‘ynoLoar 197, 298-302 (1983), A Feature of the Coat Protein of Potato Virus X Affects Both Induced Virus Resistance in Potato and Viral Fitness MATTHEW G. GOULDEN, BARBEL A. KOHM, SIMON SANTA CRUZ, TONY A. KAVANAGH,” ‘ano DAVID C. BAULCOMBE* The Sainsoury Labaratory, Norwich Research Park, Caney, Norwich NR4 7UH, United Kingdom: ‘and "Department of Generics. Tinty Collage, Lincoln Place Gave, Dubin 2 heland Roceived May 3, 1993; evepted July 21, 1968 ‘The coat protein of PVX determines whether isolates of PVX are affected by Rx-maciated resistance in potato. Isolates with the coat protein of PVK,g are not affected by the resistance; those with the coat protein of VK, licitan ‘extreme resistance in the Rx potato that prevents vrus accumulation, even on the inoculated lea. In this paper we ‘doseribo the analysis ofa series of hybrid sng mutant isolates Of PVXye ad PV, which were inoculated to plants and ‘protoplasts of x and rx cultivars of potato. From the virulence phenotypes ofthese isolates we conclude that eicka- tion ofthe resistance is affected by amino acids 121 and 127 of the viral coat protein, with codon 12 being the mejor doterminant, PVXq 2nd hybrid ar mutant ieolates with lysine and arginine et positions 121 and 127 wore able to ‘ovorcome the resistance of Rx, whereas those with threonine and arginine were resistance sensitive both on plants and {nprotoplasts. The va isolates with single mutations a either codon 121 oF 127 were less infectious than the wild-yp2 ‘double mutant isolates although, in protoplasts ofthe suscepiibe cultivar of potato, they accumulated as well asthe \wie-type virus. Teken together these data suggest thst amino acids 121 and 127 affect a feature of the viral coat protein which may interact with celular components involved in the epread of PVX and with the areduct of the Ax resistance gone. 1989 Anders Fens, INTRODUCTION Plants are resistant to specific pathovars or isolates of 2 pathogen when the pathogen has a component which is either inhibited directly by the plant, or which induces defense processes in the plant. in the study of {ungal and bacterial resistance, the components of the pathogen involved in the primary interaction with the plant are known as the avirulence (Avr) determinants, The plant gene controling the specificity ofthis inter- ‘action is the resistance (A) gene (Keen, 1992). In some of these interactions, the Aur determinant does not in- teract with the product of the R gene directly, but con- trols production of an elicitor of resistance. The elicitor may bea small secandary metabolite produced by the ‘Avr determinant (Koen ef ai., 1990), although there is at least one example in which the Avr determinant is also the elicitor Van den Ackerveken et al, 1992) Resistance gene interactions with viral pathogens have been studied in less detail than with fungal or bacterial pathogens (Fraser, 1980). There are several ‘examples in which # vius factor affecting the specific: ity of the resistance interaction has been identified (Ka 1989; Meshi ef al, 1988; Know and Dawson, 1988: Culver and Dawson, 1988), but only for two systems has the virus been analyzed ina manner which defines the avirulence determinant (Koh et al., 1993; Culver ‘and Dawson, 1991) and which rules out that the virus- encoded specificity determinant is a suppressor of re- sistance. {n the interaction, defined genetically, be- tween tobacco mosaic virus (TMV) and the N' gene of Nicotiana sylvestris, the viral coat protein is both the ‘Avr determinant and the elicitor of resistance. Similarly the coat protein of potato virus X (PVX) is also impl- cated as an Avr determinant in potatowith the Rx resis. tance gene (Kohm et al, 1993; Kavanagh et af, 1992) Rx was introgressed to cultivated potato (Solanum tuberosum) trom wild relatives S. andigena and S, ~acaule (Cockerham, 1970}. There are consequently wo Re loci in porsto (Cockerham, 1970: Ritter et a), 1991) although the phenotype of each is apparently identical: the resistant plants completely suppress the ocumulation and epread of PVX:n the inoculated and systemic leaves and normally there are no visible signs ol infection on the inoculated plant (Tozzini eral, 1991 Benson and Hooker, 1960}. The Rx-mediatad resis het a, 1992; Saito et al, 1987; Meshi et af aera ato ef al, 1987; Meshi ef 8, ance is unusual in that it is expressed at the level of protoplasts as a suppressed accumulation of PVX and » To whom rept requests should be addressed PVX RINA (Adams et al, 1986; Saladrigas et el, 1990) 203 0t2.6822/09 $5.00, Cony 185 oy Rene Pay, ‘Megs otacedsien any em save204 GOULDEN €T AL There is only a single natural isolate, PVX ye, known to ‘overcome the Rx: all other strains are sensitive to the Aocmediated resistance (Moreira ef al, 1980), Our recent analysis of resistance to PVX in potato has exploited the ability of PVXyp to overcome the Rx- mediated resistance. The use of this strain has allowed us to identify the coat protein as an Avr determinant of PVX on Rx potato (Kavanagh er a, 1992), and to show that Rx-mediated resistance is an induced effect (koh er a, 1993): protoplasts of Ax potato become resistant t0 PVXy_ if co-inoculated with an avirulent strain of this virus. The induced resistance is effective against cucumber mosaic virus and tobacco mosaic virus as well as PVX (Kuhm et ai, 1993). In order to understand the detailed mechanism of Rx-mediated re- sistance we are characterising the viral and host corn- ponents involved in the resistance mechanism. In this paper we describe a detailed analysis of the features in the primary structure of the PVX coat protein which affect its property as an Avr determinant on Rx cultivars of potato. MATERIALS AND METHODS ‘Transcription clones, mutagenesis, and hybrid construction The PVX transcription clones pTHS and pTXS have been described previously (Kavanagh et af, 1992). in each clone, a fulllength cDNA representing the PVX viral genome is flanked on the 5 side by the promoter for T7 RNA polymerase and by a unique Spel site on the 3’ side, allowing in vitro transcriotion of infectious RNA from linearized plasmid DNA (Chapman et a). 19928) A tulliength cDNA clone of strain PYXep, (ones, 1985) was prepared by the stepwise replacement of sequence in plasmid pTCP which carties a full-ength CDNA of the related viral strsin PVXcp Uones, 1986: Jones, 1990). In the first step, the DNA of pTCP was replaced with cDNA of PVXea4 between recognition sites for Not! (279) and Mul (6381). In the second and third steps, the PVXcps cDNA was substituted into the 5’ and 3' regions of the PVX cDNA, also using the Not! and Miul recognition sites, together with sites in the vector plasmid. The in vitro transcripts of the final plas mid, PTOP4, were inoculated to potato cultivars canry- ing the Rx, Nx, and Mb resistance genes, WV. tabacum, N. clevelandii, Gomphrena globosa, and to Chenopo- dium amaranticolor as indicator plants. In each in- stance the symptoms were indistinguishable from those of the progenitor PVXcey (see Results) The general scheme for introduction of mutations into the coat protein gone of PVXen4 and PVXyq in: volved oligonucleotide-directed mutagenesis of a CDNA clone of the coat protein gene, and transfer of the mutagenised sequence into the full longth viral CDNA, using restriction enzyme sites. To facilitate this transfer, Hpal sites were introduced into pTHS and PICP4 by making nucleotide changes at positions 6061 and 6063 which did not attect the sequence of the coat protein. A site for Stul was introduced into TCP4 at position 6190, for the same reason, and also bby making a change at 6192 that did not affect the sequence of the encoded protein, These modified ver sions of the PVXep, and PVXwe CDNA were designated pTHSAr and pTCP4Mr, respectively. The procedure for mutagenesis in these constructs and in the constructs described below was as described by Jones and How- ard(1991). In each construct, the sequence of the mu- tants and flanking regions was confirmed directly. The mutations introduced into the coat protein genes, and their effects on cading potential were: (1) Codon 121 of pTCPAAr trom ACA (T) to AAA (K) at posi- tion 6011; (2) codon 121 of pTHSAr from AAA (K) to ACA {7} at position 6011; (3) codon 122 af pTXS from ACA (T) 10 AAA (K} at position 6014; (4) codon 128 of BTXS from ATG (M) to AAG {K) at position 6032; (5) Codon 128 of pTXS from ATG (M) TO AGG (R) at posi- tion 6032 The mutations were introduced into subclones of the viral genes and subsequently transferred t0 full length viral cCONAS using restriction enzyme digestion and ligation (Sambrook et a/, 1989). In each instance the nucleotide sequence was determined to confirm the required mutation and absence of PCRinduced mutations in the final construct. The hybrid cDNA PTCP4-CP was produced by replacement of a Baml) fragment in pTCP4, which extends between 5684 and the 3 end of the viral genome, with the hornologous fragment of pTHSAr The virel isolates derived from transcripts of pICP4Ar or pTHSAr were referred 10 a8 PVXqx4 OF PV%nq fespectively. The isolates derived from the mur tent cDNAs are also identified by & suffix, Thus, the isolate derived from the plasmid pHO1 was referred to a8 PVXiq), The constructs in which modifications were made at codons 121 and 127 of the coat protein gene were identified by the amino acids encoded at these positions. Thus PVX ene is @ derivative of PVKig, with T and K specified at codons 121 and 127. Inoculation of plants and protoplasts and ELISA Transcripts trom wild-type and hybrid constructs were synthesized in 10-ul reactions, purified and inocu lated to N. clevelanaii as previously described (Chap. man ef al, 19922). Passage of progeny virus from in fected N. clevelandii to rooted cuttings of potato cult vars Matis Bard (rx) and Cara (Rx) was as described (Chapman et al, 1992a), except that inoculations were repeated on Days +3 and +5 post-primary inoculation. The consiructs with coding sequenco point mutationsAVIRULENCE FUNCTION OF THE POTATO VIRUS X COAT PROTEIN 296 wore much less infectious than the wild-type construct (described under Results). For that reason the inocula- tions to NV. clevelandi were carried out with the prod- cts of @ 190-4! transcription reaction. For protoplast electroporation, transcripts were purified by phenol: chloroform extraction, precipitation from 2 M LiCl and spin dialysis through Sepharose CL-68 before electro- poration of Mans Bard and Cara protoplasts, as de- scribed by Kéhm ef af. (1998). Plant infections were: monitored by ELISA as described (Kavanagh et af 1992}, except that poly-clonal antisera to PVX were used. Graft inoculations Graft inocuiations were of infected tomato scions to potato stocks, The tomatoes were inoculated al the calyledonary stage 7-14 days before wedge grafting 10 cuttings of potato, just above the iowest lateral bud. ‘The presence of virus in the lateral shoot was deter mined 14 days atter grafting by ELISA or slot blot ana ysis. Analysis of progeny viral RNAs from plants and protoplasts Total RNAs were extracted from inoculated or sys temically infected potato leaves according to either Verwoerd ef af. (1889) or Baulcombe and Buffard (1983). RNAs were recovered by precipitation twice fram 2M LiGl and once trom NaQAcfethanal. Slot blat analyses of total RNAs were as described by Clayton (1989) except that Hybond N (Amersham ple) was sub: stituted for nitrocellulose. RNA samples fram prota- plasis were prepared by phenol/chloroform extraction ‘and analyzed by northern analysis as described by Koh e¢ al. (1993). The *P-labeled RNA probes for slot blot and north: fer analysis ofthe (+)-strand of PVX RNA were synthe sized on clone pHB-RP, representing the 3'terminal 2.5 kb of pTHS between ‘position 3980 and the 3 end cloned into pBluescript (KS) (Stratagene). Restriction enzyme or nucleotide sequence analysis of the coat protein regions of progeny viral RNA made use of first strand cDNA which was PCR amplified between 5617 ‘and 6408 using oligonucleotides 5-TTGAGCGGTTAA- GTTTCCA-S' (8617-5836) and 5-GAAAATACTATC- AAACTGGG-2' (6405-6386), essentially as described {Kevanagh ef af, 1992). The primer from 6405 was based on the (-) strand of PVXyes, but had only a single mismatch at position 6394 of the sequences of PVKus of PVXepu. In some instances the identity of sequence inthe prageny RNA was confirmed by comparative re airiction enzyme analysis of the POR amplified cDNA and the POR products of the progenitor plasmid. The presence of Msc} (5804), Pvull (5887), and Nel (6081) sites were used diagnostically for the PVXey, derived sequence and the Pstl sites distinguished between PVXcee and PVXyq derived sequence (6711 and 6168 in PVKens and 5711, 6024, 6158, and 6329 in PVK,g) Sno site (8006) was a specific diagnostic test of the threonine codon at position 121 of the PVXere coat protein gene. In other instances, the POR products, were cloned in plasmid vectors and the sequence was dotermined directly. RESULTS The interaction of PVXor, with Rx is affected by sequences in the coat protein gene In previous work we have shown that the interaction of Rx with PVX involves the coat protein as.an Avr deter minant (Kavanagh et al, 1992; Kohm et al, 1893). In this paper we describe a more detailed analysis of this interaction using @ series of hybrid PVX genomes incor Porating PVXy9, as the resistance breaking strain, and PVXoos which iS sensitive to the resistance of Rx. The previous analyses were largely based on PVX yy. In the experiments described here the choice of PVXep. rather than PVXyxs Was influenced by the relationship of these strains to PVXjq: PVXiyq is 82% identical to PVXsq at the nucleotide sequence level in the coat pro- tein gene, wheress PVXcp, is 89% identical (see be low). It was considered that the degree of homology would be an important factor in the proposed experi- ments bocause other work in our laboratory (M. G. Goulden and 8. Santa Cruz, unpublished data) had shown that inter-strain recombination of PVX does not always give rise to infectious virus if the modified virus had a hybrid coat protein gene. In addition, because the resistance interactions of PVXory and PVX ya differ only in sensitivity to the effects of Rx, the analysis was potentially more straightforward than with PVXyes PVXaxq i8 also sensitive 10 Ax, due to 2 feature in the coat protein (Kavanagh et al, 1992; Santa Cruz and Baulcombe, 1993) The hybrid viral genomes were constructed at the CDNA love! using full-length cDNA clones of PVXys (DTHSAN) and PVXer4 (OTCP4Ax). The phenotype of virus derived from pTCP4Ar was determined by inocu- lation t0 various indicator species (Table 1) and was identical to the progenitor strain PVXeps in all respects, including sensitivity to Rx. The phenotype Of PVX yy de rived from pTHS and pTHSAr has been described previ ously (Kavanagh et af, 1992): unlike PVXop, derived from pTCP4, these cloned isolates of PVXg overcome Rx but, like PVKens, they are able to overcame bath Mx and Nb (Table 1), The hybrid TCP4-CP was constructed by substitu- tion of tho PVXyq.c0at protein gene into pTCP4 (Fig. 18) and the transcripts of pTCP4-CP and the progenitor clones pTCP4Ar and pTHSAr were inoculated to N. Glevelendii. The symptoms were as described in Table298 GOULDEN EF AL TABLE 1 ‘SYMETOMS INQUCED BY CLONED ISOLATES OF UX. Host plant conan tab20um Nicovene cleveland Chenopodium amarantiotor Gomphrena globass inoculated leat Solanum tuberosum ev. Cara (Rx, os, nb) ‘Solanum tuberosuen cv. Maris Piper ex, Mx No} PUxeps ftom pTOPSAr ‘systemic mosaic Systemic mossic with ecrotie lecks Pe for THAT Mild, barely visible mosaic Mid, varely visio masaic ‘on systemic leaves Chlorotic local lesions wath ‘Symptamiees. NNeerote lsions with rea ‘symptomiess border No aocurnulation or eymptome Systemic mosaic wt nacrate ‘leces ‘Systemic mild mosaic Syetomic mits mosaic 1 or, for TCP4-CP, a well-developed mosaic but with- out the necrotic tlecks observed for PVXeps. The inoc- ula were passaged as sap from the MW. clevelandii to potato cultivars Maris Bard (rx) or Cara (Re). Mosaic symptoms were observed on Maris Bard plants inocu- lated with either PVXepe (from TCP4AL oF PVXcrxces but were not used as an indicator of infection because the PVXya derived from.pTHSAr produces mild or im- perceptible symptoms on potato. Instead, the resis- tance interactions were assayed by ELISA of virus (M. G. Goulden, unpublished data) or slot blot analysis of viral RNA accumulation in the inoculated leaves: all three isolates accumulated in Maris Bard (rx) but only the two constructs with the PVX» coat protein gene accumulated on Cara (Re) (Fig. 1b). Ibis therefore con- cluded thet PYXcrq, IKE PVXues, has features in the coat protein which atfect the interaction with Rx. Identification of features in the PVX coat protein affecting the interaction with Rx The coat protein genes of PVXee and PVXeos differ at 79 nucleotide positions, of which only seven attect the primary structure of the viral coat protein (Fig. 2). The constructs described in Fig. 3 were assembled, in the background of PVXya, to determine which of these coding sequence differences is associated with the Rx interaction. Transcripts of these constructs were inocu- lated first to MV. clevelandii and the progeny virus was passaged to potato All of the hybrid constructs established systemic in. fection of WV. clevefandii within 10 days postinoculation (03) with symptoms indistinguishable from those of PVs. However, there were substantial differences in the accumulation of these hybrids in the inoculated leaf of potato plants. The variation depended on the lant genotype and the form of the viral genome. Table 2 summarizes infectnity results based on ELISA data from the inoculated and systemic leaves of Maris Bard and Cara whieh indicate that all ton hybrids infected Maris Bard to approximately the same extent as the progenitor forms PVXjs oF PVXe94. However, in leaves, of Cara, the only hybrids to accumulate were those Which included the Ggiil/Hpal fragment of the PUK.» CDNA (PVXeca. PVXwoie. PUXncre afd PUXtou: Fig. dah The ELISA result was confirmed by slot biot analysis, of total RNA samples extracted 20 days pi (Fig. 3b): in Maris Bard (72) leaves there was accumulation of all hybrid forms of PVX and the progenitor isolates PYXy and PVXe94. The only isolates to accumulate in the Dix RK = sue gt Fie. “The resistance breaking property of PVKg, PVikces, antl coat protein gene hybi. a Gene organiza Banh) snisoiotes of PVX cating the locaton of open roading ramee (ORFS). The sizeof non situctural gana products indicate ror tha sizeof ha gene produot Kk» KD} 3nd ‘me e001 protin one by COAT. The PVXen derived sequence is shaded in ho diagrams. The Bart incicetod was uped in tne constuction lof the fybrid genes and is on tha 5 side of cading sequenea diferances on the coat protein gene, () Slo: blot analyss of PYX FINA in the ‘naculated leaves of potato cutivars Cara (x) or Mars Bard (x. The RNA samples wore taken 20 days piand the hybridization probe detected ‘he (+)-strand of the virel RNAs. The samples indicated as *) were taken from the mock-inocueted tissue.PvE Pe PVR a PV PV Pie PK Va Puce Phys PK Pee PVs PV Pie PVE Phe VK PUK Pir PVR [AVIRULENGE FUNGTION OF THE POTATO VIRUS X COAT PROTEIN, MTT PANTTQAVastTo3rs 7 aatt ganagatgactacgecagceaacaccacteaagetgtaggatccactacatcaact TT TTAGATPANSGLFTIPoG Accaccactactgeaggegcaactectgctaactcagggctgttcaccataccggat goa DPFPFSTAKAVVYASNAVATNED sgacttettcageaccycanaggeoutegtggctascaatgceat tsccacceataaases g toe 9 eget L?e1ekTWKDMKIP Ss DTM AQ craactaagatacagaagatctggaaggacatgaaaattcctteggacactatggcteaa ces g a 3 AAWDLVREHCADVG ss AQ TEM Seagettgauacttagtaagacactatgctatcattgsatcttecucteagactgagaty r¢oTarysNovVsSRARDAAATK seaquctctsgcecatactcanatgungtcagtagagctaggttagetgetgcaattaaa ecg ecg ae . K RvCKLRQFCRKYAPVV WN WM Snagtgeacegactaaggsegtectoctggnagtatgctccagtcstctysasctosaty cog ea eee 2 LTNNSPPANWOAQGFK PE HK ctoacaaacaacagccraccagccaat tggcaagcaragggctteaagccggaacacaaa, fesse oo fe Se 9 PAAPDFFDGVTNPAAITPKE teogcagecttcgacttctttgatagagtcaccaaccctgcagccatcaccecaaaagaa “ cLIR?PesSEAEMNAAQTAAP VY agactcataagusctecatctuagacagagatgaataccucteaaactgctaccttceta oe = © KITKARAQSNDPFASLDAAV? aagat cactaaggcgagaucacaat ccaacgactttgccagtct ggatgecgegsteact © @ v y RGCRITGTTAAEAVISL ee PR? suasyceycatcaccagaacencesctacagagictsttatcteactacceccaccataa ¢ age ctacgtecacataaccgacgegtatcccagt tteatagtattttctagtttgattatatg nacantatanata e 5700 5760 5820 5850 5940 6000 5050 6120 180 6240 6300 6360 420 6033 207 Fig. 2. Tenvoleotide sequence ofthe coat protein gones and 3 larking Sequence of PYXy, ard PVXap,. The cDNA sequences ao shownin lowercase iype and the coat protein sequences in yopetcase type. The PVXep, CONA sequence s ony inicatad where diferent Hom PUyg The PVXex oroein sequence, where diferent from PU%, is indicated in Bold, The italicised and underined sequence indicates the Hal ors tui ses mroduces without electing coding sequence inlo BICPANY and pIHSA, The sequence obarsinates are based of the fal PVN ye Sequence which has baon submited 0 the EMBL database Accossion number 223256). The soquences shown both align, without insertion of pdding charactors 10 the sequence ot PVAe, (Mandel era, 1989; Oren era ‘soles of PVX (ureman ef a, 1986) mn laaking @ codon at Gostion 8732 n the cost protein gene 1990) and ifr rom the published sequences o European208 GOULDEN ET AL, a =e mm b einhy on Ld » x= ae! he a) s ons @e a -2 vee = oo von Za a « CI == Fic. 3. Acbreaking pronertes of hybrid forms of PVX. A series of hybrid toms of PUX wre goneratod in 8 cDNA of PV, by replace: rent of tho PV%y Sequence Wn the homologous sequence of PVKere Features of tne amino acid composition of the cost protsin in thee hybrid enornes i israteddagraramaticaly in (ab th the locaton and eading eotental of the gaimomohic codars in these two igoates shown cn digerams of the coat protein gone, with the equance dorivad ftom PV Kap shown in dark stippie, Tre data ‘shown int) are rom sl blot ansiysis of PUX RNA inthe inoculated leaves of potato cultivars Cara (Rx) or Mars Bar (x. The RNA sam les were taken 20 days oi and the hykviézation probe detected the (Yetrond of tne veal RNA leaves of Cara (Rx) were the four hybrids based on the PVXie-derived Bo!ll/Hpal fragment. The accumulation of the semaining six hybrids (PVXye,. PUK. PVKce- PV Kom PVXycns ad PVXyane) 8nd the PVXepq in leaves of Cara (Rx) was less than 0.5% the level Of PVX yo To verify that the progeny virus on these potato plants was unchanged from the progenitor constructs, total RNAS in the infected olants were reverse tran- scribed to cDNAs and PCR amplified over a region (6617-6405) which encompasses the coat protein gene. Comparative restriction enzyme analyses, showed that cDNAs generated from the plants in this, way were indistinguishable from those similarly pro- duced from the transcription clones (M. G. Goulden, unpublished data) These data establish that the ability to accumulate ‘on Cara, and thereby overcome Ax, is localized in the coat protein of PVXin the region encoded between the Ball and Hoal sites at positions $837 and 6066 of the viral CDNA. A further series of constructs was essem- bled in order to establish more precisely which fea- tures of the region 5837-6066 are involved inthe inter action of PVX and Rx. These constructs included HB- ‘TK (Fig. 3) and its reciprocal CP-KR with the Bgill-Hpal fragment of the PVX,e CDNA transferred to the PVXoo« background. Mutant versions of these two hybrids were also constructed (Fig. 4a) and were designed to determine which of the two coding sequence differ. ences (at codons 121 and 127) affect the interaction of Rec and PVX (Figs. 2 and 4), Asin the earlier experiments, the primaty transcripts, were inoculated first to M. clevelandi and subse quently to potato, either by direct inoculation or by grafting via tornato. Tho results (Table 3a) confirm the earlier conclusion about the role of the region §837—~ 6066 by showing that substitution of that region from PUX 9 it PVXeo4 (PVXeaexa) produces an Rx breaking isolate of PVX. There was a clear difference in the ac- ‘cumulation of the mutants encoding threonine at co- don 121 and those encoding lysine (Tabie 3b). Those with threonine did not accumulate on any of the Rx plants tested and were therefore considered s being Sensitive to Rx-mediated resistance. Those with lysine accumulated on approximately 20% of the inoculated Cara plants. It is not thought that this low infectivity is due to Rx because a similar low proportion of the Maris Bard plants were infected by these mutant constructs, (Table 3b) (see below). The lysine to arginine change at position 127 apparently hadno effect on the resistance sensitivity of the various forms of PVX: the isolates PV Xa and PVX ec were both aifected by the pres- ence of Rx whereas PVXceexn 2nd PVXcra ir Were BOTH resistance breaking isolates (Table 3) The resistance phenotype of Rx is expressed in pro- toplasts (Adams ef a1, 1986; Saladrigas et a1, 1990; Kbhm et a, 1993). To determine whether the features, of the viral coat protein affecting resistance in proto: TABLE 2 ‘ac SENSITWITY OF MUTANT DERNATHES OF PU Mavis Bard Cara es Go) PVKee sine 16 one PUK 146 a6 on? PY%e: ve pie one Vive we Bie one Puree we m2 ona PV Kc wie wie one Phen roe ane one PUR ies ane se wie Pk ane wie ais Pre ane ane on PVR eee ane ene we Vien wig 33 ane. ‘Note. L, Lacalyinlected: 8, systemicaly infected. Samples were taken at 15-20 day i Ganoulated leat or 23-30 days pi eystoric leaf and PUX inlection determined by ELISA,VIRULENCE FUNCTION OF THE POTATO VIRUS X COAT PROTEIN 209 plasts are the same as those affecting resistance in intact plants, transcripts of the constructs described in Fig, 42 were inoculated to protoplasts from the potato cultivars Cara or Maris Bard. The degree of resistance ‘was determined by northern analysis of RNA sarnpies taken at 24 hr pi. In most instances, the whole plant data were parallel to the protoplast data (Fig. 4b). P-VXees and the various hybrid or mutant PVK isolates with a threonine cadon at position 121 generally accu- mulated less virat RNA in the Cara protoplasts than in Maris Bard, whereas PVX., and the forms with a lysine codon were resistance breaking: they accumulated at similar levels in protoplasts of either Cara or Maris Bard. The one exception to this pattern was the con- struct PVXyexq which accumulated at a high level in ows COIR em oa on re oe Ee Fie 4. acbreaking properies of mutant are hybeid orms of PUK potato protoplasts. A series of hyd and mutant forms of PUX were: (goneratedina cDNA! PVKyy 2nd Pep By exchange analor med fieaton of sequence between coordinates $437 (2p) and 8066 (Hipah. Features ef the amino acid compesiton ofthe coat protein in ‘hese mediied gencmes are ilustrated diegremmatically in al with ‘ne location and coding potetis of ne polymonhiscodonsin Wiese ‘wo isolates shown an ciagrams of the ooat protein gone and the sequence derived fom PUXen, snow in dark stgple. The data “Showa in (6) are om a Nonhern analysis of RNA from potata pect plats inoculated withthe renscripts of the constructs shown nj} land sampled ater 24 hrinoupstion, The protoplasts wore ether fom potato cutvars Cara e) or Mans Bard (m) the probe used was spe. tfc forthe (+}sirard af PYX and the major viral species dete=tod wore he 8X0 gonomic RNA and the pulstivesubgenamic RNAS ot 2 an 08 ke TABLE 3 x Seisnt7y OF Myvanr DERVATNES OF PUY £0 PU Marie Bord Coa oh ine @ PVivw ea 22 se 22 PV 7 2" oa oe PK sis 22" os oR" PVKeraan Bie 2 ea 2/2" oo PVs ane ane Pheer 5n6 ane PVxcrte a6 ane PUXereae ene an6 ‘Nofe. Samples were taken rom the naculated leaves, or systemic leaves othe grit naculaled plants, at 15-20.days pad PV infeo- tion wes establched by ELISA, * Graft inoculated. both types of protoplast although st a marginally lower level in tha protoplasts of Cara (Fig. 4b} We have aiso used the protoplast system to evaluate whether the resistance sensitivity of PVXyes 8 affected by tha mutation of the cadon homologues of positions 121 and 127 in PVXeoe! in PVXyes these codons are at position 122 which encodes threonine and position 1128 which encodes methionine (Fig. 5a). The various mutants tested changed these two positions, either individually orn pairs, to the codon of PVXe Of PVXiap (Fig. 5b). The phenotype of these mutant derivatives of PVXue reinforced the conclusion from the PVXcrd/ PVXuo analysis, that sequence identity at codon 121/ 122 determines whether the viral isolate is sensitive t0, or can overcome the Rxmediaied resistance: the PVXyca mutant with lysine at position 122 (PVX;ysq) ac ‘cumulated at similar levels in the Care and Maris Bard protoplasts whereas PVXpce and PVX js with the thre nine accumulated at a substantially higher evel in the Maris Bard protoplasts (Fig. 5). Changes ftom the me- thionine cadon identity at position 128 (PVXresx and PVXrxes) had no major effect on the Ax response, in protoplasts. Mutation of codon 121 or 127 affects the fitness of ‘the PVX isolate in the course of the experiments described above it was apparent that the mutant forms of the PVX (Table 3) wore loss able to accumulate and spread in plants, than wild-type isolates. These isolates failed to infect, all of the inoculated plants and cid not establish a sys. temic infection even on the PVX-susceptiblo cultivar (Table 3b) or NV. clevelandti (M. G. Goulden, unpub- lished data). The low infectivity of hese constructs was established most conclusively by back-inoculation of300 GOULDEN ET AL rine sol y21422 amb ald 21128 pox) ever) Pvqunaitom pS x94 mass maxexe b UK3_TXS4 TXS5 THS8 --° os a6 Rebrating properties of ute fans cf Pa posto srooptete: Asmion tobid aan tro Pworsboer Begin SONA of Pte: by odoin ot souares Pe oat Frese tore 120903 he air edge ene a ave fafa coin shown na and carers nih te cous poten n Phen Paes nd Pie Tre ctoshonn 6) Se tame Noth faa fk on pl pals hose iaeluthtbe trcetpect heconont oeun'e (ond conped ther 2¢ 9 wefan The pcan wae oe fon G3 ot Mare ordtnand ne roe ed was sped ratte! Figo tno ral spe etared ware he 6 gor motionstbopouwoteogonrec Wise 1 ard Os bak — virus recovered from IV, clevelanaii, of the constructs descnbed in Fig. 4. There were two patterns of infectiv- ity depending on whether the constructs had natural or hybrid combinations of the 121/127 codons of PVX ye OF PVXerq. Extracts of N. clevelandii inoculated with constructs with the natural combinations of these co- dons (the wikd type constructs, PVXepexn OF PVXian} infected NW. clevelandii at 10 dilution. Extracts of NV. clevelandii inoculated with constructs with hybrid com- binations of codons 121 and 127 (PVXwexx. PVXsan: PUXonerm, PVXcouee) infected up to three quarters of the plants inoculated with undiluted extract and were ‘ot infectious at 10~ dilution. DISCUSSION Our analyses reported elsewhere indicate that Rx- mediated resistance is induced when the product of Rx interacts, directly or indirectly, with the viral coat pro- tein ofall natural igolates of PVX, excopt PVXya (Koh etal, 1993; Kavanagh etal, 1992). The data described here reinforce the conclusion that the Rx interaction is 2 protein-mediated, rather than an RNA-mediated ef fect by showing that the resistance was induced only when there was a threonine residue at position 121 of the coat protein. Interestingly, this threonine residue is conserved in the coat proteins of all known isolates of PVX, with the exception of PVXjq (Skryabin etal, 1988; Huisman et al, 1988; Orman e7 2, 1990; Kavanagh et al, 1992), However, several lines of evidence implicate ‘other parts of the molecule in the induction of the resis- tance response, For example, the demonstration that PVXu hd PVX ya. (FI. 4) isolates differed in sensi- tivity to Rin protoplasts but notin plants indicates that the lysine at position 127 may be a secondary feature fof the Avr determinant on Rx potato. It also seems likely that the coat protein in positions 1-53 and 140-236 influences the interaction with Rx because the two con- structs which differ in that region only (PVXnera and PVXyeze differ in their ability 10 elicit the resistance in protoplasts even with the threonine at position 121. similar conclusion ean be drawn from the finding that deletion of sequence encoding the C-terminal domain of the coat protein, between residues 140 and 183, (.e., away trom position 121) converted a resistance: sensitive isolate to a resistance breaking form (M. G. Goulden, B. Kohm, and D.C. Baulcombe, unpublished data) Unfortunately there is no definite structural model for the coat protein of PVX, although itis known that the thirty residues at the WV terminus ere the mast superti- cial part ofthe capsid and that the threonine at position 121 is not exposed to the surface (Baraiova et al., 19920,0). However, we can infer that the Rxinteraction does not involve the superficial domain at the N ter- minus, because the PVXep, and PVX je isolates are identical in that region. To account for the likelinood that the Rx interaction is to domains of the coat protein which are not exposedin capsids we propose that the interaction is to @ noncapsid form of the coat protein: ascent protein, monomer subunits, or small aggre- gates lke the verious disk forms of the TMV coat pro- tein. A second possibilty is that the threonine residue ‘at position 121 affects inter-subunit interactions in the virion such that a resistance-inducing domain is ex posed in the capsids of resistance sensitive, but not the resistance breaking isolates. A similar explanation hhas been proposed for the structures of the coat pro- tein of TMV involved in the resistance conferred by NV’ intobacco (Culver and Dawson, 1989; Dawson, 1981) The observation that PVX.19 was resistance-sensi tive when inoculated to Cara plants (Rx genotype) (Ta- ble 3), but not to protoplasts, indicates that Ax-me- diated resistance may have effects on virus spread as well as on virus accumulation in the inoculated cell Prosumably the offect of Rx on virus spread seen in the plants inoculated with PVX,.:m. is less sensitive to the structural context of the threonine codon than the ef- fect on virus accumulation, as assayed by inoculation of protoplasts. The possibilty that Rx-madiated resis-AVIRULENCE FUNGTION OF THE POTATO VIRUS X COAT PROTEIN 301 tance is @ complex process with more than a single mechanistn of action has also been suggested by re- sults of Benson and Hooker (1960). They described how, on gratt inoculated potato maintained at 10°, Rx- mediated resistance was associated with tuber necro- sis as well as reduced virus accumulation. Presumably the use of graft Inoculation resulted in prolonged intro- duction of high tite inoculum to the resistant piant and the elicitation of secondary resistance responses that are normally masked by the effect of the resistance mechanism on PVX accumulation. Mutation analysis of the coat protein potexviral ‘genes has demonstrated a role for the coat protein in accumulation of the genomic RNA and spread of the infection beyond the inoculated cell (Chapman et al 1992a and b; Forster et a, 1992). However, it had nat been possible to determine whether the effect on spread was direct or a secondary consequence of the effect on RNA accumulation. We can now conclude, from the phenotype of the mutant versions of PVX (Fig. 4) inoculated to susceptible potato, that these are inde- pendent effects. Several of hese mutant forms of PVX, showed normal levels of RNA accumulation in proto- lasts of Maris Bard potato (Fig. 4) but greatly reduced specific infectivity and ability to spread in, and from, the inoculated leaves of either potato or V. clevelandli ‘The observation that two simultaneous mutations are required for transition from a fit Rx-sensitive strain to a fit Axbreaking strain (Table 3) may explain, in part, why Rx is a durable resistance: there is only @ single ‘Re-breaking isolate, PVXy, which was detected in Bo- livian potataes (ones, 1985; Moreira et al, 1980). In other potato growing areas, Faxhas not been overcome and it has not been possible to generate Rx-breaking isolates in the laboratory by selection from high titre inocula on Rx potato using @ protocol which led to the identification of isolates of PVX able to overcome either Nic or Nb (Jones. 1986: Jones, 1982). However, we do not believe that the requirement for two mutations can be the full explanation for the durability of Rx. Two mu- tations were also required for the evolution of Tin? re- sistance-breaking isolates of TMV which arose rapidly upon the widespread propagation of tomato cultivars ‘carrying Tint (Meshi er al, 1988; Pelham ef al, 1970). It may be relevant that the Rx-mediated resistance, un- like the Tin? effect (Yamatuji er 2, 1991], isan induced resistance (Kahm et al,, 1993} for which evolution of a resistance-breaking isolate would require three ‘stages: two separate mutations and intraduction of the resulting double mutant to potato in the absence of wild-type, resistance-inducing forms of PVX. The full Understanding of this, and other aspects of the Rx-me- diated resistance will undoubtedly require the charac terisation of the product of Rx. The work described in this paper opens up one new approach to that end, involving the search for proteins in Rx potato having a specific affinity for forms of the PVX coat protein with a threonine residue at position 121 ACKNOWLEDGMENTS: We are grateful o Alec Forsy for carving out tho grat inocula ‘ions and the Gatsby Chartable Foundation for Suppo. Imperied ‘and mutant rus solates were handled and maintained under le ‘ence tram the Minty of Agncultue Fisheries and Food (PHF 142037733, REFERENCES: Poss, &.E, JOvEs, RA.C., and Couns, RLM. A. (1986), Bxores- ‘sion of potato vis Xresistance gene An potato ea protoplasts, 1. Gen, Virol 67, 2241-2088, LARATOVA,L A., GRERENSHOHIROY, NLL, DOBROW, EN, al (19928) ‘The orgarizalion of potato veus X coat proteins i virus paricies _sudiad by tite plonigranty and model buléing. Virology 188, 175-180, BaRATOVA, LA, GRCBENGHCHKOV, N. |, SHEHKOY, AL V., ef a 119920). The topography of the surtace of potato ius Xia planigraphy and inimunclogea! analysis. Gen. Viol. 73, 229 238, Bau.comee, D. C., and BUFFARD, D. (1969). Gibberelic acid regu lated expression of amylase and ei other genoa n wheat sleur fone layers, Planta 157, 493-507 Benson, A... and Hooren, W. J. (1869). soation of vis X fom “immune” varieties of potato Solonum tuberosum. Phytopatho~ logy 80, 231-254. ‘CHaPai, S, HRLS, G., WATTS, J, and Bauv.cowse, 0. C. (19828) Mutational analyss of the coal protein gane of potato veus X: effects of virion morphology and viet pathogenicity Virology 191, 223-230, ‘Chapin, 5, Kevanant, T., and Bav.cowse, D.C, (19826). Potato ‘ius X 380 vector for gone expression in plants. Plants 2, 543 587 (CLAYTON. T.M. (1988). "Inhibition of Transcription in Sveptomyces ‘coplicolcr en industion of tne bactenphage go,” Ph.D. Thess, University of Eas Angi Coortaie, G. (1870). Genetica! studies on resistance fo potsto viuses X and Y. Herel 25, 308-348, (Cunven, JN. and Dawaon, W. ©. (1888). Point mutaionsin the coat protein geno of tobacco mosaic wus induce hypersenstwty in| Nicoligna sylvestis. Mol Planc-Mlcrobe interact 2, 200-213. CGuuver, JN. and Dawsow, W. 0. (1891), Tobacco mosaic virus elictcr cost protein genes produce a hypersensitive phenotype in ‘varsgenic Nicotine sylvestris plants. Mol. Plant-Microbe Inter. ct 4, 458-483, Dawson, WO. (1991), The patnagariaty of tobacca mesate ies. Sorin. Viol.2, 131~197 Fonsres, 8. L. 8. Beok. D. L, GuuroR®, P. J. Voor. D. ML, VaN (Doweweend, Cj, and ANDERSEN, M. T. (1892). The coat protein ‘of whit clover mosaic petexutus has a role in facttating celto coll trangporin ploms. Virology 191, 420-484, Faasen. RS. S. (1890). The genstics of resistance to plant vise, ‘Annu, Rev. Phytopathol, 28, 179-200, Husvan, MJ, UNTHORGT. H. J ML, Bot, J. F., and CoRNEUSSEN, B J.C (1868). The complete nuceotige Sequance of patato wus X and ils homologes at the amino ac level with various plus ‘randod FINA vinises. J Gen, Vio. 68, 1789-1798, Jones DH. ane Howano, BH. (1981). ARapd Method For Recom bination and Site Specie Miagenesis by Spoing Homologous Ends on DNA Using PCR, Biotechniques 10, 62-86 Jones. R.A. (1990). Stain Group Specie and Virus Spectic Hyper02 GOULDEN ET AL. ‘sensitive Reactions to Infection with Potyvinases in Potato Cu- vars. dn. Apo. Biot 117, 83-105, Jones, R.A. C. (1982). Sreakdown ol potato virus X resistance gene Nx Selection of a group four stain rom san group tree. Pent Pao 31, 325-221 Jones, R.A. C. (1988) Further studies on resistance breaking strains of potato vius X. Plant Pathol. 34, 182-189, avanaci, T-, GOULDEN, M., SANTA ORUz, S., CHAPMAN, S., BARE, |. and BauLcowae, ©. C’ (1992). Molocular analysis of a resic- ‘anoe-breaking stan of potato vis X. Virology 189, 609-677, eeu, NT, Tawant, S.J, KoBavasti,D. ¥., er af (1990) Bacteria ‘expressing avirulence gene D product produce a specific etitor ‘ofthe soybesn hypersensitive response, Mot Blant-Microbe la- taract 3, 112-121 Keey, NT. (1992). The molecular biology of disease resistance. Prani Mo. Biol 19, 109-122. Kore, D. A. and Dawscn, W. 0. (1988), A point mutation in the ‘tobanco mosaic virus capsid protein gene induces hypersensitv ityin Nicotiana sykvests. Proc. Wat! Acad. Sc. USA BB, 170-174, Roum, B.A, Gouunen, M. G., Guar JE. Kavannos, 7. A. and Bxutcowse, D.C. (1993) Potato Vis X Resistanco Geno Med fates an inducad, Nom Speci: Resistance in Protopiaes. Plant {al 5, 913-920. Mane, A.M. Orwat,B. E., CELwit, R. Toaaes, H,N., and MENT tehny, A. N. (7989), Nucleotise CONA sequence coding forthe PuXe coal protein, Nutone Actas Res. 17, 1265 Mesit, 7, Morovost F, ADACHI, A, WATANABE, Y., TARAMATSU.N, ‘and Oras, Y. (1888), Two concomitant base substtubons inthe Putative repicasa genes cl tobacco mosaic wis conter the ability Teovercome tne efecis ata tomate resistance gene, Tin-1 EMBO 1.7, 1875-1581 esi, T, MoTOvosi,F., Mago, T., YOSHWORA,$., WATANABE, H and Oxa04, ¥. (1989), Mutations the tobacco mosaic vue 30. KD protein gene overcome Tied resistance intorato, Plant Cal 1,515-822 Moser, A. Jones, R.A. C., and Fasouna, C. E, (1980) Properties Of 6 resctance-breaking strain of poate vius X. Ana. Apa. Bio. 95, 93-103, Oman, B. E, CELNK, Ro M., MANDEL, A. M., Tomes, Hi Nk ane Menrastasy, A. N. (1980), Complete cDNA sequence of a South American isolate of potato virus X. Virus es. 16, 282-208, Peuiaus, J, FuETCHER |... ang Hawkins, JH, (1870). The establish ment of a new stréin of tobacco mosaic vius resuting trom the use of rea stant variates of tomato. Ann. Appl Bio! 65, 283-297, Fires, E. Desens. T, BaRone. A. SALAM, F.. and GEBHARD, C. (1981), RFLP mepping on patato chromasomes af wa genes con lwoling extreme resistance to potato virus X (PVX), Mol Gor. Gonet. 227, 81-88. a0, T,, Mésit, T., TaRAMArsu, N., and OxA04, ¥. (1887), Cost protein gene sequence af lobacco mosaic vis encodes @ host response determinant, Froc. Natl. Acad. Sc: USA 84, 6074-8077 Sauaomans, M.V., Cen, MF, Tozzte, AC, AngSe, A, and Horr, HE. (1990). Potato gere-X' confers inoculum dependent resistance to potata vis X repleation in protoplasts, Pls: Ce Physio! 81, 749-785, Sawono0k, |, FaTeck, E. F. and Maan, T. (1989), "Molecular Coning’ A Laboratory Manual” 254, Cola Spring Harbor Labo- ratory Press, Cold Spring Harbor, NY. Sana Cave, S. an Ba.xcoMse. D.C. (1989), Molecular analysis of Potato wus X isoates in rolaion to the potate hypersenstity ‘gone Ax. fo! Flant-Microbe interact. 6, # pres. SeRvAMI KG, KRaEV,A.S., MOROZoY, S. Yu. (198). The nucleotide sequence of potate vrus K RNA. Nucie Acs Res. 16, 10923- 10320, Torin, A.C., CenANW, MF, SALADRGAS, M. Vi and HOPE, H. (1991). Extreme resistance to inaction by potato virus Xn geno- lypes of wid tuberbeating Solanum species. Potaio Res. 34, 317-328 aN Dew AcKeREGEN, G. FJ, Mi, VaW Kav J AL, and O€ Wr 1. Mt (1992). Molecular analyss ofthe avivience gene Av Cf the fungal tomato pathogen Claciosporiam fuium fully su2- pons the gene-for-gene nypothess. Plant J 2, 369-266, \Vorwoé20, T.C., D2eKER, 8. ML M., and HOEKENA A, (1989). Smal Seale Procedure for the Raid Isolation of Plant RNAS. Acts: Aoids Res. 17,2982. ‘YAMaeUI,R, URTANABE,Y., MESH, T., ang OKADA, Y.(1991)- Replica tian of TMV-L and Lta1 RNAS and thair recombinants in TWV-re stant Tin-itoreto protoplasts, Viefogy 183, 8-105.