See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/275966246

ISOLATION AND CHARACTERIZATION OF POLYPHENOL OXIDASE FROM UPASI

SELECTED CLONE OF Camellia sinensis (L.) O. KUNTZE

Article · January 2015

CITATIONS READS

9 430

7 authors, including:

Ramkumar Samynathan Dr. Palanisamy Chella Perumal

Bharathiar University Qilu University of Technology
17 PUBLICATIONS   40 CITATIONS    44 PUBLICATIONS   354 CITATIONS   

SEE PROFILE SEE PROFILE

Abul Kalam Mandal Velliyur Kanniappan Gopalakrishnan

VIT University Bule Hora University
96 PUBLICATIONS   1,687 CITATIONS    206 PUBLICATIONS   1,924 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Different approaches of mutation breeding technique for development of new ornamental varieties View project

Prostate cancer progression biomarkers View project

All content following this page was uploaded by Dr. Palanisamy Chella Perumal on 08 May 2015.

The user has requested enhancement of the downloaded file.

 Indo American Journal of Pharmaceutical Research, 2015 ISSN NO: 2231-6876

ISOLATION AND CHARACTERIZATION OF POLYPHENOL OXIDASE FROM UPASI

SELECTED CLONE OF Camellia sinensis (L.) O. KUNTZE
Ramkumar Samynathan 1*, Chella Perumal Palanisamy2, Sudhakar Gandhi3, AbulKalam A. Mandal4,
Mohankumar Padmanabhan4, Suresh kumar Perisamy3 and Gopalakrishnan Velliyur Kanniappan2
1
Dept of Biotechnology, Centre for plant molecular Biology and Biotechnology, Tamil Nadu Agricultural University, Coimbatore
641003, TN, India.
2
Dept of Biochemistry and Bioinformatics, Karpagam University, Coimbatore 641021, TN, India.
3
Dept of Biotechnology, Anna University, BIT campus, Trichirappalli - 620024.
4
Plant Physiology & Biotechnology Division, UPASI Tea Research Foundation, UPASI Tea Research Institute, Nirar Dam BPO,
Valparai 642 127, Coimbatore District, TN, India.

ARTICLE INFO ABSTRACT

Article history Polyphenol Oxidase (PPO), a major enzyme responsible for manufacture of black tea from tea
Received 09/12/2014 leaves (Camellia sinensis (L) O. Kuntze). Objective: To isolated and characterize the
Available online Polyphenol oxidase (PPO) enzyme from UPASI selected clone of Camellia sinensis (L.). PPO
30/01/2015 was purified via ammonium sulfate precipitation and gel filtration chromatography resulted in
a recovery of 28.89% of total enzyme activity. Purified PPO was a monomeric protein of
molecular weight 32 kDa. The most preferred substrate for PPO was catechin (10 mM)
Keywords followed by catechol, caffeicacid, L-Dopa and pyrogallol. The Km and Vmax for PPO was1.22
Camellia sinensis (L.); mM ± 1.45 mM and 249.71 ± 1.86 U/ml/min using catechin as a substrate. Thermal stability
Polyphenol Oxidase; of PPO was at 62°C. The enzyme activated monovalent cations namely, K +, and Na+. The
Purification; most effective inhibitor was β - mercaptoethanol followed by EDTA and SDS. Activation
Total Enzyme Activity. energies were E(a) of PPO∆H* ( 1.3517 kJ mol-1), ∆G* ( 55402.96 kJ mol-1) and ∆S*(-185.82
J mol-1 K-1). Based on the results, this study can be concluded that the purified PPO showed
greatest substrate specificity towards catechin (10 mM), high activity in the presence of K2+,
Na2+ and greatest inhibition with β-mercaptoethanol. Thus, isolated PPO enzyme from the
selected clone of Camellia sinensis (L.) may be a potential source for pharmacology and
functional food.

Corresponding author
Dr. Ramkumar Samynathan
Dept of Biotechnology,
Centre for plant molecular Biology and Biotechnology,
Tamil Nadu Agricultural University, Coimbatore 641003, TN, India.
ramkumarbiochem007@gmail.com
+91 - 422 - 6611462
+91 - 422 - 6611462

Please cite this article in press as Ramkumar Samynathan et al. Isolation and Characterization of Polyphenol Oxidase From
241

UPASI Selected Clone of Camellia sinensis (L.) O. Kuntze. Indo American Journal of Pharm Research.2015:5(01).

Copy right © 2015 This is an Open Access article distributed under the terms of the Indo American journal of Pharmaceutical
Page

Research, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
www.iajpr.com
Vol 5, Issue 01, 2015. Ramkumar Samynathan et al. ISSN NO: 2231-6876

INTRODUCTION
The commercial tea comes from plants belonging to a relatively large group of cultivated species of Camellia sinensis (L) O.
Kuntze[1, 2]. It is one of the oldest known beverages made from tender leaves of the plants. Black tea is consumed throughout the world
for its unique taste, briskness and flavour. Tea is the most widely consumed and cheapest non-alcoholic drink next to water. The major
catechins (amounting 20% on the dry weight basis) and its biochemical constituents likes (+) catechin, epicatechin (EC),
epicatechingallate (ECG), epigallocatechin (EGC) and epigallocatechingallate (EGCG) present in tea shoots (apical bud and two
expanded leaves). Polyphenol oxidase (PPO, EC.1.10.3.1) a key enzyme in tea processing, convert catechin to its products by
undergoing enzymatic oxidation to produce black tea pigments such as theflavins (TF) and thearubigis (TR) [3]. Majority of this
process results in the formation of black tea taste, liquor, aroma, and flavour. In addition, they are connected with oxidative
transformation of phenolic compounds[4,5]. The basic principle underlying in black tea manufacture is the controlled chemical
transformations that are responsible for the formation of sparkling colour, briskness, and aroma that are conventionally associated with
taste and quality. Of the various stages of black tea processing, the “fermentation” step is the most critical one. Time, temperature, pH,
relative humidity and oxygen availability during fermentation are crucial factors responsible for increased levels of desired products
[6]. Mechanically the integrity of green tea shoots and leaves, are disturbed and allowed to undergo in vivo oxidative and hydrolytic
processes in presence of mild aeration and at slightly elevated temperature. The black tea has some important role like antioxidant,
antimutagenic and antifungal activity [7,8].
Polyphenol Oxidase (PPO) is also known as phenol oxidase, tyrosinase, o-diphenol oxidase, catechol oxidase,
phenolaseandchlorogenic acid oxidase [9]. PPO is a binuclear copper containing enzyme which catalyses two distinct reactions [10].
Primary reaction involves hydroxylation of monophenols to give o-diphenols the only specific reaction catalyzed by this enzyme
(cresolase or monophenolase) and secondary reaction involves the removal of hydrogen from diphenols to give quinone by
catecholase or diphenolase [11]. PPO enzymes encoded by nuclear genes are localized in plastids, where they seem to be associated
with the internal thylakoid membranes [12] thus remaining physically separated from their phenolic substrates stored in the vacuole.
The browning reaction is usually initiated upon physiological or accidental tissue disruption. Functional PPO enzymes have been
purified from several higher-plant species including leaves of butter lettuce [13], broccoli [14], and avocado [15]. Therefore, the main aim
of the present is to isolate and to characterize PPO enzyme from the selected United Planters' Association of Southern India (UPASI)
clone of Camellia sinensis (L.) using biochemical and molecular analysis.

MATERIALS AND METHODS

Plant material
Tea (Camellia sinensis (L) O. Kuntze) from the germplasm accessions of UPASI tea Research Institute (latitude 10º 30´N,
longitude 27º0’S and altitude 1,050 m above mean sea level) was used in the study. Crop shoots (apical bud and two terminal leaves)
from plants of uniform age ( 10 years old) maintained at the height of 26” ( 60cm) above ground level were selected. The selected Jat
type tea plants of UPASI germplasm accessions and regions or estates are presented in Table 1. The selected bushes were tagged and
coded for the experimental convenience. Tea leaves were collected during morning hour (8.30 am to 9.00 am) and subjected to
biochemical and molecular analysis. The tea leaves were plucked and transferred immediately into liquid nitrogen and stored at -80°C
till further use.

Table 1: UPASI germplasm collection used in the present study.

S.No Accessions Type Estates/regions

1 UPASI-16 Assam(B/6/182) Brooklands Estate, The Nilgiris.
2 UPASI- 18 Cambod (B/6/57) Brooklands Estate, The Nilgiris.
3 UPASI -14 Cambod S/6/99 (Singara) Singara Estate, The Nilgiris.
4 I/30/17 Nil Iyerpadai Estate selection,Valparai
5 UPASI-1 Assam B/4/141 (Ever green) BrooklandsEstate, The Nilgiris.
6 UPASI-3 Assam B/5/63 (Sundaram) Brooklands Estate, The Nilgiris.
7 UPASI-13 Assam (B/6/137) Brooklands Estate, The Nilgiris.
8 UPASI-17 Cambod B/6/203 (Swarna) Brooklands Estate, The Nilgiris.
9 UPASI-21 Assam (B/4/198) BrooklandsEstate,TheNilgiris
10 I/30/30 Assam Iyerpadai Estate selection,Valparai

Chemicals
Bovine serum albumin (BSA), Gallic acid, L-Dopa (L-3,4-dihydroxyphenylalanine), catechol, potassium, mercuric chloride,
calcium chloride, magnesium sulphate, ammonium per sulphate ( Hi media chemical Co, India.), β –mercaptoethanol, SDS, catechin ,
Sephacryl S-200 HR, acrylamide, bis-acrylamide, coomassie brilliant blue were purchased from Sigma Chemical Co, Acetone and
242

other reagents were all of analytical grade. Molecular protein marker (M.W. 14.4-116.0 kDa) was purchased from Fermentas Inc.

Preparation of acetone leaf extract

Page

Both soluble and bound component of the PPO enzyme was extracted using acetone from 25g of crop shoots powdered
extract by homogenizing the tissue of the shoots using chilled acetone (−20˚C) with acid – washed sand powder. The homogenate was
filtered through Whatmann No.1 filter paper. Phenolics were removed by passing through the extract through cold aqueous acetone

www.iajpr.com
Vol 5, Issue 01, 2015. Ramkumar Samynathan et al. ISSN NO: 2231-6876

(80:20 acetone/water, v/v).The powder was then stored in evacuated desiccators to allow complete drying. The dried white powder
was used for preparation of enzyme extracts.

Enzyme preparation
The soluble component of the enzyme was extracted with 5g powdered acetone leaf extract by gentle grinding in a pestle and
mortar with distilled water (1:10 w/v) and incubated 10 min followed by centrifugation at 4000 rpm for 10 min. The supernatant was
used as soluble enzyme. Subsequently, the residue was extracted by regrinding with 5 mL of 0.2 M sodium sulphate (Na 2SO4) solution
and incubated at 30 min followed by centrifugation for 10 min at 5000 rpm. The supernatant considered as bound enzyme.

Estimation of PPO
PPO was estimated from freshly collected UPASI 16 crop shoots following the method described by Singh and Ravindranath
(1994)[16]. Bound and soluble form of PPO was estimated separately from which total PPO was computed. The activity was expressed
in U/mg of protein. Protein content was determined according to the coomassie brilliant blue binding method of Bradford (1976)[17].

PPO purification and characterization

UPASI -16 crop shoots were selected (Table 2) for PPO purification because of high activity and drought tolerance trait
among the 10 accessions screened from UPASI germplasm. Further studies including enzyme purification, characterization, PPO gene
isolation and sequencing were carried out in this accession.

Table 2: Ten accessions with maximum PPO activity.

Soluble PPO Bound PPO Total PPO

Sample
(U/mg of protein) (U/mg of protein) (U/mg of protein)
UPASI -16 190.82 ± 4.32 1042.75 ± 3.04 1233.57 ± 4.56a
UPASI - 18 103.35 ± 4.59 1047.94 ± 5.97 1151.29 ± 3.41b
UPASI - 14 84.97 ± 1.80 744.08 ± 5.43 829.05 ± 2.23c
I/30/17 7.97 ± 0.93 781.18 ± 1.28 789.15 ± 2.02d
UPASI – 1 3.53 ± 0.83 391.30 ± 2.13 394.82 ± 1.03e
UPASI – 3 12.78 ± 1.43 432.89 ± 3.81 445.68 ± 2.84f
UPASI - 13 13.35 ± 0.55 387.24 ± 1.76 400.59 ± 1.76g
UPASI – 17 8.97 ± 0.04 369.51 ± 5.79 378.48 ± 4.0h
UPASI – 21 113.38 ± 0.23 315.84 ± 0.54 434.99 ± 1.28g
1/30/30 8.86 ± 0.43 54.53 ± 1.07 63.39 ±1.03k

Mean ± SD followed by the same letter are not significantly different at P<0.005 by Duncan’s test.
Each value is the mean of triplicate

Partial purification of PPO

The crude bound enzyme obtained from the supernatant was subjected to 80% ammonium sulphate saturation. The
precipitated enzyme was separated by centrifugation at 14,000 rpm for 25 minutes at 4°C. The enzyme precipitate was dissolved in 3
ml of 0.1 M sodium phosphate buffer (pH 5.6) and dialyzed for two days with four changes of 0.05 M sodium phosphate buffer to
remove the traces of ammonium sulphate and other impurities. For further purification, the dialyzed enzyme was fractionated by gel
filtration chromatography using Sephacryl-S-200 HR column (Hi media Co., Mumbai, India) of 100 ml bed volume, was equilibrated
with 0.1 M sodium phosphate buffer (pH 5.6). The elution rate was maintained 20 ml/hour and two ml fractions were collected
through the column. The fractions were assayed for both PPO activity and total protein content. The elution process continued until
no absorbance was detected at 280 nm. The level of purification was determined by measuring the specific activity of polyphenol
oxidase prior to and after purification.

Enzyme Characterization
Effect of pH
PPO activity, as a function of pH, was determined under standard conditions by using various buffers such as 0.1M sodium
phosphate buffer (pH 3 to 6), 0.1M sodium citrate buffer (pH 7 and 8), glycine - NaOH buffer (pH 9.0 and 10.0). The pH value
corresponding to the highest enzyme activity was considered as the optimum.

Effect of temperature on PPO activity

243

PPO activity was carried out at various temperatures (20°C to 100°C) under standard conditions. The temperature
corresponding to the highest enzyme activity was considered as optimum.
Page

Thermal inactivation of PPO

Thermal inactivation of the purified PPO was carried out under various temperatures (65°C to 90°C) at an interval of 5°C.
The experiments were performed in triplicates and unheated enzyme sample served as control.

www.iajpr.com
Vol 5, Issue 01, 2015. Ramkumar Samynathan et al. ISSN NO: 2231-6876

Optimum concentration of PPO

The effect of purified PPO concentration was determined with 10 mM catechin as substrate. The stock enzyme was diluted
with 0.1 M phosphate buffer for various concentrations. The linear relationship between enzyme concentration and activity was
calculated.

Substrate specificity
Substrate specificity of the purified PPO was assayed with various commercial grade substrates such as catechin, catechol,
caffeic acid, L-Dopa, pyrogallol, L-tyrosine and gallic acid at concentration of 10 mM. The activity was performed in triplicate. The
Michaelis-Menten constant (Km), Maximum velocity (Vmax) and specificity (Vmax/Km) of different substrates were calculated under
standard conditions. Data were plotted as 1/V and 1/(S) concentration according to Lineweaver and Burk plot method (1934) [18].

Effect of Inhibitors
The effect of various inhibitors on PPO activity was carried out using catechin as substrate. The reaction mixture was
incubated for 1 hour at 25°C in the presence of 2 mM EDTA (dissolved in 0.1M phosphate buffer, pH 5.6), Sodium dodecyl sulphate
(SDS), β-mercaptoethanol, polyvinyl pyridine (PVP) and D,L-dithiothreitol (DTT) respectively. The residual activity was determined
by measuring a change in absorbance at 380 nm. The reaction mixture without inhibitors served as control.

Effect of metal ions on PPO

The effect of metal ions on purified PPO activity was determined by incubating the reaction mixture containing 2 mM of
various metal ions viz., Cu++, K++, Na++, Hg ++, Ca++, Mg++ and Zn++, at 25°C. The residual activity (in percentage) was measured.
Reaction mixtures without metal ions served as control.

Molecular weight determination of purified PPO

The molecular weight of the partially purified PPO was estimated by SDS–PAGE[19] using a Bio-Rad Mini Gel system
(USA). The protein sample was completely denatured in a boiling water bath for 3 minute with β-mercaptoethanol and SDS.
Electrophoresis was run at 10-25 mA for 4 hour at ambient temperature. The protein was separated on a 12% polyacrylamide gel and
visualized with Coomassiebrilliant Blue R-250 staining. The molecular weight of purified protein band was determined by comparing
with standard protein markers (Fermentas). The stained protein bands were visualized using Genetool, Ver.4.01 (Syngene, USA).

Cloning of the PPO gene and sequencing

Total RNA was extracted from the frozen young buds using RNeasy Plant Mini Kit (QIAGEN, USA). RT-PCR was
performed with total RNA isolated with a view to obtaining the cDNA corresponding to PPO gene. First strand cDNA was
synthesized according to the manufacturer’s instructions(QIAGEN 1- step RT-PCR kit (QIAGEN, USA). PCR reactions were carried
out with PPO gene specific PPOF/PPOR primers PPOF (5’TTAAGAATCAAACTCAATCT 3’), PPOR (5’
ATGGCTTCCATTCTCCCTCC 3’). The total volume (50 µl) of the cocktail includes the template RNA, RT-PCR buffer, 5XQ
solution, dNTPS,RNasin, DTT, RT-PCR enzyme mix and dH2O.
Amplification was performed using the temperature profile of 50°C for 30 minutes for reverse transcription, 95°C for 15 minutes
for initial denaturation; 40 cycles of 94°C for 1 minute, 50°C for 30 seconds and 72°C for 2 minutes and additional 10 minutes at
72°C for final extension. A QIAGEN Al Quick PCR Purification Kit (QIAGEN, USA.) was used to purify the PCR product of the
cDNAaccording to the manufacturer's protocols, subcloned into pTZ57R/T vector. The resulting plasmid was used for sequence
analysis. The methods for E.coli competent cell preparation and transformation were according to the methods of Sambrook et al.
(1989)[20]. The recombinants were selected on the LB agar plate containing ampicillin (50 mg/L). The presence of the gene in the
recombinant clones was confirmed by sequencing using M13 primers.

Sequence analysis
Single-pass sequencing from the 5 inch end of the plasmid were performed in a MegaBACE TM 500 DNA capillary
sequence machine (Amersham Pharmacia Biotech Inc., USA) using DYEnamic ET Dye Terminator Cycle Sequencing Kit
(Amersham Pharmacia Biotech Inc. and GE-Health Science, USA) by dideoxy chain termination method[21]. Sequences were
manually edited to remove the plasmid sequences prior to analysis. Sequences were first subjected to multiple alignments in ClustalX
software[22]. Sequence homology was searched using the BLAST algorithm (http//www.ncbi.nlm.nih.gov). The resulting data was
selected based not only on E-value (<10-10), but also on the percentage of total sequence coverage and maximum score.

Statistical analysis
The data were subjected to statistical analysis (ANOVA) using the standard statistical software (SPSS, version 11.5). Each
experiment was carried out in triplicate. Data collected pertaining to PPO activity was subjected to ANOVA by one factor analysis
244

with AGRES software (7.01 versions) to identify the variation existing among the accessions [23].

RESULTS
Page

Screening for PPO activity in various tea accessions

PPO activity was compared between UPASI released and other estate tea accession (10 tea accessions). It was concluded that the
UPASI released clones (UPASI-18 and UPASI-16) had higher PPO activity than any other accessions (Table 1). UPASI-16 was selected for

www.iajpr.com
Vol 5, Issue 01, 2015. Ramkumar Samynathan et al. ISSN NO: 2231-6876

PPO purification due to high PPO activity and their drought tolerance capacity. The soluble form of PPO obtained with distilled water and
ionic bound PPO with 0.1M phosphate buffer as an extraction medium. The active fractions (6-12 elutes) were collected, dialyzed and
lyophilized and the degree of the purity was analyzed. The overall purification of PPO obtained in combined fraction are shown in
Figure1.The degree of purity was 12.85% after ammonium sulphate precipitation and 28.89% from gel filtration chromatography (Table 3).

Table 3: Summary of polyphenol oxidase purification.

Specific activity
Purification step Total protein (mg) Fold of Purification (%)
(U/mg of protein)
Crude extract 201.07 117.61 0
Ammonium sulfate precipitation 124.0 6 334.83 12.847
Column gel filtration chromatography 56.97 4397.80 28.89

Figure 1: Fractionation of crop shoots proteins by column gel filtration chromatography.

Enzyme characterization
Effect of pH
The PPO activity was measured using catechin as substrate at 25°C at various pH ranging from 3 to 6 in 0.1M sodium
phosphate buffer, pH 7.0-8.0 in sodium citrate buffer, and pH 9.0-10.0 in Glycine - NaOH buffer. The PPO activity was observed in
the range of pH 5.2 to 5.6 (Figure 2a) and maximum PPO activity was obtained in pH 5.6.

245

Figure 2a: pH optima of the purified PPO.

Page

www.iajpr.com
Vol 5, Issue 01, 2015. Ramkumar Samynathan et al. ISSN NO: 2231-6876

Effect of temperature and thermal inactivation of PPO activity

The PPO activity in tea plant varies over broad range of temperature from 20 to 60°C (Figure 2b). In the present study,
optimum temperature determined for PPO activity was 25°C with catechin as substrate. The thermo stability of PPO was determined
by incubating the reaction mixture at different temperatures for 30 minutes. The result of thermal inactivation study was expressed as
residual activity (Figure 2c).The residual activity of PPO after 5 min of incubation was 35%, 15% and 5% at 60, 70 and 80°C
respectively. The stability of PPO was expressed as residual enzyme activity. PPO stable at 32°C, but unstable at 62°C and was
completely inactivated at 65°C at 15 minutes. The inactivation of enzyme (PPO) was analyzed by transition state parameters viz.,
activation of Gibbs ∆G* (55402.96 kJ mol-1), enthalpy change ∆H* (1.3517 kJ mol-1) and entropy change ∆S*(-185.82 J mol-1 K-1) at
25°C.

Figure 2b: Effect of temperature on purified PPO.

Figure 2c: Thermal inactivation of purified PPO.

Substrate specificity
The substrate specificity of PPO varies widely depending on the types of substrate and purity of the enzyme. Of the various
substrates (mono-phenols, O-diphenols and pyrogallol) tested, maximum activity was observed with catechin followed by catechol,
caffeic acid, DL-Dopa and pyrogallol. No activity was observed with gallic acid as substrate. The Michaelis constants (Km) and
246

maximum velocities (Vmax) of the PPO were determined using the above substrates (Table 4). In this study catechin was the best
substrate with the lowest Kmvalue (1.22 ± 1.45 mM) and highestVmax value (249.7 ± 1.86 U/ml/min). Polyphenol oxidase showed high
affinity towards catechin as substrate at 25°C.
Page

www.iajpr.com
Vol 5, Issue 01, 2015. Ramkumar Samynathan et al. ISSN NO: 2231-6876

Effect of inhibitors
Among different inhibitors tested on PPO with 2 mM catechin as substrate at 25°C, potent inhibitors were β-mercaptoethanol
followed by EDTA, SDS, D,L-dithiothreitol, potassium iodide, potassium cyanide and PVP(Figure 2d). These compounds exhibited
high degree of PPO inhibition at 2mM concentration. The most potent inhibitor of PPO was β-mercaptoethanol and SDS, leading to
80% inactivation of PPO.

Figure 2d: Effect of inhibitors on PPO.

Effect of metal ions

At a concentration of 2 mM on PPO activity K2+, Na2+, Mg2+ and Cu2+ had a positive effect, whilst divalent cations, namely,
Hg and Ca2+ showeda negative effect on PPO activity (Figure 2e). Among the divalent cations tested, Hg 2+ showed strongest
2+

inhibitory (90%) effect.

Figure 2e: Effect of metal ions on PPO.

PPO identification by SDS-PAGE

The molecular weight of the PPO was determined by SDS-PAGE. The gel was stained with Coomassie brilliant blue R-250
(Figure 3). The molecular weight of PPO ranged from 45 to 50 kDa.
247
Page

www.iajpr.com
Vol 5, Issue 01, 2015. Ramkumar Samynathan et al. ISSN NO: 2231-6876

Figure 3: SDS-PAGE of purified PPO.

Lane: M- Marker; 1-Crude extract; 2-Purified PPO

Sequencing of PPO gene

DNA Sequencing and analysis
Total RNA was extracted from UPASI-16 from which a 1.8kb of cDNA (Figure 4) was amplified using gene specific primers
and subsequently cloned into PTZ57R/T vector. The presence of insert in the transformants was confirmed by colony PCR, using
universal M13 forward and reverse primers. Only partial sequence of cloned cDNA was obtained due to limitations in instrumental
read length. Sequence analysis indicated that partial PPO sequence contained 577 bp of nucleotides without introns. Blast searching of
the GenBank indicated that the nucleotide sequences of the cloned PPO gene had 90% identity to the registered PPO genes. The
partial PPO gene was sequenced and registered in the GenBank (Accession No.: JN801040). No functional Cu-binding domains were
noticed within the partial sequence.

Figure 4: PPO gene specific PCR product from UPASI-16.

1 DNA ladder 2 Amplified PCR product.

DISCUSSION
248

Morphological selection of superior quality accessions from large tea germplasm is a time consuming one. In order to
overcome this crisis, physiological and biochemical based screening is an ideal tool. Rajkumar et al. (1993)[24] reported that the
physiological characteristics, secondary metabolites and tea enzymes are suitable markers for the selection of superior cultivars from
tea germplasm. PPO is the major factor in determining the quality parameters of black tea [25]. Hence, in the present study, PPO
Page

activity was compared between UPASI released and other estate tea accession (10 tea accessions). Similar result was reported by
Lopez et al. (2005) [26]. Such a screening pattern for selecting superior tea quality from a large tea germplasm was followed by Biswas

www.iajpr.com
Vol 5, Issue 01, 2015. Ramkumar Samynathan et al. ISSN NO: 2231-6876

and Sarkar (1971)[27] and Magoma et al. (2000)[28]. Enzyme purification in plant extracts is a tedious process because of the presence
of large variety of secondary products that can bind tightly to the enzymes and modulate their characteristics [29]. This obscene
situation can be revealed by using the powder of acetone grounded tea leaves that lacks chlorophyll pigments. Gregory and Bendall
(1966)[30] reported high PPO recovery from the powder of acetone grounded fresh leaves.
The degree of enzyme purity was obtained after ammonium sulphate precipitation and gel filtration chromatography. More
than 90% of the enzyme was precipitated at 80-85% ammonium sulphate saturation. Similar activity was reported by Waliszewski et
al. (2009)[31]. Selles-Marchart et al. (2006)[32] reported 39.9 fold purification of PPO in EriobotryajaponicaLindl by employing
Sephadex G 100 column chromatography. Functional PPO enzymes have been purified from several higher-plant species including
chinese cabbage[33] medlar fruits[34], avocado, potato[35], marula fruit[36, 37], Ferula [38], broccoli and butter lettuce[13, 14].
In general, most plants, vegetables and fruits showed maximum activity at neutral pH [39]. The maximum PPO activity was
observed at pH 5.6 which correlated with the findings of Ravichandran and Parthiban (1998) [40]. Mdluli et al. (2005)[36] reported that
tea PPO were most stable at 5.6 to 6.0.The maximum PPO activity were observed from Stanley plum pH 6.0; and field bean seed (pH
4.0)[41]. The PPO was stable at pH 5.6 for 2 hrs at 25°C. Dogan et al. (2002)[42] reported that optimum pH and purity of enzyme can
also be affected by the type of buffer. The optimum pH for PPO activity maydepend upon the plant variety, nature of the Phenolic
substrate and the PPO extract method[43]. The optimum temperature for tea PPO activity was 25°C with catechin as substrate.
Nakamura et al. (1983)[44] reported optimum temperatures of 25°C for grape PPO. Molla (1992)[45] observed that there was no
appreciable loss in the PPO activity upto 32°C. Similarly, PPO activity was high at 25°C in other plant species, namely, medlar fruits,
emir grape and butter lettuce. The enzyme was completely inactivated at 65°C, which is comparable to Wheat PPO activity, wher e
there was 30% decrease in activity after heat treatment at 70°C for 10 min [46].
Arslan and Tozlu (1997) [47] reported that the oxidation of ortho-diphenols (catechin) by PPO was higher when compared to
monophenols. Similar activities have also been reported in broad bean, cocoa bean [48]. The Km and Vmax value of the tea PPO showed
high affinity towards catechin as substrate at 25°C. Zawistowski et al. (1988)[49] reported aKm of 3, 9mM for catechol substrate in
Jerusalem arthichoke tubers. Beta-mercaptoethanol and SDS showed similar inhibition pattern in vanilla. Similarly, 70% inhibition by
EDTA and Sodium azide was reported by Schwartz et al. (2001)[50]. D, L- dithiothreitol was an effective inhibitor of PPO in
strawberries[51] and sunflower seeds[52].
PPO was induced by the presence of K2+, Na2+ andCu2+ at 2 mM concentration in contrary to divalentcations like Hg2+ at
same concentration that showed strong inhibitory effect. This result indicates the involvement of metal ions in PPO activity. Similar
results were reported by Jiang et al. (1997)[53]. PPO of the tea plant exists in multiple forms which further comprises number of
subunits[54]. The various molecular weight form of PPO has previously been reported as 29kDa for coffee and grape juice
(40±2kDa)[55, 56].
Sullivan et al. (2004)[57] reported that the PPO genes had a high degree of identity, and were differentially expressed in
different parts of the plant. The sequenced PPO exhibited high homology in phylogenetic tree analysis when compared to other woody
plants[58]. From the GenBank analysis the PPO sequence have high identity with C. sinensis cultivar Yihongzao polyphenol oxidase
(PPO) gene (EU787433), Camellia sinensis polyphenol oxidase gene (GQ214317), Camellia sinensis cultivar Hunan Xiangbolu Black
Tea polyphenol oxidase gene ( EF650017) and Synthetic construct clone Anhuiyihao mutant-2 polyphenol oxidase (PPO) gene
(FJ210645). Van Gelder et al. (1997)[59] reported that comparing PPO sequences from a wide variety of organisms, the Cu-binding
regions are the most conserved domains of the polypeptide. However, Liang et al. (2010) [60] reported three functional Cu-binding
domains in tea plants.

CONCLUSION
It can be concluded that Polyphenol oxidase (PPO) were purified from apical bud and two expanded leaves of UPASI -16 tea
accessions (Camellia sinensis L.). The optimum pH and temperature for of UPASI -16 tea leaves PPO was found to be 5.6 and 25ºC
respectively. This purified PPO showed greatest substrate specificity towards catechin (10Mm), high activity in the presence of K2+,
Na2+ and greatest inhibition with β-mercaptoethanol. The molecular weight of the PPO from UPSAI-16 tea accessions were ranged
from 40kDa. Arrhenius equation of PPO activation energies E (a) namely ∆H* ( 1.3517 kJ mol-1), ∆G* (55402.96 kJ mol-1) and ∆S*(-
185.82 J mol-1 K-1) of PPO enzymes were determined at 25°C Full length PPO gene 1.8kb was isolated from accession UPASI-16
(“Assam”) and partial sequenced (577bp). The nucleotide sequences of the cloned PPO genes showed 90% similarity to the registered
PPO genes of other Camellia sinensis L. In future it can be leads to development of commercial tea.

ACKNOWLEDGMENTS
We are grateful to Dr.B.Radhakrishan, Director and Dr.R.Rajkumar, Senior Plant physiologist, UPASI Tea Research Institute
for their helpful suggestions and technical advice in this study.

Conflict of interest statement

The authors declare that there is no conflict of interests regarding the publication of this paper.
249
Page

www.iajpr.com
Vol 5, Issue 01, 2015. Ramkumar Samynathan et al. ISSN NO: 2231-6876

REFERENCES
1. Vazir J, Inamdar P, Desai S, Patel D, Meshram D. Phytochemical screening and in vitro antibacterial activity of
Camellia sinensis. Indo American J Pharm Res 2014; 4(02): 1158-1162.
2. Wight W. Tea classification revised. Curr Sci 1962; 31: 298-299.
3. Sanderson GW. The chemistry of tea and tea manufacturing. In: Runeckles, V.C. and Tso, T.C. (Ed). Recent
Advances in Phytochemistry: structural and functional aspects of Phytochem 1972; 5: 247-316.
4. Perumal PC, Sophia D, Raj CA, Ragavendran P, Starlin T, Gopalakrishnan VK. In vitro antioxidant activities and
HPTLC analysis of ethanolic extract of Cayratia trifolia (L.). Asian Pac J Trop Dis 2012; 2: S952-S956.
5. Starlin T, Ragavendran P, Raj CA, Perumal PC, Gopalakrishnan VK. Element and functional group analysis of
Ichnocarpus frutescens R. Br. (Apocynaceae). Int J Pharm Pharm Sci. 2012; 4: 343-345.
6. Rethinam P, Khan H, Mandal PK, Reddy KM, Suresh K. Plantation crops research and development in the new
millennium. Proce Placrosym 2002; 16: 192-196.
7. Perumal PC, Sowmya S, Pratibha P, Vidya B, Anusooriya P, Starlin T, et al. Identification of novel PPARγ agonist
from GC-MS analysis of ethanolic extract of Cayratia trifolia (L.): a computational molecular simulation studies. J
Appl Pharm Sci 2014; 4: 6-11.
8. Poornima K, Perumal PC, Gopalakrishnan VK. Protective effect of ethanolic extract of Tabernaemontana divaricata
(L.) R. Br. against DEN and Fe NTA induced liver necrosis in Wistar Albino rats. Biomed Res Int. 2014; 2014: 1-9.
9. Whitaker JR. Principles of Enzymology for the Food Sciences, 1994; New York.
10. Yelena G, Sheptovitsky, Brudvig GW. Isolation and characterization of spinach photosystem II membrane-associated
catalase and polyphenol oxidase. Biochemistry 1996; 35: 16255-16263.
11. Espin JC, Garcia-Ruiz PA, Tudela J. Garcia – Canovas. Study of spectrospecificity in mushroom tyrosinase. J
Biochem 1990; 331:547-551.
12. Mayer AM. Polyphenol oxidases in plants and fungi: Going places? Review Phytochemistry 2006; 67: 2318-2331.
13. Gawlik-Dziki U, Zlotek U, Swieca M. Characterization of polyphenol oxidase from butter lettuce
(Lactucasativavar.Capitata L.). Food Chem 2008; 107: 129-135.
14. Gawlik-Dziki U, Szymanowska U, Baraniak B. Characterization of polyphenol oxidase from broccoli (Brassica
oleracea var. Botrytis italica) florets. Food Chem 2007; 105: 1047-1053.
15. Gomez-Lopez VM. Some biochemical properties of polyphenol oxidase from two varieties of avocado. Food Chem
2002; 77: 163-169.
16. Singh HP, Ravindranath SD. Occurrence and distribution of PPO Activity in floral organs of some standard and local
cultivars of tea. J Sci Food Agri 1994; 64: 117-120.
17. Bradford MM. A rapid and sensitive method for the quantification of microgram quantities of proteins using the
principle of protein-dye–binding. Anal Biochem 1979; 72: 248-254.
18. Lineweaver H, Burk D. The determination of enzyme dissociation constant. J Ameri Chem Society 1934; 56: 658-
661.
19. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970; 227:
68012-68015.
20. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning. A laboratory manual. Cold spring harbor laboratory Press.
Cold spring harbour 1989; New York.
21. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci 1977; 74:
5463-5467.
22. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: Flexible
strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 1997; 25: 4876-4882.
23. Gomez KA Gomez AA. Statistical Procedures for Agricultural Research. John Wiley and Sons, 1984 New York 20-
30.
24. RajKumar R, Manivel L, Marimuthu S. Evaluation of clonal characteristics in mature tea. J Plant Crops 1993; 21:
241-247.
25. SenthilKumar RS. Studies on improving quality of south Indian black teas. Final Technical Report submitted to Tea
Board, Kolkata, India 2004; 1-71.
26. Lopez JS, Jibu Thomas, Pius PK, Raj Kumar R, Muraleedharan N. A reliable technique to identify superior quality
clones from tea germplasm. Food Chem 2005; 91: 771-778 .
250

27. Biswas AK, Sarkar AR. Biological and chemical factors affecting the evaluations of North East India plain teas. II.
Statistical evaluation of the biochemical constituents and their effects on briskness, quality and cash valuation of
Page

black teas. J Sci and Food Agri 1971; 22: 191–198.

28. Magoma GN, Wachira FN, Obanda M, Imbuga M, Agong SG. The use of catechins as biochemical markers in
diversity studies of tea (Camellia sinensis). Genetic Res and Crop Evolu 2000; 47: 107-114.

www.iajpr.com
Vol 5, Issue 01, 2015. Ramkumar Samynathan et al. ISSN NO: 2231-6876

29. Loomis WD. Overcoming problems of phenolics and quinones in the isolation of plant enzymes and organelles. M
Enzymol 1974; 31: 528-540.
30. Gregory RPF Bendall DS. Purification and some properties of polyphenol oxidase from tea. J Biochem 1966; 101:
569-581.
31. Waliszewski KN, Marquez O, Pardio T. Quantification and characterisation of polyphenol oxidase from vanilla bean.
Food Chem 2009; 117: 196-203.
32. Selles-Marchart S, Casado-Vela J, Bru-Martinez R. Isolationof a latent polyphenol oxidase from loquat fruit
(EriobotryajaponicaLindl.): kinetic characterization and comparison with theactive form. Arch Biochem.Biophys
2006; 446: 175-185.
33. Nagai T, Suzuki N. Partial purification of polyphenol oxidase from Chinese cabbage (Brassica rapa L). J
AgriFoodChem 2001; 49: 3922-3926.
34. Dincer B, Colak A, Aydin N, Kadioglu A, Guner S. Characterization of polyphenoloxidase from medlar fruits
(MespilusgermanicaL., Rosaceae). Food Chem 2002; 77: 1-7.
35. Marri C, Frazzoli A, Hochkoeppler A, Poggi V. Purification of a polyphenol oxidase isoform from potato
(Solanumtuberosum) tubers. Phytochemistry 2003; 63: 745-752.
36. Mdluli KM. Partial purification and characterisation of polyphenol oxidase and peroxidase from marula fruit
(Sclerocaryabirreasubsp. Caffra). Food Chem 2005; 92: 311-323.
37. Ayaz FA, Demir O, Torun H, Kolcuoglu Y, Colak A. Characterization of polyphenoloxidase (PPO) and total phenolic
contents in medlar (Mespilusgermanica L.) fruit during ripening and over ripening. Food Chem 2008; 106: 291-298.
38. Erat M, Sakiroglu H, Kufrevioglu OI. Purification and characterization of polyphenol oxidase from Ferula sp. Food
Chem 2006; 95: 503–508.
39. Siddiq M, Sinha NK, Cash JN. Characterization of polyphenol oxidase from Stanley plums. J Food Sci 1992; 57:
1177-1179.
40. Ravichandran R, Parthiban R. Changes in enzyme activities (polyphenol oxidase and phenylalanine ammonia lyase)
with type of tea leaf and during black tea manufacture and effect of enzyme supplementation of dhool on black tea
quality. Food Chem 1998; 62: 277-281.
41. Paul B, Gowda LR. Purification and characterization of a polyphenol oxidase from the seeds of field bean. J Agri
Food Chem 2000; 48: 3839- 3846.
42. Dogan M, Arslan O, Dogan S. Substrate specificity, heat inactivation and inhibition of polyphenol oxidase from
different aubergine cultivars. In J Food Sci Tech 2002; 37: 415-423.
43. Unal MU, Sener A. Determination of some biochemical properties of polyphenol oxidase from Emir grape
(Vitisvinifera L. cv. Emir). J Sci Food Agri 2006; 86: 2374-2379.
44. Nakamura K, Amano Y, Kagami M. Purification and some properties of a polyphenoloxidase from Koshu grapes. Am
J EnolVitic 1983; 34: 122-127.
45. Molla MM. Effect on polyphenol oxidase activity in extracts of tea leaf prepared by maceration at different
temperature. Sri Lankan J Tea Sci 1992; 61: 15-19.
46. Kihara T, Murata M, Homma S, Kaneko S, Komae K. Purification and characterization of wheat (Triticumaestivum)
polyphenoloxidase. Food Sci Technol Res 2005; 11: 87-94.
47. Arslan O, Temur A, Tozlu I. Polyphenol oxidase from Allium sp. J Agric Food Chem 1997; 45: 2861–2863.
48. Lee, CY, Smith NL, Pennesi AP .Polyphenoloxidase from De Chaunac grapes. J Sci Food Agri 1983; 34: 987-991.
49. Zawistowski J, Biliaderis CG, Murray ED. Isolation and some properties of an acidic fraction of polyphenol oxidase
from Jerusalem artichoke (Helianthus tuberosus L.). J Food Biochem 1988; 12: 23-35.
50. Schwartz B, Olgin AK, Klinman JP. The role of copper in topaquinone biogenesis and catalysis, as probed by azide
inhibition of a copper amine oxidase from yeast. J. Biochem 2001; 40: 2954-2963.
51. Wesche-Ebeling P, Montgomery MW. Strawberry polyphenol oxidase: Extraction and partial characterization. J Food
Sci 1990; 55: 1320-1325.
52. Raymond J, Rakariyatham N, Azanza JL. Purification and some properties of polyphenoloxidase from sunflower
seeds. Phytochemistry 1993; 34: 927-931.
53. Jiang YM, Zauberman G, Fuchs Y. Partial purification and some properties of polyphenol oxidase extracted from
litchi fruit pericarp. P Har Biol Tech 1997; 10: 221-228.
251

54. Pruidze GN, Mchedlishvili NI, Omiadze NT, Gulua LK. Mutiple forms of phenol oxidase from Kolkhida tea leaves
(CameliaSinensis L.) and Mycelia Sterila IBR35219/2 and their role in tea production. Sci Food Res Int 2003; 36:
587-595.
Page

55. Pereira GP, Donizeti AJ, Murad MM, De Oliveira LL, Evangekista ML. Purification of polyphenoloxidase from
coffee fruits. Food Chem 2003; 83: 7-11.

www.iajpr.com
Vol 5, Issue 01, 2015. Ramkumar Samynathan et al. ISSN NO: 2231-6876

56. Okuda T, Pue AG, Fujiyama K, Yokotsuka K. Purification and characterization of polyphenol oxidase from Muscat
Bailey A grape juice. Am J Enol Viticu 1999; 50: 137-143.
57. Sullivan ML, Thoma SL, Samac DA. Cloning and characterization of red clover polyphenol oxidase cDNAs and
expression of active protein in Escherichia coli and transgenic alfalfa. Plant Physiol 2004; 136: 3234-3244.
58. Zhao D, Liu ZS, Xi B. Cloning and alignment of polyphenol oxidase cDNA of tea plant. J Tea Sci 2001; 21: 94-98.
59. Van Gelder CWG, Flurkey WH, Wichers HJ. Sequence and structural features of plant and fungal tyrosinases.
Phytochem 1997; 45: 1309-1323.
60. Liang YW, Ping LP, Yu SL, Hai-Hang L. Cloning, microbial expression and structure–activity relationship of
polyphenol oxidases from Camelliasinensis. J Biotech 2010; 145: 66-72.

54878478451141224

252
Page

www.iajpr.com
View publication stats