabilize the interaction of IFIT1 and
viral RNA. Absent in melanoma 2 (AIM2) is a cytoplasmic protein that
can interact with adaptor protein through the pyrin domain (Choubey,
2019). Once the cytoplasmic dsDNA is sensed, AIM2 will recruit ASC to
produce an inflammatory complex, which in turn activates caspase-1 to
promote the maturation and secretion of inflammatory cytokines, such
as IL-18 (Wang et al., 2019). 2′ -5 ‘oligoadenylate synthetase (OAS) is a
kind of important antiviral proteins which is induced by interferon
(Schwartz and Conn, 2019). OAS1 and OAS3 exert their antiviral effects
mainly through RNase L-dependent pathways. Previous research has
demonstrated that OAS, once activated by dsRNA, can catalyze the
production of 2-5A, which activates the endonuclease RNase L, degrades
viral RNA, blocks viral protein synthesis, and exerts an antiviral effect
(Dejucq et al., 1997). In general, the eight ISGs we detected in this study
played an important role in the body’s antiviral response. We believe
that their high expression is related to the onset of secondary syphilis.
However, what we cannot explain is whether they are also highly
expressed in the PBMCs of patients with latent syphilis, primary syphilis,
and tertiary syphilis. Although ROC analysis has shown that CXCL10,
OAS3, OAS1, MX1, IFIT3, IFIT2, IFI6 and AIM2 were predictive factors
for the diagnosis of secondary syphilis, the function of their combination
to predict the stage of syphilis is still unclear. Moreover, the ISGs
measured in this study were from either the first category (direct anti­
viral function) or the second category (enhancing host responses). The
expression of ISGs suppressing the interferon signaling pathways is still
unclear. We will continue to pay attention to these issues in our future
research.
In conclusion, we have reported that eight ISGs including CXCL10,
OAS3, OAS1, MX1, IFIT3, IFIT2, IFI6 and AIM2 were all upregulated in
PBMCs of patients with SS. AUC of the 8 ISGs were all more than 0.5 in
ROC analysis, suggesting that they are all predictive factors for
6
Infection, Genetics and Evolution 96 (2021) 105137
secondary syphilis and the upregulation of RPR titer in patients. IFIT3
exhibited the highest diagnostic value, followed by AIM2, IFIT2 and
CXCL10, according to AUC and the Yoden Index.
Disclosure of potential conflicts of interest
The authors declare that they have no conflict of interest.
Funding
None.
Acknowledgements
Not applicable.
Author statement
Yulei Zhao conceive this study. Yulei Zhao and Danmin Liu con­
ducted the experiments, analyzed the data, and wrote the paper.
References
Choubey, D., 2019. Type I interferon (IFN)-inducible absent in melanoma 2 proteins in
neuroinflammation: implications for Alzheimer’s disease. J. Neuroinflammation 16,
236.
Dejucq, N., Chousterman, S., Jegou, B., 1997. The testicular antiviral defense system:
localization, expression, and regulation of 2′ 5′ oligoadenylate synthetase, double-
stranded RNA-activated protein kinase, and mx proteins in the rat seminiferous
tubule. J. Cell Biol. 139, 865–873.
Edmondson, D.G., Hu, B., Norris, S.J., 2018. Long-term in vitro culture of the syphilis
spirochete Treponema pallidum subsp. pallidum. mBio 9.
Forrestel, A.K., Kovarik, C.L., Katz, K.A., 2020. Sexually acquired syphilis: laboratory
diagnosis, management, and prevention. J. Am. Acad. Dermatol. 82, 17–28.
Green, R., Ireton, R.C., Gale Jr., M., 2018. Interferon-stimulated genes: new platforms
and computational approaches. Mamm. Genome 29, 593–602.
Ishida, Y., Kakuni, M., Bang, B.R., Sugahara, G., Lau, D.T., Tateno-Mukaidani, C., Li, M.,
Gale Jr., M., Saito, T., 2019. Hepatic IFN-induced protein with Tetratricopeptide
repeats regulation of HCV infection. J. Interf. Cytokine Res. 39, 133–146.
Kumar, H., Bot, A., 2018. In this issue: role of specific and non-specific immunity in
disease. Int. Rev. Immunol. 37, 1–2.
Lin, J.S., Eder, M.L., Bean, S.I., 2018. Screening for syphilis infection in pregnant women:
updated evidence report and systematic review for the US preventive services task
force. JAMA 320, 918–925.
Luu, M., Ham, C., Kamb, M.L., Caffe, S., Hoover, K.W., Perez, F., 2015. Syphilis testing in
antenatal care: policies and practices among laboratories in the Americas. Int. J.
Gynaecol. Obstet. 130 (Suppl. 1), S37–S42.
Ma, J., Zhao, F., Su, W., Li, Q., Li, J., Ji, J., Deng, Y., Zhou, Y., Wang, X., Yang, H.,
Saksena, N.K., Kristiansen, K., Wang, H., Liu, Y., 2018. Zinc finger and interferon-
stimulated genes play a vital role in TB-IRIS following HAART in AIDS. Per. Med. 15,
251–269.
Majoros, A., Platanitis, E., Kernbauer-Holzl, E., Rosebrock, F., Muller, M., Decker, T.,
2017. Canonical and non-canonical aspects of JAK-STAT signaling: lessons from
Interferons for cytokine responses. Front. Immunol. 8, 29.
Mattei, P.L., Beachkofsky, T.M., Gilson, R.T., Wisco, O.J., 2012. Syphilis: a reemerging
infection. Am. Fam. Physician 86, 433–440.
Nesterenko, V.G., Akovbian, V.A., Semenova, E.N., Vavilova, L.M., Iudina, T.I., 2006.
Syphilis as a chronic systemic infection. Zh. Mikrobiol. Epidemiol. Immunobiol.
120–124.
Peters, S.O., Hussain, T., Adenaike, A.S., Hazzard, J., Morenikeji, O.B., De Donato, M.,
Paul, S., Babar, M., Yakubu, A., Imumorin, I.G., 2020. Evolutionary pattern of
interferon alpha genes in Bovidae and genetic diversity of IFNAA in the bovine
genome. Front. Immunol. 11, 580412.
Rosenfeld, C.S., Han, C.S., Alexenko, A.P., Spencer, T.E., Roberts, R.M., 2002. Expression
of interferon receptor subunits, IFNAR1 and IFNAR2, in the ovine uterus. Biol.
Reprod. 67, 847–853.
Sarigul, F., Sayan, M., Inan, D., Deveci, A., Ceran, N., Celen, M.K., Cagatay, A.,
Ozdemir, H.O., Kuscu, F., Karagoz, G., Heper, Y., Karabay, O., Dokuzoguz, B.,
Kaya, S., Erben, N., Karaoglan, I., Ersoz, G.M., Gunal, O., Hatipoglu, C., Kutlu, S.S.,
Akbulut, A., Saba, R., Sener, A., Buyuktuna, S.A., 2019. Current status of HIV/AIDS-
syphilis co-infections: a retrospective multicentre study. Cent. Eur. J. Public Health
27, 223–228.
Schlueter, A., Doshi, U., Garg, B., Hersh, A.R., Caughey, A.B., 2021. Adverse pregnancy
outcomes associated with maternal syphilis infection. J. Matern. Fetal Neonatal Med.
1–6.
Schneider, W.M., Chevillotte, M.D., Rice, C.M., 2014. Interferon-stimulated genes: a
complex web of host defenses. Annu. Rev. Immunol. 32, 513–545.
Schwartz, S.L., Conn, G.L., 2019. RNA regulation of the antiviral protein 2′ -5′ -
oligoadenylate synthetase. Wiley Interdiscip. Rev. RNA 10, e1534.
Y. Zhao and D. Liu
Sen, G.C., Sarkar, S.N., 2007. The interferon-stimulated genes: targets of direct signaling
by interferons, double-stranded RNA, and viruses. Curr. Top. Microbiol. Immunol.
316, 233–250.
Thaiss, C.A., Zmora, N., Levy, M., Elinav, E., 2016. The microbiome and innate
immunity. Nature 535, 65–74.
Wang, S.N., Guo, X.Y., Tang, J., Ding, S.Q., Shen, L., Wang, R., Ma, S.F., Hu, J.G., Lu, H.
Z., 2019. Expression and localization of absent in melanoma 2 in the injured spinal
cord. Neural Regen. Res. 14, 542–552.
Wang, W., Xu, L., Su, J., Peppelenbosch, M.P., Pan, Q., 2017. Transcriptional regulation
of antiviral interferon-stimulated genes. Trends Microbiol. 25, 573–584.
Zhang, S.Y., Boisson-Dupuis, S., Chapgier, A., Yang, K., Bustamante, J., Puel, A.,
Picard, C., Abel, L., Jouanguy, E., Casanova, J.L., 2008. Inborn errors of interferon
Infection, Genetics and Evolution 96 (2021) 105137
(IFN)-mediated immunity in humans: insights into the respective roles of IFN-alpha/
beta, IFN-gamma, and IFN-lambda in host defense. Immunol. Rev. 226, 29–40.
Zhao, Y., Altendorf-Hofmann, A., Pozios, I., Camaj, P., Daberitz, T., Wang, X., Niess, H.,
Seeliger, H., Popp, F., Betzler, C., Settmacher, U., Jauch, K.W., Bruns, C., Knosel, T.,
2017. Elevated interferon-induced protein with tetratricopeptide repeats 3 (IFIT3) is
a poor prognostic marker in pancreatic ductal adenocarcinoma. J. Cancer Res. Clin.
Oncol. 143, 1061–1068.
Zhao, Y.L., Le, W.J., Li, S., Li, Y., Zhu, X.F., Su, X.H., 2016. Gene expression profiling of
peripheral blood mononuclear cells in patients with secondary syphilis. Zhonghua
Nan Ke Xue 22, 1104–1109.